DOCSLIB.ORG

The Role of Hes1 in Pancreas Development Expression, Interdependancy and Notch Signalling

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Role of Hes1 in Pancreas Development Expression, Interdependancy and Notch Signalling FACULTY OF SCIENCE UNIVERSITY OF COPENHAGEN PhD thesis Cand.scient. Rasmus Klinck Department of Beta Cell Regeneration, Hagedorn Research Institute, and The PhD School of Science, Faculty of Science, University of Copenhagen, Denmark. The role of Hes1 in pancreas development Expression, Interdependancy and Notch signalling. Academic Advisors Dr. Olaf Nielsen, Department of Biology, Faculty of Science, University of Copenhagen – Denmark Dr. Mette C. Jørgensen, Department of Beta Cell Regeneration, Hagedorn Research Institute Denmark Submitted: 31/05/11 Cover picture: e10.5 mouse embryo expressing EGFP under the control of the Hes1 promoter manually stitched together from 15 complete image stacks. 2 Preface This Ph.D. thesis is based on experimental work performed in the Department of β Cell Regeneration at the Hagedorn Research Institute, Gentofte, Denmark from January 2008 to December 2010. The faculty supervisor on the project was Professor Olaf Nielsen, Department of Genetics, Faculty of Science, University of Copenhagen, and the project supervisor was Mette Christine Jørgensen, Ph.D., Chemist, Department of Beta Cell Regeneration at the Hagedorn Research Institute. This thesis is submitted in order to meet the requirements for obtaining a Ph.D. degree at the Faculty of Science, University of Copenhagen. The thesis is built around three scientific Manuscripts: Manuscript I: “A BAC transgenic Hes1-EGFP reporter reveals novel expression domains in mouse embryos” Submitted to Gene Expression Patterns Rasmus Klinck1, Ernst-Martin Füchtbauer2, Jonas Ahnfelt-Rønne1, Palle Serup1,Jan Nygaard Jensen1, Ole Dragsbæk Madsen1, Mette Christine Jørgensen1 1Department of Beta Cell Regeneration, Hagedorn Research Institute, Niels Steensens Vej 6, DK-2820 Gentofte, Denmark .2Department of Molecular Biology, Aarhus University, C. F. Møllers Alle 3 bldg.1130, DK-8000 Aarhus C, Denmark Manuscript II: “Neurog3 dependent, aberrant morphogenesis causes ectopic pancreas in Hes1 mutants” Draft manuscript that will be submitted when additional data is obtained. Rasmus Klincka, Signe Vendelbo Horn Pedersena, Heiko Lickertb, Chris V.E. Wright,c,d Jan Nygaard Jensena, Palle Serupa,d,e and Mette Christine Jørgensena* aDepartment of Beta Cell Regeneration, Hagedorn Research Institute, Niels Steensens Vej 6, DK-2820 Gentofte, Denmark. bHelmholtz Zentrum München, Institute of Stem Cell Research, Ingolstädter Landstraße 1 D-85764 Neuherberg Germany. cDepartment of Cell and Developmental Biology, Vanderbilt University School of Medicine, Nashville, TN, USA dBeta Cell Biology Consortium, 2213 Garland Avenue, 9465 MRB IV, Nashville, TN 37323-0494, USA eJDRF Center for Beta Cell Therapy in Diabetes, Laarbeeklaan 103, B1090 Brussels, Belgium 3 Manuscript III: “Ptf1a is Required for Dll1 Mediated Notch Signalling in Multipotent Pancreatic Progenitors” Submitted to Genes and Development. Jonas Ahnfelt-Rønne,1,9 Mette C. Jørgensen,1,9 Rasmus Klinck,1 Jan N. Jensen,1 Ernst-Martin Füchtbauer,2 Tye Deering,3 Raymond J. MacDonald,3,7 Chris V.E. Wright,4,7 Mark A. Magnuson,5,6,7 Ole D. Madsen,1,7,8 and Palle Serup1,7,8,* 1Department of Developmental Biology, Hagedorn Research Institute, Niels Steensens Vej 6, DK-2820 Gentofte, Denmark 2Department of Molecular Biology, University of Aarhus, Aarhus, Denmark 3Department of Molecular Biology, University of Texas Southwestern Medical Center, Dallas, TX, USA 4Department of Cell and Developmental Biology, Vanderbilt University School of Medicine, Nashville, TN, USA 5Center for Stem Cell Biology, Vanderbilt University School of Medicine, Nashville, TN, USA 6Department of Molecular Physiology and Biophysics, Vanderbilt University School of Medicine, Nashville, TN, USA 7Beta Cell Biology Consortium, 2213 Garland Avenue, 9465 MRB IV, Nashville, TN 37323-0494, USA 8JDRF Center for Beta Cell Therapy in Diabetes, Laarbeeklaan 103, B1090 Brussels, Belgium 9These authors contributed equally to this work Manuscript I and Manuscript III have recently been submitted to scientific journals. Manuscript II is based on my own data but additional data will be added from other contributors before submission to a scientific journal. However to keep the flow of this thesis I have added the section as a finished draft manuscript. In addition to the three manuscripts, this thesis contains a general introduction to the field, including manuscript specific background sections to place the thesis subject in relation to the existing knowledge within the field. A separate section with the thesis objectives is presented before the three manuscripts. Within each manuscript, the reader is presented with an overview of the results in relation to the existing knowledge and also discussions of the data. Finally I have included a general discussion of the results presented in the thesis, including conclusions and perspectives for future research within the field. Here I have tried not to overlap with the discussions in the manuscripts Rasmus Klinck, May 2011, Copenhagen, Denmark 4 Resumé (Danish summary) Diabetes er ved at blive en verdensomspændende epidemi, hvilket til dels skyldes bedre levestandard i store dele af verden hvor der i øjeblikket sker en øget industrialisering. Selvom diabetes kan behandles med et bredt udvalg af bl.a. insulin præparater, vil der med tiden altid opstå komplikationer og følgesygdomme i forbindelse med diabetes. I gennemsnit forkorter diabetes levetiden med seks år i Vesteuropa. Derfor søger forskere rundt om i verden stadig efter en kur eller en behandling der kan regulere blod-glukose niveauet endnu bedre end man kan med de nuværende behandlinger. Set fra et grundvidenskabeligt synspunkt er de mest fremadstormene strategier i øjeblikket; styret differentiering af stamceller og induceret Beta-celle regeneration. For at blive i stand til at differentiere stamceller eller opdage et medicinerbart emne, der vil føre til øget betacelle antal, er det nødvendigt at vide hvordan bugspytkirtlen udvikler sig, og hvilke netværk af faktorer der er aktive både under bugspytkirtlens udvikling og under selve sygdommen. Baseret på flere transgene muse linjer og immunohistokemiske teknikker, benytter denne afhandling sig af grundvidenskab til at afdække en lille del af det transkriptionsfaktor-netværk der er nødvendigt for korrekt udvikling af bugspytkirtlen. Arbejdet fokuserer på den transkriptionelle repressor, Hairy Enhancer of Split 1 (Hes1), i relation til formationen af bugspytkirtlen og dens celle typer. I manuskript I bruger vi en BAC transgen muse reporter linje, Tg(Hes1-EGFP)1Hri, til at analysere Hes1 udtrykket fra embryonisk dag 7.0 (E7.0) indtil postnatal dag 8 (P8). Ved E7.0 er Hes1 udtrykt eksklusivt i den definitive endoderm. Ved E8.5 i den posterior endoderm er Hes1 udtrykt med en tydelig grænse ved det 4. somit par. Anterior er Hes1 udtrykt I den anterior-intestinale portal (AIP). Efter lukningen af mavetarmkanalen er Hes1 udtrykt i den dorsale del af mavetarmkanalen, inklusiv bugspytkirtlens epitel. Senere, ved E10.5 beskriver vi Hes1-udtrykket i både det dorsale og ventrale bugspytkirtel epitel. Ved senere stadier er Hes1 udtrykt i forskellige celletyper bland andre tarm, nyre, lunge og bugspytkirtel, udtrykket af Hes1 medieret GFP matcher kendte Hes1 udtryksmønstre. Manuscript II fokuserer på Hes1-nul mutant fænotypen i relation til bugspytkirtlens organogenese. I Hes1-nul mutanten er bugspytkirtlen underudviklet og udviser et overskud af endokrin differentiation af primært glukagon celler. De endokrine celler er også ektopiske og observeres langs med den dorsale mave hvor de strækker sig i en anterior retning fra bugspytkirtlen. Den pro-endokrine faktor Neurog3 er nødvendig for at videregive den afvigende morfogenese som er styret af umådeholden Neurog3-medieret migration og ikke en patterning defekt. Manuscript III diskuterer Hes1 i relation til den velbeskrevne Notch signaleringskaskade. Det er blevet dokumenteret at Notch-signalering og nedenstrøms-genet Hes1, regulerer bugspytkirtlens endokrine 5 udvikling, muligvis gennem lateral inhibering, hvor Neurog3-udtrykkende endokrine ophavsceller via Dll1, instruerer naboceller til ikke at blive til endokrine celler. Selvom Notch er aktiv under den tidlige specificering af bugspytkirtlen, uddyber vi på forholdet mellem Hes1, Dll1 og Ptf1a. Vi viser at Dll1 udtrykket er afhængig af Ptf1a i de multipotente bugspytkirtel ophavsceller (MPC). At Hes1 er nødvendig for Dll1 og Ptf1 udtrykket i et kort tidsvindue samt at Hes1 udtrykket er uafhængigt af Dll1 medieret Notch signalering frem til E10.5. Samlet giver disse resultater ny indsigt i udtrykket og funktionen af Hes1 under den tidlige bugspytkirtels udvikling, og giver det videnskabelige felt et nyt værktøj til at arbejde videre med funktionen af Hes1. 6 Summary Diabetes is becoming a worldwide epidemic due to increased living standards throughout the world. Although the disease is treatable with a wide variety of insulins, affordable by most, complications will inevitably arise, and on average the disease takes six years off the average life expectancy in a western European country. Therefore, the medical industry is looking for a cure or a treatment that will regulate the blood glucose levels of the diabetic patient much tighter than what is currently possible. The most prevailing strategies seen from a basic research point is currently the use of; directed differentiation of stem cells, and induced β-cell regeneration. To eventually be able to either differentiate stem cells or discover a drugable target that will lead
Load more

Recommended publications
  • Hes5 Regulates the Transition Timing of Neurogenesis and Gliogenesis In
    © 2017. Published by The Company of Biologists Ltd | Development (2017) 144, 3156-3167 doi:10.1242/dev.147256 RESEARCH ARTICLE Hes5 regulates the transition timing of neurogenesis and gliogenesis in mammalian neocortical development Shama Bansod1,2, Ryoichiro Kageyama1,2,3,4 and Toshiyuki Ohtsuka1,2,3,* ABSTRACT has been reported that the high mobility group AT-hook (Hgma) During mammalian neocortical development, neural stem/progenitor genes regulate gene expression by modulating chromatin structure cells (NSCs) sequentially give rise to deep layer neurons and (Ozturk et al., 2014), maintain neurogenic NSCs, and inhibit superficial layer neurons through mid- to late-embryonic stages, gliogenesis during early- to mid-embryonic stages through global shifting to gliogenic phase at perinatal stages. Previously, we found opening of the chromatin state (Kishi et al., 2012). However, the that the Hes genes inhibit neuronal differentiation and maintain mechanism by which the expression of these epigenetic factors is NSCs. Here, we generated transgenic mice that overexpress Hes5 in controlled remains to be analyzed. NSCs of the central nervous system, and found that the transition Here, we found that Hes5, a transcriptional repressor acting timing from deep to superficial layer neurogenesis was shifted earlier, as an effector of Notch signaling, regulates the timing of while gliogenesis precociously occurred in the developing neocortex neurogenesis and gliogenesis via alteration in the expression of Hes5-overexpressing mice. By contrast, the transition from deep to levels of epigenetic factors. Notch signaling contributes to the superficial layer neurogenesis and the onset of gliogenesis were elaboration of cellular diversity during the development of various delayed in Hes5 knockout (KO) mice.
    [Show full text]
  • Roles and Regulation of Transcription Factor Mafa in Islet Β-Cells
    Endocr. J./ S. ARAMATA et al.: INSULIN TRANSCRIPTION AND MafA doi: 10.1507/endocrj.KR-101 REVIEW Roles and Regulation of Transcription Factor MafA in Islet β-cells * SHINSAKU ARAMATA, SONG-IEE HAN AND KOHSUKE KATAOKA Graduate School of Biological Science, Nara Institute of Science and Technology, 8916-5 Takayama-cho, Ikoma, Nara 630-0192, Japan ＊Graduate School of Life and Environmental Sciences, University of Tsukuba, Tsukuba Science City, Ibaraki 305-8572, Japan. Released online August 30, 2007 Correspondence to: Kohsuke KATAOKA, Graduate School of Biological Science, Nara Institute of Science and Technology, 8916-5 Takayama-cho, Ikoma, Nara 630-0192, Japan Abstract. Insulin is a critical hormone in the regulation of blood glucose levels. It is produced exclusively by pancreatic islet β-cells. β-cell-enriched transcription factors, such as Pdx1 and Beta2, have dual roles in the activation of the insulin gene promoter establishing β-cell-specific insulin expression, and in the regulation of β-cell differentiation. It was shown that MafA, a β-cell-specific member of the Maf family of transcription factors, binds to the conserved C1/RIPE3b element of the insulin promoter. The Maf family proteins regulate tissue-specific gene expression and cell differentiation in a wide variety of tissues. MafA acts synergistically with Pdx1 and Beta2 to activate the insulin gene promoter, and mice with a targeted deletion of mafA develop age-dependent diabetes. MafA also regulates genes involved in β-cell function such as Glucose transporter 2, Glucagons-like peptide 1 receptor, and Prohormone convertase 1/3. The abundance of MafA in β-cells is regulated at both the transcriptional and post-translational levels by glucose and oxidative stress.
    [Show full text]
  • HES1, Two Programs: Promoting the Quiescence and Proliferation of Adult Neural Stem Cells
    Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press OUTLOOK HES1, two programs: promoting the quiescence and proliferation of adult neural stem cells Lachlan Harris and François Guillemot The Francis Crick Institute, London NW1 1AT, United Kingdom Adult neural stem cells are mostly quiescent and only bition of this pathway drives neuronal differentiation rarely enter the cell cycle to self-renew and generate neu- (Imayoshi et al. 2013). Specifically, they had determined ronal or glial progenies. The Notch signaling pathway is that Notch signaling induces proliferation via activating essential for both the quiescent and proliferative states the expression of the transcriptional repressor HES1, of neural stem cells. However, these are mutually exclu- whose protein levels oscillate due to autorepression (Hir- sive cellular states; thus, how Notch promotes both of ata et al. 2002). The oscillation of the HES1 protein then these programs within adult neural stem cells has re- induces the out of phase oscillation of its target gene, mained unclear. In this issue of Genes & Development, Achaete–scute homolog 1 (Ascl1), which in turn activates Sueda and colleagues (pp. 511–523) use an extensive reper- the transcription of positive regulators of cell cycle pro- toire of mouse genetic tools and techniques to demon- gression. Conversely, inhibition of the Notch pathway strate that it is the levels and dynamic expression of the down-regulates HES1 below a critical level, resulting in Notch transcriptional effector Hairy and Enhancer of sustained, rather than oscillatory, ASCL1 expression and Split 1 that enables this dual role. the induction of neuronal genes (Imayoshi et al.
    [Show full text]
  • Homeobox Gene Expression Profile in Human Hematopoietic Multipotent
    Leukemia (2003) 17, 1157–1163 & 2003 Nature Publishing Group All rights reserved 0887-6924/03 $25.00 www.nature.com/leu Homeobox gene expression profile in human hematopoietic multipotent stem cells and T-cell progenitors: implications for human T-cell development T Taghon1, K Thys1, M De Smedt1, F Weerkamp2, FJT Staal2, J Plum1 and G Leclercq1 1Department of Clinical Chemistry, Microbiology and Immunology, Ghent University Hospital, Ghent, Belgium; and 2Department of Immunology, Erasmus Medical Center, Rotterdam, The Netherlands Class I homeobox (HOX) genes comprise a large family of implicated in this transformation proces.14 The HOX-C locus transcription factors that have been implicated in normal and has been primarily implicated in lymphomas.15 malignant hematopoiesis. However, data on their expression or function during T-cell development is limited. Using degener- Hematopoietic cells are derived from stem cells that reside in ated RT-PCR and Affymetrix microarray analysis, we analyzed fetal liver (FL) in the embryo and in the adult bone marrow the expression pattern of this gene family in human multipotent (ABM), which have the unique ability to self-renew and thereby stem cells from fetal liver (FL) and adult bone marrow (ABM), provide a life-long supply of blood cells. T lymphocytes are a and in T-cell progenitors from child thymus. We show that FL specific type of hematopoietic cells that play a major role in the and ABM stem cells are similar in terms of HOX gene immune system. They develop through a well-defined order of expression, but significant differences were observed between differentiation steps in the thymus.16 Several transcription these two cell types and child thymocytes.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Rb and P53 Execute Distinct Roles in the Development of Pancreatic Neuroendocrine Tumors
    Author Manuscript Published OnlineFirst on June 26, 2020; DOI: 10.1158/0008-5472.CAN-19-2232 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. 1 Title: Rb and p53 execute distinct roles in the development of pancreatic neuroendocrine tumors 2 Running Title: Roles of Rb and p53 in pancreatic neuroendocrine tumors 3 4 1Yuki Yamauchi, 1,2Yuzo Kodama, 1Masahiro Shiokawa, 1Nobuyuki Kakiuchi, 1Saiko Marui, 5 1Takeshi Kuwada, 1Yuko Sogabe, 1Teruko Tomono, 1Atsushi Mima, 1Toshihiro Morita, 1Tomoaki 6 Matsumori, 1Tatsuki Ueda, 1Motoyuki Tsuda, 1Yoshihiro Nishikawa, 1Katsutoshi Kuriyama, 7 1Yojiro Sakuma, 1Yuji Ota, 1Takahisa Maruno, 1Norimitsu Uza, 2Atsuhiro Masuda, 3Hisato 8 Tatsuoka, 3Daisuke Yabe, 4Sachiko Minamiguchi, 5Toshihiko Masui, 3Nobuya Inagaki, 5Shinji 9 Uemoto, 1,6Tsutomu Chiba, and 1Hiroshi Seno 10 11 1Department of Gastroenterology and Hepatology, Kyoto University Graduate School of 12 Medicine, 54 Kawahara-cho, Shogoin, Sakyo-ku, Kyoto, 606-8507, Japan. 13 2Department of Gastroenterology, Kobe University Graduate School of Medicine, 7-5-1 14 Kusunoki-cho, Chuo-ku, Kobe, Hyogo, 650-0017, Japan. 15 3Department of Diabetes, Endocrinology and Nutrition, Kyoto University Graduate School of 16 Medicine, 54 Kawahara-cho, Shogoin, Sakyo-ku, Kyoto, 606-8507, Japan. 17 4Department of Diagnostic Pathology, Kyoto University Graduate School of Medicine, 54 18 Kawahara-cho, Shogoin, Sakyo-ku, Kyoto, 606-8507, Japan. 1 Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 2020 American Association for Cancer Research. Author Manuscript Published OnlineFirst on June 26, 2020; DOI: 10.1158/0008-5472.CAN-19-2232 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
    [Show full text]
  • Insulin/Glucose-Responsive Cells Derived from Induced Pluripotent Stem Cells: Disease Modeling and Treatment of Diabetes
    Insulin/Glucose-Responsive Cells Derived from Induced Pluripotent Stem Cells: Disease Modeling and Treatment of Diabetes Sevda Gheibi *, Tania Singh, Joao Paulo M.C.M. da Cunha, Malin Fex and Hindrik Mulder * Unit of Molecular Metabolism, Lund University Diabetes Centre, Jan Waldenströms gata 35; Box 50332, SE-202 13 Malmö, Sweden; [email protected] (T.S.); [email protected] (J.P.M.C.M.d.C.); [email protected] (M.F.) * Correspondence: [email protected] (S.G.); [email protected] (H.M.) Supplementary Table 1. Transcription factors associated with development of the pancreas. Developmental Gene Aliases Function Ref. Stage SRY-Box Transcription Factor Directs the primitive endoderm SOX17 DE, PFE, PSE [1] 17 specification. Establishes lineage-specific transcriptional programs which leads DE, PFE, PSE, Forkhead Box A2; Hepatocyte to proper differentiation of stem cells FOXA2 PMPs, EPs, [2] Nuclear Factor 3-β into pancreatic progenitors. Regulates Mature β-cells expression of PDX1 gene and aids in maturation of β-cells A pleiotropic developmental gene which regulates growth, and Sonic Hedgehog Signaling differentiation of several organs. SHH DE [3] Molecule Repression of SHH expression is vital for pancreas differentiation and development Promotes cell differentiation, proliferation, and survival. Controls C-X-C Motif Chemokine the spatiotemporal migration of the Receptor 4; Stromal Cell- CXCR4 DE angioblasts towards pre-pancreatic [4] Derived Factor 1 Receptor; endodermal region which aids the Neuropeptide Y3 Receptor induction of PDX1 expression giving rise to common pancreatic progenitors Crucial for generation of pancreatic HNF1 Homeobox B HNF1B PFE, PSE, PMPs multipotent progenitor cells and [5] Hepatocyte Nuclear Factor 1-β NGN3+ endocrine progenitors Master regulator of pancreatic organogenesis.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Genome-Wide DNA Methylation Analysis Reveals Molecular Subtypes of Pancreatic Cancer
    www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 17), pp: 28990-29012 Research Paper Genome-wide DNA methylation analysis reveals molecular subtypes of pancreatic cancer Nitish Kumar Mishra1 and Chittibabu Guda1,2,3,4 1Department of Genetics, Cell Biology and Anatomy, University of Nebraska Medical Center, Omaha, NE, 68198, USA 2Bioinformatics and Systems Biology Core, University of Nebraska Medical Center, Omaha, NE, 68198, USA 3Department of Biochemistry and Molecular Biology, University of Nebraska Medical Center, Omaha, NE, 68198, USA 4Fred and Pamela Buffet Cancer Center, University of Nebraska Medical Center, Omaha, NE, 68198, USA Correspondence to: Chittibabu Guda, email: [email protected] Keywords: TCGA, pancreatic cancer, differential methylation, integrative analysis, molecular subtypes Received: October 20, 2016 Accepted: February 12, 2017 Published: March 07, 2017 Copyright: Mishra et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC-BY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Pancreatic cancer (PC) is the fourth leading cause of cancer deaths in the United States with a five-year patient survival rate of only 6%. Early detection and treatment of this disease is hampered due to lack of reliable diagnostic and prognostic markers. Recent studies have shown that dynamic changes in the global DNA methylation and gene expression patterns play key roles in the PC development; hence, provide valuable insights for better understanding the initiation and progression of PC. In the current study, we used DNA methylation, gene expression, copy number, mutational and clinical data from pancreatic patients.
    [Show full text]
  • Notch Signaling in Breast Cancer: a Role in Drug Resistance
    cells Review Notch Signaling in Breast Cancer: A Role in Drug Resistance McKenna BeLow 1 and Clodia Osipo 1,2,3,* 1 Integrated Cell Biology Program, Loyola University Chicago, Maywood, IL 60513, USA; [email protected] 2 Department of Cancer Biology, Loyola University Chicago, Maywood, IL 60513, USA 3 Department of Microbiology and Immunology, Loyola University Chicago, Maywood, IL 60513, USA * Correspondence: [email protected]; Tel.: +1-708-327-2372 Received: 12 September 2020; Accepted: 28 September 2020; Published: 29 September 2020 Abstract: Breast cancer is a heterogeneous disease that can be subdivided into unique molecular subtypes based on protein expression of the Estrogen Receptor, Progesterone Receptor, and/or the Human Epidermal Growth Factor Receptor 2. Therapeutic approaches are designed to inhibit these overexpressed receptors either by endocrine therapy, targeted therapies, or combinations with cytotoxic chemotherapy. However, a significant percentage of breast cancers are inherently resistant or acquire resistance to therapies, and mechanisms that promote resistance remain poorly understood. Notch signaling is an evolutionarily conserved signaling pathway that regulates cell fate, including survival and self-renewal of stem cells, proliferation, or differentiation. Deregulation of Notch signaling promotes resistance to targeted or cytotoxic therapies by enriching of a small population of resistant cells, referred to as breast cancer stem cells, within the bulk tumor; enhancing stem-like features during the process of de-differentiation of tumor cells; or promoting epithelial to mesenchymal transition. Preclinical studies have shown that targeting the Notch pathway can prevent or reverse resistance through reduction or elimination of breast cancer stem cells. However, Notch inhibitors have yet to be clinically approved for the treatment of breast cancer, mainly due to dose-limiting gastrointestinal toxicity.
    [Show full text]
  • Activated Notch Counteracts Ikaros Tumor Suppression in Mouse and Human T-Cell Acute Lymphoblastic Leukemia
    Leukemia (2015) 29, 1301–1311 © 2015 Macmillan Publishers Limited All rights reserved 0887-6924/15 www.nature.com/leu ORIGINAL ARTICLE Activated Notch counteracts Ikaros tumor suppression in mouse and human T-cell acute lymphoblastic leukemia MT Witkowski1,2,8, L Cimmino1,2,3,8,YHu4, T Trimarchi3, H Tagoh5, MD McKenzie1,2, SA Best1,2, L Tuohey1,2, TA Willson1,2, SL Nutt2,6, M Busslinger5, I Aifantis3, GK Smyth4,7 and RA Dickins1,2 Activating NOTCH1 mutations occur in ~ 60% of human T-cell acute lymphoblastic leukemias (T-ALLs), and mutations disrupting the transcription factor IKZF1 (IKAROS) occur in ~5% of cases. To investigate the regulatory interplay between these driver genes, we have used a novel transgenic RNA interference mouse model to produce primary T-ALLs driven by reversible Ikaros knockdown. Restoring endogenous Ikaros expression in established T-ALL in vivo acutely represses Notch1 and its oncogenic target genes including Myc, and in multiple primary leukemias causes disease regression. In contrast, leukemias expressing high levels of endogenous or engineered forms of activated intracellular Notch1 (ICN1) resembling those found in human T-ALL rapidly relapse following Ikaros restoration, indicating that ICN1 functionally antagonizes Ikaros in established disease. Furthermore, we find that IKAROS mRNA expression is significantly reduced in a cohort of primary human T-ALL patient samples with activating NOTCH1/ FBXW7 mutations, but is upregulated upon acute inhibition of aberrant NOTCH signaling across a panel of human T-ALL cell lines. These results demonstrate for the first time that aberrant NOTCH activity compromises IKAROS function in mouse and human T-ALL, and provide a potential explanation for the relative infrequency of IKAROS gene mutations in human T-ALL.
    [Show full text]