Identification Human T Cells: a Potential Marker for Their ADP

Home , ADP ribosylation factor, Small GTPase

Differential Localization and Function of ADP-Ribosylation Factor-6 in Anergic Human T Cells: A Potential Marker for Their Identification This information is current as of September 26, 2021. Dimitrios Tzachanis, Leonard J. Appleman, Andre A. F. L. van Puijenbroek, Alla Berezovskaya, Lee M. Nadler and Vassiliki A. Boussiotis J Immunol 2003; 171:1691-1696; ; doi: 10.4049/jimmunol.171.4.1691 Downloaded from http://www.jimmunol.org/content/171/4/1691

References This article cites 40 articles, 19 of which you can access for free at: http://www.jimmunol.org/ http://www.jimmunol.org/content/171/4/1691.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists by guest on September 26, 2021 • Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2003 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Differential Localization and Function of ADP-Ribosylation Factor-6 in Anergic Human T Cells: A Potential Marker for Their Identiﬁcation1

Dimitrios Tzachanis, Leonard J. Appleman, Andre A. F. L. van Puijenbroek, Alla Berezovskaya, Lee M. Nadler, and Vassiliki A. Boussiotis2

Anergy is a state of immunologic tolerance in which T cells are viable but incapable of responding to antigenic stimulation. Recent data indicate that anergic cells have a distinct gene expression program that determines their unique function. In this study we show that anergic human T cells selectively express the small GTPase ADP-ribosylation factor-6 (ARF6), which is involved in membrane trafﬁc and regulation of the cortical actin cytoskeleton. ARF6 was expressed in the GTP-bound form that localizes at the plasma membrane, resulting in a distinct morphologic appearance of anergic cells. Forced expression of ARF6-GTP in Jurkat Downloaded from T cells prevented TCR-mediated reorganization of cortical actin, extracellular signal-regulated kinase1/2 activation, and IL-2 transcription. Forced expression of ARF6-GTP in primary human T cells inhibited extracellular signal-regulated kinase1/2 activation and proliferative responses. Importantly, T cells with the distribution pattern of ARF6-GTP were detected in peripheral blood, suggesting that anergic T cells may constitutively exist in vivo. The Journal of Immunology, 2003, 171: 1691Ð1696.

aintenance of peripheral tolerance while retaining an sponse, resulting in a distinct gene transcription pattern, defective http://www.jimmunol.org/ intact ability for initiation of immune responses is im- IL-2 production, and a blockade of cell cycle progression (9Ð12). M portant for immune homeostasis. Compelling experi- Despite these extensive studies, it still remains unclear why aner- mental evidence supports the notion that TCRs have a dual poten- gic cells fail to respond to antigenic stimulation. It is also unknown tial to transmit crucial activation signals for initiating immune whether anergic cells exist constitutively in vivo. responses and equally potent inactivating signals to abort immune During Ag recognition, the filaments of cytoskeletal actin play responses and lead to tolerance. The notion that lymphocytes dis- at least two important roles (13). The first is the initiation of mi- tinguish foreign Ags from self-Ags and respond positively only to crometric molecular movements on the surface of T cells. This damage-inducing signals is a current model for understanding the large-scale molecular rearrangement results in formation of the induction and maintenance of self tolerance (1). immunological synapse organized into distinct supramolecular ac- by guest on September 26, 2021 T cell tolerance and its in vitro counterpart anergy is induced tivation clusters (SMACs).3 The second is the formation of a scaf- when T cells are stimulated via the TCR without costimulation or fold for signaling complexes, resulting in activation of signaling IL-2. Anergy can also be induced when T cells are stimulated by cascades. a TCR antagonistic altered peptide ligand (2). In vivo studies in In this study we show that anergic T cell clones have increased animal models have provided evidence for the biological signifi- expression of ADP-ribosylation factor-6 (ARF6), a member of the cance of tolerance in the prevention of autoimmunity, graft rejec- ARF family of GTPases involved in membrane traffic and regulation, and graft-vs-host disease (3Ð7). Moreover, induction of tol- tion of the cortical actin cytoskeleton (14Ð16). ARF6 was ex- erance enabled transplantation of histoincompatible grafts in pressed in the GTP-bound form that localizes predominantly at the patients with hematologic malignancies (8). Because of the clinical plasma membrane (16, 17), resulting in a distinct morphologic implications of tolerance, extensive studies have examined the mo- appearance of anergic cells. Forced expression of ARF6-GTP in lecular events that control the anergic state in vitro. These studies primary human T cells inhibited extracellular signal-regulated ki- have indicated that induction of T cell anergy is an active process nase (ERK)1/2 activation and CD3- plus CD28-mediated prolif- that requires Ca2ϩ mobilization. However, the biochemical events eration. In Jurkat T cells, forced expression of ARF6-GTP pre- that predominate during induction of anergy are different from vented TCR-mediated reorganization of polymerized actin and those that predominate during induction of productive immune re- inhibited ERK1/2 activation and IL-2 transcription. Thus, defective reorganization of the actin cytoskeleton during TCR ligation may be the most proximal event, which results in altered bio- Department of Adult Oncology, Dana-Farber Cancer Institute, Division of Medical chemical signaling in anergic cells. The distinct intracellular lo- Oncology, Brigham and Women’s Hospital, and Department of Medicine, Harvard Medical School, Boston, MA 02115 calization of ARF6 makes it a candidate marker for phenotypic identification of anergic cells. Interestingly, T cells with the dis- Received for publication March 25, 2003. Accepted for publication June 10, 2003. tribution pattern of ARF6-GTP were detected in peripheral blood The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance of healthy individuals, suggesting that anergic T cells may consti- with 18 U.S.C. Section 1734 solely to indicate this fact. tutively exist in vivo. 1 This work was supported by National Institutes of Health Grants AI43552, AI46584, and AI41584. L.J.A. is supported by the Leukemia Research Foundation. V.A.B. and L.J.A. are grateful for support from the Friends of Dana-Farber Cancer Institute. 3 Abbreviations used in this paper: SMAC, supramolecular activation cluster; ARF6, 2 Address correspondence and reprint requests to Dr. Vassiliki A. Boussiotis, Dana- ADP-ribosylation factor-6; ERK, extracellular signal-regulated kinase; HA, hemag- Farber Cancer Institute, Mayer 547, 44 Binney Street, Boston, MA 02115. E-mail glutinin; GEF, guanidine nucleotide exchange factor; GRP1, general receptor of phos- address: [email protected] phoinositides 1.

Materials and Methods anti-CD28 mAb for 6 h, and luciferase activity was measured. In all ex- Cells and suppression subtractive hybridization periments, transfection efficiency was normalized by cotransfection with pEF-lacZ and assay for ␤-galactosidase. Alloantigen-specific human T cell clones were rendered anergic by culture with soluble anti-CD3 mAb (100 ng/ml; Research Diagnostics, Flanders, Transfection or primary human T cells NJ). Control-cultured populations were rescued from anergy induction by Primary human T cells were transfected with either empty vector or the culture with the same concentration of soluble anti-CD3 plus anti-CD28 indicated ARF6 plasmids by the nucleofection technique and device (19) (200 ng/ml; Research Diagnostics) according to described protocol (12). according to the manufacturer’s instructions (Amaxa Biosystems, Cologne, After6hofculture, mRNA was isolated from each population, and cDNA Germany). Twenty-four hours after transfection, T cells were recovered was prepared by RT-PCR. cDNA from anergic T cell clones was used as and stimulated as described above for assessment of ERK1/2 activation. At “tester.” cDNA from control-cultured cells was used as “driver,” and sub- the same time, cells (105 cells per well) were cultured in 96-well plates tractive suppressive hybridization (18) was done with the use of the PCR- with either medium or a combination of anti-CD3 (300 ng/ml) and anti- select cDNA subtraction kit (Clontech Laboratories, Palo Alto, CA) as CD28 (500 ng/ml) mAbs, and DNA synthesis was assessed by [3H]thymi- previously described (12). Primary human T cells were isolated by Ficoll/ dine for the last 16 h of a 72-h culture period. Responses were evaluated paque (Amersham Pharmacia Biotech, Uppsala, Sweden) gradient centrif- by assessment of stimulation index as described before (20). ugation from leukopacks obtained from the blood banks of the Dana-Farber Cancer Institute and Brigham and Women’s Hospital. T cells were en- Confocal microscopy riched by depletion of plastic-adherent mononuclear cells, positive selec- tion by E rosetting using SRBC (BioWhittaker, Walkersville, MD), and Cells were isolated from cultures, allowed to attach on poly-L-lysine coated removal of NK and B cells by mAbs and anti-mouse Ig-coated magnetic coverslips for 2 min, fixed with 3% paraformaldehyde, and permeabilized beads. For experiments in which expression of ARF6 on CD8ϩ cells was with 0.1% Triton X in PBS-1% BSA. Cells were stained with ARF6- examined, enrichment for CD8ϩ T cells after E rosetting was achieved by specific mAb followed by FITC-conjugated donkey anti-mouse serum and removal of CD4ϩ cells along with NK and B cells by the use of mAbs and propidium iodide to visualize the nuclei. When detection of double staining Downloaded from anti-mouse Ig-coated magnetic beads. for ARF6 and either CD4, CD8, or CD25 was conducted, cells were stained with ARF6 followed by FITC-conjugated donkey anti-mouse serum and Northern blot were subsequently incubated with the indicated second Ab conjugated with ␮ rhodamine. For the bead assay, goat anti-mouse IgG dynabeads M-450 For Northern blot analysis, 15 g of mRNA was analyzed by electrophore- (Dynal Biotech, Great Neck, NY) were coated with anti-CD3 mAb. Coated sis on 1% agarose gel containing formamide and transferred on Hy- beads and Jurkat T cells were washed and resuspended in RPMI/HEPES bond-XL blotting membrane (Amersham Pharmacia Biotech). The ARF6 supplemented with 1% FCS. Cells and beads were mixed and incubated for http://www.jimmunol.org/ probe consisted of full-length human ARF6 cDNA. The G3PDH probe 30 min at 4¡C followed by 5 min at 37¡C. Cells were allowed to attach on consisted of a 1-kb fragment of the cDNA spanning the coding region of poly-L-lysine-coated coverslips for 2 min on ice, fixed, permeabilized, and human G3PDH. cDNA fragments were labeled by random priming with stained with rhodamine-labeled phalloidin to visualize polymerized actin. ␣ 32 [ - P]dATP using a labeling kit (Amersham Pharmacia Biotech). Blots Samples were visualized and photographed using a confocal laser scanner were hybridized with labeled probes in hybridization buffer (Molecular microscope (MRC 1024 Kr/Ar; Bio-Rad, Hercules, CA). Research Center, Cincinnati, OH) according to the manufacturer’s protocol. After hybridization, blots were washed four times at room temperature in SSC (2ϫ) and SDS (0.1%), followed by one wash at 50¡C. They were Results then examined by autoradiography. Anergic cells express high levels of ARF6 mRNA and protein Western blot To identify genes that are selectively expressed in anergic cells, we used suppression subtractive hybridization. Alloantigen-specific by guest on September 26, 2021 Equal amounts of protein from each sample were analyzed by SDS-PAGE, human T cell clones were rendered anergic by stimulation via transferred on nitrocellulose membranes, and immunoblotted with the indicated mAbs or antiserum. ARF mAb was purchased from Alexis Bio- TCR/CD3 alone. Control stimulated cells were rescued from an- chemicals (Axxora; San Diego, CA). ARF6-specific mAb and actin anti- ergy induction by simultaneous costimulation via CD28. Sequence serum were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). analysis of the confirmed positive clones obtained by subtraction Immunodetection was done with HRP-conjugated anti-mouse IgG (1:5000) hybridization revealed that ARF6 was selectively up-regulated in or anti-goat IgG (1:10,000) (Promega, Madison, WI) and developed by chemiluminescence (NEN, Boston, MA). For assessment of ERK1/2 acti- anergic cells. vation, Jurkat cells or primary human T cells resuspended as 107/ml were Northern blot analysis showed that ARF6 mRNA was expressed left untreated or treated with anti-CD3 (1 ␮g/ml) and anti-CD28 (1 ␮g/ml) at low levels in unstimulated T cell clones and was up-regulated (both from Research Diagnostics) for 30 min on ice followed by cross- during culture. Immunogenic culture resulted in transient up-reg- ␮ linking with rabbit anti-mouse Ig (20 g/ml; DAKO, Carpinteria, CA) for ulation of ARF6 mRNA that peaked at 3 h and gradually declined. 2 min. Lysates were analyzed by SDS-PAGE and immunoblot with pERK1/2-specific mAb (Santa Cruz Biotechnology) and subsequently re- In contrast, anergizing culture resulted in sustained and augmented blotted with ERK1/2 antiserum (Upstate Biotechnology, Lake Placid, NY). expression of ARF6 mRNA for up to 12 h of culture (Fig. 1A). Preparation of whole cell lysates, SDS-PAGE, stripping, and reprobing of Western blot analysis confirmed that higher levels of ARF6 protein the immunoblots were done as described (12). were detected in anergic, compared with productively, stimulated Site-directed mutagenesis cells (Fig. 1B). To generate ARF6T27N and ARF6Q67L, specific mutations were intro- ARF6 is expressed in the GTP-bound form in anergic cells duced in the ARF6 sequence using the QuickChange Multi Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA) according to the manufacturer’s ARF6 is a member of the ARF GTPases and cycles between a protocol. The following primers were used to generate the mutations: GTP-bound and a GDP-bound form (14). The GDP-bound form of primer T27N: GACGCGGCCGGCAAGAACACAATCCTGTACAAG; ARF6 is present in the cytoplasm and the endosomal membranes. primer Q67L: TGGGATGTGGGCGGCCTGGACAAGATCCGGCCG. It is converted into the GTP-bound form by the action of guanidine The fidelity of the mutations was verified by sequencing. Constructs were expressed in pSRaHA vector as fusions to N-terminal hemagglutinin (HA) nucleotide exchange factors (GEFs), resulting in a conformational epitope tag. change of the protein that allows its intracellular relocalization. Subsequently, ARF6-GTP is associated with recycling endosomal Jurkat cell transfection and luciferase assays vesicles at the cell periphery and predominantly with the plasma For assessment of IL-2 transcription, Jurkat T cells were transiently transmembrane, resulting in a distinct pattern of intracellular localiza- fected by electroporation with a constant amount (20 ␮g) of the reporter tion between ARF6-GDP and ARF6-GTP (15Ð17). constructs of luciferase driven by the 2-kB IL-2 promoter/enhancer and with equal amounts (50 ␮g) of pcDNA1.1/amp empty vector or cDNA of One of the GEFs for ARF6 is the general receptor of phosphoi- the indicated ARF6 plasmids. Forty hours after transfection, 5 ϫ 105 cells nositides 1 (GRP1), a member of the Cytohesin family (21). No- were cultured with either medium or with a combination of anti-CD3 plus tably, GRP1 was shown to be selectively expressed in anergic The Journal of Immunology 1693

(13). TCR-mediated stimulation leads to the organization of SMACs at the interfaces of physical contact between T cells and APC. Assembly of the signaling molecules within the SMACs supports signaling synergy, resulting in efﬁcient lymphocyte activation. Formation of SMACs is a dynamic process that depends on movement of actin ﬁlaments. Upon binding to an APC, the cytoskeleton of a T cell rapidly polarizes. The accumulation of polymerized F-actin in a tight collar at the T cell-APC interface sta- bilizes a continuous contact between T cell and APC. T cells also become polarized toward anti-CD3-coated beads and reorganize their actin cytoskeleton as a dense F-actin collar. This approach mimics the actin reorganization taking place during T cell-APC interaction and permits the precise analysis of actin remodeling in T cells (22). We have previously observed that anergic T cells have defective ability to reorganize cytoskeletal actin after TCR ligation (23). However, it is currently unclear whether ARF6 might be involved in this event. To address the role of ARF6 in TCR-mediated actin

remodeling, we transfected Jurkat T cells with either empty vector, Downloaded from ARF6T27N that remains in the GDP-bound state, or ARF6Q67L that remains in the GTP-bound state (24). Cells were stimulated FIGURE 1. Differential expression and intracellular localization of with anti-CD3-coated beads, and actin remodeling was examined ARF6 in anergic and control-activated T cell clones. A, Northern blot anal- with phalloidin staining. Although ARF6-GDP (ARF6T27N) did ysis of ARF6. T cell clones were treated for induction of productive im- not affect actin reorganization and formation of the F-actin collar munity, or anergy RNA was extracted at the indicated time intervals, and at the cell-bead contact site, ARF6-GTP (ARF6Q67L) prevented http://www.jimmunol.org/ expression of ARF6 was examined by Northern blot. B, T cell clones were redistribution of F-actin at the contact site (Fig. 2A). Consistent cultured as indicated, lysates were prepared and analyzed by SDS-PAGE and immunoblot with ARF6-specific mAb and actin-specific antiserum. C, Productively stimulated (top) and anergic (bottom) T cell clones were fixed, stained with ARF6 mAb and propidium iodide to visualize the nuclei, and subjected to confocal microscopy. This unique expression pattern was detected in Ͼ80% of the cells in the productively stimulated and the anergic population (total number of cells counted in multiple fields, n ϭ 50). by guest on September 26, 2021 mouse T cells. Similar to the expression pattern of ARF6, GRP1 was up-regulated during both anergizing and immunogenic stimulation, but its expression was augmented and sustained only in anergic cells (10). The observations that anergic cells have high and sustained expression of ARF6 and GRP1 suggest that ARF6 may be present in the GTP-bound form. Assessment of GTP load showed that anergic cells preferentially expressed the GTP-bound form of ARF6 (data not shown). Because the GDP and GTP-bound forms of ARF6 are distributed in distinct cellular compartments (14, 16), we hypothesized that a distinct intracellular localization pattern of ARF6 might be detectable in anergic cells. Staining with ARF6-specific mAb revealed that in productively stimulated cells ARF6 was predominantly localized in scattered internal structures (Fig. 1C, top). In contrast, anergic cells had predominantly plasma membrane localization of ARF6, allowing their phenotypic identification (Fig. 1C, bottom). This different localization pattern of ARF6 was detected for up to 4 days of resting culture in medium alone after the induction of productive stimulation or anergy. After FIGURE 2. ARF6-GTP inhibits TCR-mediated redistribution of F-actin this time interval of culture, viability of human T cell clones rap- and blocks ERK1/2 activation and IL-2 transcription. A, Jurkat T cells idly declines and does not allow further analysis. transfected with the indicated plasmids were stimulated with goat anti- mouse IgG dynabeads M-450 (Dynal Biotech) coated with anti-CD3 mAb. Forced expression of ARF6-GTP in Jurkat T cells inhibits TCR- Cells were fixed and stained with rhodamine-labeled phalloidin to visualize mediated actin reorganization and blocks ERK1/2 activation and polymerized actin. Asterisks indicate beads in contact with cells. Expres- IL-2 transcription sion of HA-tagged ARF6 was confirmed by staining with anti-HA mAb (data not shown). B, Jurkat T cells, transfected as indicated, were stimu- ARF6 is involved in regulation of endocytic traffic, but also in lated by CD3 and CD28 cross-linking; and activation of ERK1/2 was ex- remodeling of the cortical actin cytoskeleton (16). The finding that amined by immunoblot with an Ab specific for phosphorylated ERK1/2, a molecule involved in reorganization of the cytoskeleton is highly followed by reblotting with an Ab specific for the nonphosphorylated form expressed in anergic cells suggests that it may play a role in the of ERK1/2. C, Jurkat cells were transfected with the indicated plasmids outcome of TCR ligation by Ag. The link between the actin cy- along with IL-2-luciferase reporter. Cells were cultured for 6 h as shown in toskeleton and lymphocyte activation has been well documented the graph, and IL-2 transcription was examined by luciferase assay. 1694 DIFFERENTIAL EXPRESSION OF ARF6 IN ANERGIC CELLS

treatment approach. It may also provide a means for the evaluation of autoimmune diseases in which tolerance to self-Ags is compro- mised. For these reasons, we sought to determine whether ARF6 expression was detectable in T cells isolated from peripheral blood of healthy individuals. The majority of peripheral blood T cells had undetectable or very low cytoplasmic expression of ARF6 (Fig. 3). A small number of cells had increased cytoplasmic expression of ARF6 that localized in scattered intracellular structures, similar to that observed in productively stimulated T cell clones. Surpris- ingly, a number of cells exhibited predominant membrane localization of ARF6, consistent with the expression pattern identiﬁed in anergic T cell clones, suggesting that detectable anergic T cells may constitutively exist in vivo. Staining with CD4, CD8, and CD25 mAbs showed that ARF6-positive cells were detected al- most exclusively within the CD4ϩ and CD25ϩ populations. In contrast, CD8ϩ T cells had undetectable or very low expression of ARF6 (Fig. 4A). To address the role of ARF6 on TCR-mediated activation of

primary T cells, we transfected freshly isolated peripheral blood Downloaded from human T cells with either empty vector, ARF6T27N that remains in the GDP-bound state, or ARF6Q67L that remains in the GTP- bound state using the nucleofection technique. Cells were rested in FIGURE 3. T cells with membrane localization of ARF6 are detectable in the peripheral blood of healthy individuals. Purified peripheral blood T medium for 24 h and subsequently stimulated by TCR/CD3 and cells were stained with ARF6 mAb and propidium iodide and analyzed by CD28 cross-linking. Activation of ERK1/2 was determined by im- confocal microscopy. munoblot with phospho-specific Ab. Although forced expression http://www.jimmunol.org/ of ARF6-GDP (ARF6T27N) did not affect ERK1/2 activation, forced expression of ARF6-GTP (ARF6Q67L) resulted in defec- with the role of actin reorganization in the initiation of signaling tive augmentation of ERK1/2 phosphorylation after TCR/CD3 li- cascades that lead to T cell activation, ARF6-GTP prevented TCR/ gation (Fig. 4B). ARF6-GTP (ARF6Q67L) also prevented optimal CD3-mediated ERK1/2 activation (Fig. 2B) and inhibited IL-2 proliferative responses of T cells to TCR/CD3-plus-CD28 ligation transcription (Fig. 2C). (Fig. 4C). T cells with membrane localization of ARF6 are detected in Discussion peripheral blood of healthy individuals Our present studies identified ARF6 as an unexpected target of T by guest on September 26, 2021 The observation that ARF6 intracellular localization provides a cell anergy. ARF6 is expressed in anergic cells, not only in higher detectable morphologic appearance of anergic cells suggests that levels compared with productively stimulated cells, but, more im- ARF6 might be a useful marker for the identification of anergic portantly, in the GTP-bound form that localizes at the plasma cells in vivo. Enumeration of such cells during treatment for tol- membrane. This distinct localization makes ARF6 an attractive erance induction for allogeneic organ or bone marrow transplan- candidate marker for the identification of anergic cells in various tation may provide a useful assessment for the efficiency of the clinical conditions in which anergy may have a critical role. Such

FIGURE 4. ARF6-GTP is detected in peripheral blood T cells and inhibits TCR and CD28-mediated ERK1/2 activation and T cell proliferation. A, Purified peripheral blood T cells were stained with ARF6 mAb and FITC-conjugated donkey anti-mouse serum, followed by incubation with the rhodamine-conjugated CD4, CD8, or CD25. The cells were then analyzed by confocal microscopy. B, Freshly isolated peripheral blood primary human T cells were transfected with either empty vector, ARF6T27N (ARF6-GDP), or ARF6Q67L (ARF6-GTP) by nucleofection. Cells were stimulated by TCR/CD3 and CD28 cross-linking, and activation of ERK1/2 was examined by immunoblot with an Ab specific for phosphorylated ERK1/2, followed by reblotting with an Ab specific for the nonphosphorylated form of ERK1/2. C, DNA synthesis was assessed after in vitro culture of the same samples with anti-CD3 and CD28 mAb for 72 h. Results of one of three independent experiments are shown. The Journal of Immunology 1695 conditions include allogeneic bone marrow and organ transplan- 5. Lenschow, D. J., Y. Zeng, J. R. Thistlethwaite, A. Montag, W. Brady, tation, autoimmune diseases, and cancer in which induction of tol- M. G. Gibson, P. S. Linsley, and J. A. Bluestone. 1992. Long-term survival of xenogeneic pancreatic islet grafts induced by CTLA4lg. Science 257:789. erance to tumor Ags may be an early event in the tumor-bearing 6. Blazar, B. R., P. Taylor, R. J. Noelle, and D. A. Vallera. 1998. CD4ϩ T cells host (25). tolerized ex-vivo to host alloantigen by anti-CD40 ligand (CD40L: CD154) Ab Several studies have provided compelling evidence that central lose their graft-versus-host lethality capacity but retain normal antigen responses. J. Clin. Invest. 102:473. tolerance allows some thymocytes with self-reactivity to slip the 7. Larsen, C. P., E. T. Elwood, D. Z. Alexander, S. C. Ritchie, R. Hendrix, deletion process and exit in the periphery. Self-reactive T cells can C. Tucker-Burden, H. R. Cho, A. Aruffo, D. Hollenbaugh, P. S. Linsley, et al. be isolated from the peripheral blood of healthy individuals, sug- 1996. Long-term acceptance of skin and cardiac allografts after blocking CD40 and CD28 pathways. Nature 381:434. gesting that they are silenced by different mechanisms (1). Our 8. Guinan, E. C., V. A. Boussiotis, D. Neuberg, L. LaVita Brennan, N. Hirano, present data provide evidence that T cells with a phenotypic ARF6 L. M. Nadler, and J. G. Gribben. 1999. Transplantation of anergic histoincom- localization of anergic T cell clones can be detected in the blood of patible bone marrow allografts. N. Engl. J. Med. 340:1704. 9. Appleman, L. J., and V. A. Boussiotis. 2003. T cell anergy and costimulation. healthy individuals, suggesting that active mechanisms for main- Immunol. Rev. 191:1. taining immune quiescence and peripheral tolerance are constitu- 10. Korthauer, U., W. Nagel, E. M. Davis, M. M. Le Beau, R. S. Menon, tively present. The fact that GRP1 GEF (10) and its target, ARF6, E. O. Mitchell, C. A. Kozak, W. Kolanus, and J. A. Bluestone. 2000. Anergic T are transcriptionally up-regulated in anergic cells confirms once lymphocytes selectively express an integrin regulatory protein of the cytohesin family. J. Immunol. 164:308. more the active nature of the anergic state. 11. Lechner, O., J. Lauber, A. Franzke, A. Sarukhan, H. von Boehmer, and J. Buer. The mechanism by which ARF6-GTP inhibits redistribution of 2001. Fingerprints of anergic T cells. Curr. Biol. 11:587. polymerized actin and blocks TCR-mediated activation is still un- 12. Tzachanis, D., G. J. Freeman, N. Hirano, A. A. van Puijenbroek, M. W. Delfs, A. Berezovskaya, L. M. Nalder, and V. A. Boussiotis. 2001. Tob is a negative Downloaded from clear. Studies of other cell types have shown that AFR6 and Rho regulator of activation that is expressed in anergic and quiescent T cells. Nat. GTPases are antagonistic, and ARF6-GTP down-regulates Rho Immunol. 2:1174. and Rac activation (26, 27). It is possible that in a similar manner 13. Krawczyk, C., and J. M. Penninger. 2001. Molecular controls of antigen receptor in T cells, ARF6-GTP inhibits actin reorganization because it in- clustering and autoimmunity. Trends Cell Biol. 11:212. 14. Takai, Y., T. Sasaki, and T. Matozaki. 2001. Small GTP-binding proteins. hibits activation of Rho GTPases. RhoA controls polarization and Physiol. Rev. 81:153. spread of T cells and potentiates AP-1 transcriptional activity after 15. D’Souza-Schorey, C., G. Li, M. I. Colombo, and P. D. Stahl. 1995. A regulatory role for ARF6 in receptor-mediated endocytosis. Science 267:1175. TCR engagement (28Ð30). Mouse T cells expressing constitu- http://www.jimmunol.org/ tively active RhoA are hyperresponsive to TCR-induced prolifer- 16. Donaldson, J. G. 2002. Arf6 and its role in cytoskeletal modulation. Methods Mol. Biol. 189:191. ation (31). Rac1 is activated by TCR, CD28, and CD46-mediated 17. Gaschet, J., and V. W. Hsu. 1999. Distribution of ARF6 between membrane and signals (32Ð34). It is required for activation-dependent actin po- cytosol is regulated by its GTPase cycle. J. Biol. Chem. 274:20040. lymerization (35) and is implicated in the activation of Jun kinase, 18. Diatchenko, L., Y. F. Lau, A. P. Campbell, A. Chenchik, F. Moqadam, B. Huang, S. Lukyanov, K. Lukyanov, N. Gurskaya, E. D. Sverdlov, and P. D. Siebert. phosphorylation of c-Jun, and transactivation of AP-1 (32, 36). 1996. Suppression subtractive hybridization: a method for generating differen- Constitutively active Rac1 is sufficient to induce T cell develop- tially regulated or tissue-specific cDNA probes and libraries. Proc. Natl. Acad. ment even in the absence of a functional pre-TCR (35). The fact Sci. USA 93:6025. 19. Hamm, A., N. Krott, I. Breibach, R. Blindt, and A. K. Bosserhoff. 2002. Efficient that deletion of Vav, a GEF for Rac1 (37), impairs cytoskeletal transfection method for primary cells. Tissue Eng. 8:235. by guest on September 26, 2021 actin organization and T cell activation (38, 39) provides evidence 20. Appleman, L. J., A. A. van Puijenbroek, K. M. Shu, L. M. Nadler, and for the actin requirement for lymphocyte signal transduction. V. A. Boussiotis. 2002. CD28 costimulation mediates down-regulation of p27kip1 and cell cycle progression by activation of the PI3K/PKB signaling pathway in In epithelial cells, ARF6-GTP facilitates disassembly of the ad- primary human T cells. J. Immunol. 168:2729. herens junctions by decreasing Rac1-GTP levels, but also by pro- 21. Langille, S. E., V. Patki, J. K. Klarlund, J. M. Buxton, J. J. Holik, A. Chawla, moting clathrin-dependent internalization of E-cadherin to early S. Corvera, and M. P. Czech. 1999. ADP-ribosylation factor 6 as a target of endosomes (27). In a similar fashion, in T cells ARF6-GTP may guanine nucleotide exchange factor GRP1. J. Biol. Chem. 274:27099. 22. Lowin-Kropf, B., V. S. Shapiro, and A. Weiss. 1998. Cytoskeletal polarization of mediate internalization of critical transmembrane proteins that par- T cells is regulated by an immunoreceptor tyrosine-based activation motif-de- ticipate in the immune response. In this respect, it is noteworthy pendent mechanism. J. Cell Biol. 140:861. that HIV-1 Nef down-regulates MHC class I via the ARF6 endo- 23. Tzachanis, D., A. A. F. L. van Puijenbroek, A. Berezovskaya, G. J. Freedman, L. M. Nadler, and V. A. Boussiotis. 2001. Anergic T cells selectively express cytic pathway, providing a mechanism for HIV-1 immunoevasion ARF6, a GTP-binding protein, which inhibits T cell activation by regulating (40). Further studies will determine the precise mechanism by actin-cytoskeleton remodeling. Blood 98:73. which ARF6-GTP inhibits activation of T cells. 24. Peters, P. J., V. W. Hus, C. E. Ooi, D. Finazzi, S. B. Teal, V. Oorschot, J. G. Donaldson, and R. D. Klausner. 1995. Overexpression of wild type and Regardless of the mechanism by which it regulates T cell acti- mutant ARF1 and ARF6: distinct perturbations of nonoverlapping membrane vation, the distinct intracellular localization of ARF6 provides a compartments. J. Cell Biol. 128:1003. detectable phenotypic appearance of the anergic cells. Finally, the 25. Stavely-O’Carroll, K., E. Sotomayor, J. Montgomery, I. Borrello, L. Hwang, observation that T cells with the intracellular ARF6 distribution S. Fein, D. Pardoll, and H. Levitsky. 1998. Induction of antigen-specific T cell anergy: an early event in the course of tumor progression. Proc. Natl. Acad. Sci. pattern of anergic T cell clones are detected among primary pe- USA 95:1178. ripheral blood T lymphocytes suggests that anergic T cells may 26. Boshans, R. L., S. Szanto, L. van Aelst, and C. D’Souza-Schorey. 2000. ADP- exist in vivo, and their detection may be feasible. ribosylation factor 6 regulates actin cytoskeleton remodeling in coordination with Rac1 and RhoA. Mol. Cell Biol. 20:3685. 27. Palacios, F., J. K. Schweitzer, R. L. Boshans, and C. D’Souza-Schorey. 2002. ARF6-GTP recruits Nm23ÐH1 to facilitate dynamin-mediated endocytosis during References adherens junctions disassembly. Nat. Cell Biol. 4:929. 1. Walker, L. S., and A. K. Abbas. 2002. The enemy within: keeping self-reactive 28. del Pozo, M. A., M. Vicente-Manzanares, R. Tejedor, J. M. Serrador, and T cells at bay in the periphery. Nat. Rev. Immunol. 2:11. F. Sanchez-Madrid. 1999. Rho GTPases control migration and polarization of 2. Schwartz, R. H. 1996. Models of T cell anergy: is there a common molecular adhesion molecules and cytoskeletal ERM components in T lymphocytes. Eur. mechanism? J. Exp. Med. 184:1. J. Immunol. 29:3609. 3. Kirk, A. D., D. M. Harlan, N. N. Armstrong, T. A. Davis, Y. Dong, G. S. Gray, 29. Borroto, A., D. Gil, P. Delgado, M. Vicente-Manzanares, A. Alcover, X. Hong, D. Thomas, J. H. J. Fechner, and S. J. Knechtle. 1997. CTLA4-Ig and F. Sanchez-Madrid, and B. Alarcon. 2000. Rho regulates T cell receptor ITAM- anti-CD40 ligand prevent renal allograft rejection in primates. Proc. Natl. Acad. induced lymphocyte spreading in an integrin-independent manner. Eur. J. Immu- Sci. USA 94:8789. nol. 30:3403. 4. Lin, H., S. F. Bolling, P. Linsley, R. Q. Wei, D. Gordon, C. A. Thompson, and 30. Chang, J. H., J. C. Pratt, S. Sawasdikosol, R. Kapeller, and S. J. Burakoff. 1998. L. A. Turka. 1993. Long-term acceptance of major histocompatibility complex The small GTP-binding protein Rho potentiates AP-1 transcription in T cells. mismatched cardiac allografts induced by CTLA4Ig plus donor-specific transfu- Mol. Cell Biol. 18:4986. sion. J. Exp. Med. 178:1801. 31. Corre, I., M. Gomez, S. Vielkind, and D. A. Cantrell. 2001. Analysis of thymo- 1696 DIFFERENTIAL EXPRESSION OF ARF6 IN ANERGIC CELLS

cyte development reveals that the GTPase RhoA is a positive regulator of T cell 36. Crespo, P., X. R. Bustelo, D. S. Aaronson, O. A. Coso, M. Lopez-Barahona, receptor responses in vivo. J. Exp. Med. 194:903. M. Barbacid, and J. S. Gutkind. 1996. Rac-1 dependent stimulation of the JNK/ 32. Kaminuma, O., M. Deckert, C. Elly, Y. C. Liu, and A. Altman. 2001. Vav-Rac1- SAPK signaling pathway by Vav. Oncogene 13:455. mediated activation of the c-Jun N-terminal kinase/c-Jun/AP-1 pathway plays a 37. Crespo, P., K. E. Schuebel, A. A. Ostrom, J. S. Gutkind, and X. R. Bustelo. 1997. major role in stimulation of the distal NFAT site in the interleukin-2 gene pro- Phosphotyrosine-dependent activation of Rac-1 GDP/GTP exchange by the Vav moter. Mol. Cell Biol. 21:3126. proto-oncogene product. Nature 385:169. 33. Kaga, S., S. Ragg, K. A. Rogers, and A. Ochi. 1998. Stimulation of CD28 with 38. Holsinger, L. J., I. A. Graef, W. Swat, T. Chi, D. M. Bautista, L. Davidson, B7-2 promotes focal adhesion-like cell contacts where Rho family small G pro- R. S. Lewis, F. W. Alt, and G. R. Crabtree. 1998. Defects in actin-cap formation teins accumulate in T cells. J. Immunol. 160:24. in Vav-deﬁcient mice implicate an actin requirement for lymphocyte signal trans- 34. Zaffran, Y., O. Destaing, A. Roux, S. Ory, T. Nheu, P. Jurdic, C. Rabourdin-Combe, duction. Curr. Biol. 8:563. and A. L. Astier. 2001. CD46/CD3 costimulation induces morphological changes of 39. Tarakhovsky, A., M. Turner, S. Schaal, P. J. Mee, L. P. Duddy, K. Rajewsky, and human T cells and activation of Vav, Rac, and extracellular signal-regulated kinase V. L. Tybulewicz. 1995. Defective antigen receptor-mediated proliferation of B mitogen-activated protein kinase. J. Immunol. 167:6780. and T cells in the absence of Vav. Nature 374:467. 35. Gomez, M., D. Kioussis, and D. A. Cantrell. 2001. The GTPase Rac-1 controls 40. Blagoveshchenskaya, A. D., L. Thomas, S. F. Feliciangeli, C. H. Hung, and cell fate in the thymus by diverting thymocytes from positive to negative selec- G. Thomas. 2002. HIV-1 Nef down-regulates MHC-I by a PACS-1- and PI3K- tion. Immunity 15:703. regulated ARF6 endocytic pathway. Cell 111:853. Downloaded from http://www.jimmunol.org/ by guest on September 26, 2021