Deployment of Regulatory Genes During Gastrulation and Germ Layer Speciﬁcation in a Model Spiralian Mollusca Crepidula

DEVELOPMENTAL DYNAMICS 244:1215–1248, 2015 DOI: 10.1002/DVDY.24308

RESEARCH ARTICLE

Kimberly J. Perry,1 Deirdre C. Lyons,2 Marta Truchado-Garcia,3 Antje H. L. Fischer,4,5 Lily W. Helfrich,5 Kimberly B. Johansson,5,6 Julie C. Diamond,5 Cristina Grande,3 and Jonathan Q. Henry1*

1University of Illinois, Department of Cell and Developmental Biology, Urbana, Illinois 2Biology Department, Duke University, Durham, North Carolina 3Departamento de Biologıa Molecular and Centro de Biologıa Molecular, “Severo Ochoa” (CSIC, Universidad Autonoma de Madrid), Madrid, Spain 4Department of Metabolic Biochemistry, Ludwig-Maximilians-University, Munich, Germany 5Marine Biological Laboratory, Woods Hole, Massachusetts 6Department of Molecular and Cellular Biology, Harvard University, Cambridge, Massachusetts

Background: During gastrulation, endoderm and mesoderm are specified from a bipotential precursor (endomesoderm) that is argued to be homologous across bilaterians. Spiralians also generate mesoderm from ectodermal precursors (ectomesoderm), which arises near the blastopore. While a conserved gene regulatory network controls specification of endomesoderm in deuterostomes and ecdysozoans, little is known about genes controlling specification or behavior of either source of spiralian mesoderm or the digestive tract. Results: Using the mollusc Crepidula, we examined conserved regulatory factors and compared their expression to fate maps to score expression in the germ layers, blastopore lip, and digestive tract. Many genes were expressed in both ecto- and endomesoderm, but only five were expressed in ectomesoderm exclusively. The latter may contribute to epithelial-to-mesenchymal transition seen in ectomesoderm. Conclusions: We present the first comparison of genes expressed during spiralian gastrulation in the context of high-resolution fate maps. We found variation of genes expressed in the blastopore lip, mouth, and cells that will form the anus. Shared expression of many genes in both mesodermal sources suggests that components of the conserved endomesoderm program were either co-opted for ectomesoderm formation or that ecto- and endomesoderm are derived from a common mesodermal precursor that became subdivided into distinct domains during evolution. Developmental Dynamics 244:1215–1248, 2015. VC 2015 Wiley Periodicals, Inc.

Key words: Spiralia; gastrulation; blastopore; mesoderm; endoderm; EMT; mouth; foregut; hindgut; anus; Mollusca

Submitted 1 April 2015; First Decision 16 July 2015; Accepted 16 July 2015; Published online 21 July 2015

Introduction contrast, germ layer speciﬁcation is not well understood in the Spiralia, a major branch of bilaterians (Boyle et al., 2014; Passa- Most bilaterian taxa have three principle germ layers: ectoderm, maneck et al., 2015). The Spiralia contains animals such as

DEVELOPMENTAL DYNAMICS endoderm, and mesoderm. The invention of mesoderm was inti- annelids, molluscs, brachiopods, phoronids, rotifers, among mately tied to the generation of the diverse morphologies of trip- others, with diverse larval and adult body plans (Hejnol, 2010; loblasts (Perez-Pomares and Munoz-Chapuli,~ 2002; Martindale, Henry, 2014). Many members of the Spiralia exhibit a highly 2005; Martindale and Hejnol, 2009). Much effort has centered on conserved spiral cleavage pattern and cell lineage fate map (Hej- deciphering the molecular basis for specifying distinct ectoder- nol, 2010; Lambert, 2010; Henry, 2014). This characteristic spiral mal, endodermal, and mesodermal germ layers during develop- cleavage program, together with molecular phylogenetic analy- ment and great progress has been made to understand germ layer ses, reveals the close evolutionary relationships amongst mem- specification in deuterostomes (e.g., echinoderms, chordates), bers of the Spiralia (Boyer et al., 1996; Henry and Martindale, ecdysozoans (e.g., fly, nematode), and cnidarians (Byrum and 1999; Dunn et al., 2008; Giribet, 2008; Hejnol, 2010; Lambert, Martindale, 2004; Martindale et al., 2004; Magie et al., 2007; 2010; Henry, 2014). Thus understanding germ layer specification Sawyer et al., 2010; Gorfinkiel et al., 2011; Peter and Davidson, in the Spiralia, particularly in those with spiral cleavage, which is 2011; Rottinger€ et al., 2012; Solnica-Krezel and Sepich, 2012). In believed to be the ancestral condition for this clade, should expand our understanding of how this clade evolved. Kimberly J. Perry and Deirdre C Lyons are co-first authors. *Correspondence to: Jonathan Q. Henry, Department of Cell and Develop- Article is online at: http://onlinelibrary.wiley.com/doi/10.1002/dvdy. mental Biology, University of Illinois, 601 S. Goodwin Avenue, Urban, IL 24308/abstract 61801. E-mail: [email protected] VC 2015 Wiley Periodicals, Inc.

1215 1216 PERRY ET AL.

Ectoderm, endoderm, and mesoderm are segregated during the erians. In the snail Crepidula, the 4d cell divides bilaterally, pro- process of gastrulation, which occurs as the result of cellular sig- ducing two stem cells (teloblasts) that divide synchronously and naling, and morphogenetic rearrangement (Stern, 2004). Morpho- give rise to daughter cells that are strictly endodermal or mesoder- genetic events associated with the process of gastrulation and mal; cell ablation experiments demonstrated that these fates are germ layer formation also have a direct bearing on the formation determined autonomously (Lyons et al., 2012). Here when we refer of the digestive tract, including structures such as the mouth and to expression in endomesoderm, we mean specifically the meso- the anus (Hejnol and Martindale, 2008; Lyons and Henry, 2014). dermal derivatives of 4d. However, spiralian mesoderm is also Cell lineage and fate mapping studies show that mesoderm and derived from ectomesoderm, which typically gives rise to larval endoderm usually arise from common endomesoderm progenitor tissues (e.g., muscles), as well as some adult tissues (Boyer et al., cells, and that this condition appears to be conserved across met- 1996; Lyons and Henry, 2014; Chan and Lambert, 2014). The cells azoans, including in ctenophores, acoels, ecdysozoans, spiralians, that give rise to ectomesoderm vary between species, but in many echinoderms, urochordates, and vertebrates (Nishida and Satoh, spiralians ectomesoderm arises primarily from 3a and 3b micro- 1985; Martindale and Henry, 1999; Logan et al., 1999; Henry meres, which is argued to be the ancestral condition (Dictus and et al., 2000; Kimelman and Griffin, 2000; Fukuda and Kikuchi, Damen, 1997; Byrum and Martindale, 2004; Hejnol et al., 2007; 2005; Maduro, 2006; Gilles et al., 2007; Ryan et al., 2013). Meso- Chan and Lambert, 2014; Lyons and Henry, 2014). At a molecular derm likely evolved from endoderm, since many genes associated level, we do not know whether these two types of mesodermal with bilaterian mesoderm cell types are expressed within the precursors are regulated by the same or different specification endoderm of basally branching animals like cnidarians (Martin- programs, but some investigators have suggested that spiralian dale et al., 2004; Rottinger€ et al., 2012). It is now common to endomesoderm is similar to endomesoderm in other metazoans build gene regulatory networks (GRNs) for specification of endo- on the basis of shared expression of regulatory genes (Lartillot derm, and mesoderm in order to understand how endoderm and et al., 2002b; Arenas-Mena, 2006, 2013; Dill et al., 2007; Henry mesoderm become distinct cell types during development and et al., 2008; Pfeifer et al., 2013; Boyle et al., 2014). evolution (Hinman et al., 2003; Maduro, 2006; Peter and David- While many spiralian fate maps have traced later development son, 2011; Rottinger€ et al, 2012). Such studies have revealed of larval structures, few fate maps have traced the behavior of cells highly conserved core regulatory components and wiring that are during gastrulation, when germ layers typically first become speci- involved in endomesoderm specification and diversification. fied. Recently we completed such fate maps for the snail, Crepidula Comparing GRNs across species can reveal which sub-circuits of fornicata (Lyons et al., 2012, 2015), making it possible to examine the network are most conserved, and how they have diverged gene expression patterns in the context of the highly stereotyped over evolutionary time. spiralian fate map and germ layer formation in a mollusc. In the The most complete endomesoderm GRN is that of the sea urchin present study we cloned fifteen genes from C. fornicata that are (Oliveri et al., 2008; Peter and Davidson, 2011; http://sugp.cal- known to be involved in gastrulation, endomesoderm specification, tech.edu/endomes). It often serves as a framework for examining and gut development in other model systems. We analyzed their germ layer specification in other organisms. Additional GRNs expression patterns in order to compare the lineage-specific origins have been reconstructed for sea stars (Hinman and Davidson, of the germ layers, mouth, foregut, and hindgut, with what is cur- 2003; Hinman et al., 2003; McCauley et al., 2015), vertebrates rently known in other metazoans. For many of the genes examined, (Chan et al., 2009), nematode (Maduro and Rothman, 2002; we showed expression in both endo- and ectomesoderm. This result Maduro, 2006; Owraghi et al., 2010), and sea anemone (Rottinger€ suggests that in Spiralia, either a conserved metazoan endomeso- et al., 2012). To date, no endomesoderm GRN has been built for a derm GRN (Davidson et al., 2002; Loose and Patient, 2004; David- spiralian. A necessary pre-requisite for generating a spiralian son and Erwin, 2006; Peter and Davidson, 2011) was co-opted for GRN requires that three types of data must be acquired: (1) fate ectomesoderm specification, or alternatively, that ecto- and endo- mapping data showing when and from where ectoderm, endomesoderm were derived from common mesodermal precursors that DEVELOPMENTAL DYNAMICS derm, and mesoderm cell types arise, (2) experimental perturba- became segregated into distinct domains during the subsequent tions to establish to what extent specification is accomplished cell course of evolution. autonomously, versus as a result of inter-cellular signaling, and We also examined gene expression for common markers of the (3) gene expression data showing where germ layer specification digestive system, including genes known to be involved in mouth and differentiation genes are expressed, relative to the fate map. and hindgut specification. Expression as it relates to the embryonic The highly stereotyped early spiral cleavage program has made blastopore is presented for various stages of gastrulation and early it possible to generate high-quality fate maps using modern intra- organogenesis, and is further compared to other members of the cellular lineage tracing techniques in several species (Boyer et al., Spiralia and Bilateria in order to compare the diverse developmen- 1996; Dictus and Damen, 1997; Henry and Martindale, 1998; tal origins of these structures. We found shared expression in both Goto et al., 1999; Hejnol et al., 2007; Meyer et al., 2010a,b; Gline the ectodermal foregut and the endodermal hindgut, which may et al., 2011; Chan and Lambert, 2014). These lineage studies have reveal common aspects in their specification, as well. revealed an interesting fact: unlike many other animal groups, spiralians have two sources of mesoderm (Lillie, 1895; Wilson, 1898; Henry and Martindale, 1999; Henry et al., 2000; Martin- Results dale, 2005; Lyons and Henry, 2014). Endomesoderm typically Overview of Cleavage, Gastrulation and arises from the 4d micromere, and gives rise to heart, muscle, kid- Organogenesis in Crepidula ney, germ line, and additional mesenchyme (Lambert, 2008; Goulding, 2009; Gline et al., 2011; Lyons et al., 2012; Fischer and Spiral cleavage involves alternating sets of oblique cell divisions Arendt, 2013; Lyons and Henry, 2014), suggesting that this source that form staggered quartets of micromeres at the animal pole of of spiralian mesoderm is homologous to mesoderm in other bilat- the embryo. The first two cell divisions generate four blastomeres REGULATORY FACTORS IN THE MOLLUSC Crepidula 1217

occupying each of the basic embryonic quadrants (termed A, B, axial elongation of the embryo. Posterior closure of the blasto- C, and D; see Conklin, 1897). Each of these cells subsequently pore lip and axial elongation displaces the ectodermal progeny of generates a series of typically smaller animal daughter cells 2d (including the 2d2 derived anus anlagen), the terminal cells termed “micromeres,” which are formed in alternating clockwise (3c2/3d2-derivatives), and the endodermal hindgut, away from and counterclockwise orientations around the animal-vegetal the mouth. axis, whereas the four vegetal-most cells are typically larger and During organogenesis stages, the ciliated prototroch forms per- termed “macromeres.” Animal micromeres are designated with pendicular to the anterior-posterior axis and separates the ecto- lowercase letters, while the vegetal macromeres are designated derm of the developing larvae into different regions. The anterior with uppercase letters. Hence, the first quartet of micromeres is region consists of pre-trochal ectoderm (derived from the first named 1a, 1b, 1c, and 1d, while the corresponding macromeres quartet and includes anterior ectoderm of the velum, apical are named 1A, 1B, 1C, and 1D. The second quartet is named 2a, organ, and apical ganglia, 1q; Fig. 1). The post-trochal region 2b, 2c, and 2d, and the corresponding macromeres are named 2A, that lies posterior to the mouth consists of ectoderm derived from 2B, 2C, and 2D, and so on. second and third quartet micromeres (2q, 3a; Fig. 1). During later The process of gastrulation follows early cleavage events and stages of organogenesis (196hpf), the rudiments of the velar lobes has recently been examined in depth in C. fornicata using in vivo become more pronounced and the ciliated apical plate shifts ven- imaging and cell lineage analyses (Lyons et al., 2015). Gastrula- trally within the developing head. Prominent ciliated bands tion occurs by epiboly, and is characterized by expansion of the involved in larval feeding and locomotion form at the edge of the progeny of the first through third quartet animal micromeres developing velum, and include the food groove, and primary and toward the equatorial zone and ultimately the vegetal pole secondary ciliary bands (which Hejnol et al., 2007, describe as the (approximately 48–117 hpf; all staging follows that established prototroch and metatroch, respectively). In the post-trochal in Lyons and Henry, 2014, and Lyons et al., 2015). During this region, the shell gland forms on the dorsal surface, the foot rudi- process, animal cap cells surround vegetal endodermal precursors ment and operculum develop on the ventral surface, and the (the fourth quartet micromeres: 4a–4c; and the macromeres: 4A– paired bilateral larval external kidneys or absorptive cells develop 4D). As epiboly progresses, the leading edge of animal micro- on the left and right lateral sides (Rivest, 1992; Lyons et al., meres (i.e., the blastopore lip) begin to spread and cover these 2012). The hindgut rudiment also forms within the post-trochal underlying cells (round stages, 48–117hpf). Eventually, the cir- region along the posterior ventral midline, but as development cumference of the blastopore lip constricts as it approaches the progresses this structure shifts towards the right lateral side (see vegetal pole of the embryo, and the cells around the lip (derived Hejnol et al., 2007; Henry et al., 2010a; Lyons et al., 2012, 2015). from progeny of the second and third quartet of micromeres; 2a– The veliger larval stage is reached by 10 days of development. 2d and 3a–3d; Fig. 1) undergo rearrangement around the open The anus, which will be located at the distal tip of the hindgut, blastopore. The blastopore, as it relates to C. fornicata, is defined does not open until later, at approximately 12 days of develop- as the site where presumptive endoderm and mesoderm are inter- ment (veliger larval stage; Lyons et al., 2015). nalized during gastrulation. In C. fornicata, this opening never fully closes and ultimately gives rise to the mouth and ectodermal foregut (or esophagus). Cells of the posterior lip of the blastopore In situ Expression Patterns (progeny of 2d) also contribute to the anus (Lyons and Henry, Endomesoderm 2014; Lyons et al., 2015). Specifically, during later stages of epiboly (beginning at 97 hpf), the posterior lip of the blastopore closes Beta-catenin (ctnnb). Beta-catenin is a multifunctional protein by a zippering process that involves convergence and extension involved in cell adhesion, cell signaling, and transcriptional regu- (CE; Lyons et al., 2015). At this time, the cells that are ultimately lation. It is broadly expressed, given its roles in cell adhesion. It involved in the formation of the anus are displaced towards the has also been shown to play conserved roles during gastrulation DEVELOPMENTAL DYNAMICS posterior pole of the embryo, away from the persistent opening of and endomesoderm specification, and serves as a key upstream the blastopore (described further below). component of the sea urchin endomesoderm GRN (Wikrama- Mesoderm in C. fornicata is derived from two sources: endo- nayake et al., 1998, 2003; Logan et al., 1999; Imai et al., 2000; mesoderm (derived from one of the fourth quartet micromeres, Miyawaki et al., 2003; Kawai et al., 2007; Rottinger€ et al., 2012). 4d; Fig. 1), and ectomesoderm (derived from ectodermal bipoten- Active ctnnb signaling occurs with the nuclearization of this pro- tial progeny of 3a and 3b at the very anterior-lateral edges of the tein that serves as an intracellular signal transducer to regulate blastopore; Fig. 1). During epiboly, progeny of 4d reside at a pos- downstream targets, such as those involved in the canonical Wnt terior location adjacent to the blastopore lip (Lyons et al., 2015). signaling pathway. The expression of ctnnb has been described For the expression data represented in the next section, we refer for C. fornicata (Henry et al., 2010), but that study did not specifi- to any expression (after 90 hpf) in the 4d lineage as either being cally describe expression during gastrulation stages. Here we expressed in the mesodermal derivatives as “endomesoderm,” or report on the mRNA expression patterns, which do not necessar- in the 4d-derived endodermal progeny, which contributes to the ily indicate active ctnnb signaling. “hindgut precursors” or “hindgut rudiment.” Following blasto- The expression pattern of ctnnb at early stages of development pore constriction, the embryo undergoes anterior-posterior axial is dynamic (Figs. 1 and 2A-F; Table 1; J. Q. Henry et al., 2010). In elongation (elongation stages, 117–170hpf) and this axial elon- a previous study we showed that expression is seen weakly in gation results in the mouth becoming displaced towards the ante- macromeres and animal micromeres (quadrants A–D), and rior pole of the embryo (Fig. 1; Lyons and Henry, 2014). By 145 depending on the cell cycle, ctnnb becomes more highly localized hpf (later stages of elongation just prior to organogenesis stages), to a region adjacent to the nuclei, which we presume to be the the morphogenetic events that make the mouth and esophagus centrosomes (Henry et al., 2010c). By mid to late gastrulation are largely completed, and subsequent morphogenesis results in more intensely labeled cells are observed around the entire edge 1218 PERRY ET AL. DEVELOPMENTAL DYNAMICS

Fig. 1. Lineage and expression summary during development in C. fornicata. Fate map for various stages of C. fornicata development is represented along the top row with groups of clones highlighted according to their clonal lineage in various colors. Key is located at the bottom right corner of the figure. Illustrations are shown as vegetal/ventral views with anterior to the top of the figure. Below is a summary of each gene expression pattern presented for three stages of development representing epiboly (94hpf), elongation (120–130hpf), and late elongation/early organogenesis (140–145hpf). If no pattern is displayed, then no expression was observed at that particular stage. The blastopore (bp) is outlined for each stage with a dashed grey line. “em” represents ectomesoderm.

of the blastopore (Fig. 2E–I). Signal is noted particularly along Fainter label also becomes visible in some posterior progeny, the posterior edge of the blastopore lip, along with cells exhibit- lateral to the ventral midline. During later elongation stages, ing higher levels of expression extending from the posterior blas- expression is observed in the anterior ectoderm derived from the topore along the ventral midline, towards the more posterior 1st quartet micromeres and in posterior ectoderm (mainly progeny regions (ectodermal cells derived form 3c and 3d, Fig. 2G–H). of 2d) in a radiating pattern that extends from the blastopore and DEVELOPMENTAL DYNAMICS e nMP n iial h aeogngnssseie nQT tutrsaelblda olw:b,batpr;e,etmsdr;h,hindgut hr, ectomesoderm; ec, blastopore; speci- bp, ovoid follows: elongating late as embryo same T labeled same the in are the from bar Structures Scale shown from Q–T. stomodeum. are expression st, expression in of gland; of specimen shell view views organogenesis sg, Various dorsal mouth; DAPI same (L). corresponding A mo, nuclei the rudiment; with J. labeled similarly DAPI (G) in and corresponding M–P, blastopore labeling and the in DAPI (K) corresponding around men in expression with shown with I is embryo I–J in elongation represented in same early show is of elongation and view during (F), Vegetal Expression image A–D. (H). pan of of DAPI labeling localization each corresponding panel the each and of showing within corner (E) labeled begins, embryo right are epiboly stage bottom A–D as quadrants the A,B Embryonic in in (B). v Animal nuclei located specimen images. labeled 80hpf is brightfield DAPI some specimens corresponding accompany fluorescence) and of (blue (A) Orientation nuclei (80hpf) DAPI-labeled section. expression ventral). Results vent., vegetal/ventral; the vent., veg. in animal; descriptions (an., detailed the to Refer organogenesis). i.2. Fig. xrsinof Expression ctnnb uigerydvlpetin development early during .fornicata C. ¼ 50 ctnnb . A m – m. T: xrsin()adcrepnigDP-aee uli() ltee round Flattened (D). nuclei DAPI-labeled corresponding and (C) expression ctnnb xrsini mro agn rm8–7hf(al epiboly–early (early 80–170hpf from ranging embryos in expression EUAOYFCOSI H MOLLUSC THE IN FACTORS REGULATORY Crepidula e of iew ctnnb 1219 el 1220 PERRY ET AL.

TABLE 1. Grids Detailing Expression in Speciﬁc Tissues/Rudiments During Embryogenesis in C. fornicata (3 Rep- resentative Time Periods)a DEVELOPMENTAL DYNAMICS

aGenes are listed along the top of the grids and regions of expression are noted along the left side of the grids. The embryonic range of development is noted at the top left of each expression grid. Shaded boxes represent areas where expression was noted and un-shaded boxes represent areas where no expression was detected. The embryonic range of development examined is noted at the top left of each expression grid, including epiboly (90–117hpf), elongation (120–137hpf) and late stages of elongation/early organogenesis (140–170hpf).

developing mouth (Fig. 2I–L). Expression is somewhat diminished more strongly in progeny of 4d, particularly the hindgut rudi- by early organogenesis stages, but broadens during later organo- ment (Fig. 2Q–S). genesis stages and is observed around the mouth, the shell gland, and a proliferative zone located on the left-and right-lateral Orthodenticle (otx). Orthodenticle is a homeobox transcription post-trochal area (Fig. 2M–T). Pre-larval expression also appears factor with conserved roles in the speciﬁcation of anterior struc- to be somewhat more intense on the right side. tures, including those of the CNS and the stomodeum (Cohen and Expression is also seen in the progeny of 4d. ctnnb expression Jurgens,€ 1990; Finkelstein et al., 1990; Acampora et al., 2000; was observed in organogenesis specimens, where it is noted Boyle et al., 2014). REGULATORY FACTORS IN THE MOLLUSC Crepidula 1221 DEVELOPMENTAL DYNAMICS

Fig. 3. Expression of otx during early development in C. fornicata. A–P: otx expression in embryos ranging from 99–165hpf (late epiboly through elongation stages). Refer to the detailed descriptions in the Results section. Orientation of specimens is located in the bottom right corner of each panel (veg. vent., vegetal/ventral; vent., ventral). DAPI-labeled nuclei (blue fluorescence) accompany some brightfield images. Mid-epiboly embryo (A) and corresponding DAPI image (B), and later epiboly embryo with expression around the blastopore (C) with corresponding DAPI labeling (D). Expression during elongation is represented in E with corresponding DAPI labeling in F. Ventral expression in an elongating oval stage is shown in G with corresponding dorsal view in H. Various views of expression are shown from the same late ovoid specimen in I–L, and similarly the same organogenesis specimen in M–P. Black arrowheads point to asymmetric post-trochal ectodermal patch of expression in I, J, L–N, P. Structures are labeled following designations used in Figure 2 and as follows: fr, foot rudiment; np, neural precursors; vr, velar rudiment. Scale bar in P ¼ 50mm.

otx does not exhibit a distinct localized expression pattern dur- genesis, expression is noted in the anterior mouth and esophagus, ing early cleavage stages, but there appears to be faint wide- with less intense expression along the posterior edge of the spread expression throughout the embryo. During early to mid- mouth and foregut (Fig. 3G, I–K, M–O). otx expression is wide- gastrula stages, more pronounced expression is seen around the spread in the ectoderm at later stages of development and noted blastopore (Figs. 1, 3A–D; Table 1), and later gastrula embryos asymmetrically in a patch of cells on the right side of the embryo have expression around the entire blastopore (Fig. 3E–F). Mid to in the post-trochal region (Fig. 3I–J, L–N, P). Expression is also late gastrula embryos display otx labeled cells along the ventral observed anterior to the mouth in head ectoderm and scattered midline posterior to the blastopore (Fig. 3C–F). During organo- cells likely to be the neuronal precursors (Fig. 3G, H, J, M–O). The DEVELOPMENTAL DYNAMICS vi pcmni –,adsmlrytesm raoeei pcmni –.Bakarwed on oaymti ottohlectodermal T post-trochal in asymmetric late bar same Scale to 3. the point and from arrowheads 2 shown Figures Black are in Q–T. expression used of in designations following views specimen labeled Various organogenesis are (L). with Structures same labeling embryo T. round DAPI Q, the corresponding Flat in similarly with 3mR). expression (H). and 3mL, of (K) labeling M–P, patch 1mR, stage DAPI (1mL, in ovoid corresponding progeny an with specimen teloblasts and (G) the ovoid blastopore (J), to the labeling localized of DAPI is region sponding that posterior expression showing the (F) at expression image DAPI corresponding and (E) AL. ET PERRY 1222 al tgso raoeei) ee otedtie ecitosi h eut eto.Oinaino pcmn slctdi h otmrgtco right bottom brightfield the some in accompany of located fluorescence) view is (blue Animal specimens nuclei DAPI-labeled A–D. of ventral). Orientation of vent., section. panel vegetal/ventral; Results vent., the veg. of in animal; view descriptions (an., Animal detailed panel the each of to ner Refer organogenesis). of stages early 4. Fig. xrsinof Expression foxA xrsini laaeeby A n orsodn AIlbldnce B.EbyncqarnsADaelbldwti each within labeled are A–D quadrants Embryonic (B). nuclei labeled DAPI corresponding and (A) embryo cleavage in expression foxA uigerydvlpetin development early during foxA xrsini 5p pcmn()adcrepnigDP-aee uli() oslve fa4hfspecimen 48hpf a of view dorsal A (D). nuclei DAPI-labeled corresponding and (C) specimen 45hpf in expression .fornicata C. . A – T : foxA xrsini mro agn rm2-el10p erycevg to cleavage (early 24-cell-170hpf from ranging embryos in expression foxA xrsindrn neioysae()wt corre- with (I) stage epiboly an during expression ¼ 50 m m. images. r- DEVELOPMENTAL DYNAMICS .Srcue r aee olwn eintosue nFgrs2ad3 n sflos p pclpae t ertoh b eolss c termin tc, teloblasts; tb, neurotroch; and nt, V, plate; U, apical in ap, expression follows: showing of as specimen patch sim- and staged and ectodermal 3, similarly Q–T, X post-trochal and a in in 2 as asymmetric specimen bar Figures well to ovoid Scale as J– in late point midline. of (O) from used same ventral arrowheads shown region specimen designations the vm, Black is same following from posterior cells; U–X. (elongated) the labeled shown the stage in of are are at oval Structures view expression specimen expression late of X. posterior organogenesis A with views A same Various (N). fluorescence). embryo the fluorescence). labeling green oval ilarly green DAPI (L, (P, Early corresponding labeling labeling (F). the tubulin tubulin with nuclei anti-acetylated anti-acetylated (M) A– as labeled shown of well DAPI is (H). right panel as corresponding L labeling each (K), bottom of showing and within labeling DAPI the view (D) (E) labeled DAPI corresponding in Animal nuclei embryo are corresponding with located images. DAPI-labeled A–D same (G) is brightfield quadrants corresponding the blastopore Embryonic some and specimens of the (B). accompany (C) of view nuclei fluorescence) specimen Orientation dorsal DAPI-labeled (blue 48hpf section. corresponding the nuclei of Results and DAPI-labeled view (A) the ventral). Animal embryo in F. vent., cleavage descriptions animal; early detailed in (an., the expression panel to each Refer of organogenesis). corner of stages early i.5. Fig. xrsinof Expression bra uigerydvlpetin development early during ¼ 50 m m. .fornicata C. bra xrsini hw na al vi tg I.Altroodsae()i hw with shown is (J) stage ovoid later A (I). stage ovoid early an in shown is expression . A – X : bra xrsini mro agn rm8cl–7hf(al laaeto cleavage (early 8-cell–170hpf from ranging embryos in expression bra xrsini h eolss(M,3R ln with along 3MR) (3ML, teloblasts the in expression bra al DEVELOPMENTAL DYNAMICS 24PRYE AL. ET PERRY 1224 N,a ela lgtyodroodsae()adDP aeig() aiu iw fepeso r hw rmasnl aeoodseie nQT and Q–T, in X specimen in ovoid and T–V, bar late R, Scale single Q, 5. a in and from expression 3, shown of 2, are patch labeling Figures ectodermal expression DAPI in post-trochal corresponding of asymmetric used with designations views to following Various (M) point labeled arrowheads (P). shown are labeling Black is Structures U-X. DAPI stage X. in and elongating specimen (O) An stage organogenesis stage (L). single labeling ovoid a DAPI older corresponding also slightly with with shown a (K) is as embryo specimen well same Epiboly as (F). the (N), nuclei of labeled quadrants view Embryonic DAPI posterior corresponding (H). (D). a and labeling nuclei as (E) DAPI DAPI well specimen corresponding corresponding 80hpf and and of (C) view embryo (G) Vegetal A–F. cleavage expression of advanced blastopore panel more veget each as vent., within well veg. labeled as vegetal; are of (B), veg., A–D animal; nuclei view (an., labeled Animal panel images. DAPI brightfield corresponding each some and of accompany corner (A) fluorescence) right (blue bottom nuclei DAPI-labeled the ventral). in vent., located tral; is specimens of Orientation organogenesis). of stages 6. Fig. xrsinof Expression cdx uigerydvlpetin development early during .fornicata C. cdx . A xrsini hw ta vi tg I ihcrepnigDP aeig() as (J), labeling DAPI corresponding with (I) stage ovoid an at shown is expression – X : cdx xrsini mro agn rm1-el10p erycevg oearly to cleavage (early 16-cell–170hpf from ranging embryos in expression ¼ 50 m m. cdx xrsini al laaeembryo cleavage early in expression al/ven- REGULATORY FACTORS IN THE MOLLUSC Crepidula 1225

developing velum expresses otx (Fig. 3G, I–K, M–O), as do cells in Centrosomal localization has been reported previously in the the foot rudiment (Fig. 3N) and in the proliferative zone of the molluscs, Ilyanassa (Lambert and Nagy, 2002; Kingsley et al., shell gland (Fig. 3I, K, L). 2007) and Crepidula (Henry et al., 2010). After the 24-cell stage, otx can also be observed in ectomesodermal derivatives (3a2, localization appears mainly in cells of the D-quadrant (Fig. 5C– 3b2; Fig. 3C–G), as well as the ectomesoderm cells undergoing F). Localization is observed during early gastrulation around the EMT. Expression is also observed in both the endomesodermal lip of the entire blastopore with more concentrated expression progeny of the mesentoblast (2mL and 2mR) and in the endoder- seen along the posterior edge (Fig. 5G, H) and in ectoderm poste- mal hindgut rudiment (Fig. 3E–G, I–K, M–O). Relatively intense rior to the blastopore lip. This expression pattern is reminiscent expression is present in the teloblast cells at certain stages. of that seen for ctnnb. There is localization of bra in some cells derived from 3c1 and 3d1 to the sides of the ventral midline (Fig. Forkhead box A (foxA). FoxA is a member of the forkhead 5I). Signal is also observed in progeny of 3a2 and 3b2, which give box, helix-turn-helix class of transcription factors (Kaufmann rise to ectomesoderm, and are located on the lateral sides of the and Knochel, 1996). Fox genes are known to play roles in specifi- blastopore. Unlike in Capitella, we did not observe asymmetric cation and differentiation of endodermal structures and are bra expression to the left side of the blastopore (Boyle et al., thought to regulate the fates of both ectomesoderm (Arenas- 2014). Localization of bra in gastrula stage embryos is also noted Mena, 2006) and endomesoderm (Olsen and Jeffrey, 1997; Mar- in what are presumed to be neuronal precursors from scattered tindale et al., 2004; Oliveri et al, 2006; Boyle and Seaver, 2008, anterior 1q progeny. At later stages, expression is seen in the cells 2010). that undergo convergent extension (from 3c2 and 3d2), which During early cleavage stages in C. fornicata, foxA mRNA is originally occupied the posterior blastopore lip (including the ter- localized to regions adjacent to the nuclei in the A–D macro- minal cells; Fig. 5O–P; Lyons et al., 2015), and come to reside meres, which we presume to be the centrosomes (Figs. 1, 4A–D). along the ventral midline (Fig. 5I, O). During later gastrula stages Expression is seen during epiboly in cells of the blastopore lip expression continues in cells around the entire blastopore lip. (Fig. 4G–J; Table 1), and in particular cells of the posterior lip, During cleavage stages, two areas of expression are also which undergo convergent extension (Fig. 4I–J). As development observed in the mesodermal left and right teloblasts derived from continues, expression is seen in all cells of the developing mouth 4d (Fig. 5J–N), and at later stages of gastrulation, prominent and esophagus, being somewhat more highly expressed in the expression continues in the teloblasts and in endomesodermal anterior regions of both structures (Fig. 4K–L). During organo- progeny. Pre-larval expression appears around the entire mouth, genesis, expression appears in cells posterior to and along the rim in the esophagus, in both mesodermal and endodermal progeny of the velum (Fig. 4M–S). Expression is also seen in the foot rudi- of 4d, including the hindgut rudiment, in intense spots associated ment and the shell gland (Fig. 4M, O–T). with nuclei in some cells of the anterior/apical plate ectoderm, in Expression is detected in progeny of the mesentoblast (4d), the prototroch cells (derived from 1q), and in the more ventral- including progenitors of the hindgut during early to mid stages lateral progeny of 2b1 (neuronal cells) and 2b2 (Fig. 5Q–X). Proxi- of gastrulation (e.g, 1mL, 1mR, 3mL, 3mR; Fig. 4E, F). Expression mal lateral cells of the foot rudiment also express bra (derived is also apparent in the progenitors of the ectomesoderm (progeny from 3c1 and 3d1, Fig. 5U–W). 2 2 of 3a ,3b; Fig. 4K, L), and in scattered mesenchymal progeny of Several bra in situ specimens were also labeled with acetylated 2 2 3a and 3b . During stages of organogenesis, expression appears tubulin antibody, which labels ciliated cells that appear during to be lost in ectomesoderm that has migrated away from the later stages of gastrulation (during elongation) and organogenesis region of the mouth, though expression continues in the endo- stages. These ciliated cells are found in ectodermal regions of the derm of the developing hindgut rudiment (Fig. 4M–O; Q–S). foxA mouth, apical plate, and cells located posterior to the mouth is asymmetrically expressed in post-trochal ectoderm with more along the ventral midline including the two terminal cells (Lyons expression in a patch on the right side. (Fig. 4Q, T). Similar to C. et al., 2015; Fig. 5L). Acetylated tubulin labeling corresponds DEVELOPMENTAL DYNAMICS fornicata, foxA is also expressed asymmetrically in one blasto- with regions along the ventral midline where bra expression is mere on the right side of the post-trochal region in Patella (possi- also noted. During later elongation stages and organogenesis, the bly the ectodermal midline stem cell; Lartillot et al., 2002a). two ciliated terminal cells have migrated towards the posterior pole (Fig. 5P), and lie in a region where bra mRNA is also Brachyury (bra). Brachyury is a T-box transcription factor that observed (Fig. 5O, P). plays a key role in specifying cells of the blastopore (Shoguchi et al., 1999; Arendt et al., 2001; Technau, 2001; Gross and McClay, 2002), regulating genes involved in gastrulation-specific Digestive Tract Markers morphogenetic movements (i.e., convergent extension; Arendt, Caudal (cdx). Caudal is a hox-related homeobox transcription 2004), and the development and specification of the adult meso- factor important during early embryonic development and in the derm (Peterson et al., 1999; Technau, 2001; Gross and McClay, process of gastrulation. At later stages, cdx is involved in the 2002; Boyle et al., 2014). It also regulates the development of the specification of posterior fates, including the hindgut (Schulz and anterior-posterior axis (Arendt et al., 2001; Lartillot et al., 2002b; Tautz, 1995; Wu and Lengyel, 1998; Moreno and Morata, 1999; Koop et al., 2007). More recently a study in the cnidarian Acrop- Lartillot et al., 2002b). ora suggests a role for bra in demarcating ectoderm from endo- During cleavage stages, cdx is localized in specific cells of all derm (Hayward et al., 2015). four quadrants of the embryo and is particularly localized to In C. fornicata, bra expression appears to be dynamic and regions adjacent to the nuclei, which we presume to be the cen- mainly restricted to the vegetal macromeres during early cleavage trosomes of the macromeres, and to some extent also in the stages, where it localizes to regions adjacent to the nuclei during micromeres (Figs. 1, 6A–F; Table 1). At later stages expression interphase (presumably the centrosomes, Figs. 1, 5A, B; Table 1). appears to be more widespread and is seen in particular around DEVELOPMENTAL DYNAMICS on oaymti ottohletdra ac fepeso nQ ,adT tutrsaelbldfloigdsgain sdi iue 2 Figures arrowheads in Black used Q–T. designations in following specimen posterior labeled ovoid a a are late in in Structures epiboly and same T. represented (N) late the and is in from and R, labeling J shown Q, (H), DAPI I, are in corresponding image in expression T expression with in shown of DAPI of (M) bar embryo views in patch corresponding speci- Scale Various represented The ectodermal cleavage 5. and is (P). (J). post-trochal late and (G) elongation labeling of asymmetric labeling during view DAPI to embryo DAPI Expression Animal with point brightfield corresponding A–F. stage (L). (O) of some with labeling round specimen panel DAPI (I) accompany Flattened later each corresponding blastopore fluorescence) cor within with (F). the right labeled (blue (K) nuclei bottom around are view nuclei the A–D expression DAPI-labeled in DAPI-labeled quadrants with corresponding located Embryonic ventral). embryo is and (D). vent., specimens nuclei (E), of vegetal/ventral; DAPI Orientation men corresponding vent., section. and Results veg. (C) the of animal; stage in view (an., descriptions Animal detailed panel the images. each to Refer of elongation). ner of stages later to 26PRYE AL. ET PERRY 1226 i.7. Fig. xrsinof Expression ¼ gsc 50 gsc m uigerydvlpetin development early during m. xrsini 6cl laaesae()adcrepnigDP-aee uli() swl sa2-elcleavage 27-cell a as well as (B), nuclei DAPI-labeled corresponding and (A) stage cleavage 16-cell in expression .fornicata C. . A – T : gsc xrsini mro agn rm1-el15p erycleavage (early 16-cell–145hpf from ranging embryos in expression - REGULATORY FACTORS IN THE MOLLUSC Crepidula 1227

Fig. 8. Expression of hex during early development in C. fornicata. A–H: hex expression in embryos ranging from 110–196hpf (late epiboly to late stages of organogenesis). Refer to the detailed descriptions in the Results section. Orientation of specimens is located in the bottom right corner of each panel (veg. vent., vegetal/ventral; vent., ventral). DAPI-labeled nuclei (blue fluorescence) accompany one brightfield image. Vegetal ventral view of hex expression very faintly along the anterior region of the blastopore (A) and corresponding DAPI labeled nuclei (B). Ventral view of hex expression in ovoid stage specimen (C) and even later ovoid stage (D). Various views of the same specimen during organogensis are represented in (E-H). Structures are labeled following designations used in Figures 2 and 3. Scale bar in H ¼ 50 mm.

posterior and anterior-lateral cells of the blastopore (Fig. 6G,H). During early cleavage stages gsc mRNA is concentrated in Though between 120–137hpf (elongating stage), it is excluded regions adjacent to the nuclei, which we presume to be the cen- from the very anterior region of the blastopore lip. cdx is trosomes of the A–D macromeres, but is also expressed in animal observed in posterior ectoderm, and possibly in some cells that micromeres (Figs. 1, 7A–F; Table 1). Faint expression is wide- are located closest to the ventral midline (Fig. 6I–P). Expression is spread throughout the embryo, but during epiboly it is more con- widespread and includes other ectodermal cells, including an centrated in posterior and lateral regions around the blastopore asymmetric patch in the right post-trochal region (Fig. 6I–L). At (Fig. 7G–J). As the blastopore constricts at later stages of epiboly, later stages, cdx is seen in the cells that undergo convergent localization becomes more prominent in cells of the blastopore extension, which originally comprised the posterior blastopore lip (Fig. 7M, N). Expression becomes less pronounced along the lip. This includes the two terminal cells, but expression at later posterior edge of the blastopore (Fig. 7O, R). At later stages, gsc stages appears to be extinguished in these cells (Fig. 6K, L, O, P). mRNA is seen in the cells that undergo convergent extension, As development continues, cdx is expressed in all cells of the including the two terminal cells, which originally comprised the DEVELOPMENTAL DYNAMICS developing mouth and the esophagus. Pre-larval expression is posterior blastopore lip (Fig. 7M, N). As development continues, seen in the cells of the hindgut, shell gland, velar lobes, and foot gsc is seen in all cells of the developing mouth and the esopha- rudiment (Fig. 6Q, X). Noticeably, cdx is asymmetrically gus, and is more prominently expressed in the anterior regions of expressed in the ectoderm with more expression in a patch on the these structures (Fig. 7Q–S). Additional regions of expression are right side of the post-trochal region as compared with the left also noted in post-trochal right and left regions in pre-larval side. Asymmetric expression of cdx was also noted in a similar specimens (Fig. 7Q–T). region in Patella (Lartillot et al., 2002b). During elongation stages, expression is noted in the 4d derived Expression is also seen in progeny of the mesentoblast (4d), left and right teloblasts (Fig. 7K, L) and in endomesodermal prog- including distinct expression in the two teloblasts at certain eny of these cells, as well as the hindgut rudiment (Fig. 7Q–S). stages (Fig. 6K–N). At later stages, prominent expression is seen Furthermore, expression is apparent in the progenitors of the in both endomesoderm and the developing hindgut rudiment ectomesoderm (3a2,3b2; Fig. 7R) and seen faintly in scattered (Fig. 6R, U, V). Furthermore, expression is apparent in the pro- mesenchymal cells. genitors of ectomesoderm (Fig. 6Q–X), but is not apparent once the progeny have undergone EMT. Hex. Hex is a divergent homeobox transcription factor involved in anterior-posterior patterning (Thomas et al., 1998). This gene is Goosecoid (gsc). Goosecoid is a homeobox transcription factor expressed in vertebrate anterior endomesoderm and is required for expressed during gastrulation. It is expressed during the develop- anterior development, including the forebrain (Newman et al., ment of mesendodermal fates in many metazoans, and promotes 1997; Zorn et al., 1999; Jones et al., 1999; Brickman et al., 2000; the development of the dorsal organizer in chordates (Angerer Barbera et al., 2000; Zamparini et al. 2006). The literature also sug- et al., 2001; Lartillot et al., 2002a; Boyle and Seaver, 2008). gests a role in migrating hepatic endoderm (Bogue et al., 2000). 1228 PERRY ET AL.

Fig. 9. Expression of nk2.1 during early development in C. fornicata. A–P: nk2.1 expression in embryos ranging from 24-cell–160hpf (early cleavage through late elongation stage). Refer to the detailed descriptions in the Results section. Orientation of specimens is located in the bottom right corner of each panel (an., animal; vent., ventral). DAPI-labeled nuclei (blue fluorescence) accompany some brightfield images. A–D labeled within DEVELOPMENTAL DYNAMICS each panel in A,B represent the relative position of the embryo quadrants. Animal view of nk2.1 expression in cleavage stage embryo (A) and corresponding DAPI-labeled nuclei (B). Dorsal view (C) of nk2.1 expression in the teloblasts (2ML, 2MR) and their progeny (2mL1, 2mR1) with corresponding DAPI labeling (D). Oval stage specimen (E) with corresponding DAPI labeling (F), as well as ventral view of older oval stage specimen (G) and corresponding dorsal view (H). Various views of expression are shown from the late ovoid specimen (I–L), and also an early organogenesis specimen (M–P). Structures are labeled following designations used in Figures 2, 3, and 5. Scale bar in P ¼ 50 mm.

Expression of hex is not observed during C. fornicata early Nk2.1 (ttf1). Nk2.1 is a homeodomain transcription factor cleavage stages. The first detectable expression emerges within known to regulate the development of endodermal fates, but also mid to late gastrula embryos as faint labeling in a subset of cells plays a role in the specification of the nervous system (Ciona, Ris- of the blastopore lip (Figs. 1, 8A, B; Table 1). During later stages toratore et al., 1999; Amphioxus, Venkatesh et al., 1999). Addi- of gastrulation, expression is seen in the more anterior and lateral tionally, this transcription factor is reported to be a potential cells of the developing mouth and esophagus, though it becomes downstream target of bra in the sea urchin oral ectoderm GRN more diffuse at later stages (Fig. 8C–H). During organogenesis (Rast et al., 2002). stages expression is also noted within two deeper areas in the Expression is first observed in cleavage stages within each of head, which we presume to be neuronal cells in the vicinity of the the four quadrants, and is localized to regions adjacent to the photoreceptors (Fig. 8E–G). nuclei (presumably the centrosomes of the macromeres, as well as hex is also localized to the hindgut primordium during organo- many of the micromeres, Figs. 1, 9A–D; Table 1). This localization genesis stages (Fig. 8D). This hindgut expression persists during of transcripts is dynamic and depends on the cell cycle. Expres- later pre-larval stages (Fig. 8E–G). sion is no longer detected during early to mid gastrula stages. REGULATORY FACTORS IN THE MOLLUSC Crepidula 1229

Fig. 10. Expression of otp during early development in C. fornicata. A–L: otp expression in embryos ranging from 37–140hpf (late cleavage through late elongation stage). Refer to the detailed descriptions in the Results section. Orientation of specimens is located in the bottom right corner of each panel (an., animal; veg. vent., vegetal/ventral; vent., ventral). DAPI-labeled nuclei (blue fluorescence) accompany some brightfield images. Animal view of otp expression in late cleavage embryo (A) and corresponding DAPI-labeled nuclei (B), as well as vegetal ventral view of epiboly embryo (C) and corresponding DAPI nuclei (D). Embryonic quadrants A–D are labeled within each panel of A, B. Ventral view of 99hpf specimen (E) and corresponding DAPI-labeled nuclei (F). Expression around the blastopore is observed in an epiboly specimen (G) and ovoid specimen (H). otp expression is shown with various views for the same late ovoid specimen (I–L). Black arrowheads point to asymmetric post-trochal ectodermal patch of expression in I, J, and L. Structures are labeled following designations used in Figures 2 and 5. Scale bar in L ¼ 50 mm. DEVELOPMENTAL DYNAMICS Towards the end of gastrulation and during the formation of the Orthopedia (otp). Orthopedia is a homeobox transcription fac- mouth, expression appears in the anterior-most region of the sto- tor that is commonly associated with CNS and brain development modeum (Fig. 9E–G). Expression also expands in an anterior cres- in the mouse. Specifically, it controls development of the hypo- cent above the mouth (Fig. 9I–K, M-O). These cells presumably thalamus, a derivative of the forebrain in vertebrates (Acampora include neural precursors of the CNS (Fig. 9M–O). nk2.1 is also et al., 2000; Kaji and Nonogaki, 2013). In Drosophila, otp is expressed in what appear to be the terminal cells (Fig. 9I–K; M- expressed during gastrulation in the proctodeum, and during later O). During organogenesis and pre-larval stages, expression is stages in the CNS and posterior fates, including the hindgut and noted in the shell gland (Fig. 9I, K, L, O, P). Some expression is anal plate regions (Simeone et al., 1994). also seen in the anterior mouth and in the esophagus. Two more Expression of otp is first observed in the D quadrant during intensely labeled lateral clusters of cells reside just outside of the cleavage stages (Figs. 1, 10A, B; Table 1). During early epiboly left and right sides of the developing mouth (Fig. 9I–K, M–O). stages, expression is present in cells from all four quadrants and nk2.1 also continues to be expressed in the terminal cells at these becomes more intense in cells along the blastopore lip (Fig. 10C– later stages (Fig. 9M–O). F). At later stages, expression continues around the constricted During late cleavage stages, expression is observed faintly in blastopore (Fig. 10G, H). During organogenesis stages, labeling is the progeny of the mesentoblast, 4d, including the 2ML and 2MR observed along the anterior-lateral edges of the developing teloblasts, and more prominently in two daughters (2mL1, 2mR1; mouth and esophagus, but expression in the posterior region of Fig. 9C, D). However during gastrulation and later stages of orga- the mouth is visibly diminished (Fig. 10J). Some anterior expres- nogenesis, expression is no longer detected in mesentoblast prog- sion is observed in progeny of the first quartet. Elevated expres- eny and no expression is detected in ectomesoderm. sion is seen in posterior ectoderm cells in the blastopore lip close 1230 PERRY ET AL. DEVELOPMENTAL DYNAMICS

Fig. 11. Expression of six3/6 during early development in C. fornicata. A–P: six3/6 expression in embryos ranging from 120–196hpf (early elongation to late stages of organogenesis). Refer to the detailed descriptions in the Results section. Orientation of specimens is located in the bottom right corner of each panel (ant., anterior; vent., ventral). DAPI-labeled nuclei (blue fluorescence) accompany some brightfield images. Ventral six3/6 expression is shown for a range of ovoid specimens: (A) with corresponding dorsal view in B, later ovoid (C) with corresponding dorsal view in D, and slightly later ovoid stage (E) with a corresponding anterior view of neural precursor labeling (F). Ventral views of later ovoid stages showing the expanded neural precursor cell labeling are presented in G, H. Various views of six3/6 expression are shown for a later ovoid specimen (I–L), as well as multiple views from an organogenesis specimen (M–O) are presented. An anterior view of a late organogenesis specimen shows expression around the ocelli (P). Black arrowheads point to asymmetric post-trochal ectodermal patch of expression in I, J, L–N. Structures are labeled following designations used in Figures 2, 3, and 5, and as follows: cb, ciliary bands; oc, ocelli; pt, prototroch. Scale bar in P ¼ 50 mm.

to the ventral midline (Fig. 10G, H). Faint expression of otp During gastrulation, otp mRNA is observed in progenitors of appears along the ventral midline posterior to the blastopore (Fig. ectomesoderm derived from 3a2 and 3b2 (Fig. 10G, H). Faint 10G, H, J). There appears to be diffuse labeling in the ectoderm at expression is seen in both the endomesodermal (2mL, 2mR) and later stages. Interestingly, an asymmetric patch of ectoderm on endodermal progeny of the mesentoblast (Fig. 10E–H). During the right post-trochal region expresses otp (Fig. 10I, J, L), similar organogenesis, otp expression is not detected in the ectomeso- to that described for genes such as cdx, otx, and foxA. Diffuse derm or endomesoderm, nor is it expressed in the developing expression is also noted in the shell gland (Fig. 10I, K, L). hindgut rudiment. REGULATORY FACTORS IN THE MOLLUSC Crepidula 1231 DEVELOPMENTAL DYNAMICS

Fig. 12. Expression of snail2 during early development in C. fornicata. A–P: snail2 expression in embryos ranging from 130–170hpf (elongation stages to early stages of organogenesis). Refer to the detailed descriptions in the Results section. Orientation of specimens is located in the bottom right corner of each panel (vent., ventral). DAPI-labeled nuclei (blue fluorescence) accompany some brightfield images. Ventral view of snail2 expression in ovoid stage (A) and corresponding DAPI labeled nuclei (B), as well as a later ovoid stage (C) and corresponding DAPI nuclei (D). Var- ious views of expression are shown from a late ovoid specimen (E–H), a specimen with various views transitioning to the organogensis stage (I–L) and various views of a specimen during organogenesis (M–P). Black arrowheads point to asymmetric post-trochal ectodermal patch of expression in M, N, and P. Structures are labeled following designations used in Figures 2, 3, and 11. Scale bar in P ¼ 50 mm.

Six3/6. Six3/6 is a homeobox transcriptional regulator com- six3/6 expression is not observed at early cleavage stages, but monly associated with the development of the forebrain and appears anteriorly after the onset of gastrulation when the blasto- anterior neural structures including eyes or photoreceptors, and pore is beginning to constrict (Figs. 1, 11A, B; Table 1). During mid is expressed in the chordate mouth primordium (Niimi et al., to late gastrula stages, expression appears in additional cells 1999; Boorman and Shimeld, 2002; Christiaen et al., 2007; around the blastopore lip, being more prominently expressed in the Kumar 2009). It is also involved in the speciﬁcation of the apical region of the anterior blastopore lip (Fig. 11C, E, G). Expression is plate in Platynereis (Marlow et al., 2014). Alternatively, six3/6 is also noted as spots in the anterior (animal) with some faint expres- involved in the speciﬁcation of the aboral (posterior) territory in sion observed around the anterior portion of the forming blasto- cnidarians (Sinigaglia et al., 2013). pore, which are presumably neural progenitors (Fig. 11A–H). Two 1232 PERRY ET AL.

Fig. 13. Expression of twist during early development in C. fornicata. A–L: twist expression in embryos ranging in stages from 24-cell–170hpf (cleavage stages to early stages of organogenesis). Please refer to the detailed descriptions in the Results section. Orientation of specimens is located in the bottom right corner of each panel (an., animal; vent., ventral). DAPI-labeled nuclei (blue fluorescence) accompany some brightfield images. A cleavage stage (A) is shown with the corresponding DAPI-labeled nuclear image (B). A–D labeled within each panel in A, B represent the relative position of the embryo quadrants. Ovoid specimens in C and E are shown with corresponding DAPI images in D and F, respectively. A ventral view of a late ovoid specimen (G) is shown with the corresponding dorsal view (H). Multiple views of the same organogenesis specimen are shown in I–L. Black arrowheads point to asymmetric post-trochal ectodermal patch of expression in E–J, L. Structures are labeled following designations used in Figures 2 and 3. Scale bar in L ¼ 50 mm.

intense focused regions of expression persist around the animal six3/6 is detected transiently in both ectomesodermal and pole through later gastrula stages, which are presumably the form- endomesodermal cells during mid- to late gastrula stages. six3/6 DEVELOPMENTAL DYNAMICS ing ocelli. Very faint expression is present along the ventral midline is not detected in the developing hindgut rudiment. during mid to late gastrula stages. Expression is observed in cells of the ciliary band, which later expands to cells of the developing EMT Markers velum (Fig. 11I–K; M–O). Later stages continue to exhibit expression in the cells of the developing CNS, including the precursors of Snail2. Snail genes encode zinc-ﬁnger transcription factors the apical ganglia and the ocelli (Fig. 11N, P; Hejnol et al., 2007). In commonly associated with development and behavior of verte- these later stages, six3/6 is noted in the ventral midline cells under- brate neural crest. Those cells are of ectodermal origin, which going convergent extension, which includes the terminal cells (Fig. arise along the dorsal midline during closure of the neural tube 11E, H). and undergo epithelial to mesenchymal transition (EMT) to adopt During stages of organogenesis, intense anterior signal is a variety of fates (Baker and Bronner-Fraser, 1997a, b; Nieto, observed in a symmetric pattern, which represents components 2002). snail2 (also known as slug) is directly implicated in the of the developing brain and the ocelli located deeper within process of EMT and serves as a transcriptional repressor of E- the developing head (Fig. 11H, J, N, P). Pre-larval specimens cadherin (Knight and Shimeld, 2001). Additionally, Snail proteins show expression in the mouth, esophagus, left and right velar can also function as regulators of mesodermal invagination rudiments, which include the developing ciliated bands, left (Hemavathy et al., 2000). Only one copy of snail has been isolated and right food grooves (Fig. 11I–K; Lyons et al., 2015), the in C. fornicata. According to phylogenetic analysis (not shown), shell gland, central nervous system and neurosensory cells of this clone was determined to be orthologous to vertebrate snail2. the foot (which may be the statocysts), with asymmetric snail2 ﬁrst appears in a small population of anterior ectoder- expression noted on the right side in the post-trochal ectoderm mal cells during early stages of gastrulation (Figs. 1, 12A–D; (Fig. 11I–O). Table 1). During elongation stages, an asymmetric region of REGULATORY FACTORS IN THE MOLLUSC Crepidula 1233

Fig. 14. Expression of notch2 during early development in C. fornicata. A–L: notch2 expression in embryos ranging from 37-cell–170hpf (cleavage stages to early stages of organogenesis). Refer to the detailed descriptions in the Results section. Orientation of specimens is located in the bottom right corner of each panel (an., animal; veg., vegetal; vent., ventral). DAPI labeled nuclei (blue fluorescence) accompany some brightfield images. A–D labeled within each panel in A–D represent the relative position of the embryo quadrants. An animal view is shown of a cleavage embryo (A) with the corresponding DAPI labeling (B). Epiboly is just beginning in the vegetal view (C) and corresponding DAPI-labeled image (D). An early ovoid stage (E) with the corresponding DAPI labeling (F), as well as a later ovoid stage showing the ventral (G) and dorsal view (H) are shown. Various views of an organogenesis specimen are shown in I–L. Black arrowheads point to asymmetric post-trochal ectodermal patch of expression in G–J, L. Structures are labeled following designations used in Figures 2 and 3. Scale bar in L ¼ 50 mm. DEVELOPMENTAL DYNAMICS snail2 expression begins to emerge (Fig. 12A–H) and this asym- Ectomesodermal progenitors express snail2 in mid to late gas- metry persists into stages of organogenesis in an area posterior to trula stages. Though snail2 is expressed in ectomesoderm, it is the blastopore on the right lateral side (Fig. 12I–P). Asymmetric not expressed in endomesoderm. No expression of snail2 was expression of another Snail family member (Pv-snail1) was also detected in the hindgut rudiment. observed in Patella (Lespinet et al., 2002). At later stages of organogenesis, expression is visible in anterior neuronal precursors Twist. Twist is a bHLH transcription factor, which is essential that may correspond to the apical ganglia and ocelli (Hejnol for mesoderm development (summarized by Technau and Scholz, et al., 2007; Fig. 12E–G, I–K, M–O), as well as scattered cells in 2003). It is involved in specification and patterning of mesoderm other regions of the embryo. Expression is observed in a subset of and is expressed in the larval head mesoderm, as well as the sto- cells around the mouth and in bilateral bands of cells that con- modeum, foregut, and hindgut of polychaetes (Dill et al., 2007). tribute to structures of the velar rim, including the food groove Additionally, it functions to regulate gastrulation, and is an and metatroch (Fig. 12I–K). In the oldest pre-larval specimens, inducer of EMT during gastrulation events, specifically by repres- cells in the developing head and more specifically, the developing sing E-cadherin, which results in modulation of cell adhesion CNS (ocelli and cranial ganglia) express snail2. Some of those (Gheldof and Berx, 2013; Wong et al., 2014). twist plays a key cells are located in the surface ectoderm and may be neuronal role in regulating the development of the neural crest in verte- precursors, whereas some are deeper cells (presumably ectomeso- brates (Meulemans and Bronner-Fraser, 2004; Adams, et al., dermal cells that have undergone EMT, Fig. 12I–P). In addition, 2008; Betancur et al., 2010). some cells towards the right side of the foot rudiment also twist is expressed transiently during early cleavage stages express snail2 (Fig. 12M, N). (Henry et al., 2010b), and reappears in mid to late gastrula 1234 PERRY ET AL.

Fig. 15. Expression of hesA during early development in C. fornicata. A–L: hesA expression in embryos ranging from 130–170hpf (elongation stages to early stages of organogenesis). Refer to the detailed descriptions in the Results section. Orientation of specimens is located in the bottom right corner of each panel (vent., ventral). DAPI-labeled nuclei (blue fluorescence) accompany some brightfield images. Ventral views are shown of an ovoid stage (A) with corresponding DAPI labeling (B), as well as a later ovoid stage (C) with corresponding DAPI labeling (D). Multiple views of the same late ovoid stage embryo are shown in E–H, as well as multiple views of an early organogenesis specimen in I–L. Structures are labeled following designations used in Figures 2 and 3, and as follows: nsc, neurosensory cell. Scale bar in L ¼ 50 mm.

embryos in the anterior and lateral edge of the blastopore (Figs. during organogenesis. twist is not detected in the endomesoderm

DEVELOPMENTAL DYNAMICS 1, 13A–F; Table 1). Faint label is also seen in the lateral ectoderm or in the hindgut rudiment. and expands at later stages in anterior ectoderm of the head and velum (Fig. 13E–K). twist appears to be very faintly expressed Notch Signaling Members along the posterior blastopore lip and in posterior cells including those that have undergone convergent extension (progeny of Neurogenic locus notch homolog protein (notch2). Neurogenic 3c2 and 3d2; Fig. 13C–F). During stages of organogenesis, locus notch homolog protein (Notch) family members are single twist is also detectable in the developing mouth and esopha- pass membrane proteins that serve in contact mediated intracel- gus (Fig. 13G). A gradient of expression is observed in the lular signaling and interact with their receptors Delta and developing mouth, where labeling is more intense along the Jagged/Serrate (Lawrence et al., 2000; de Celis, 2013). Notch pro- anterior region and less intense along the posterior edge (Fig. teins play key roles in regulating many developmental processes 13G, J). In later stages, asymmetric expression is also noted including differentiation, proliferation, and apoptosis (Artavanis- faintly in the right post-trochal region (Fig. 13I, J, L). twist is Tsakonas et al., 1999). C. fornicata contains 3 variants of Notch. expressed more intensely in bilateral bands that run along For the purposes of this study, we have examined, C. fornicata the edge of the developing velum and include precursors of notch2, which has relevant expression during gastrulation and the prototroch, metatroch, and ciliated food groove (Fig. 13I– particularly in the development of the digestive tract. K). The ectoderm of the head (neuronal cells) and the prolif- Expression for notch2 is seen during cleavage stages in the macro- erative zone of the developing shell also exhibit twist expres- meres. (Figs. 1, 14A–D; Table 1). Further expression is observed dur- sion (Fig. 13H, L). ing mid to late stages of gastrulation, appearing faintly to the sides While expression is detected in the precursors of the ectomeso- of the blastopore. Expression continuestospreadtomoreanterior derm (3a2,3b2), it is not seen in the mesenchymal progeny later cells as the embryo undergoes elongation, being excluded from the REGULATORY FACTORS IN THE MOLLUSC Crepidula 1235 DEVELOPMENTAL DYNAMICS

Fig. 16. Expression of hesB during early development in C. fornicata. A–P: hesB expression in embryos ranging from 80–160hpf (epiboly stages to late stages of elongation). Refer to the detailed descriptions in the Results section. Orientation of specimens is located in the bottom right corner of each panel (an., animal; vent., ventral). DAPI-labeled nuclei (blue fluorescence) accompany some brightfield images. Animal view of hesB expression in epiboly stage (A) and corresponding DAPI-labeled nuclei (B), as well as an early oval/elongating stage (C) and corresponding DAPI nuclei (D). A–D labeled within each panel in A, B represent the relative position of the embryo quadrants. Multiple views of the same later oval stage specimen are shown in E–H, and similar multiple views are shown for a late oval specimen (I–L) and early organogenesis specimen (M–P). Black arrowheads point to asymmetric post-trochal ectodermal patch of expression in E, F, H, I, L–N, P. Structures are labeled following designations used in Figures 2, 3, and as follows: ect, ectoderm. Scale bar in P ¼ 50 mm.

posterior lip and developing mouth, with very faint expression along the shell gland (Fig. 14H–L). Interestingly there is also an asymmetric the very posterior edge (Fig. 14E–G). Late elongation stage specimens patch of ectodermal cells expressing notch2 on the right side of the exhibit more intense expression around the anterolateral edges of post-trochal region (Fig. 14G–J, L). the mouth and esophagus (Fig. 14G). Expression is also seen in the No expression of notch2 was noted in endomesoderm. How- ectoderm lateral to the mouth, and the foot rudiment (Fig. 14I–L). ever, prior to undergoing EMT, progenitors of the ectomeso- Some expression is also seen in post-trochal ectoderm. Expression is derm show some faint expression of notch2 (Fig. 14E, F). At also visible in cells of the head that likely include neuronal precur- later stages during organogenesis, expression is detectable in sors. During pre-larval stages, there is more intense expression in hindgut endoderm, which is derived from the 4d mesentoblast rudiments of the velar lobes, in the mouth and the foot, as well as (Fig. 14I, J). 1236 PERRY ET AL.

Hes. The Hes family includes basic helix-loop-helix (bHLH) slipper snail, C. fornicata, and examined expression patterns for type transcription factors and its members act as repressors, fifteen regulatory genes known to be involved in gastrulation except Hes6, which is an activator protein due to its inhibitory and germ layer specification in other metazoans. We present effect on the repressor Hes1. Hes members are downstream tar- these expression patterns in the context of recently completed gets of Notch signaling (Iso et al., 2003), and are known to be fate maps for gastrulation-stage embryos (Lyons et al., 2012, involved in neural differentiation, as well as the regulation and 2015), which allow us to assess expression relative to specific maintenance of stem cells in digestive systems (Baek et al., 2006; cells and germ layers. It is possible to compare cell-type specific Kageyama et al., 2008). They are also involved in cell fate deter- gene expression patterns between species because many spirali- mination, and this occurs by physical interactions between cells ans share a homologous, stereotyped cleavage pattern. We dis- expressing the Notch receptor and Delta/Jagged ligands in adja- cuss these findings within the framework of ongoing debates cent cells. Finally, they are involved in regulating the timing of regarding the evolution of germ layers, and the digestive tract biological events such as segmentation of the somites (Kageyama (Technau and Scholz, 2003; Hejnol and Martindale, 2008; Mar- et al., 2007). For this study, we report on the expression of two tindale and Hejnol, 2009; Lyons and Henry, 2014; Hejnol and isolated hes genes, which we have named hesA and hesB. Phylo- Martın-Duran, 2015). genetic analysis (not shown) was inconclusive in determining which of the known orthologs each C. fornicata hes gene most Endomesoderm closely resembles, but showed that C. fornicata HesA and B are most closely related to the Hes1, Hes2, and Hes4 branch of Homo ctnnb, bra, cdx, foxA, gsc, nk2.1, otp, otx, and six3/6 were all sapiens. Compared to a canonical Hes sequence, we found that expressed in the endomesodermal progeny of 4d (Table 1). Four both genes have the same domains as the canonical form, includ- of the genes examined here also exhibited enhanced expression ing its characteristic basic domain with the proline residue. within the 4d-derived teloblasts, which include bra, cdx, gsc, and hesA expression is not observed during cleavage or early to nk2.1. Two of these genes, bra and cdx, are also known to be mid gastrula stages, but appears later during formation of the expressed in the paired mesoteloblasts in Patella (Lartillot et al., esophagus in two bilateral clusters of cells (Figs. 1, 15A–D; Table 2002b; Le Gouar et al., 2003). While ctnnb, bra, foxA, and otx are 1). Expression is also detected in neurosensory cells located in the known to be involved in the highly conserved sea urchin endo- foot (Fig. 15I-K; Lyons et al., 2015), which could be related to the mesoderm GRN, in contrast, gsc, nk2.1, and six3 are part of the posterior expression seen at earlier stages (Fig. 15A–C, E-G). In sea urchin ectoderm GRN (Oliveri et al., 2008; Peter and David- addition some expression is seen at the base of the foot rudiment son, 2011; Li et al., 2014). We were not able to examine expres- anteriorly to the left and right sides. sion for orthologs of additional genes often found in metazoan Expression is not seen in the progeny of the mesentoblast, but mesoderm, such as Gata-family genes, Blimp/Krox or Mef2, the location of expression during later stages of gastrulation sug- which are either not present in our available ESTs, or have not gests that the expression may be associated with some ectomeso- yet been cloned. dermal progenitors at the blastopore prior to their undergoing Our results indicate that there is conservation in terms of the EMT (Fig. 15E-H). deployment of metazoan endomesodermal specification in this hesB has a more dynamic expression pattern over a broader representative of the Spiralia. However, while there are similar- range of stages, and is seen first during late cleavage stages ities in the particular genes that are expressed during endomeso- within variable cells of all four quadrants of the embryo (Figs. 1, derm specification, it is obvious that the expression domains do 16A, B; Table 1). Some faint spots of expression are noted in cells not have exactly the same expression patterns, even within the of the anterior ectoderm (Fig. 16C, D). Mid to late gastrula stage Crepidula endomesodermal lineage. Therefore, these differences embryos display expression in a somewhat symmetrical pattern could potentially serve as a starting point for understanding flanking the blastopore (Fig. 16E–G). Expression is also noted in specification of sublineages in this tissue. DEVELOPMENTAL DYNAMICS cells along the anterior-lateral blastopore lip (Fig. 16I–K). Some hesB expression is noted during stages of organogenesis in ecto- A Shared Toolkit for Crepidula Endo- and derm, as well as in the right post-trochal region (Fig. 16H–P). Ectomesoderm Increased expression is also noted along the lateral edges of the foot rudiment and extending toward the medial area of the foot In C. fornicata, the 3a and 3b cells are bipotential precursors, and (Fig. 16M–O). only one daughter cell of each (the 3a2 and 3b2 cells) gives rise to Ectomesoderm expression is noted in the lateral blastopore mesoderm. Given that some similar mesodermal fates differentiate region during gastrulation stages (Fig. 16C, D). Intense expression from both ectomesoderm and endomesoderm (e.g., muscle cells), is observed in the latest pre-larval stages on either side of the one can hypothesize that components of the endomesodermal mouth in cells radiating outward towards the anterior and poste- GRN are shared between the two. Alternatively, it is conceivable rior regions. Some of these are ectomesodermal and others appear that the genes that control ectomesoderm specification are dis- to be superficial ectodermal cells. Cells expressing hesB seem to tinct from those controlling endomesoderm specification. There be arranged with linear-periodic distributions (Fig. 16E–P). are a few examples of novel origins of mesoderm tissues that are Expression is noted in the velum in scattered mesenchyme cells. distinct from the eumetazoan endomesoderm, for example the evolution of mesoderm in ctenophores (Ryan et al., 2013), and Discussion entocodon of some cnidarian medusae (Burton, 2008). Addition- ally, the neural crest generates some fates in common with both Relatively little is known about how germ layers are specified in ectoderm and mesoderm (Simoes-Costa~ and Bronner, 2015). Neu- the Spiralia, despite the fact that it is a large branch of the Bilate- ral crest cells also undergo EMT like cells of the ectomesoderm in ria. We took advantage of newly generated EST databases in the Crepidula. In each of these cases, genes typically associated with REGULATORY FACTORS IN THE MOLLUSC Crepidula 1237

endomesoderm are not expressed. Thus, we were interested to et al., 2012; Lyons and Henry, 2014). Other species of spiralians compare the expression profiles of C. fornicata 3a2,3b2, and 4d- gastrulate by invagination, and in those cases the 4d-derived derived lineages to examine any similarity between their reper- mesoderm may become internalized by EMT (Lyons and Henry, toires of regulatory factors. 2014). Examining gene expression patterns in these other spira- Expression in C. fornicata ectomesodermal progenitors was lian species would allow us to broaden our comparison of expres- noted for the following: ctnnb, bra, cdx, foxA, gsc, hesA, hesB, sion of snail and twist within the 4d lineage. We note that in notch2, otp, otx, six3/6, snail, and twist. All of those genes Patella, twist is expressed in the ectomesoderm of trochophore- except for snail2, twist, notch2, hesA, and hesB are expressed in staged embryo, but snail is not (Nederbragt et al., 2002b; Lespinet both ectomesoderm and endomesoderm. Most of the expression et al., 2002). seen in these two populations of cells was coincident over the Further, since all of the genes expressed in ectomesoderm time intervals we examined (Figs. 1–16; Table 1). Some excep- (snail2, twist, notch2, hesA, and hesB) start their expression later tions were found in the timing (initiation vs. termination) of cer- compared to the expression of the other endomesodermally tain genes such as foxA and gsc (Figs. 4 and 7; Table 1). expressed genes, one could argue that these five genes, and The expression profiles of ectomesoderm and endomesoderm potentially others (Figs. 12–16; Table 1), may be necessary for are not identical, which suggests that some aspects of their ectomesoderm differentiation or morphogenesis and not neces- specification and/or their cellular behaviors are different. The sary for its initial specification. Alternatively, ectomesoderm spatial separation of the two sources of mesoderm has been specification may simply be delayed in comparison with endome- noted in other spiralians. For example, Lartillot et al. (2002a) soderm. Some of these genes could have other roles in segregat- and Nederbragt et al. (2002b) questioned any homology between ing cells fates within the 3a and 3b lineages. For example Notch/ ecto- and endomesoderm in the gastropod Patella.Incontrastto Hes signaling is known to be involved in contact mediated cell Crepidula, Nederbragt et al. (2002b) showed that twist,andLar- specification in other systems (Drosophila, Greenwald, 1998; tillot et al. (2002a) showed that gsc and foxA, are expressed in mammals, Kageyama and Ohtsuka, 1999). Likewise, twist expres- ectomesoderm, but not endomesoderm. Lartillot et al. (2002a) sion has been noted later during the specification of anterior argued that ectomesoderm may be homologous with anterior mesoderm in brachiopods (Passamaneck et al., 2015). Given the prechordal mesoderm of vertebrates, while posterior endomeso- fact that little is known about the morphogenetic behavior of derm may be homologous with the tail-trunk mesoderm. An either source of mesoderm in spiralians, it will be very interesting alternative hypothesis is that differences in gene expression to correlate gene expression and cell behavior in these animals as might reflect different behaviors of these two forms of more detailed descriptions of their development become mesoderm. available. However, since there is some overlap in the expression of genes in both endomesoderm and ectomesoderm, the data may Endoderm suggest that ectomesoderm is specified by a very similar set of genes that specify endomesoderm. Given these similarities, dif- Endoderm is derived from different blastomeres in C. fornicata th ferent scenarios for the evolution of ectomesoderm can be envi- including the 4 quartet micromeres and macromeres. The sioned. When ectomesoderm arose, it may have co-opted the hindgut rudiment is a compact structure comprised of many spiralian endomesodermal tool kit. Alternatively, ectomeso- small cells derived specifically from progeny of the mesentoblast derm and endomesoderm may have had a common origin, 4d (Lyons et al., 2012). We found that many of the genes exam- being separated into distinct domains (e.g., anterior vs. poste- ined in this study were expressed in the hindgut endoderm, rior, or ventral vs. dorsal), which subsequently underwent including: ctnnb, bra, cdx, foxA, gsc, hex, notch2, otp, and otx changes during the course of evolution. Depending on the spe- (Tables 1 and 2). While most of these genes were expressed at all cies, ectomesoderm can arise from different combinations of stages examined, some were expressed relatively late (hex at DEVELOPMENTAL DYNAMICS cells from any of the four quadrants (Lyons and Henry, 2014), 120 hpf, elongating, short oval stage; notch2 at 170 hpf, early and 4d has been described as an ectomesodermal cell in the organogenesis), while others are turned off by 140 hpf (elongat- annelid, Capitella (Meyer et al., 2010a, b). Distinguishing ing, late oval stage; six3/6, otp). between these scenarios will require building GRNs and addi- Hindgut development in some bilaterian members is often tional lineage data and lineage-specific expression of characterized by the expression of conserved genes, which “endomesodermal” genes in a wider range of spiralians. include bra, cdx, otp, foxA, and nk2.1 (Hejnol and Martindale, 2008; Table 2). Many metazoans display conserved hindgut Differences in Ecto- Versus Endomesodermal expression for bra (Kispert et al., 1994; Tagawa et al., 1998; Sho- guchi et al., 1999, Woollard and Hodgkin, 2000; Arendt et al., Expression May Be Tied to Morphogenetic Behaviors 2001; Croce et al., 2001; Arenas-Mena, 2013). However, unlike C. The differences in ecto- and endomesodermal expression may fornicata, hindgut expression of bra was not observed for the reflect different behaviors of these two derivatives of mesoderm. molluscs Patella or Haliotis (Lartillot et al., 2002b; Koop et al., For example snail2 and twist may be necessary for the EMT that 2007). C. fornicata hindgut expression for cdx (Brooke et al., we recently described as a key behavior of the ectomesodermal 1998; Wu and Lengyel, 1998; Edgar et al., 2001; Le Gouar et al., cells that express these genes (Lyons et al., 2015). snail and twist 2003; de Rosa et al., 2005; Shimizu et al., 2005; Frobius€ and Sea- are necessary for EMT in the sea urchin primary mesenchyme ver, 2006; Arnone et al., 2006), foxA (but not in nematodes or cells (Wu and McClay, 2007; Saunders and McClay, 2014), fly hemichordates; Weigel et al. 1989; Arenas-Mena, 2006; Oliveri mesoderm (Nieto, 2002), and vertebrate neural crest (Carl et al., et al., 2006; Boyle and Seaver, 2008, 2010) and nk2.1 (Venkatesh 1999; Hall 2000). We note that in C. fornicata, the 4d-derived et al., 1999; Takacs et al., 2002; Lowe et al., 2003; Tessmar- mesoderm does not undergo EMT, but is born internally (Lyons Raible, 2007) were also conserved compared to other metazoans. 1238 PERRY ET AL.

TABLE 2. Summarized Comparison of Published Gene Expression Data Among Various Members of the Spiralia and an Echinoderm (Sea Urchin)a

aEach organism is noted along the left side of each column and the mode of gastrulation is listed below the organism’s name. Tis-

DEVELOPMENTAL DYNAMICS sues examined are listed along the left side of each column and gene names are noted along the top of each column. Information in the table was obtained from references cited: Patella (Lartillot et al., 2002a,b; Nederbragt et al., 2002a; Lespinet et al., 2002; Nederbragt et al., 2002b; Le Gouar et al., 2003); Saccostrea (Kin et al., 2009); Haliotis (Degnan and Morse, 1993; Koop et al., 2007); Platynereis (Arendt et al., 2001; de Rosa et al, 2005; Steinmetz et al., 2007; Tessmar-Raible et al., 2007; Kerner et al., 2009; Steinmetz et al., 2010; Christodolou et al., 2010; Steinmetz et al., 2011; Pfeifer et al., 2013; Pfeifer et al., 2014; Gazave et al., 2014; Marlow et al., 2014); Capitella (Frobius€ and Seaver, 2006; Dill et al., 2007; Boyle and Seaver, 2008; Thamm and Seaver, 2008; Christodolou et al., 2010; Boyle et al., 2014); Hydroides (Arenas-Mena, 2006; Arenas- Mena and Wong, 2007; Arenas-Mena, 2013); Chaetopterus (Boyle and Seaver, 2010); Helobdella (Soto et al., 1997; Goldstein et al., 2001; Song et al., 2004; Rivera et al., 2005); Themiste (Boyle and Seaver, 2010); Tubifex (Matsuo et al., 2005; Kitakoshi and Shimizu, 2010); Sea urchin (Di Bernardo et al., 1999; Angerer et al., 2001; Croce et al., 2001; Minokawa et al., 2004; Oliveri et al., 2006; Walton et al., 2006; Dunn et al., 2007; Wu and McClay, 2007; Wu et al., 2008; Wei et al., 2009; Cole et al., 2009).

In contrast to other bilaterians, gsc, hex and hesA are expressed The localization of otp to C. fornicata hindgut tissues was also in hindgut tissues in C. fornicata (Figs. 7–15; Table 1). This was somewhat surprising since this gene is often associated with CNS surprising, as previous studies highlight the importance of gsc in or brain development (Simeone et al., 1994; Umesono et al., 1997; foregut tissues of arthropods (Drosophila, Goriely et al., 1996), Acampora et al., 2000). However, in Patella, otp is also expressed annelids (Platynereis, Arendt et al., 2001), molluscs (Patella, Lar- in the stomodaeum, as we noted here for C. fornicata (Arendt et al., tillot et al., 2002a), and sea urchins (Angerer et al., 2001). Like- 2001; Nederbragt et al., 2002a; Steinmetz et al., 2011). Other stud- wise, hex expression has been noted in the pharyngeal isthmus of ies, including one in the spiralian nemertean C. lacteus,revealan C. elegans (Morck€ et al., 2004). ancestral role for ctnnb in the establishment of endodermal and/or REGULATORY FACTORS IN THE MOLLUSC Crepidula 1239

endomesodermal fates (Schneider et al., 1996; Rocheleau et al., (Boyle et al., 2014). Likewise, blastopore expression was also 1997; Thorpe et al., 1997: Logan et al., 1999; Imai et al., 2000; noted for FoxA1 and FoxA2 in Hydroides (Arenas-Mena, 2006), Miyawaki et al., 2003; Wikramanayake et al., 2003; Lee et al., and Patella (Lartillot et al., 2002b). Despite labeling of the entire 2007: Momose et al. 2008; Henry et al., 2008). During earlier cleav- blastopore, enhanced posterior blastopore signal was noted for age stages, C. fornicata GFP-labeled ctnnb mRNA becomes both C. fornicata bra and cdx. Posterior localization of bra is con- restricted to the 4d endomesodermal lineage (Henry et al., 2008), sistent with that observed during blastopore formation in other which ultimately gives rise to the hindgut. However, the localiza- molluscs, including Haliotis (Koop et al., 2007), Patella (Lartillot tion of ctnnb to endomesodermal derivatives in other spiralians has et al., 2002a), and annelids, Capitella (Boyle et al., 2014; also not been well characterized to make a sufficient comparison. seen in left-lateral blastopore) and Hydroides (expression noted It seems somewhat surprising that we did not observe appreci- in left and right sides flanking posterior region of blastopore; able expression of endodermal genes in the macromeres and Arenas-Mena, 2013). Posterior expression of C. fornicata cdx has fourth quartet micromeres during gastrulation in Crepidula.On also been observed in the mollusc Patella (Le Gouar et al., 2003), the other hand, with the exception of hex, notch2, otp, and otx, and the annelids Capitella (Frobius€ and Seaver, 2006) and Platy- message was detected in those cells during cleavage stages, where nereis (de Rosa et al., 2005), but is not detected in early stages of they were generally found to be localized to regions we interpret gastrulation for the mollusc, Gibbula varia (Samadi and Steiner, to be the centrosomes (see Figs. 5–16). Some of these transcripts 2010). In contrast, otp expression in the blastopore was not may become dispersed during gastrula stages. The large, yolky observed in Patella (Nederbragt et al., 2002a). cells could have also hindered visualization of those transcripts. ctnnb and gsc were also expressed along the posterior blasto- In addition, these cells become covered by ectoderm derived from pore during early epiboly in C. fornicata. In contrast, ctnnb is the animal cap during gastrulation, which also could have expressed in many cells of the developing Platynereis embryo, obscured their visualization. Alternatively, it is possible that tran- where varying levels of expression determine animal versus vege- scripts may have been translated, and/or the RNAs degraded in tal fates during embryonic development (i.e., Schneider and those cells. Therefore, some of these genes may play a more gen- Bowerman, 2007; Pruitt et al., 2014). gsc is not observed around eral role in endodermal development, while others could be more the blastopore for Capitella (Boyle et al., 2014), but is observed in 2 2 specific to the hindgut. the 3a and 3b derived cells of the anterior blastopore and several cells along the posterior vegetal plate in Patella (Lartillot The Blastopore and Openings of the Digestive Tract et al., 2002b). Anterior blastopore lip expression was noted for hex during early epiboly in C. fornicata, similar to that of The evolution of the bilaterian gut is still debated (e.g. Martindale amphioxus (Yu et al., 2007). and Hejnol, 2009; Martın-Duran et al., 2012; Lyons and Henry, When the blastopore begins to constrict further during later 2014). One question relates to the origin of the mouth and anus stages in C. fornicata (late epiboly through elongating stages, 97– in the Deuterostomia, Ecdysozoa, and Spiralia, relative to the 140 hpf), expression patterns changed slightly, but a majority of blind gut of early-branching animals, like cnidarians, cteno- the genes display some expression in progeny associated with the phores, and acoels. Some authors argue that the mouth evolved blastopore lip. The following genes were observed around the first and is homologous among all bilaterians (Arendt et al., entire periphery of the blastopore lip: ctnnb, otx, foxA, goosecoid, 2001; Christiaen et al., 2007; Hejnol and Martindale, 2008), while otp, six3/6, and notch2. The posterior region of the blastopore the anus evolved later and independently in different animal lin- showed bra expression, which is similar to that noted in Haliotis eages (Hejnol and Martın-Duran, 2015). In contrast, another (Koop et al., 2007) and Patella (Lartillot et al., 2002a), and to the hypothesis argues that the mouth and anus evolved at the same dorsal/aboral (posterior) region in Hydroides (Arenas-Mena, time through the process of amphistomy (Arendt and Nubler-€ 2013). cdx was observed only in the lateral regions of the blasto- Jung, 1997). These, and other hypotheses rely on comparative pore in C. fornicata, which differs from the posterior blastopore DEVELOPMENTAL DYNAMICS gene expression analyses during the development and formation expression noted in another mollusc, Patella (Le Gouar et al., of these structures. 2003), but is consistent with the lateral regionalization of cdx fol- In the Spiralia, the fate of the blastopore varies widely. lowing blastopore closure in the annelid, Capitella (Frobius€ and Depending on the species, cells of the blastopore lip can give rise Seaver, 2006). Additionally, cdx was localized to a U-shaped to the mouth (protostomy), the anus (deuterosomy), both mouth area, which extended around the posterior and lateral regions of and anus (amphistomy), or to neither (the blastopore may close the blastopore for Platynereis (de Rosa et al., 2005). nk2.1 and completely). Previous spiralian data focused on two species: the hex were observed in the anterior region of the blastopore in C. limpet mollusc Patella, and the polychaete annelid, Platynereis fornicata, which includes ectomesodermal progenitors. Likewise, (Table 2). More recently, additional expression data have been nk2.1 was expressed in regions flanking the blastopore for Capi- reported in two additional polychaetes, Hydroides and Capitella, tella (Boyle et al., 2014). as well as expression data for a few genes from other annelids These data reveal that considerable variation exists between and molluscs (Table 2). In Crepidula the blastopore gives rise to spiralians in how genes are expressed in cells around the blasto- the opening of the mouth (protostomy, Lyons et al., 2015). Here, pore, and later during development in the mouth and anus. Many our study constitutes the most thorough examination of germ genes are expressed in part or all of the blastopore lip, while very layer markers among molluscs. few are exclusively expressed in the mouth, hindgut, or anus in During early epiboly to flattened round stages (50–65% epib- spiralians. The specification of these structures likely involves oly, 48–91 hpf), otx, foxA, bra, cdx, and otp, were expressed in other genes we have yet to examine. Unfortunately, in most spe- cells of the blastopore lip in C. fornicata (Figs. 1, 3–6, 10; Tables cies the behavior of the cells of the blastopore lip is not fully 1 and 2). otx was also observed around the entire blastopore understood, nor is it understood how those cells contribute to the periphery for Patella (Nedebragt et al., 2002a) and Capitella mouth, hindgut and anus. These data will be necessary before 1240 PERRY ET AL.

definitive arguments about the consecutive, or simultaneous, ble et al., 2007). However, otp is observed in hindgut tissues of evolution of the mouth and anus can be made. Drosophila melanogaster (Simeone et al., 1994) and posterior ectoderm of hemichordates (Lowe et al., 2003). The Posterior Blastopore Lip Cells that are likely homologous to the two terminal cells of C. fornicata express bra and cdx in the mollusc Patella (Lartillot et al., In spiralians the cells that contribute to the mouth and anus are 2002a; Le Gouar et al., 2003; see Lyons et al., 2015). Faint labeling initially located close to one another during early development, of bra was also observed in Haliotis in a posterior region judged to but those cells become separated by various morphogenetic be the site of the anal cells (likely the terminal cells), although this events that are not well understood in most species (Lyons et al., was not linked to discrete cells of known lineage origins (Koop 2015). Our recent cell lineage analysis of gastrulation stages in C. et al., 2007). It is important to note that bra expression is not con- fornicata revealed that the mouth and esophagus are made by fined to terminal cells in these species. Whether or not bra plays a sublineages of each of the second and third quartet micromeres role in the development of terminal cells is unclear; however, bra (except the 2d lineage), which make up the blastopore lip at early expression may be involved in convergent extension and closure of epiboly stages (Lyons et al. 2015). As the blastopore constricts, the posterior lip of the blastopore in those species where these clones of micromeres on the anterior and lateral sides largely events likely take place. Others have proposed that bra plays a role retain their relative positions along the anterior-posterior axis. in regulating morphogenetic processes associated with convergent Cell re-arrangement largely involves some progeny becoming extension in vertebrates and other bilaterians (Hardin, 1989; displaced deeper into the blastopore, contributing to the esopha- Yamada, 1994; Conlon and Smith, 1999; Arendt, 2004). For exam- gus, while the rest of the clone stays at the surface, contributing ple, although bra is expressed in endodermal cells during gastrula- to the anterior and lateral sides of the mouth (Fig. 1). In contrast, tion in the annelid Hydroides, it is also expressed in ectodermal we have shown that the posterior lip of the blastopore undergoes tissue that eventually merges along the ventral midline in Hydro- closure via a novel zippering process (Lyons et al., 2015). Zipper- ides, thereby contributing to elongation and displacement of the ing is a unique example of convergence and extension, which mouth from the anus (Arenas-Mena, 2013). Likewise bra is gives rise to an elongated assemblage of eight ciliated cells that expressed in ventral cells that undergo convergent extension in the extend from the esophagus, anteriorly, towards the posterior end annelid Platynereis (Steinmetz et al., 2007). of the embryo. As closure of the posterior blastopore lip takes place, these cili- Expression of Genes in the Digestive Tract (Mouth and ated cells displace progeny of 2d (more specifically 2d2) away from the blastopore lip towards the posterior end of the embryo. Esophagus) Progeny of 2d ultimately form the anus later in development. Many of the genes examined in this study are localized to both Two cells of the posterior blastopore lip, which were located clos- the C. fornicata pre-larval/larval mouth and the esophagus (fore- est to the ventral midline prior to zippering (3c221,3d221), are dis- gut), including ctnnb, otx, foxA, bra, cdx, gsc, nk2.1, otp, six3/6, placed farther towards the posterior pole and become isolated twist, and notch2 (Tables 1 and 2). Table 2 reveals that all of the within the clone of cells derived from 2d. Earlier investigators genes expressed in the mouth are expressed earlier in the blasto- confused these cells with those that make the anus, referring to pore. We found that nk2.1, otp, and six3/6 mark the mouth, and them as “anal cells” (e.g., Conklin, 1897). These cells do not give not the endodermal hindgut (Table 2). nk2.1 was found to be rise to the anus in Crepidula, which forms much later in develop- expressed in the anterior blastopore lip (Fig. 9E, G), while otp and ment from progeny of 2d2 (Lyons et al., 2015). Hence, we six3/6 were expressed in the posterior blastopore lip, and the pos- renamed the former anal cells as “terminal cells.” Previous inter- terior ectodermal ventral midline (Figs. 10G, H, 11E, H), before pretations of gene expression in these cells (as being in the anus being restricted to the mouth (Figs. 10J, 11J). Only otp was also in other spiralians) must be regarded with caution. Similar events found in the 2d lineages, which gives rise to the anus, though we DEVELOPMENTAL DYNAMICS leading to closure of the posterior lip of the blastopore likely did not examine embryos old enough to score otp in the anus occur in the annelids Polygordius and Platynereis, and the mol- itself. These data suggest that the morphogenetic events that zip- luscs Ilyanassa and Patella (Woltereck, 1904; Arendt et al., 2001; per closed the posterior blastopore lip, and separate the mouth Lartillot et al., 2002a, Chan and Lambert, 2014; Lyons et al., territory from the posterior end of the embryo, involve changes 2015), though they have not been formally described. in expression of regulatory factors that could be necessary for Just two cells from each of the 3c2 and 3d2 lineages remain at proper mouth formation. Functional analyses of these genes will the opening of the blastopore to give rise to the posterior-most be necessary to test this hypothesis. portion of the esophagus and mouth. The analysis reported here A comparison of gene expression in the mouth among spiralians shows that several genes are expressed in the progeny of 3c2 and (Table 2), and other bilaterians, reveals interesting similarities and 3d2 during closure of the posterior blastopore lip, including: differences. C. fornicata ctnnb expression is comparable to that ctnnb, otx, foxA, bra, cdx, gsc, otp, six3/6, notch2, hes (Figs. 1– observed in the ectoderm around the stomodaeum of the mollusc, 16; Table 1). This also includes the terminal cells (bra, Fig. 5M–O, Haliotis (Koop et al., 2007). Likewise, bra is also observed in the Q–S, V; cdx, Figure 6K, L, O, P). Following gastrulation during foregut of annelids (Arendt et al, 2001; Boyle et al., 2014), molluscs later development, bra and cdx continue to be expressed in these (Lartillot et al., 2002a; Koop et al, 2007), echinoderms (Shoguchi cells along the ventral midline, with nkx2.1 also being expressed et al., 1999; Croce et al., 2001) and hemichordates (Tagawa et al., in the terminal cells (Fig. 9G–K, M–O). Earlier localization of otp 1998). However, some localization of C. fornicata cdx in foregut to terminal cells in C. fornicata contradicts with many studies tissue contrasts with more highly conserved hindgut expression that usually associate this gene with anterior fates such as the across the Metazoa, though cdx is also expressed in the hindgut of apical organ in Patella (Nederbragt et al., 2002a) and the brain in C. fornicata (Brooke et al., 1998; Wu and Lengyel, 1998; Hinman the planarian (Umesono et al., 1997), and annelids (Tessmar-Rai- et al., 2000; Edgar et al., 2001; Le Gouar et al., 2003; de Rosa et al., REGULATORY FACTORS IN THE MOLLUSC Crepidula 1241

2005; Frobius€ and Seaver, 2005; Shimizu et al., 2005; Arnone the ectoderm (derived from 2d, 3c, and 3d) is quite reduced. At et al., 2006). Foregut expression for foxA, gsc and nk2.1 appears to later stages, we were only able to see expression of otx in the 2d be largely conserved when compared to other spiralians and bilat- clone where the anus will eventually form (Fig. 3I–K, M–O). Thus, erians (Table 2). otp expression in C. fornicata foregut tissues dif- while the ectodermal and endodermal components of the terminal fers from conserved patterns, where it is usually associated with portion of the digestive tract initially express many of the same brain and sensory cells among arthropods (Simeone et al., 1994), genes, it is likely that the ectodermal lineages that make the anus annelids (Tessmar-Raible et al., 2007), molluscs (Nederbragt et al., and other nearby ectodermal cells (e.g., TCs), express only a sub- 2002a) and platyhelminthes (Umesono et al., 1997); but anterior set of these genes. neural expression is also seen in C. fornicata, as well (Fig. 10G, H, While the bilaterian mouth has been argued to be homologous J). Like C. fornicata, ectoderm around the stomodaeum is similarly (Arendt et al., 2001; Hejnol and Martindale, 2008), the anus may noted for otx expression in Patella (Nederbragt et al., 2002a) and have evolved independently on multiple occasions (Hejnol and Platynereis (Arendt et al., 2001; Steinmetz et al., 2011). Expression Martindale, 2008; Hejnol and Martın-Duran, 2015). Hejnol and of six3/6 is commonly associated with chordate mouth formation Martindale (2008) argued that when an anus evolves it might co- (Christiaen et al., 2007), and is similarly observed in the mouth and opt components of the endodermal hindgut GRN. In fact, most of esophagus of C. fornicata. twist is associated with foregut specifi- the genes that are reported to be expressed in the anus in spirali- cation in Capitella (Dill et al., 2007), which is similar to the mouth ans are also expressed in the hindgut. The ability to compare and esophagus expression observed in C. fornicata. Expression of gene expression in the context of homologous cell lineages snail2 is associated with the pre-larval mouth and not the esopha- makes the spiralians particularly useful. For example, lineage gus of C. fornicata. Snail2 is present in the foregut epithelium in tracing in C. fornicata revealed that the ectodermal anus arises Capitella (Dill et al., 2007), but not in the mollusc Patella (Neder- from 2d2.InCapitella both anus and hindgut arise from the 4d bragt et al., 2002b). hesA and hex are localized to the C. fornicata lineage as a common ectodermal structure, and so it may not be esophagus. hes is involved with oral ectoderm specification in the surprising that many of the genes expressed in the anus are also sea urchin (Minokawa et al., 2004), in the planarian stomodaeum expressed in the hindgut (Meyer et al., 2010b). (Gazave al., 2014), but not in the leech, Helobdella, where it is in the posterior addition zone (Song et al., 2004). hex expression is Conclusion found in the prospective dorsal endoderm (foregut) of the hemichordate S. kowalevskii (Lowe et al., 2006). This study lays the groundwork for building GRNs during the Overall, these data suggest that comparing mouth development process of germ layer specification in C. fornicata. If we are to between different spiralians may be a fruitful area of future tease apart how the gene regulatory networks controlling mouth research, as the relationship of the blastopore and the mouth, and and anus formation evolved, we must understand how gastrula- the patterns of gene expression in these domains vary between tion takes place and how specific cell lineages contribute to these species. If the bilaterian mouth is indeed homologous, then the var- structures. While some regard regulatory factors as “markers” for iation seen can be used to understand what aspects of mouth for- cell fate specification, they also play roles in controlling morpho- mation are labile during evolution, and which are resistant to genetic events. Given that spiralians exhibit a wide range of gas- change. These differences could be tied to variations in the process trulation modes (Table 2; Lyons and Henry, 2014; Arenas-Mena, of gastrulation (Table 2), or in the clonal contributions to the cells 2013), they present an opportunity to assess the role of specifica- of the mouth and foregut. For instance, some of the genes exam- tion versus cell behavior in the evolution of gastrulation, germ ined were expressed in the entire circumference of the mouth (e.g., layer formation (e.g. mesoderm) and gut development. bra, cdx; Figs. 5 and 6), while others were more restricted to the anterior (six3/6, hesA; Figs. 11 and 15), or lateral (hex; Fig. 8) sides. Experimental Procedures These different expression domains appear to correlate with clonal DEVELOPMENTAL DYNAMICS lineages, and may reflect differences in cellular structure or func- Animal Care and Handling tion that should be examined in future studies. Adult C. fornicata were harvested from local waters near Woods Hole, MA, by the Marine Resources Center at the Marine Biologi- Conserved Expression of Genes in the Digestive Tract cal Laboratory. Embryos were collected and reared, as previously (Anus) described (Henry et al., 2006, 2010a, 2010b; Lyons et al., 2012, 2015). Lineage tracing in C. fornicata has demonstrated that the endodermal hindgut arises from several daughter cells of the Fixation and Histology 4d lineage (Lyons et al., 2012), while the ectodermal anus is derived from the 2d2 lineage (Lyons et al., 2015). At 12 days Embryos and larvae were fixed for one hour at room temperature post fertilization, the opening of the anus forms as it fuses in a 3.7% solution of ultrapure formaldehyde (Ted Pella, Inc., with the endodermal hindgut. The current gene expression Redding, CA) dissolved in filtered sea water (FSW), with added analysis stops before the definitive anus forms. While we did Instant Ocean Aquarium Sea Salt Mixture (United Pet Group, not score for expression in the anus itself, we were able to Blacksburg, VA), as previously described (Lyons et al., 2015). Fol- score for expression in the hindgut rudiment, terminal cells, lowing fixation, embryos were rinsed with three sterile 1X PBS and the posterior 2d clone, which eventually forms the anus in washes (1XPBS:1.86mM NaH2PO4, 8.41mM Na2HPO4, 175mN Crepidula. NaCl, pH 7.4), followed by three washes in 100% methanol. Many of the genes expressed in hindgut endoderm were also Embryos were stored in 100% methanol at -80degC. Following in expressed in the overlying 2d clone during late epiboly and early situ hybridization (see below), embryos were incubated in a solu- elongation stages, but at later stages, ventral midline staining in tion of 0.5 mg/ml DAPI (Life Technologies, Grand Island, NY) 1242 PERRY ET AL.

TABLE 3. List of Primers Used to Prepare ISH Probesa

Probe Accession Gene Forward primer Reverse primer length HM040900 ctnnb CGATAGATGAGCAGTTATCAGATG GGTCTGTGTCAAACCATATG 1913bp HM040889 bra GAGAGAAAGTGGACCCTGATGCCCAG GAGCCCTCTGCCCTGTCCGTC 650bp KM434315 cdx CAGCCATGGAGACAGCCCAGTAC GGAACTCCTTCTCCAGCTCCAGTC 582bp KM434317 foxA CTATGTCCTCCATGGGGTCCATGG GAGTCGCCTGCACATCATGAGG 978bp HM046939 gsc GAGATGGTCCGTAGCGGTCTG CTTGAACCAGACCTCGACTCTC 290bp KP902717 hesA CCGACAAGTACAGGCTTGGCTTC outer CTGACTTCACTAGACTTGGCCTC:outer 966bp GGCTTGGCTTCAATGAGTGCGCC:nest GACTTGGCCTCACTCGTCACTGT: nest KP902718 hesB CGAGAATCAACAGCTGTCTGTCG outer CAAGGGGCTGTAGACGGACGAAT outer 926bp GCTGTCTGTCGCAGCTCAAGTCC:nest GACGGACGAATCAAACGACATTT:nest KP885704 hex GCTGTCGTCGTCAGGCATGTTTAAAC CAGAGTCCGGTATGATGTCGTCGTC 566bp KM434318 nk2.1 CATGTCCCTCAGTCCCAAACAC GTCTGGGGAATCCTTGGTGTCC 732bp KM434321 notch2 GAGGAACTCATCACGGCTGAG GACCCCACATCCCCGAGCC 1200bp KM434316 otp GGTCTGGAGATGGACGAGG CTATTTGACCGCTGCTGC 330bp KM434320 otx CACTAACACCACCACGGGAAGC CTCAAAGGCTCTGGAACTCATTCATC 740bp KP885705 six3/6 GAAAGCGGGGACATTGAGCGTC CTCTCTGGCGCCGGTTCTTG 515bp KP885706 snail2 CCCTCCACATCGTCCACACC TACCTCACCGGCTCGTGCTC 1500bp HM040896 twist ATGGTGCTGGAGCGGCAGACA CACTGGCCGGCCATGGAGCC 877bp

aThe NCBI accession number is presented along the far left column for each of the clones examined in this study. Gene-speciﬁc forward and reverse primers used to isolate each C. fornicata clone are listed next in 50-to30- orientation. For each clone used for ISH, the DIG-labeled probe length is listed in the far right column.

dissolved in 1X PBS. DAPI incubation lasted for 10 min in the assembly, contigs less than 200 bp in length were removed from dark, followed by 3 washes in 1X PBS/0.1% Tween. Specimens our dataset. Assessments of the quality of read data were per- were stored at 4degC in 80% glycerin/20% 1X PBS until imaged formed using FastQC (available at: http://www.bioinformatics. (see below). bbsrc.ac.uk/projects/fastqc/) and the statistics on the final trimmed assembly are as follows: Trinity transcript reads (con- cDNA Library Preparation and Analysis tigs) ¼ 326,118, mean read (contig) length ¼ 564 bp, N50 read (contig) length ¼ 717 bp; minimum read (contig) length: 201; Three different C. fornicata EST databases were used to identify maximum read (contig) length: 28,997; median read (contig) and clone various genes known to be involved in germ layer length: 350; number of reads (contigs) >¼1kb: 37,979; number specification, gastrulation and development of the digestive tract of bases in all reads (contigs): 183,902,140. (Lengyel and Iwaki, 2002; Technau and Scholz, 2003; Heath, Finally, a third set of EST libraries was prepared in the lab of 2010; Hejnol and Martın-Duran, 2015). All the developmental Dr. Joel Smith (Marine Biological Laboratory, Woods Hole, MA). material used to prepare these libraries came from animals col- A total of 24 Illumina RNAseq libraries from various embryonic DEVELOPMENTAL DYNAMICS lected at the Marine Biological Laboratory in Woods Hole, MA. stages were prepared and the sequence data was pooled prior to These include a previously published C. fornicata 454 EST library assembly. The 18 libraries were collected from a single brood at prepared by Henry et al. (2010a), and two new libraries described consecutive time points: 147 to 223 embryos were collected in below. Trizol approximately every 90 min starting at 11.5 hpf (hours A second EST library was prepared in the lab of Dr. Cristina post fertilization; approximately 4 to 8-cell stage) to 40 hpf Grande (Centro de Biologıa Molecular Severo-Ochoa, UAM-CSIC, (cleavage stages, pre 4th quartet). The 6 remaining libraries were Madrid, Spain). The RNA used to prepare this library was collected from a different brood at 22 hpf after treatment with obtained from early cleavage stage embryos up through advanced either U0126 (a MAPK inhibitor) or DMSO at the 4-cell stage. veliger larval stages (two to four weeks of age, but prior to hatch- These samples contained 115 to 139 embryos each. Total RNA ing). These embryos and larvae were collected and stored in RNA extraction from Trizol and Ribo-Zero low input (Illumina) was later at -80degC. Total RNA was prepared using Trizol following performed as recommended by the manufacturer’s instructions. the manufacturer’s instructions (Life Technologies). The embryos The RNA quality before and after the removal of ribosomal RNAs and larvae were homogenized using sterile plastic pestles. To pre- was assessed on a Bioanalyzer using RNA pico chips (Agilent pare the cDNA, approximately 3 mg of extracted RNA was com- Technologies, Santa Clara, CAA). The RNAseq libraries were con- bined from each stage collected. The RNAseq library was structed using ScriptSeq (Illumina), with a 60-sec fragmentation constructed using TruSeq RNA Sample Prep Kit v2 (Illumina, San time, and otherwise following the manufacturer’s instructions. Diego, CAA) following the manufacturer’s instructions. The RNA- ERCC control RNA (available from Invitrogen/Life Technologies) seq library was quantified using the Qubit HS DNA Assay and was added before library preparation. The libraries were size sequenced in 3 HiSeq 2000 PE100 lanes (Illumina). Assembly was selected with a 2% Pippin prep gel (Sage Science, Beverly, MAA) done with Trinity assembler software (Grabherr et al. 2011). After for 350–600 bp. The quality of the libraries before and after the REGULATORY FACTORS IN THE MOLLUSC Crepidula 1243

size selection was assessed on a Bioanalyzer using DNA high sen- of Illinois’ Carver Biotechnology Center (Urbana, IL) and sequen- sitivity chips (Agilent). Bi-directional sequencing was done using ces assembled using Sequencher software (Gene Codes Corp., the Illumina HighSeq 1000 platform, and the assembly of this Ann Arbor, MI). combined library was done with Trinity assembler software (Grabherr et al. 2011): Trinity transcript reads (contigs) ¼ Gene Expression Analyses 285,503, mean read (contig) length ¼ 712 bp, N50 read (contig) Gene specific DIG-labeled probes ranged from 290 nt to 1.2 kb in length ¼ 1145 bp; minimum read (contig) length: 201; maximum read (contig) length: 30,863; median read (contig) length: 389; length, depending on available sequence data (see Table 3). Line- arized template DNA (amplified from plasmid DNA with T7/SP6 number of reads (contigs) >¼1kb: 71,337; number of bases in all reads (contigs): 203,168,019. primers) was used to synthesize RNA probes with either T7 or SP6 RNA polymerase (Life Technologies) and DIG-labeling mix (Roche, Indianapolis, IN). Reactions were purified with RNeasy Sequence Analysis MinElute Cleanup kit (Qiagen, Valencia, CA) and probe concen- Assembled consensus sequence files from each EST database trations were verified on a NanoDrop ND-1000 Spectrophotome- were uploaded to the software program Geneious (Auckland, New ter. The in situ hybridization protocol was modified from Zealand). Using publicly available invertebrate homologous pro- Finnerty et al. (2003) and is similar to that described by Henry tein sequences from NCBI or UniProtKB, tBlastn alignments et al. (2010b), but with the following modifications. The protein- against each C. fornicata EST database were performed individu- ase K digestion was eliminated and following rehydration in PTw ally for each of the genes of interest in the Geneious program. (1X PBS, 0.5% Tween 20), embryos were washed in two acetic Any C. fornicata EST that aligned with a gene of interest was anhydride washes. Hybridizations were conducted overnight at then submitted to BlastX (NCBI) to verify the identity of the EST. 61degC with a probe concentration of 1 ng/ml followed by grad- Each identified C. fornicata nucleotide sequence was also used as uated washes into 2X SSC at 61degC, 0.2X SSC at 61degC, and a query sequence for additional Blastn alignments in Geneious finally PTw at room temperature. The alkaline phosphatase (AP) against the C. fornicata ESTs to further extend the nucleotide buffer was modified slightly to eliminate salt precipitation (5 mM sequence in the 50-or30-direction. Extended sequence informa- MgCl2, 100 mM NaCl, 100 mM Tris pH 9.5, 0.5% Tween 20) and tion was compiled and assembled using Sequencher software NBT/BCIP was used for probe visualization, by incubation at (Gene Codes Corporation, Ann Arbor, MI) and consensus sequen- room temperature in the dark. Following in situ hybridization, ces verified again for identity against the NCBI database using specimens were incubated in Hoecsht 33342 (Life Technologies, BlastX. Only one discrete version of each gene was found in the 1:10,000 dilution in PTw) for 10 min at room temperature for vis- EST datasets, with the exception of notch (three copies), twist ualization of nuclei, followed by three washes in 1X PBS. (two copies), and hes (two copies). Phylogenetic analysis was conducted for snail2, hesA and hesB sequences (data not shown). Microscopy snail2 was analyzed and confirmed to be orthologous to the ver- Fixed embryos processed for in situ hybridization, were mounted tebrate Snail2, which is reflected in the naming scheme, even on Rain-X-coated (ITW Global Brands, Houston, TX) glass slides though snail1 has not been identified in the available C. fornicata in 80% glycerol/20% 1X PBS. Coverslips were prepared as EST collections. hesA and hesB grouped within the vertebrate described in Lyons et al. (2015). Specimens were visualized on a Hes1, 2 and 4 branches, but neither could be definitively Zeiss Axioplan microscope (Carl Zeiss Inc., Munich, Germany) grouped. Therefore, we chose to name these C. fornicata genes and a Spot Flex camera (Spot Imaging Solutions, Sterling hesA and hesB, as to avoid confusion in terms of orthology. Heights, Michigan) was used for imaging. Multifocal stacks of brightfield images were combined and flattened using Helicon Cloning DEVELOPMENTAL DYNAMICS Focus stacking software (Helicon Soft Ltd., Kharkov, Ukraine). Using specimens stored in RNAlater (Life Technologies), C. fornicata RNA was isolated from both gastrulating embryos and pre- Acknowledgments veliger larvae. High quality total RNA was extracted using TriZol, The authors thank the Marine Biological Laboratory and especially and purification methods followed the manufacturer’s suggested the directors of the Embryology course, Drs. Richard Behringer and protocol. The purity and concentration of total RNA was verified Alejandro Sanchez Alvarado for supporting this research. We with a NanoDrop ND-1000 Spectrophotometer (Thermo Scien- thank Dr. Joel Smith for his support in the preparation of one of tific, Wilmington, DE) and approximately 1mg of total RNA from the C. fornicata EST databases. We also thank Dr. Nathan Kenny each developmental stage (epiboly and pre-veliger stages) was (School of Life Sciences, Chinese University of Hong Kong, Shatin used to synthesize cDNA (iScript cDNA Synthesis kit, Bio-Rad, Hong Kong) for his contribution in preparing the data used from Hercules, CA). the C. fornicata EST library prepared in Spain. DCL thanks Dave Gene-specific primers were designed for each gene of interest McClay for his support. C.G. is currently a “Ramon y Cajal” post- and those can be found in Table 3. Due to the presence of GC- doctoral fellow supported by the Spanish MICINN and the UAM, rich regions, PCR amplification reactions were performed with Q5 and funded by project CGL2011-29916 (MICINN). This research High Fidelity DNA polymerase and Q5 High GC enhancer buffer was supported by NSF grant 1121268 to Dr. J.Q.H. (JJH). (New England Biolabs, Ipswich, MA), according to manufacturer suggested ratios. Amplified PCR products were run on 1% aga- References rose gels, gel purified (GeneClean Turbo kit, MP Biomedicals, Acampora D, Postiglione MP, Avantaggiato V, Di Bonito M, Solon, OH) and cloned into pGem-T Easy vector (Promega, Madi- Simeone A. 2000. The role of Otx and Otp genes in brain devel- son, WI). All clones were verified by sequencing at the University opment. Int J Dev Biol 44:669–677. 1244 PERRY ET AL.

Adams MS, Gammill LS, Bronner-Fraser M. 2008. Discovery of Byrum CA, Martindale MQ. 2004. Gastrulation in the Cnidaria and transcription factors and other candidate regulators of neural Ctenophora. In Stern CA, editor. Gastrulation: from cells to crest development. Dev Dyn 237:1021–1033. embryo. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Angerer LM, Oleksyn DW, Levine AM, Li X, Klein WH, Angerer RC. Press. p 33–50 2001. Sea urchin goosecoid function links fate specification Carl TF, Dufton C, Hanken J, Klymkowsky MW. 1999. Inhibition of along the animal-vegetal and oral-aboral embryonic axes. Devel- neural crest migration in Xenopus using antisense slug RNA. Dev opment 128:4393–4404. Biol 213:101–115. Arenas-Mena C. 2006. Embryonic expression of HeFoxA1 and Chan TM, Longabaugh W, Bolouri H, Chen HL, Tseng WF, Chao HeFoxA2 in an indirectly developing polychaete. Dev Genes Evol CH, Jang TH, Lin YI, Hung SC, Wang HD, Yuh CH. 2009. Devel- 216:727–736. opmental gene regulatory networks in the zebrafish embryo. Bio- Arenas-Mena C. 2013. Brachyury, Tbx2/3 and sall expression dur- chim Biophys Acta 1789:279–298. ing embryogenesis of the indirectly developing polychaete Chan XY, Lambert JD. 2014. Development of blastomere clones in Hydroides elegans. Int J Dev Biol 57:73–83. the Ilyanassa embryo: transformation of the spiralian blastula into Arenas-Mena C, Wong KS. 2007. HeOtx expression in an indirectly the larval body plan. Dev Genes Evol 224:159–174. developing polychaete correlates with gastrulation by invagina- Christiaen L, Jaszczyszyn Y, Kerfant M, Kano S, Thermes V, Joly tion. Dev Genes Evol 217:373-384. JS. 2007. Evolutionary modification of mouth position in deuter- Arendt D. 2004. Comparative aspects of gastrulation. In: Stern C ostomes. Semin Cell Dev Biol 18:502–511. (ed) Gastrulation: from cells to embryo. Cold Spring Harbor, NY: Christodolou F, Raible F, Tomer R, Simakov O, Trachana K, Klaus Cold Spring Harbor Laboratory Press. S, Snyman H, Hannon GJ, Bork P, Arendt D. 2010. Ancient ani- Arendt D, Nubler-Jung€ K. 1997. Dorsal or ventral: similarities in fate mal microRNAs and the evolution of tissue identity. Nature 463: maps and gastrulation patterns in annelids, arthropods and chor- 1084–1088. dates. Mech Dev 61:7–21. Cohen SM, Jurgens€ G. 1990. Mediation of Drosophila head devel- Arendt D, Technau U, Wittbrodt J. 2001. Evolution of the bilaterian opment by gap-like segmentation genes. Nature 346:482–485. larval foregut. Nature 409:81–85. Cole AG, Rizzo F, Martinez P, Fernandez-Serra M, Arnone MI. Arnone MI, Rizzo F, Annunciata R, Cameron RA, Peterson KJ, 2009. Two ParaHox genes, SpLox and SpCdx, interact to parti- Martınez P. 2006. Genetic organization and embryonic expres- tion the posterior endoderm in the formation of a functional gut. sion of ParaHox genes in the sea urchin S. purpuratus: insights Development 136:541–549. into the relationship between clustering and colinearity. Dev Biol Conklin EG. 1897. The embryology of Crepidula. J Morphol 13:1– 300:63–73. 226. Artavanis-Tsakonas S, Rand MD, Lake RJ. 1999. Notch signaling: Conlon FL, Smith JC. 1999. Interference with brachyury function Cell fate control and signal integration in development. Science inhibits convergent extension, causes apoptosis, and reveals 284:770–776. separate requirements in the FGF and activin signaling path- Baek JH, Hatakeyama J, Sakamoto S, Ohtsuka T, Kageyama R. ways. Dev Biol 213:85–100. 2006. Persistent and high levels of Hes1 expression regulate Croce J, Lhomond G, Gache C. 2001. Expression pattern of Bra- boundary formation in the developing central nervous system. chyury in the embryo of the sea urchin Paracentrotus lividus. Dev Development 133:2467–2476. Genes Evol 211:617–619. Baker CV, Bronner-Fraser M. 1997a. The origins of the neural crest. Davidson EH, Erwin DH. 2006. Gene regulatory networks and the Part I: embryonic induction. Mech Dev 69:3–11. evolution of animal body plans. Science 311:796–800. Baker CV, Bronner-Fraser M. 1997b. The origins of the neural crest. Davidson EH, Rast JP, Oliveri P, Ransick A, Calestani C, Yuh CH, Part II: an evolutionary perspective. Mech Dev 69:13–29. Minokawa T, Amore G, Hinman V, Arenas-Mena C, Otim O, Barbera JPM, Clements M, Thomas P, Rodriguez T, Meloy D, Brown CT, Livi CB, Lee PY, Revilla R, Rust AG, Pan Zj, Schilstra Kioussis D, Beddington RSP. 2000. The homeobox gene Hex is MJ, Clarke PJ, Arnone MI, Rowen L, Cameron RA, McClay DR, required in definitive endodermal tissues for normal forebrain, Hood L, Bolouri H. 2002. A genomic regulatory network for liver and thyroid formation. Development 127:2433–2445. development. Science 295:1669–1678. Betancur P, Bronner-Fraser M, Sauka-Spengler T. 2010. Assem- de Celis JF. 2013. Understanding the determinants of notch inter- bling neural crest regulatory circuits into a gene regulatory net- actions with its ligands. Sci Signal 5:pe19. work. Annu Rev Cell Dev Biol 26:581–603. Degnan BM, Morse DE. 1993. Identification of eight homeobox- Bogue CW, Ganea GR, Sturm E, Ianucci R, Jacobs HC. 2000. Hex containing transcripts expressed during larval development and expression suggests a role in the development and function of at metamorphosis in the gastropod mollusc Haliotis rufescens. organs derived from foregut endoderm. Dev Dyn 219:84–89. Mol Mar Biol Biotehnol 2:1–9. DEVELOPMENTAL DYNAMICS Boorman CJ, Shimeld SM. 2002. The evolution of left-right asym- de Rosa R, Prud’homme B, Balavione G. 2005. Caudal and even- metry in chordates. Bioessays 24:1004–1011. skipped in the annelid Platynereis dumerilii and the ancestry of Boyer BC, Henry JQ, Martindale MQ. 1996. Modified Spiral Cleav- posterior growth. Evol Dev 7:574–587. age: The duet cleavage pattern and early blastomere fates in the Di Bernardo M, Castagnetti S, Bellomonte D, Oliveri P, Melfi R, acoel turbellarian Noechildia fusca. Bio Bull 191:285–286. Palla F, Spinelli G. 1999. Spatially restricted expression of PlOtp, Boyle MJ, Seaver EC. 2008. Developmental expression of foxA a Paracentrotus lividus orthopedia-related homeobox gene, is and gata genes during gut formation in the polychaete annelid, correlated with oral ectodermal patterning and skeletal morpho- Capitella sp. I. Evol Dev 10:89–105. genesis in late-cleavage sea urchin embryos. Development 10: Boyle MJ, Seaver EC. 2010. Expression of FoxA and GATA tran- 2171–2179. scription factors correlates with regionalized gut development in Dictus WJ, Damen P. 1997. Cell-lineage and clonal-contribution two lophotrochozoan marine worms: Chaetopterus (Annelida) map of the trochophore larva of Patella vulgata (mollusca). Mech and Themiste lageniformis (Sipuncula). EvoDevo 1:2. Dev 62:213–226. Boyle MJ, Yamaguchi E, Seaver EC. 2014. Molecular conservation Dill KK, Thamm K, Seaver EC. 2007. Characterization of twist and of metazoan gut formation: evidence from expression of endo- snail gene expression during mesoderm and nervous system mesoderm genes in Capitella teleta (Annelida). EvoDevo 5:39. development in the polychaete annelid Capitella sp. I. Dev Brickman JM, Jones CM, Clements M, Smith JC, Beddington RS. Genes Evol 217:435–447. 2000. Hex is a transcriptional repressor that contributes to ante- Dunn CW, Hejnol A, Matus DQ, Pang K, Browne WE, Smith SA, rior identity and suppresses Spemann organiser function. Devel- Seaver E, Rouse GW, Obst M, Edgecombe GD, Sørenson MV, opment 127:2303–2315. Haddock SH, Schmidt-Rhaesa A, Okusu A, Kristensen RM, Brooke NM, Garcia-Fernandez J, Holland PWH. 1998. The ParaHox Wheeler WC, Martindale MQ, Giribet G. 2008. Broad phyoge- gene cluster is an evolutionary sister of the Hox gene cluster. nomic sampling improves resolution of the animal tree of life. Nature 392:920–922. Nature 452:745–749. Burton PM. 2008. Insights from diploblasts; the evolution of meso- Dunn EF, Moy VN, Angerer LM, Angerer RC, Morris RL, Peterson derm and muscle. J Exp Zool B Mol Dev Evol. 310:5–14. KJ. 2007. Molecular paleoecology: using gene regulatory REGULATORY FACTORS IN THE MOLLUSC Crepidula 1245

analysis to address the origins of complex life cycles in the late Hejnol A, Martın-Duran JM. 2015. Getting to the bottom of anal Precambrian. Evol Dev 9:10–24. evolution. Zool Anz 256:61–74. Edgar LG, Carr S, Wang H, Wood WB. 2001. Zygotic expression of Hejnol A, Martindale MQ. 2008. Acoel development indicates the the caudal homolog pal-1 is required for posterior patterning in independent evolution of the bilaterian mouth and anus. Nature Caenorhabditis elegans embryogenesis. Dev Biol 229:71–88. 456:382–386. Finkelstein R, Smouse D, Capaci TM, Spradling AC, Perrimon N. Hejnol A, Martindale MQ, Henry JQ. 2007. High-resolution fate 1990. The orthodenticle gene encodes a novel homeodomain map of the snail Crepidula fornicata: the origins of ciliary bands, protein involved in the development of the Drosophila nervous nervous system, and muscular elements. Dev Biol 305:63–76. system and ocellar visual structures. Genes Dev 4:1516–1527. Hemavathy K, Ashraf SI, Ip YT. 2000. Snail/slug family of repress- Finnerty JR, Paulson D, Burton P, Pank K, Martindale MQ. 2003. ors: slowly going into the fast lane of development and cancer. Early evolution of a homeobox gene: the parahox gene Gsx in Gene 257:1–12. Cnidaria and the Bilateria. Evol Dev 5:331–345. Henry JJ. 2014. Spiralian model systems. Int J Dev Biol 58:389–401. Fischer AH, Arendt D. 2013. Mesoteloblast-like mesodermal stem Henry JJ, Martindale MQ. 1998. Conservation of the spiralian cells in the polychaete annelid Platynereis dumerilii (Nereididae). developmental program: Cell lineage of the nemertean, Cerebra- J Exp Zool B Mol Dev Evol 320B:94–104. tulus lacteus. Dev Biol 201:253–269. Frobius€ AC, Seaver EC. 2006. ParaHox gene expression in the pol- Henry JJ, Martindale MQ. 1999. Conservation and innovation in ychaete annelid Capitella sp. I. Dev Genes Evol 216:81–88. the spiralian developmental program. Hydrobiologia 402:255– Fukuda K, Kikuchi Y. 2005. Endoderm development in vertebrates: 265. fate mapping, induction and regional specification. Dev Growth Henry JJ, Collin R, Perry KJ. 2010a. The Slipper Snail, Crepidula,an Differ 47:343–355. emerging Lophotrochozoan model system. Biol Bull 218:211–229. Gazave E, Guillou A, Balavione G. 2014. History of a prolific family: Henry JJ, Perry KJ, Fukui L, Alvi N. 2010b. Differential Localization the Hes/Hey-related genes of the annelid Platynereis. EvoDevo of mRNAs During Early Development in the Mollusc, Crepidula 5:29. fornicata. Integr Comp Biol 50:720–733. Gheldof A, Berx G. 2013. Cadherins and epithelial-to-mesenchymal Henry JQ, Martindale MQ, Boyer BC. 2000. The unique develop- transition. Prog Mol Biol Transl Sci 116:317–336. mental program of the acoel flatworm, Neochildia fusca. Dev Gilles WJ, Bowerman B, Schneider SQ. 2007. Ectoderm- and Biol 220:285–295. endomesoderm-specific GATA transcription factors in the marine Henry JQ. Perry KJ, Martindale MQ. 2006. Cell specification and annelid Platynereis dumerilli. Evol Dev 9:39–50. the role of the polar lobe in the gastropod mollusc, Crepidula for- Giribet G. 2008. Assembling the lophotrochozoan (¼spiralian) tree nicata. Dev Biol 297:295–307. of life. Phil Trans R Soc Lond B Biol Sci. 363:1513–1522. Henry JQ, Perry KJ, Wever J, Seaver E, Martindale MQ. 2008. Gline SE, Nakamoto A, Cho SJ, Chi C, Weisblat DA. 2011. Lineage Beta-catenin is required for the establishment of vegetal embry- analysis of micromere 4d, a super-phylotypic cell for Lophotro- onic fates in the nemertean, Cerebratulus lacteus. Dev Biol 317: chozoa, in the leech Helobdella and the sludgeworm Tubifex. 368–379. Dev Biol 353:120–133. Henry JQ, Perry KJ, Martindale MQ. 2010. Beta-catenin and early Goldstein B, Leviten MW, Weisblat DA. 2001. Dorsal and snail development in the gastropod, Crepidula fornicata. Integr Comp homologs in leech development. Dev Genes Evol 211:329–337. Biol 50:707–719. Gorfinkiel N, Schamberg S, Blanchard GB. 2011. Integrative Hinman VF, Davidson EH. 2003. Expression of a gene encoding approaches to morphogenesis: lessons from dorsal closure. Gata transcription factor during embryogenesis of the starfish Genesis 49:522–533. Asterina miniata. Gene Expr Patterns 3:419–422. Goriely A, Stella M, Coffinier C, Kessler D, Mailhos C, Dessain S, Hinman VF, Becker E, Degnan BM. 2000. Neuroectodermal and Desplan C. 1996. A functional homologue of goosecoid in Dro- endodermal expression of the ascidian Cdx gene is separated sophila. Development 122:1641–1650. by metamorphosis. Dev Genes Evol 210:212–216. Goto A, Kitamura K, Arai A, Shimizu T. 1999. Cell fate analysis of Hinman VF, Nguyen AT, Cameron RA, Davidson EH. 2003. Devel- teloblasts in the Tubifex embryo by intracellular injection of HRP. opmental gene regulatory network architecture across 500 mil- Dev Growth Differ 41:703–713. lion years of echinoderm evolution. Proc Natl Acad Sci USA 100: Goulding MQ. 2009. Cell lineage analysis of the Ilyanassa embryo: 13356–13361. evolutionary acceleration of regional differentiation during early Imai K, Takada N, Satoh N, Satou Y. 2000. b-catenin mediates the development. PLoS One 4:e5506. specification of endoderm cells in ascidian embryos. Develop- Grabherr MG, Haas BJ, Yassour M, Levin JZ, Thompson DA, Amit ment 127:3009–3020.

DEVELOPMENTAL DYNAMICS I, Adiconis X, Fan L, Raychowdhury R, Zeng Q, Chen Z, Mauceli Iso T, Kedes L, Hamamori Y. 2003. HES and HERP families: multi- E, Hacohen N, Gnirke A, Rhind N, di Palma F, Birren BW, ple effectors of the Notch signaling pathway. J Cell Physiol 194: Nusbaum C, Lindblad-Toh K, Friedman N, Regev A. 2011. Full- 237–255. length transcriptome assembly from RNA-Seq data without a ref- Jones CM, Broadbent J, Thomas PQ, Smith JC, Beddington RS. erence genome. Nat Biotechnol 29:644–652. 1999. An anterior signalling centre in Xenopus revealed by the Greenwald I. 1998. LIN-12/Notch signaling: lessons from worms homeobox gene XHex. Curr Biol 9:946–954. and ﬂies. Genes Dev 12:1751–1762. Kageyama R, Ohtsuka T. 1999. The Notch-Hes pathway in mam- Gross JM, McClay DR. 2002. The role of Brachyury (T) during gas- malian neural development. Cell Res 9:179–188. trulation movements in the sea urchin Lytechinus variegatus. Dev Kageyama R, Ohtsuka T, Kobayashi T. 2007. The Hes gene family: Biol 239:132–147. repressors and oscillators that orchestrate embryogenesis. Hall BK. 2000. The neural crest as a fourth germ layer and verte- Development 134:1243–1251. brates as quadroblastic not triploblastic. Evol Dev 2:3–5. Kageyama R, Ohtsuka T, Kobayashi T. 2008. Roles of Hes genes in Hardin J. 1989. Local shifts in position and polarized motility drive neural development. Dev Growth Differ 50:S97–S103. cell rearrangement during sea urchin gastrulation. Dev Biol 136: Kaji T, Nonogaki K. 2013. Role of homeobox genes in the hypo- 430–445. thalamic development and energy balance. Front Biosci (Land- Hayward DC, Grasso LC, Saint R, Miller DJ, Ball EE. 2015. The mark Ed) 18:740–747. organizer in evolution-gastrulation and organizer gene expression Kaufmann E, Knochel W. 1996. Five years on the wings of fork highlight the importance of Brachyury during development of the head. Mech Dev 57:3–20. coral, Acropora millepora. Dev Biol 399:337–47. Kawai N, Iida Y, Kumano G, Nishida H. 2007. Nuclear accumulation Heath JK. 2010. Transcriptional networks and signaling pathways of beta-catenin and transcription of downstream genes are regu- that govern vertebrate intestinal development. Curr Top Dev Biol lated by zygotic Wnt5alpha and maternal Dsh in ascidian 90:159–192. embryos. Dev Dyn 236:1570–1582. Hejnol A. 2010. A twist in time- the evolution of spiral cleavage in Kerner P, Hung J, Behague J, Le Gouar M, Balavoine G, Vervoort the light of animal phylogeny. Integr Comp Biol 50:695–706. M. 2009. Insights into the evolution of the snail superfamily from 1246 PERRY ET AL.

metazoan wide molecular phylogenies and expression data in Lowe CJ, Terasaki M, Wu M, Freeman Jr. RM, Runft L, Kwan K, annelids. BMC Evol Biol 9:94. Haigo S, Aronowicz J, Lander E, Gruber C, Smith M, Kirschner Kimelman D, Griffin KJ. 2000. Vertebrate mesendoderm induction M, Gerhart J. 2006. Dorsoventral patterning in hemichordates: and patterning. Curr Opin Genet Dev 10:350–356. Insights into early chordate evolution. PLoS Biol 4:e291. Kin K, Kakoi S, Wada H. 2009. A novel role for dpp in the shaping Lyons DC, Henry JQ. 2014. Ins and Outs of Spiralian Gastrulation. of bivalve shells revealed a conserved molluscan developmental Int J Dev Biol 58:413–428. program. Dev Biol 329:152–166. Lyons DC, Perry KJ, Lesoway MP, Henry JQ. 2012. Cleavage pat- Kingsley EP, Chan XY, Duan Y, Lambert JD. 2007. Widespread tern and fate map of the mesentoblast, 4d, in the gastropod RNA segregation in a spiralian embryo. Evol Dev 9:527–539. Crepidula: a hallmark of spiralian development. EvoDevo 3:21. Kispert A, Herrmann BG, Leptin M, Reuter R. 1994. Homologs of Lyons DC, Perry KJ, Henry JQ. 2015. Gastrulation in the slipper the mouse Brachyury gene are involved in the specification of snail Crepidula fornicata: germ layer formation, morphogenesis, posterior terminal structures in Drosophila, Tribolium, and and fate of the blastopore in a model spiralian “protostome.” Locusta. Genes Dev 8:2137–2150. EvoDevo 6:24. Kitakoshi T, Shimizu T. 2010. An oligochaete homologue of the Bra- Maduro MF. 2006. Endomesoderm specification in Caenorhabditis chyury gene is expressed transiently in the third quartette of elegans and other nematodes. BioEssays 28:1010–1022. micromeres. Gene Expr Patterns 10:306–313. Maduro MF, Rothman JH. 2002. Making worm guts: the gene regu- Knight RD, Shimeld SM. 2001. Identification of conserved C2H2 latory network of the Caenorhabditis elegans endoderm. Dev zinc-finger gene familiees in the Bilateria. Genome Biol 2: Biol 246:68–85. research0016.1-research0016.8. Magie CR, Daly M, Martindale MQ. 2007. Gastrulation in the cni- Koop D, Richards GS, Wanninger A, Gunter HM, Degnan BM. darian Nematostella vectensis occurs via invagination not ingres- 2007. The role of MAPK signaling in patterning and establishing sion. Dev Biol 305:483–497. axial symmetry in the gastropod Haliotis asinina. Dev Biol 311: Marlow H, Tosches MA, Tomer R, Steinmetz PR, Lauri A, Larsson 200–217. T, Arendt D. 2014. Larval body patterning and apical organs are Kumar JP. 2009. The sine oculis homeobox (SIX) family of tran- conserved in animal evolution. BMC Biol 12:7. scription factors as regulators of development and disease. Cell Martindale MQ. 2005. The evolution of metazoan axial properties. Mol Life Sci 66:565–583. Nat Rev Genet 6:917–927. Lambert JD. 2008. Mesoderm in spiralians: the organizer and the Martindale MQ, Hejnol A. 2009. A developmental perspective: 4d cell. J Exp Zool B Mol Dev Evol 310:15–23. changes in the position of the blastopore during bilaterians evo- Lambert JD. 2010. Developmental patterns in spiralian embryos. lution. Dev Cell. 17:162–174. Curr Biol 20:R72–7. Martindale MQ, Henry JQ. 1999. Intracellular fate mapping in a Lambert JD, Nagy LM. 2002. Asymmetric inheritance of centroso- basal metazoan, the ctenophore Mnemiopsis leidyi, reveals the mally localized mRNAs during embryonic cleavages. Nature 420: origins of mesoderm and the existence of indeterminate cell line- 682–686. ages. Dev Biol 214:243–257. Lartillot N, Le Gouar M, Adoutte A. 2002a. Expression patterns of Martindale MQ, Pang K, Finnerty JR. 2004. Investigating the origins fork head and goosecoid homologues in the mollusc Patella vul- of triploblasty: ‘mesodermal’ gene expression in a diploblastic gata supports the ancestry of the anterior mesendoderm across animal, the sea anemone Nematostella vectensis (phylum, Cnida- Bilateria. Dev Genes Evol 212:551–561. ria; class, Anthozoa). Development 131:2463–2474. Lartillot N, Lespinet O, Vervoort M, Adoutte A. 2002b. Expression Martın-Duran JM, Janssen R, Wennberg S, Budd GE, Hejnol A. pattern of Brachyury in the mollusc Patella vulgata suggests a 2012. Deuterostomic development in the protostome Priapulus conserved role in the establishment of the AP axis in Bilateria. caudatus. Curr Biol 22:2161–2166. Development 129:1411–1421. Matsuo K, Yoshida H, Shimizu T. 2005. Differential expression of Lawrence N, Klein T, Brennan K, Arias AM. 2000. Structure require- caudal and dorsal genes in the teloblast lineages of the oligo- ments for Notch signalling with Delta and Serrate during the chaete annelid Tubifex tubifex. Dev Genes Evol 215:238–247. development and patterning of the wing disc of Drosophila. McCauley BS, Akyar E, Saad HR, Hinman VF. 2015. Dose-depend- Development 127:3185–3195. ent nuclear b-catenin response segregates endomesoderm along Lee PN, Kumburegama S, Marlow HQ, Martindale MQ, the sea star primary axis. Development 142:207–217. Wikramanayake AH. 2007. Asymmetric developmental potential Meulemans D, Bronner-Fraser M. 2004. Gene-regulatory interac- along the animal-vegetal axis in the anthozoan cnidarian, Nema- tions in neural crest evolution and development. Dev Cell 7:291– tostella vectensis, is mediated by Dishevelled. Dev Biol 310:169– 299. 186. Meyer NP, Boyle MJ, Martindale MQ, Seaver EC. 2010a. A com- DEVELOPMENTAL DYNAMICS Le Gouar M, Lartillot N, Adoutte A, Vervoort M. 2003. The expres- prehensive fate map by intracellular injection of identified blasto- sion of a caudal homologue in a mollusc, Patella vulgata. Gene meres in the marine polychaete Capitella teleta. EvoDevo 1:8. Expr Patterns 3:35–37. Meyer NP, Seaver EC. 2010b. Cell lineage and fate map of the pri- Lengyel JA, Iwaki DD. 2002. It takes guts: The Drosophila hindgut mary somato- blast of the polychaete annelid Capitella teleta. as a model system for organogenesis. Dev Biol 243:1–19. Integr Comp Biol 50:756–767. Lespinet O, Nederbragt AJ, Cassan M, Dictus WJ, Van Loon AE, Minokawa T, Rast JP, Arenas-Mena C, Franco CB, Davidson EH. Adoutte A. 2002. Characterization of two snail genes in the gas- 2004. Expression patterns of four different regulatory genes that tropod Patella vulgata. Implications for understanding the ances- function during sea urchin development. Gene Expr Patterns 4: tral function of the snail-related genes in Bilateria. Dev. Genes 449–456. Evol. 212:186–195. Miyawaki K, Yamamoto M, Saito K, Saito S, Kobayashi N, Li E, Cui M, Peter IS, Davidson EH. 2014. Encoding regulatory Matsuda S. 2003. Nuclear localization of beta-catenin in vegetal state boundaries in the pregastrular oral ectoderm of the sea pole cells during early embryogenesis of the starfish Asterina urchin embryo. Proc Natl Acad Sci USA 111:E906–913. pectinifera. Dev Growth Differ 45:121–128. Lillie FR. 1895. The embryology of the Unionidae. J Morph 10:1– Momose T, Derelle R, Houliston E. 2008. A maternally localised 100. Wnt ligand required for axial patterning in the cnidarian Clytia Logan CY, Miller JR, Ferkowicz MJ, McClay DR. 1999. Nuclear hemisphaerica. Development 135:2105–2113. beta-catenin is required to specify vegetal cell fates in the sea Morck€ C, Rauthan M, Wagberg F, Pilon M. 2004. pha-2 encodes urchin embryo. Development 126:345–357. the C. elegans orthologs of the homeodomain protein HEX and Loose M, Patient R. 2004. A genetic regulatory network for Xeno- is required for the formation of the pharyngeal isthmus. Dev Biol pus mesendoderm formation. Dev Biol 2:467–478. 272:403–418. Lowe CJ, Wu M, Salic A, Evans L, Lander E, Stange-Thomann N, Moreno E, Morata G. 1999. Caudal is the Hox gene that specifies Gruber CE, Gerhart J, Kirschner M. 2003. Anteroposterior pat- the most posterior Drosophila segment. Nature 400:873-7. terning in hemichordates and the origins of the chordate nervous Nederbragt AJ, te Welscher P, van den Driesche S, van Loon AE, system. Cell 113:853–865. Dictus WJ. 2002a. Novel and conserved roles for orthodenticle/ REGULATORY FACTORS IN THE MOLLUSC Crepidula 1247

otx and orthopedia/otp orthologs in the gastropod mollusc Rottinger€ E, Dahlin P, Martindale MQ. 2012. A framework for the Patella vulgata. Dev Genes Evol 212:330-337. establishment of a cnidarian gene regulatory network for Nederbragt AJ, Lespinet O, van Wageningen S, van Loon AE, “endomesoderm” specification: the inputs of b-catenin/TCF sig- Adoutte A, Dictus WJ. 2002b. A Lophotrochozoan twist gene is naling. Plos Genet 8:1–28. expressed in the ectomesoderm of the gastropod mollusk Patella Ryan JF, Pang K, Schnitzler CE, Nguyen AD, Moreland RT, vulgata. Evol Dev 4:334–343. Simmons DK, Koch BJ, Francis WR, Havlak P; NISC Compara- Newman CS, Chia F, Krieg PA. 1997. The XHex homeobox gene is tive Sequencing Program, Smith SA, Putnam NH, Haddock SH, expressed during development of the vascular endothelium: Dunn CW, Wolfsberg TG, Mullikin JC, Martindale MQ, Baxevanis overexpression leads to an increase in vascular endothelial cell AD. 2013. The genome of the ctenophore Mnemiopsis leidyi and number. Mech Dev 66:83–93. its implications for cell type evolution. Science 342:1242592. Nieto MA. 2002. The snail superfamily of zinc-finger transcription Samadi L, Steiner G. 2010. Conservation of ParaHox genes’ func- factors. Nature 3:155–166. tion in patterning of the digestive tract of the marine gastropod Niimi T, Seimiya M, Kloter U, Flister S, Gehring WJ. 1999. Direct Gibbula varia. BMC Dev Biol 10:74. regulatory interaction of the eyeless protein with an eye-specific Saunders LR, McClay DR. 2014. Sub-circuits of a gene regulatory enhancer in the sine oculis gene during eye induction in Dro- network control a developmental epithelial-mesenchymal transi- sophila. Development 126:2253–2260. tion. Development 141:1503–1513. Nishida H, Satoh N. 1985. Cell lineage analysis in ascidian Sawyer JM, Harrell JR, Shemer G, Sullivan-Brown J, Roh-Johnson embryos by intracellular injection of a tracer enzyme. II. The 16- M, Goldstein B. 2010. Apical constriction: a cell shape change and 32-cell stages. Dev Biol 110:440–454. that can drive morphogenesis. Dev Biol 341:5–19. Oliveri P, Tu Q, Davidson EH. 2008. Global regulatory logic for Schneider SQ, Bowerman B. 2007. b-Catenin asymmetries after all specification of an embryonic cell lineage. Proc Natl Acad Sci animal/vegetal oriented cell divisions in Platynereis dumerilii USA 105:5955–5962. embryos mediate binary cell-fate specification. Dev Cell 13:73–86. Oliveri P, Walton KD, Davidson EH, McClay DR. 2006. Repression Schneider S, Steinbeisser H, Warga RM, Hausen P. 1996. Beta-cat- of mesodermal fate by foxa, a key endoderm regulator of the enin translocation into nuclei demarcates the dorsalizing centers sea urchin embryo. Development 133:4173-4181. in frog and fish embryos. Mech Dev 57:191–198. Olsen CL, Jeffrey WR. 1997. A forkhead gene related to HNF- Schulz C, Tautz D. 1995. Zygotic caudal regulation by hunchback 3beta is required for gastrulation and axis formation in the ascid- and its role in abdominal segment formation of the Drosophila ian embryo. Development 124:3609-3619. embryo. Development 121:1023–1028. Owraghi M, Broitman-Maduro G, Luu T, Roberson H, Maduro MF. Shimizu T, Bae YK, Muraoka O, Hibi M. 2005. Interaction of Wnt 2010. Roles of the Wnt effector POP-1/TCF in the C. elegans and caudal-related genes in zebrafish posterior body formation. endomesoderm specification gene network. Dev Biol 340:209- Dev Biol 279:125–141. 221. Shoguchi E, Satoh N, Maruyama YK. 1999. Pattern of Brachyury gene Passamaneck YJ, Hejnol A, Martindale MQ. 2015. Mesodermal expression in starfish embryos resembles that of hemichordate gene expression during the embryonic and larval development of embryos but not of sea urchin embryos. Mech Dev 82:185–189. the articulate brachiopod Terebratalia transversa. EvoDevo 6:10. Simeone A, D’Apice MR, Nigro V, Casanova J, Graziani F, Perez-Pomares JM, Munoz-Chapuli R. 2002. Epithelial- mesenchy- Acampora D, Avantaggiato V. 1994. Orthopedia, a novel mal transitions: a mesodermal cell strategy for evolutive innova- homeobox-containing gene expressed in the developing CNS of tion in Metazoans. Anat Rec 268:343–351. both mouse and Drosophila. Neuron 13:83–101. Peter IS, Davidson EH. 2011. A gene regulatory network controlling Simoes-Costa~ M, Bronner ME. 2015. Establishing neural crest the embryonic specification of endoderm. Nature 474:635–639. identity: a gene regulatory recipe. Development. 142:242–257. Peterson KJ, Harada Y, Cameron RA, Davidson EH. 1999. Expres- Sinigaglia C, Busengdal H, Lecle` re L, Technau U, Rentzsch F. sion pattern of Brachyury and Not in the sea urchin: comparative 2013. The bilaterian head patterning gene six3/6 controls aboral implications for the origins of mesoderm in the basal deuteros- domain development in a Cnidarian. PLoS Biol 11:e1001488. tomes. Dev Biol 207:419–431. Solnica-Krezel L, Sepich DS. 2012. Gastrulation: making and shap- Pfeifer K, Schaub C, Wolfstetter G, Dorresteijn A. 2013. Identifica- ing germ layers. Ann Rev Cell Dev Biol 28:687 tion and characterization of a twist ortholog in the polychaete Song MH, Huang FZ, Gonsalves FC, Weisblat DA. 2004. Cell annelid Platynereis dumerilii reveals mesodermal expression of cycle-dependent expression of hairy and Enhancer of split (hes) Pdu-twist. Dev Genes Evol 223:319–328. homolog during cleavage and segmentation in leech embryos. Pfeifer K, Schaub C, Domsch K, Dorresteijn A, Wolfstetter G. 2014. Dev Biol 269:183–185. Maternal inheritance of twist and analysis of MAPK activation in Soto JG, Nelson BH, Weisblat DA. 1997. A leech homolog of twist:evi- DEVELOPMENTAL DYNAMICS embryos of the polychaete annelid Platynereis dumerilii. PLoS dence for its inheritance as a maternal mRNA. Gene 199:31–37. One 9:e96702. Steinmetz PR, Urbach R, Posnien N, Eriksson J, Kostyuchenko RP, Pruitt MM, Letcher EJ, Chou HC, Bastin BR, Schneider SQ. 2014. Brena C, Guy K, Akam M, Bucher G, Arendt D. 2010. Six3 Expression of the wnt gene complement in a spiral-cleaving demarcates the anterior-most developing brain region in bilater- embryo and trochophore larva. Int J Dev Biol 58:563–573. ian animals. EvoDevo 1:14. Rast JP, Cameron RA, Poutska ASJ, Davidson EH. 2002. The Steinmetz PR, Kostyuchenko RP, Fischer A, Arendt D. 2011. The GATA family (vertebrates and invertebrates). Curr Opin Gen Dev segmental pattern of otx, gbx, and Hox genes in the annelid Pla- 12:416–422. tynereis dumerilii. Evol Dev 13:72–79. Ristoratore F, Spagnuolo A, Aneillo F, Branno M, Fabbrini F, Di Steinmetz PR, Zelada-Gonzales F, Burgtorf C, Wittbrodt J, Arendt Lauro R. 1999. Expression and functional analysis of Cititf1,an D. 2007. Polychaete trunk neuroectoderm converges and ascidian NK-2 class gene, suggests its role in endoderm devel- extends by mediolateral cell intercalation. Proc Natl Acad Sci opment. Development 126:5149–5159. USA 104:2727–2732. Rivera AS, Gonsalves FC, Song MH, Norris BJ, Weisblat DA. 2005. Stern CD. 2004. Gastrulation: from cells to embryo, 1st ed. Cold Characterization of Notch-class gene expression in segmentation Spring Harbor, NY: Cold Spring Harbor Laboratory Press. p 731. stem cells and segment founder cells in Helobdella robusta Tagawa K, Humphreys T, Satoh N. 1998. Novel pattern of Bra- (Lophotrochozoa; Annelida; Clitellata; Hirudinida; Glossiphonii- chyury gene expression in hemichordate embryos. Mech Dev 75: dae). Evol Dev 7:588–599. 139–143. Rivest BR. 1992. Studies on the structure and function of the larval Takacs CM, Moy VN, Peterson KJ. 2002. Testing putative hemi- kidney complex of Prosobranch gastropods. Biol. Bull. 182:305– chordate homologues of the chordate dorsal nervous system 323. and endostyle: expression of NK2.1 (TTF-1) in the acorn worm Rocheleau CE, Downs WD, Lin R, Wittmann C, Bei Y, Cha YH, Ali Ptychodera flava (Hemichordata, Ptychoderidae). Evol Dev 4: M, Priess JR, Mello CC. 1997. Wnt signaling and an APC-related 405–417. gene specify endoderm in early. C. elegans embryos. Cell 90: Technau U. 2001. Brachyury, the blastopore and the evolution of 707–716. mesoderm. BioEssays 23:788–794. 1248 PERRY ET AL.

Technau U, Scholz CB. 2003. Origin and evolution of endoderm Wikramanayake AH, Huang L, Klein WH. 1998. beta-catenin is and mesoderm. Int J Dev Biol 47:531–539. essential for patterning the maternally specified animal-vegetal Tessmar-Raible K, Raible F, Christodoulou F, Guy K, Rembold M, axis in the sea urchin embryo. Proc Natl Acad Sci USA 95:9348– Hausen H, Arendt D. 2007. Conserved sensory-neurosecretory 9348. cell types in annelid and fish forebrain: insights into hypothala- Wilson EB. 1898. Cell-lineage and ancestral reminiscence. In: Bio- mus evolution. Cell 129:1389–1400. logical Lectures from the Marine Biological Laboratory, Woods Thamm K, Seaver EC. 2008. Notch signaling during larval and Hole, Massachusetts. Boston: Ginn & Co pp 21–42. juvenile development in the polychaete annelid Capitella sp. I. Woltereck R. 1904. Contribution to experimental analysis of Poly- Dev Biol 320:304–318. gordius development of the North Sea and Mediterranean type. Thomas PQ, Brown A, Beddington RS. 1998. Hex: a homeobox Arch EntwMech Org 18:377–403. gene revealing peri-implantation asymmetry in the mouse Woollard A, Hodgkin J. 2000. The Caenorhabditis elegans fate- embryo and an early transient marker of endothelial cell precur- determining gene mab-9 encodes a T-box protein required to sors. Development 125:85–94. pattern the posterior hindgut. Genes Dev 14:596–603. Thorpe CJ, Schlesinger A, Carter JC, Bowerman B. 1997. Wnt sig- Wu LH, Lengyel JA. 1998. Role of caudal in hindgut specification naling polarizes an early C. elegans blastomere to distinguish and gastrulation suggests homology between Drosophila amnio- endoderm from mesoderm. Cell 90:695–705. proctodeal invagination and vertebrate blastopore. Development Umesono Y, Watanabe K, Agata K. 1997. A planarian orthopedia 125:2433–2442. homolog is specifically expressed in the branch region of both the Wong MC, Dobi KC, Baylies MK. 2014. Discrete levels of twist mature and regenerating brain. Dev Growth Differ 39:723–727. activity are required to direct distinct cell functions during gastru- Venkatesh TV, Holland ND, Su M-T, Bodmer R. 1999. Sequence lation and somatic myogenesis. PLoS One 9:e99553. and developmental expression of AmphiNK2-1: insights into the Wu SY, McClay DR. 2007. The snail repressor is required for PMC evolutionary origin of the vertebrate thyroid gland and forebrain. ingression in the sea urchin embryo. Development 134:1061–1070. Dev Genes Evol 209:254–259. Wu SY, Yang YP, McClay DR. 2008. Twist is an essential regulator Walton KD, Croce JC, Glenn TD, Wu SY, McClay DR. 2006; of the skeletogenic gene regulatory network in the sea urchin Genomics and expression profiles of the Hedgehog and Notch embryo. Dev Biol 319:406–415. signaling pathways in sea urchin development. Dev Biol 200: Yamada T. 1994. Caudalization by the amphibian organizer: bra- 153–164. chyury, convergent extension and retinoic acid. Development. Wei Z, Yaguchi J, Yaguchi S, Angerer RC, Angerer LM. 2009. The 120:3051–3062. sea urchin animal pole domain is a Six3-dependent neurogenic Yu J-K, Satou Y, Holland ND, Shin-I T, Kohara Y, Satoh N, Bronner- patterning center. Development 136:1179–1189. Fraser M, Holland LZ. 2007. Axial patterning in cephalochordates Weigel D, Jurgens G, Kuttner F, Seifert E, Jackle H. 1989. The and the evolution of the organizer. Nature 445:613–617. homeotic gene forkhead encodes a nuclear-protein and is Zamparini AL, Watts T, Gardner CE, Tomlinson SR, Johnston GI, expressed in the terminal regions of the Drosophila embryo. Cell Brickman JM. 2006. Hex acts with beta-catenin to regulate ante- 57:645–658. roposterior patterning via a Grouch-related co-repressor and Wikramanayake AH, Hong M, Lee PN, Pang K, Byrum CA, Bince Nodal. Development 133:3709–3722. JM, Xu R, Martindale MQ. 2003. An ancient role for nuclear Zorn AM, Butler K, Gurdon JB. 1999. Anterior endomesoderm beta-catenin in the evolution of axial polarity and germ layer seg- specification in Xenopus by Wnt/b-catenin and TGF-b signalling regation. Nature 426:446–450. pathways. Dev Biol 209:282–297. DEVELOPMENTAL DYNAMICS