Mechanism Governing a Stem Cell-Generating Cis-Regulatory Element

Mechanism governing a stem cell-generating PNAS PLUS cis-regulatory element

Rajendran Sanalkumara,b, Kirby D. Johnsona,b, Xin Gaoa,b, Meghan E. Boyera,b, Yuan-I Changb,c, Kyle J. Hewitta,b, Jing Zhangb,c, and Emery H. Bresnicka,b,1

aDepartment of Cell and Regenerative Biology, Wisconsin Institutes for Medical Research, Carbone Cancer Center, University of Wisconsin School of Medicine and Public Health, Madison, WI 53705; cMcArdle Laboratory for Cancer Research, University of Wisconsin School of Medicine and Public Health, Madison, WI 53706; and bUniversity of Wisconsin–Madison Blood Research Program, Madison, WI 53705

Edited by Stuart H. Orkin, Children’s Hospital and the Dana–Farber Cancer Institute, Harvard Medical School and Howard Hughes Medical Institute, Boston, MA, and approved February 11, 2014 (received for review January 2, 2014) The unremitting demand to replenish differentiated cells in tissues transplants (19, 20). Heterozygous mutations of GATA2 underlie requires efficient mechanisms to generate and regulate stem and the development of a human immunodeficiency syndrome, mon- progenitor cells. Although master regulatory transcription factors, ocytopenia and mycobacterial infection (MonoMAC), and related including GATA binding protein-2 (GATA-2), have crucial roles in these disorders, which are accompanied by myelodysplastic syndrome mechanisms, how such factors are controlled in developmentally dy- and acute myeloid leukemia (21–23). Although the critical role namic systems is poorly understood. Previously, we described five of GATA-2 in hematopoietic stem/progenitor biology has been dispersed Gata2 locus sequences, termed the −77, −3.9, −2.8, −1.8, established through rigorous genetic studies, many questions and +9.5 GATA switch sites, which contain evolutionarily conserved remain unanswered regarding mechanisms underlying Gata2 ex- GATA motifs occupied by GATA-2 and GATA-1 in hematopoietic pression and regulation. precursors and erythroid cells, respectively. Despite common Studies in cultured and primary erythroid cells revealed five attributes of transcriptional enhancers, targeted deletions of GATA-1– and GATA-2–occupied upstream (−77, −3.9, −2.8, the −2.8, −1.8, and +9.5 sites revealed distinct and unpredictable and −1.8 kb) and intronic (+9.5 kb) sites of the Gata2 locus (10). contributions to Gata2 expression and hematopoiesis. Herein, we Because GATA-2 occupies these prospective regulatory sites in describe the targeted deletion of the −3.9siteandmechanistically erythroid precursor cells lacking GATA-1, we proposed that this −/− compare the −3.9 site with other GATA switch sites. The −3.9 mice reflects GATA-2–mediated positive autoregulation (10). Be- were viable and exhibited normal Gata2 expression and steady-state cause GATA-1 is expressed during erythropoiesis, it displaces hematopoiesis in the embryo and adult. We established a Gata2 GATA-2, instigating Gata2 repression (24). GATA-1–mediated repression/reactivation assay, which revealed unique +9.5 site displacement of GATA-2 from chromatin is termed GATA activity to mediate GATA factor-dependent chromatin structural switching, and the GATA factor-occupied sites are deemed transitions. Loss-of-function analyses provided evidence for a GATA switch sites (10, 24).

mechanism in which a mediator of long-range transcriptional con- Despite the compelling biochemical and molecular attributes GENETICS trol [LIM domain binding 1 (LDB1)] and a chromatin remodeler of the GATA switch sites, targeted deletion of the −1.8 and −2.8 [Brahma related gene 1 (BRG1)] synergize through the +9.5 site, sites individually in the mouse revealed only minor roles in max- conferring expression of GATA-2, which is known to promote the imizing Gata2 expression in hematopoietic precursors (6, 7). − − − − genesis and survival of hematopoietic stem cells. The −1.8 / and −2.8 / mice were born at normal Mendelian ratios, and hematopoiesis was largely normal in steady-state and stress cis element | HSCs contexts. The −1.8 element is uniquely required to maintain, but

hereas proximal promoter sequences assemble the basal Significance Wtranscriptional machinery and RNA polymerase, distant cis-regulatory elements often confer tissue-specific or context- The continuous replenishment of differentiated cells, for example, dependent transcriptional regulation. Enhancer elements reside those constituting the blood, involves proteins that control the many kilobases upstream or downstream of a promoter or within generation and function of stem and progenitor cells. Although “ introns, and extensive efforts have focused on elucidating ac- “master regulators” are implicated in these processes, many question-at-a-distance” mechanisms (1). Long-range transcriptional tions remain unanswered regarding how their synthesis and control involves physical interactions between proteins bound at activities are regulated. We describe a mechanism that con- distal regions and promoter sequences and higher order struc- trols the production of the master regulator GATA binding tural transitions, including subnuclear relocalization of target protein-2 (GATA-2) in the context of blood stem and progenitor loci (2–4). Given the high frequency of long-range mechanisms cells. Thousands of GATA-2 binding sites exist in the genome, at mammalian loci and the mutations that disrupt the function of and genetic analyses indicate that they differ greatly and un- such elements in pathological conditions, elucidating the un- predictably in functional importance. The parameters involved derlying mechanisms in development, tissue homeostasis, and in endowing sites with functional activity are not established. disease is critically important. In the context of the essential We describe unique insights into ascertaining functionally im- process of hematopoiesis, we have been dissecting long-range portant GATA-2 binding sites within chromosomes. mechanisms controlling the expression and function of the master regulator GATA binding protein-2 (GATA-2) (5–12). Author contributions: R.S., K.D.J., X.G., and E.H.B. designed research; R.S., K.D.J., X.G., M.E.B., and Y.-I.C. performed research; K.D.J. contributed new reagents/analytic tools; The dual zinc finger transcription factor GATA-2 is expressed R.S., K.D.J., X.G., K.J.H., J.Z., and E.H.B. analyzed data; and R.S., K.D.J., and E.H.B. wrote in hematopoietic stem cells (HSCs), select hematopoietic pro- the paper. genitors, endothelial cells, neurons, and additional specialized The authors declare no conflict of interest. cell types (13–18). Targeted deletion of Gata2 revealed its es- This article is a PNAS Direct Submission. sential function for hematopoiesis. Gata2-nullizygous mouse 1To whom correspondence should be addressed. E-mail: [email protected]. embryos die from severe anemia at embryonic day (E) 10.5 (13, This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. +/− 15), and Gata2 HSCs have reduced activity in competitive 1073/pnas.1400065111/-/DCSupplemental.

www.pnas.org/cgi/doi/10.1073/pnas.1400065111 PNAS | Published online March 10, 2014 | E1091–E1100 Downloaded by guest on September 27, 2021 not to initiate, Gata2 repression in late-stage erythroblasts, but this motifs, are essential for +9.5 site enhancer activity in reporter molecular defect was not coupled to major functional deficits (6). assays (11). The E-box binding protein TAL1 cooperates with In contrast to the −1.8 and −2.8 site deletions, targeted deletion GATA factors in the assembly of a multicomponent complex on of the +9.5 intronic site is embryonically lethal at E13.5–E14.5 E-box–GATA composite elements at genes important for blood (5). The +9.5 site is essential for GATA-2 expression in hema- cell development and function (27–33). The TAL1-interacting topoietic stem and progenitor cells (HSPCs) and in endothelium proteins LDB1 and LMO2 control the development and function during embryogenesis (5, 9, 25, 26). Definitive hematopoiesis is of HSPCs (22, 34–38). In addition to binding sites containing − − severely impaired in +9.5 / mice due to defective HSC produc- GATA–E-box composite elements, like the +9.5 site, TAL1 occu- tion, as demonstrated by competitive transplants and imaging of pies GATA motif-containing sites lacking a consensus E-box, pre- HSC genesis from hemogenic endothelium in the dorsal aorta (25). sumably via recruitment by the GATA factor (28). The LIM The +9.5 site contains an E-box–GATA composite element, domain binding-1 coregulator LDB1 promotes chromatin loop- which mediates assembly of a complex containing GATA-1 or ing (39, 40) and facilitates HSC maintenance, primitive hema- GATA-2, T-cell acute lymphocytic leukemia 1 (TAL1), LIM topoietic progenitor generation, and erythroid differentiation domain binding 1 (LDB1), and LIM domain only 2 (LMO2). (37, 41–44). Certain patients with MonoMAC who lack GATA2 The GATA and E-box motifs, and the spacing between the coding region mutations harbored deletion or point mutations in

Fig. 1. The −3.9 GATA switch site bears hallmarks of an important cis-regulatory element. (A) Sequence alignment of the −3.9 site demonstrates conservation among vertebrates. The WGATAR motifs and intervening sequence that were removed by homologous recombination are indicated. (B)ChIP- sequencing profiles for factor occupancy and histone modifications at the Gata2 locus mined from existing datasets (37, 69–72). BM, bone marrow; H3K27a, acetylation of H3 at lysine 27; H3K4m1, monomethylation of histone H3 at lysine 4; MEL, murine erythroleukemia cells. (C) Strategy for targeted deletion of the −3.9 site. Following NeoR excision, the targeted allele has a 126-bp Xba I-to-Not I fragment containing a single LoxP site substituted for the GATA motifs and intervening sequence. Arrowheads indicate positions of primers used for genotype determination. (D) Representative gel shows PCR-based − strategy to distinguish WT and targeted alleles following NeoR excision. (E) Genotypes of viable pups from mating −3.9+/ males and females determined at − − the time of weaning. Expected numbers of pups based on Mendelian ratios are shown in parenthesis. (F) Representative −3.9+/+ and −3.9 / embryos at E12.5.

E1092 | www.pnas.org/cgi/doi/10.1073/pnas.1400065111 Sanalkumar et al. Downloaded by guest on September 27, 2021 or near the +9.5 site (5, 45). Thus, mutations of the +9.5 element, deleted 27 nucleotides encompassing the GATA motifs and PNAS PLUS an essential mediator of definitive hematopoiesis in the mouse, intervening sequence by homologous recombination and excised underlie human hematopoietic pathology. the NeoR gene (Fig. 1C). Targeted and WT alleles were distin- The contributions of the −77 and −3.9 GATA switch sites to guishable by PCR with primers flanking the −3.9 site (Fig. 1D). − − − Gata2 regulation in vivo have not been reported. The −3.9 site Like −1.8 and −2.8 mice, genotypes of −3.9 / and −3.9+/ mutants harbors two inverted GATA motifs and contains canonical conformed to Mendelian genetics, indicating the −3.9 site is dis- − − attributes of cis-regulatory elements, including DNase I hyper- pensable for viability (Fig. 1E). The −3.9 / embryos were sensitivity and GATA site-dependent enhancer activity in a indistinguishable from WT littermates and did not exhibit he- − − transfection assay (9, 12). Because these attributes are shared matopoietic or vascular defects characteristic of +9.5 / embryos with one or more of the −2.8, −1.8, and +9.5 sites, which differ (Fig. 1F). greatly in their importance in vivo, the contribution of the −3.9 Although a single Gata2 allele is sufficient to confer viability in − − site can only be ascertained by disruption of this site at the en- Gata2+/ and +9.5+/ mouse strains, heterozygosity in these dogenous locus. Herein, we describe the consequences of a −3.9 mice reduces Gata2 expression, as well as HSC generation and site deletion from the endogenous Gata2 locus and a mecha- function (5, 19, 20, 25). To assess the influence of the −3.9 nistic comparison of the −3.9 site with the −2.8, −1.8, and +9.5 mutation on HSC genesis, we conducted whole-mount 3D em- sites in biologically relevant contexts. These studies led to a model bryo imaging to visualize c-Kit+ hematopoietic clusters con- to explain the unique importance of the +9.5 site. taining HSCs in E10.5 aorta gonad mesonephros (AGM) of − − − − −3.9+/+ and −3.9 / littermates. Whereas +9.5 / AGM is al- − − Results most devoid of c-Kit staining (25), −3.9 / AGM hematopoietic Sequence Conservation and Transcription Factor Occupancy Do Not clusters were indistinguishable in size and number vs. those of Predict Gata2 Cis-Element Function in Vivo. The −3.9 site contains WT littermates (Fig. 2A). Quantitation of Gata2 mRNA levels in inverted WGATAR motifs that are well conserved among verte- E13.5 fetal livers and brains revealed no differences between − − − brates (Fig. 1A). GATA-2 occupancy of the −3.9 site, first de- −3.9+/+, −3.9+/ , and −3.9 / littermates (Fig. 2B). − − − scribed in GATA-1–null G1E cells (12), occurs in multiple cell In adult −3.9+/+, −3.9+/ , and −3.9 / mice, complete blood − lines and primary cells, including lineage negative (Lin ) he- cell count (CBC) measurements were compared at 2 and 6 mo of matopoietic progenitors from bone marrow (Fig. 1B). Features age (Tables S1 and S2). The quantities of circulating blood cell commonly associated with enhancers [DNase hypersensitivity, types were indistinguishable. Because GATA-2 haploinsufficiency monomethylation of histone H3 at lysine 4, acetylation of H3 at increases quiescence and apoptosis in primitive bone marrow cells lysine 27, and p300 occupancy (46, 47)] characterize the −3.9 site without changes to circulating blood cells (19), the −3.9 mutation and other GATA switch sites. To assess −3.9 site function, we might alter GATA-2 levels in HSPCs without significantly affect-

A -3.9+/+ -3.9-/- B Fetal Liver Fetal Brain GENETICS

AD AD 1.0

c-Kit CD31 c-Kit CD31 -/- 500

+9.5 Levels mRNA 0.5 400 (Relative Units) 300 Gata2 DA 200 *** + 100 0 +/-+/+-/- -RT +/++/- -/- -RT c-Kit cells per DA 0 c-Kit CD31 -3.9+/+ -3.9-/- +9.5-/-

5 C DFE 10 0.15 + + - + + 1.0 0.32 Sca Kit Lin Sca Kit Mpl 4 Hbb-b1 10 +/+ -/- 3 +/+ 0.8 10 0.24 0.10

0.6

Sca-1 5 0.16 10 Sca+ Kit+ 0.4 4 10 0.05 -/-

0.08 3 Levels (Relative Units) mRNA 0.2 Levels (Relative Units) mRNA 10 mRNA Levels (Relative Units) mRNA Gata2 Gata2

0 0 0 Lin- Ter119+ -RT 3 4 5 +/+ -/- -RT -RT 0 10 10 10 Lin- Lin- c-Kit Ter119+ Ter119+ er119- Lin+ er119- er119- Lin+ er119- T T

Fig. 2. The −3.9 site is dispensable for Gata2 expression during hematopoiesis. (A) Whole-mount immunostaining of CD31+ cells (magenta) and c-Kit+ cells − − − − (green) within the aorta region of E10.5 embryos. The −3.9 / embryos were compared with WT littermates and with +9.5 / embryos that almost entirely lack − − c-Kit+ HSCs (25). (Scale bars, 100 μM.) Quantitation of the number of c-Kit+ cells per dorsal aorta (DA) (four embryos each for −3.9+/+ and −3.9 / ; two embryos − − − − − for +9.5 / ) (mean ± SEM). (B) Quantitative analysis of Gata2 mRNA in E13.5 livers [six litters: −3.9+/+ (n = 12), −3.9+/ (n = 20), −3.9 / (n = 18)] and brains [four − − − − litters: −3.9+/+ (n =9),−3.9+/ (n = 14), −3.9 / (n = 11)] (mean ± SEM). −RT, no reverse transcriptase. (C) Ter119+ and Lin populations were sequentially isolated from bone marrow via magnetic bead separation. Enrichment of the distinct populations was confirmed in −3.9+/+ bone marrow samples by measuring the expression of the lineage-restricted genes Mpl (Lin−) and Hbb-b1 (Ter119+). (D) Comparison of Gata2 mRNA expression in Lin− and Ter119+ cells from three independent isolations (mean ± SEM). Fluorescence-activated cell sorting of Sca-1+ and c-Kit+ double-positive cells from Lin− cells of −3.9+/+ and − − − −3.9 / mice (E) and comparison of Gata2 expression in Lin Sca+Kit+ cells from two independent biological replicates (mean ± SD) (F) are shown. ***P < 0.001 (two-tailed unpaired Student t test).

Sanalkumar et al. PNAS | Published online March 10, 2014 | E1093 Downloaded by guest on September 27, 2021 − ing differentiated cell types. Gata2 mRNA levels were quantitated +9.5+/ E12.5 fetal livers using primers specific for the WT or − in Lin progenitors and Ter119+ erythroid cells isolated from mutant −3.9 and +9.5 alleles. Chromatin accessibility was con- − − bone marrow of −3.9+/+ and −3.9 / mice. The purity of each siderably reduced at the mutant alleles (Fig. 3D). Despite the population was confirmed by quantitating expression of lineage- reduced accessibility resulting from the −3.9 mutation, Gata2 − − specific markers Mpl and Hbb-b1 (Fig. 2C). Although highly expression in −3.9 / fetal livers was indistinguishable from that − expressed in the Lin population, Gata2 expression levels were of −3.9+/+ controls (Fig. 2B). Thus, the −3.9 site confers ac- − − indistinguishable between −3.9+/+ and −3.9 / mice (Fig. 2D). cessibility at this site but is dispensable for Gata2 expression. − − In Ter119+ cells, Gata2 expression was not greater than in the Because +9.5 / mice are deficient in fetal liver HSPCs (5), we control lacking reverse transcriptase. Sca-1 and c-Kit double-pos- took advantage of the intronic location of the +9.5 site to con- − − itive cells were sorted from the Lin population (Lin Sca+Kit+) duct allele-specific measurements of Gata2 primary transcripts − − of −3.9+/+ and −3.9 / bone marrow to enrich for HSPCs (Fig. generated from WT and mutant alleles in primary cells from − 2E). Gata2 expression in these cells was not influenced signifi- +9.5+/ mice. In E12.5 fetal liver and adult bone marrow, cantly by the −3.9 mutation (Fig. 2F). transcription of the mutant allele was substantially reduced (P < Despite certain shared molecular attributes of the −3.9 and 0.001) (Fig. 3E), whereas both alleles were expressed equiva- +9.5 sites, the conserved GATA motifs of the −3.9 site were lently in E12.5 fetal brain (Fig. 3E), consistent with our prior dispensable for Gata2 expression in the embryo and adult, steady- findings (5). In summary, although mutations of the −3.9 and +9.5 state hematopoiesis, and embryogenesis. To elucidate the unique sites abrogate local chromatin accessibility, this altered molecular molecular underpinnings of the critical +9.5 site activity, we attributeisonlylinkedtolossofGata2 transcription with the +9.5 mechanistically compared the four GATA switch sites (−3.9, −2.8, site mutation. −1.8, and +9.5) that have been functionally analyzed in vivo. Of the Gata2 GATA switch sites analyzed in vivo, only the +9.5 site contains a conserved E-box in proximity to the GATA Requirements for Assembly of an Intronic Enhancer Complex motif. GATA-2, TAL1, and LDB1 ChIP-sequencing analysis in − Containing Master Regulators of Hematopoiesis. The −3.9 and +9.5 Lin bone marrow (37) revealed the +9.5 site as the sole region GATA switch sites are DNaseI-hypersensitive in murine eryth- of the Gata2 locus occupied by all of these factors (Fig. 4A). roleukemia cells (Fig. 1B) and E14.5 fetal liver (48) (Fig. 3A), Quantitative ChIP analysis in E12.5 fetal liver revealed TAL1 indicative of an open chromatin configuration. As an alternative and LDB1 occupancy at the +9.5 site but not at other GATA approach to evaluate chromatin accessibility at these sites, we switch sites (Fig. 4B). The +9.5 site deletion abrogated TAL1 and conducted formaldehyde-assisted isolation of regulatory elements LDB1 occupancy (P < 0.001) at the mutant, but not WT, alleles − (FAIRE) analysis (49). Genome-wide analyses indicated that in +9.5+/ fetal liver cells (Fig. 4C). The analyses with primary − FAIRE peaks overlap with multiple open chromatin parameters, fetal liver cells from +9.5+/ mice described above revealed +9.5 and FAIRE can be conducted with fewer cells than conventional site-dependent chromatin accessibility and regulatory complex ChIP or DNase I hypersensitivity and/or sensitivity assays (50, 51). assembly at the Gata2 locus. FAIRE analysis of E12.5 fetal liver cells demonstrated enhanced accessibility at the −3.9 and +9.5 sites (Fig. 3B), with the Molecular Attributes That Distinguish the +9.5 Site from Other GATA open chromatin restricted to the GATA switch sites (Fig. 3C). Switch Sites. Because targeted deletion of the −3.9, −2.8, or −1.8 − Allele-specific FAIRE analysis was conducted on −3.9+/ and site individually did not evoke major biological phenotypes, the

-2.8 DNase HS A -3.9 -1.8 +9.5 200

100

1 2 kb Sequence Reads 1G 1S

+/+ +/+ +/+ 1.5 0.8 0.8 B C -3.9 +9.5 0.6 0.6 **** 1.0 ** * 0.4 0.4 * 0.5 * 0.2 0.2 FAIRE Signal FAIRE (Relative Units) FAIRE Signal FAIRE (Relative Units) 0 0 0 -1.2 -0.6 0 +0.6 +1.2 -1.2 -0.6 0 +0.6 +1.2 -3.9 -2.8 -1.8 +9.5 Krt5 Distance from -3.9 (kb) Distance from +9.5 (kb) RPII215 Fetal Liver Fetal Liver Bone Marrow Fetal Brain DE-3.9+/- +9.5+/- +/+ +9.5+/- +/+ +9.5+/- +/+ +9.5+/-

0.6 stpircsnarT 0.8 0.45 0.8 )s

*** cif

i icepS-e

n 0.6 0.6

0.4 evitaleR( U 0.30 *** *** **

0.4 0.4

0.2 2ataG 0.15 e

l 0.2 0.2 l

FAIRE Signal FAIRE A Allele-Specific (Relative Units) 0 0 0 0 Primers: MtWT MtWT Primers: WT MtWT Mt WT Mt WT MtWT Mt WT Mt WT MtWT Mt WT Mt 1o Transcripts -RT 1o Transcripts -RT 1o Transcripts -RT

Fig. 3. GATA switch site mutations abrogate chromatin accessibility at −3.9 and +9.5 sites. (A) DNaseI hypersensitivity at the Gata2 locus in fetal liver mined from mouse Encyclopedia of DNA Elements data (48). (B) Quantitative FAIRE analysis of GATA switch sites in WT fetal liver (n =4,mean± SEM). The promoters of the actively transcribed RNA Polymerase II (RPII215) and inactive Keratin 5 (Krt5) genes were used as positive and negative controls, respectively. (C) Quantitative FAIRE analysis of chromatin accessibility at and surrounding the −3.9 and +9.5 sites (n =4,mean± SEM). The dashed line illustrates the average FAIRE signal at the Krt5 − − promoter. (D) Allele-specific FAIRE analysis of WT and mutated (Mt) alleles in fetal liver cells from −3.9+/ (n =4)and+9.5+/ (n =5)E13.5embryos(mean± SEM). − Primers used for the allele-specific FAIRE analysis are indicated in Table S3.(E) Allele-specific analysis of Gata2 primary transcripts from WT and Mt alleles in +9.5+/ E13.5 fetal liver and brain (n = 8) and adult bone marrow (n = 3) samples (mean ± SEM). *P < 0.05; **P < 0.01; ***P < 0.001 (two-tailed unpaired Student t test).

E1094 | www.pnas.org/cgi/doi/10.1073/pnas.1400065111 Sanalkumar et al. Downloaded by guest on September 27, 2021 PNAS PLUS A 8.1-8.2-9.3- 5.9+ 20 GATA-2

4 30 TAL1

3 18 LDB1 Sequence Reads 3 1G 2 kb 1S

B 0.06 C 0.20 PI TAL1 *** PI TAL1 *** 0.15 0.04

0.10

0.02 0.05 Allele-Specific (Relative Units) (Relative Units) TAL1 Occupancy TAL1 Occupancy 0 0 0.012 0.03 PI LDB1 PI LDB1 *** 0.008 *** 0.02

0.004 0.01 Allele-Specific (Relative Units) (Relative Units) LDB1 Occupancy LDB1 Occupancy 0 0 -3.9 -2.8 -1.8 +9.5 WT Mt

Necdin

Fig. 4. Unique propensity of TAL1 and LDB1 to occupy the +9.5 site. (A) ChIP-sequencing profiles of factor occupancy at the Gata2 locus in lineage-negative GENETICS bone marrow cells mined from existing datasets (37). (B) Quantitative ChIP analysis of TAL1 and LDB1 occupancy at GATA switch sites of the Gata2 locus in E13.5 fetal liver (n = 3, mean ± SEM). ***P < 0.001. The Necdin promoter was used as a negative control. (C) Allele-specific ChIP analysis of TAL1 and LDB1 occupancy at WT and Mt alleles in fetal liver from E13.5 +9.5+/− embryos (n =4,mean± SEM). ***P < 0.001 (two-tailed unpaired Student t test). PI, preimmune.

+9.5 element uniquely endows hemogenic endothelium of the of Gata2 primary transcripts (Fig. 5B) and GATA-2 protein AGM with the capacity to generate long-term repopulating (Fig. 5C), concomitant with reduced ER–GATA-1 levels (Fig. 5C). HSCs (LT-HSCs) that populate the fetal liver (5, 25). In addi- Because we are unaware of a system that allows one to study the − − tion, the small number of HSCs generated from +9.5 / AGM conversion of the repressed Gata2 locus to an active locus, this undergo apoptosis and lack LT activity, indicating that the +9.5 system has unique utility for elucidating GATA switch site element also confers LT-HSC survival (25); a similar conclusion function. emerged from analysis of a conditional Gata2 KO mouse (52). GATA-1–mediated Gata2 repression is associated with GATA-1 The +9.5 site confers maximal Gata2 expression in the AGM replacement of GATA-2 at GATA switch sites (10). To inves- and definitive hematopoietic precursors in the fetal liver (5, 25). tigate the impact of the Gata2 reactivation on the GATA switch, A critical question is what molecular attributes underlie the ChIP analysis was used to quantitate changes in ER–GATA-1 uniquely important +9.5 site activity. and GATA-2 occupancy during Gata2 repression and reacti- To identify molecular attributes that distinguish the +9.5 vation (Fig. 5D). As expected (24), 24 h of β-estradiol treatment site from the other GATA switch sites, we developed a Gata2 induced replacement of GATA-2 by ER–GATA-1 at all sites repression/reactivation system using GATA-1–null G1E pro- tested, although ER–GATA-1 occupancy of the −1.8 site was low, erythroblast-like cells (53). G1E cells express GATA-2 (53), and consistent with our prior findings. Surprisingly, 24 h after washing ectopic expression of GATA-1 represses GATA-2 and overcomes out β-estradiol, when GATA-2 is readily detected by Western an erythroid maturation blockade (10, 54). Using a conditionally blotting, GATA-2 occupancy was only restored at the +9.5 and active GATA-1 allele, in which GATA-1 is fused to the estrogen −3.9 sites (54% and 57% reoccupancy, respectively), despite loss receptor ligand binding domain (ER–GATA-1), β-estradiol treat- of GATA-1 from all sites (Fig. 5D). ment of G1E–ER–GATA-1 cells rapidly induces Gata2 repression Given that GATA-2 occupies all of the Gata2 GATA switch (10). We reasoned that removing β-estradiol from the culture sites before repression but only reoccupies +9.5 and −3.9 sites media subsequent to Gata2 repression would induce time- following Gata2 reactivation, we tested whether ER–GATA-1– dependent loss of ER–GATA-1 activity, ER–GATA-1 dissocia- induced repression creates inaccessible chromatin at the −1.8 tion from chromatin, and reversion of ER–GATA-1 influences and −2.8 sites that persists after ER–GATA-1 dissociation from on gene expression (Fig. 5A). β-Estradiol treatment of G1E–ER– chromatin and prevents subsequent GATA-2 occupancy. We used GATA-1 cells for 24 h strongly reduces Gata2 mRNA and quantitative FAIRE to analyze chromatin accessibility in the protein (10). β-Estradiol washout after 24 h induced reactivation GATA-2 repression/reactivation system. In uninduced proliferating

Sanalkumar et al. PNAS | Published online March 10, 2014 | E1095 Downloaded by guest on September 27, 2021 Wash protein is undetectable, TAL1 and LDB1 levels were unchanged A +Estradiol Wash out C or increased slightly (Fig. 6C). Both factors occupied the −2.8, 02426303648 52 GATA-2 −1.8, and +9.5 sites of the active Gata2 locus (Fig. 6D). Upon B 1.2 +Estradiol Wash out -3 38 Gata2 repression, TAL1 and LDB1 occupancy decreased at the −2.8 and −1.8 sites but was partially retained at the +9.5 site. x 10 0.8 r 102

M Brahma related gene 1 (BRG1) occupied the active and re- Primary 76 ER-GATA-1 pressed loci (Fig. 6E). The TAL1 and LDB1 levels retained at 0.4 β

Transcripts the +9.5 site were comparable to the highly active major pro- -actin Gata2  < 0 38 moter and were considerably higher (P 0.001) than those at the 0 12 24 36 48 02426303648 − − – Time (h) Time (h) 1.8 and 2.8 sites (Fig. 6D); ER GATA-1 is known to increase TAL1 recruitment to the βmajor promoter (40). It is attractive to D +Estradiol Wash out +Estradiol Wash out 0.18 0.18 propose that TAL1/LDB1/BRG1 retention at the +9.5 site of -3.9 -2.8 the repressed Gata2 locus reflects a priming mechanism that

0.12 0.12 creates epigenetic memory to ensure a rapid increase in the chromatin accessibility and factor occupancy required for sub-

0.06 0.06 sequent locus reactivation.

Establishing and Maintaining Physiological GATA-2 Levels: Dual 0 0 0.12 Requirement for a Chromatin Looping Factor and a Chromatin 0.36 -1.8 +9.5 Remodeler. Of the −3.9, −2.8, −1.8, and +9.5 GATA switch

(Relative Units) 0.08 0.24 sites analyzed in mutant mouse strains, TAL1/LDB1 chromatin occupancy is unique to the +9.5 site. We conducted loss-of-

GATA-2/ER-GATA-1 Occupancy GATA-2/ER-GATA-1 0.12 0.04 function analyses to establish the importance of the +9.5 site- occupied components. Regarding the possibility of priming the 0 0 +9.5 site to ensure rapid chromatin remodeling as a requisite 0 12 24 36 48 0 12 24 36 48 )h(emiT )h(emiT step in reactivation, because TAL1 and GATA-1 can localize to GATA-2 ER-GATA-1 chromatin sites with and interact functionally with the ATPase component (BRG1) of the SWI/SNF chromatin remodeling Fig. 5. Gata2 repression/reactivation assay. Evidence for distinct functional complex (55–57), BRG1 might mediate chromatin remodeling at properties of the GATA switch sites is illustrated. (A) Schematic representa- the +9.5 site. To assess the contributions of LDB1 and BRG1 to tion of the experimental strategy for Gata2 repression and reactivation in – – G1E–ER–GATA-1 cells. Treatment of G1E–ER–GATA-1 cells with β-estradiol maintenance of Gata2 expression, uninduced G1E ER GATA-1 activates ER–GATA-1, leading to loss of Gata2 transcripts and protein by 24 h cells were treated twice with siRNA and harvested 24 h after the (10). Washout of β-estradiol reverses Gata2 repression, leading to restoration second treatment (Fig. 7A). When knocked down individually, of GATA-2 by 48-h treatment. (B) Quantitative real-time PCR was used to loss of LDB1 or BRG1 did not influence GATA-2 levels (Fig. measure Gata2 primary transcripts during locus reactivation. After 24 h, 7B), whereas simultaneous loss of LDB1 and BRG1 substantially β -estradiol treatment (+estradiol) cells were washed in PBS and cultured in reduced GATA-2. LDB1 and BRG1 activity to establish Gata2 media without β-estradiol (washout) for an additional 24 h. RNA was isolated and analyzed before β-estradiol treatment (0 h); after 24 h of β-es- expression was assessed with the reactivation system (Fig. 7C). tradiol treatment; and 2, 6, 12, and 24 h following washout (n = 4, mean ± Although knocking down LDB1 or BRG1 individually did not SEM). (C) Representative Western blots of GATA-2 and ER–GATA-1 from prevent Gata2 reactivation, GATA-2 levels were partially re- samples isolated at the same times as the corresponding RNA samples. (D) duced (Fig. 7D, Left and Fig. S1). Knocking down LDB1 did Relative chromatin occupancy of ER-GATA-1 (○) and GATA-2 (●) during not affect GATA-2 chromatin occupancy (Fig. S2). Resembling ± Gata2 reactivation using quantitative ChIP (n = 3, mean SEM). the results with uninduced cells, knocking down LDB1 and BRG1 simultaneously greatly reduced reactivation (Fig. 7D, G1E-ER-GATA-1 cells expressing Gata2, chromatin accessibil- Right). Thus, LDB1 and BRG1 establish and maintain GATA-2 ity of the GATA switch sites was significantly greater than in the expression. inactive Necdin promoter (Fig. 6A). ER–GATA-1–mediated In uninduced cells and reactivation contexts, the LDB1 knock- GATA-2 displacement reduced FAIRE signals at GATA switch down decreased TAL1 levels without a concomitant change in sites 2.8- to 14-fold (Fig. 6B, 24 h). Upon Gata2 reactivation, GATA-2 levels (Fig. 7B). This result is consistent with our prior – – chromatin accessibility was restored (108% of 0 h) only at the TAL1 knockdown in G1E ER GATA-1 cells, which did not +9.5 site (Fig. 6B,48h;P < 0.001); accessibility of −1.8, −2.8, alter GATA-2 levels (58). LDB1 occupies the TAL1 locus (37) and −3.9 sites remained low (Fig. 6B, 48 h). The unique tripartite (Fig. S3), and therefore might directly regulate TAL1 expression. chromatin signature of the +9.5 site, in which accessibility is lost Although individually knocking down LDB1 prevented the res- upon repression and restored upon reactivation, reflects +9.5 toration of TAL1 occupancy at the +9.5 site to a level com- site activity to mediate dynamic chromatin transitions during mensurate with the active Gata2 locus (Fig. 7E), under these Gata2 activation. Because this tripartite chromatin signature conditions, the washout still restored chromatin accessibility distinguishes the +9.5 site from other switch sites, we evaluated (Fig. 7F). TAL1 occupancy (Fig. 7E) and chromatin accessibility mechanisms underlying this unique behavior. (Fig. 7F) decreased at the −1.8 site upon repression and were not In principle, certain factors might be selectively retained at the restored upon Gata2 reactivation. Unlike the individual factor +9.5 site, thus explaining its unique capacity to reestablish ac- knockdowns, the LDB1/BRG1 double knockdown, which blocked cessible chromatin. Based on the +9.5 site-restricted TAL1 and Gata2 reactivation, prevented the washout-induced restoration of LDB1 occupancy in fetal liver (Fig. 4B), we asked whether TAL1 open chromatin at the +9.5 site (Fig. 7E). Because the washout and LDB1 occupancy uniquely characterizes the +9.5 site. Using decreased GATA-1 occupancy at all Gata2 GATA switch sites the repression/reactivation system, we quantitated TAL1 and (Fig. 7G), the inability to reactivate Gata2 when LDB1 and BRG1 LDB1 occupancy at the active (0 h, uninduced), repressed (24 h, levels are limiting cannot be explained by GATA-1 retention. These estradiol-induced), and reactivated (48 h, washout) Gata2 locus. results suggest that the failure to establish an active enhancer Twenty-four hours after β-estradiol treatment, when GATA-2 complex at the +9.5 site underlies the reactivation defect.

E1096 | www.pnas.org/cgi/doi/10.1073/pnas.1400065111 Sanalkumar et al. Downloaded by guest on September 27, 2021 PNAS PLUS 2.0 AB) +Estradiol Wash out +Estradiol Wash out +Estradiol Wash out +Estradiol Wash out

stinUevitale )s 1.5 *** lan -1.8 +9.5 t -3.9 -2.8

ngiS 1.5 *** inU ***

i 1.0

1.0 SERIA

*** evi

ta IAF 0.5 0.5

eR(

(

F 0 0 012243648012243648012243648012243648 -3.9 -2.8 -1.8 +9.5 Time (h) Necdin 0.30 -3.9 -2.8 -1.8 +9.5 major C D ** 0.20 52 GATA-2 *** 0.10 *** 50 *** -3 TAL1 (Relative Units) * Occupancy TAL1 0 PI TAL1 x 10 r LDB1 0.015 M 52 -3.9 -2.8 -1.8 +9.5 major ** ** *** 0.010 *** -actin 38  0.005 0 24 WO

-estradiol (h) (Relative Units) LDB1 Occupancy 0 0 24 WO 0 24 WO 0 24 WO 0 24 WO 0 24 WO IgG LDB1 0.15 E PI BRG1 0.10 ***

0.05 (Relative Units)

BRG1 Occupancy 0 0 24 0 24 0 24 0 24 major +9.5 -1.8 Necdin

Fig. 6. Molecular attributes of the +9.5 site revealed by the repression/reactivation assay. (A) Quantitative FAIRE analysis of chromatin accessibility at GATA switch sites in untreated G1E-ER-GATA-1 cells (0 h). The inactive Necdin locus was used as a negative control (n = 4, mean ± SEM). (B) Quantitative FAIRE analysis of chromatin accessibility at GATA switch sites upon Gata2 repression and reactivation. FAIRE signals for the 0-h times were normalized to 1.0 (n =4, mean ± SEM). (C) Representative Western blots of GATA-2, TAL1, and LDB1 protein levels at the same times analyzed by ChIP. The asterisk represents a nonspecific band. (D) Quantitative ChIP analysis of TAL1 and LDB1 chromatin occupancy at the active (0 h), repressed (+24 h), and reactivated (WO) Gata2 locus. The βmajor promoter was used as a positive control (n = 4, mean ± SEM). **P < 0.01; ***P < 0.001. (E) Quantitative ChIP analysis of BRG1 chromatin occupancy at the active (0 h) and repressed (+24 h) Gata2 locus and control sites (βmajor and Necdin)(n = 3, mean ± SEM). ***P < 0.001. WO, washout. GENETICS

Discussion Gata2 transcriptional activation. This mechanism may be con- How to distill large chromatin occupancy datasets into functionally ceptually similar to the findings that target gene occupancy by critical genomic sites, especially sites distal to genes, represents a certain transcription factors is retained in mitotic chromatin and formidable problem with far-reaching implications. Our mouse is associated with more rapid transcriptional activation upon entry strains lacking GATA switch sites differ grossly in phenotypes into G1 (59, 60). and offer a unique opportunity to elucidate mechanisms that GATA-1 and GATA-2 occupy the TAL1 locus and loci-encoding endow GATA factor-bound chromatin sites with nonredundant components of the TAL1 complex (e.g., the corepressor ETO2) activity in vivo. Despite certain shared molecular attributes of (61, 62). Herein, we demonstrate that TAL1 protein expression the −3.9 and +9.5 sites, the conserved GATA motifs of the −3.9 is sensitive to LDB1 protein levels. The relationship between site were dispensable for Gata2 expression in the embryo or adult, LDB1, TAL1, and GATA-2 can be modeled as a coherent type I in steady-state hematopoiesis, and in embryogenesis. feed-forward loop (Fig. 7H), which is predicted to require per- Because the coupling of the E-box and GATA motif and sistently elevated input signals (e.g., those controlling the LDB1 intronic location distinguish the +9.5 site from the −3.9, −2.8, level/activity), although filtering out transiently elevated input and −1.8 sites, it is attractive to propose that these attributes are signals, to achieve a robust output (e.g., enhanced HSC genera- important determinants of +9.5 site activity in vivo. In Gata2- tion) (63). LDB1 and BRG1 synergistically confer +9.5 site- expressing fetal liver cells, the +9.5 site resided in open chro- accessible chromatin, enhancer activity, and Gata2 expression. matin and assembled a complex containing GATA-2, TAL1, and Although BRG1 was reported to interact functionally with TAL1 LDB1 (Fig. 7I). Simultaneous interrogation of the chromatin (32), we are unaware of examples of a mechanism requiring both − accessibility of WT and mutant alleles in +9.5+/ fetal liver cells BRG1 and LDB1. The BRG1 activity may have broad implica- and analyses with the repression/reactivation system revealed tions in diverse contexts, because BRG1 is required for Pax6- that the +9.5 site mediates dynamic chromatin structure tran- dependent control of neural fate (38), for Olig2 to establish an sitions. Although ER–GATA-1 converted accessible chromatin oligodendrocyte-specific transcriptional program (64), and for at the +9.5 site and other Gata2 GATA switch sites into in- cardiovascular development (65, 66). accessible chromatin, concomitant with repression, the washout- In summary, we describe a mechanism that endows a stem induced loss of GATA-1 activity selectively converted +9.5 site- cell-generating enhancer element with its unique activity and inaccessible chromatin into accessible chromatin. Intriguingly, differentiates it from other GATA factor-bound chromosomal TAL1 and LDB1 were partially retained at the +9.5 site but not sites that we have rigorously analyzed in vivo. Intrinsic to this at other Gata2 GATA switch sites, and upon reactivation, chro- mechanism is synergism between a chromatin looping factor and matin accessibility was only restored at the +9.5 site. These results a chromatin remodeler to generate physiological levels of the suggest that TAL1/LDB1 retention creates an epigenetic memory master hematopoietic regulator GATA-2 (Fig. 7I). In the context that ensures reassembly of the functional +9.5 site enhancer and of hematopoiesis, it will be particularly instructive to consider

Sanalkumar et al. PNAS | Published online March 10, 2014 | E1097 Downloaded by guest on September 27, 2021 A siRNA siRNA Harvest C loidartsE siRNA Wash & siRNA tsevraH

h0 h42 h84 h6h0 h42 h84

GATA-2 GATA-2 B 52 D 52 50 TAL1 50

-3 TAL1 * -3 * LDB1

x 10 LDB1 r x 10 52

52 r M

M 260 260 BRG1 BRG1

-actin 38 -actin 38 + Control siRNA - - + - Estradiol -+wo wo wo wo wo ++ +- - + - + Ldb1 siRNA - - - ++ Control siRNA -- -+- - + Brg1 siRNA -- + - Ldb1 siRNA Brg1 siRNA ---- + -+

0.20 2.4 ** *** E ** F 0.15 *** 1.6 **

0.10 *** 0.8

0.05 FAIRE Signal (Relative Units) (Relative Units) TAL1 Occupancy 0 0 Estradiol -+wo wo wo - + wo wo wo wo wo wo wo Estradiol -+wo wo wo - + wo wo wo wo wo wo wo Control siRNA +++- - +++- - + - + - Control siRNA +++- - +++- - + - + - Ldb1 siRNA ---+- ---+- - + - + Ldb1 siRNA ---+- ---+- - + - + Brg1 siRNA ---- + ---- + - + - + Brg1 siRNA ---- + ---- + - + - + +9.5 -1.8 +9.5 -1.8 +9.5 -1.8 +9.5 -1.8

0.6 G -3.9 -2.8 -1.8 +9.5 H LDB1 *** *** 0.4 *** *** *** ** TAL1 0.2 GATA-2 (Relative Units)

GATA-1 Occupancy 0 Type 1 Coherent Estradiol -+wo wo -+wo wo -+wo wo -+wo wo FeedForward Loop Control siRNA +++- +++- +++- +++ - Ldb1 siRNA ---+ ---+ ---+ --- + Brg1 siRNA --- + --- + --- + --- + PI GATA-1 I Wild type

Gata2 -3.9 +9.5 +9.5 Mutant -3.9 Mutant

Gata2 -3.9 +9.5 -3.9 +9.5

Fig. 7. Mechanism underlying +9.5 site function. (A) Knockdown strategy. Cells were transfected with siRNA twice with a 24-h interval and harvested 48 h after the first transfection. (B) Representative Western blots of GATA-2, TAL1, LDB1, and BRG1 following knockdown of Ldb1 and Brg1 mRNAs individually or in combination. The asterisk represents a nonspecific band. Schematic representation (C) and Western blots (D) of siRNA-mediated factor knockdown strategy during Gata2 repression/reactivation. G1E–ER–GATA-1 cells were induced with β-estradiol (0 h) and transfected twice with factor-specific or control siRNAs at 6 and 24 h postinduction. β-estradiol was washed out at the time of the second transfection. Protein and RNA samples were collected at 24 and 48 h. −, β-estradiol uninduced at 0 h; +, β-estradiol induced at 24 h; WO, β-estradiol washout. All conditions received specific siRNA or nontargeting control siRNA at same molar concentration. (E) ChIP analysis of TAL1 occupancy at the +9.5 and −1.8 sites quantitated under individual knockdown or LDB1 and BRG1 combined knockdown conditions (n = 4, mean ± SEM). **P < 0.01; ***P < 0.001. (F) FAIRE analysis of chromatin accessibility of +9.5 and −1.8 sites following LDB1 and BRG1 individual or LDB1/BRG1 combined knockdown (n = 3, mean ± SEM). ***P < 0.001. (G) ChIP analysis of GATA-1 occupancy at GATA switch sites following LDB1/BRG1 combined knockdown during GATA-2 reactivation (n = 4, mean ± SEM). **P < 0.01; ***P < 0.001. (H) Type I coherent feed-forward loop network motif that controls Gata2 expression. (I) Model depicts GATA switch-site chromatin architecture and its relationship to Gata2 expression. The red X indicates that the motif has been deleted.

whether this mechanism is quite selective for controlling GATA-2 cre)1Cgn/J mice (Jackson Laboratory). Cre-mediated excision of NeoR in the and the GATA-2–dependent genetic network or if it has an progeny was confirmed by PCR using primers flanking the targeted se- impact, more broadly, on the HSPC transcriptome. quence. Primer sequences are provided in Table S3.

Materials and Methods Analysis of Mouse Embryos and Tissues. Staged embryos were obtained from − Generation of Gata2 Δ-3.9 Mutant Mice. The Gata2 −3.9 site sequence AGA- timed matings of Gata2 3.9 heterozygotes. Embryo viability was scored by TAGGAAAATGGCCGCGCGCTATCT containing the inverted WGATAR motifs the presence of a beating heart. E13.5 fetal livers and brains were harvested was replaced with a LoxP-phosphoglycerate kinase neomycin (neo)-LoxP into TRIzol (Invitrogen) for RNA extraction. For CBC analysis, blood samples +/+ +/− −/− cassette via homologous recombination. Targeting was confirmed by from 33 anesthetized mice (four litters: 10 −3.9 ,14−3.9 , and 9 −3.9 Southern blotting. Chimeric mice were generated by blastocyst injection, mice) were collected by retroorbital bleeding at 2 and 6 mo of age. CBC mea- and first filial generation pups were screened for germ-line transmission by surements were collected using a Hemavet CBC Analyzer (Drew Scientific, Inc.). PCR. NeoR excision was achieved by mating to CMV-cre strain B6.C-Tg(CMV- Bone marrow was isolated from femurs and tibias into PBS containing

E1098 | www.pnas.org/cgi/doi/10.1073/pnas.1400065111 Sanalkumar et al. Downloaded by guest on September 27, 2021 2% (vol/vol) FBS and 2 mM EDTA (wash buffer). Dissociated cells were reverse transcriptase (M-MLV RT). Real-time PCR analysis was conducted with PNAS PLUS pelleted at 300 × g for 10 min and resuspended in wash buffer at 1 × 108 SYBR Green Master Mix (Applied Biosystems). Control reactions lacking M- cells per milliliter. Ter119+ cells were isolated by magnetic bead isolation MLV RT yielded little to no signal. Relative expression was determined from using rat anti-mouse Ter-119 Biotin (eBioscience). The Ter-119–depleted a standard curve of serial dilutions of cDNA samples, and values were nor- population was depleted for additional lineage markers using the EasySep malized to 18S RNA expression. Primer sequences are provided in Table S3. Mouse Hematopoietic Progenitor Cell Enrichment Kit (Stemcell Technol- − + + ogies). For isolation of Lin Sca Kit cells, Sca-1 and c-Kit double-positive Quantitative FAIRE Assay. FAIRE analysis was conducted as described (50) with − cells were sorted from Lin cells on a FACSAria II cell sorter (BD Biosciences) minor modifications. Cells were fixed with 1% formaldehyde for 5 min at using rat anti-mouse CD117 allophycocyanin and anti-mouse Ly-6A/E perdi- room temperature and sonicated to shear the DNA to an average size of dine chlorophyll protein-Cyaninine5.5 (eBioscience). Data were analyzed using 200–700 bp. Ten percent of the sonicated chromatin was used as the input FlowJo v9.0.2 software (TreeStar). control. Following phenol/chloroform extraction, ethanol-precipitated DNA pellets were resuspended in 50 μL of nuclease-free water. For FAIRE analysis − − Whole-Embryo Confocal Microscopy. Embryos were fixed, stained, and ana- of fetal livers, −3.9+/ and +9.5+/ embryos from timed matings were col- lyzed as described (25, 67). Briefly, E10.5 embryos were stained for c-Kit using lected at E13.5 into ice-cold PBS. Livers were removed and dissociated by rat anti-mouse c-Kit (BD Biosciences) and Alexa Fluor 647 goat anti-rat IgG pipetting before formaldehyde fixation. An allele-specific quantitative PCR (Invitrogen) and then for PECAM1 using biotinylated rat anti-mouse CD31 assay was conducted with allele-specific primers that distinguish WT and (BD Biosciences) and Cy3-conjugated streptavidin (Jackson ImmunoResearch). mutant alleles. Serial dilutions of input samples were used for generating Samples were cleared in a 1:2 mix of benzyl alcohol and benzyl benzoate to a standard curve, and relative FAIRE signals were calculated for specific sites. increase transparency before imaging with a Nikon A1R Confocal Microscope. – Three-dimensional reconstructions were generated from Z-stacks (50 150 op- Western Blot Analysis. Whole-cell lysates were prepared by boiling 1 × 107 tical sections) using Fiji software. cells per milliliter in SDS sample buffer [25 mM Tris (pH 6.8), 2% β-mercap- toethanol, 3% SDS, 0.1% bromophenol blue, 5% glycerol] for 10 min. Cell Culture. G1E-ER-GATA-1 cells (10, 54) were maintained in Iscove’s mod- Samples (10 μL) were resolved by SDS/PAGE and analyzed with specific ified Dulbecco’s medium (GIBCO) supplemented with 15% FBS (Gemini), 1% antibodies. Rabbit anti–GATA-2 (68) and rabbit anti-TAL1 (11) were de- penicillin/streptomycin (Gemini), 2 U/mL erythropoietin, 120 nM mono- scribed previously. Rat anti–GATA-1 (N-6, sc-265), rabbit anti-BRG1 (H-88, thioglycerol (Sigma), 0.6% conditioned medium from a Kit ligand-producing sc10768), and goat anti-LDB1 (N18, sc11198) were from Santa Cruz Bio- μ – CHO cell line, and 1 g/mL puromycin (Sigma). To induce ER GATA-1, cells technology, and mouse anti–β-actin (3700S) was from Cell Signaling. were treated with 1 μM β-estradiol. For Gata2 reactivation studies, cells were β × ’ induced with -estradiol for 24 h and then washed with 1 Dulbecco s Quantitative ChIP Assay. A quantitative ChIP assay was conducted as described β phosphate buffered saline to remove -estradiol. Cells were grown in media previously (8). Cells cross-linked with 1% formaldehyde were sonicated to β without -estradiol for an additional 24 h, and samples were collected 2, 6, yield DNA with an average size of 200–700 bp and immunoprecipitated with 12, and 24 h after washout. Cell cultures were maintained in a 37 °C incubator specific antibodies [rabbit anti–GATA-1 (68), rabbit anti–GATA-2 (68), and with 5% CO . siRNA-mediated genetic perturbation was used to knock down 2 rabbit anti-TAL1 (11)], LDB1 (N18, sc11198), and BRG1 (ab110641). For BRG1 factors in G1E-ER-GATA-1 cells. Specific SMART Pool siRNAs or nontargeting ChIP, cells were cross-linked with 1% formaldehyde for 20 min. ChIP samples siRNA pools (240 pmol each; Dharmacon) were transfected into cells using were quantitated relative to the input DNA using real-time PCR analysis. Amaxa nucleofection kit R. For knockdown analyses in uninduced cells, cells Rabbit preimmune serum or normal IgG was used as a negative control. were transfected twice with a 24-h interval. For analyses in the reactivation paradigm, two transfections were conducted 6 and 24 h after β-estradiol

ACKNOWLEDGMENTS. This work was supported by Grant R01 DK68634 GENETICS induction. Samples were harvested at 24 h and/or 48 h. from the National Institutes of Health (NIH) (to E.H.B.), a University of Wisconsin–Madison Stem Cell and Regenerative Medicine Center postdoc- Quantitative Real-Time PCR Analysis. Total RNA was purified with TRIzol. toral fellowship (to R.S.), and an NIH T32 Hematology Training Grant Award cDNA was synthesized from 1.5 μg of purified total RNA by Moloney MLV (to K.J.H.).

1. Bender MA, Bulger M, Close J, Groudine M (2000) Beta-globin gene switching and 16. Dorfman DM, Wilson DB, Bruns GA, Orkin SH (1992) Human transcription factor DNase I sensitivity of the endogenous beta-globin locus in mice do not require the GATA-2. Evidence for regulation of preproendothelin-1 gene expression in endo- locus control region. Mol Cell 5(2):387–393. thelial cells. J Biol Chem 267(2):1279–1285. 2. Krivega I, Dean A (2012) Enhancer and promoter interactions-long distance calls. Curr 17. Nardelli J, Thiesson D, Fujiwara Y, Tsai FY, Orkin SH (1999) Expression and genetic Opin Genet Dev 22(2):79–85. interaction of transcription factors GATA-2 and GATA-3 during development of the 3. Harmston N, Lenhard B (2013) Chromatin and epigenetic features of long-range gene mouse central nervous system. Dev Biol 210(2):305–321. regulation. Nucleic Acids Res 41(15):7185–7199. 18. Dasen JS, et al. (1999) Reciprocal interactions of Pit1 and GATA2 mediate signaling 4. Lee HY, Johnson KD, Boyer ME, Bresnick EH (2011) Relocalizing genetic loci into gradient-induced determination of pituitary cell types. Cell 97(5):587–598. specific subnuclear neighborhoods. J Biol Chem 286(21):18834–18844. 19. Rodrigues NP, et al. (2005) Haploinsufficiency of GATA-2 perturbs adult hematopoi- 5. Johnson KD, et al. (2012) Cis-element mutated in GATA2-dependent immunodefi- etic stem-cell homeostasis. Blood 106(2):477–484. ciency governs hematopoiesis and vascular integrity. J Clin Invest 122(10):3692–3704. 20. Ling KW, et al. (2004) GATA-2 plays two functionally distinct roles during the on- 6. Snow JW, et al. (2010) A single cis element maintains repression of the key de- togeny of hematopoietic stem cells. J Exp Med 200(7):871–882. velopmental regulator Gata2. PLoS Genet 6(9):e1001103. 21. Hsu AP, et al. (2011) Mutations in GATA2 are associated with the autosomal dominant 7. Snow JW, et al. (2011) Context-dependent function of “GATA switch” sites in vivo. and sporadic monocytopenia and mycobacterial infection (MonoMAC) syndrome. Blood 117(18):4769–4772. Blood 118(10):2653–2655. 8. Grass JA, et al. (2006) Distinct functions of dispersed GATA factor complexes at an 22. Mansour S, et al.; Lymphoedema Research Consortium (2010) Emberger syndrome- endogenous gene locus. Mol Cell Biol 26(19):7056–7067. primary lymphedema with myelodysplasia: Report of seven new cases. Am J Med 9. Wozniak RJ, Boyer ME, Grass JA, Lee Y, Bresnick EH (2007) Context-dependent GATA Genet A 152A(9):2287–2296. factor function: Combinatorial requirements for transcriptional control in hemato- 23. Hahn CN, et al. (2011) Heritable GATA2 mutations associated with familial myelo- poietic and endothelial cells. J Biol Chem 282(19):14665–14674. dysplastic syndrome and acute myeloid leukemia. Nat Genet 43(10):1012–1017. 10. Grass JA, et al. (2003) GATA-1-dependent transcriptional repression of GATA-2 via 24. Bresnick EH, Lee HY, Fujiwara T, Johnson KD, Keles S (2010) GATA switches as de- disruption of positive autoregulation and domain-wide chromatin remodeling. Proc velopmental drivers. J Biol Chem 285(41):31087–31093. Natl Acad Sci USA 100(15):8811–8816. 25. Gao X, et al. (2013) Gata2 cis-element is required for hematopoietic stem cell gen- 11. Wozniak RJ, et al. (2008) Molecular hallmarks of endogenous chromatin complexes eration in the mammalian embryo. J Exp Med 210(13):2833–2842. containing master regulators of hematopoiesis. Mol Cell Biol 28(21):6681–6694. 26. Lim KC, et al. (2012) Conditional Gata2 inactivation results in HSC loss and lymphatic 12. Martowicz ML, Grass JA, Boyer ME, Guend H, Bresnick EH (2005) Dynamic GATA mispatterning. J Clin Invest 122(10):3705–3717. factor interplay at a multicomponent regulatory region of the GATA-2 locus. J Biol 27. Tripic T, et al. (2009) SCL and associated proteins distinguish active from repressive Chem 280(3):1724–1732. GATA transcription factor complexes. Blood 113(10):2191–2201. 13. Tsai FY, et al. (1994) An early haematopoietic defect in mice lacking the transcription 28. Porcher C, et al. (1996) The T cell leukemia oncoprotein SCL/tal-1 is essential for de- factor GATA-2. Nature 371(6494):221–226. velopment of all hematopoietic lineages. Cell 86(1):47–57. 14. Minegishi N, et al. (1999) The mouse GATA-2 gene is expressed in the para-aortic 29. Wadman IA, et al. (1997) The LIM-only protein Lmo2 is a bridging molecule assem- splanchnopleura and aorta-gonads and mesonephros region. Blood 93(12):4196–4207. bling an erythroid, DNA-binding complex which includes the TAL1, E47, GATA-1 and 15. Tsai FY, Orkin SH (1997) Transcription factor GATA-2 is required for proliferation/ Ldb1/NLI proteins. EMBO J 16(11):3145–3157. survival of early hematopoietic cells and mast cell formation, but not for erythroid 30. Lécuyer E, et al. (2002) The SCL complex regulates c-kit expression in hematopoietic and myeloid terminal differentiation. Blood 89(10):3636–3643. cells through functional interaction with Sp1. Blood 100(7):2430–2440.

Sanalkumar et al. PNAS | Published online March 10, 2014 | E1099 Downloaded by guest on September 27, 2021 31. Lahlil R, Lécuyer E, Herblot S, Hoang T (2004) SCL assembles a multifactorial complex 52. de Pater E, et al. (2013) Gata2 is required for HSC generation and survival. J Exp Med that determines glycophorin A expression. Mol Cell Biol 24(4):1439–1452. 210(13):2843–2850. 32. Xu Z, Huang S, Chang LS, Agulnick AD, Brandt SJ (2003) Identification of a TAL1 53. Weiss MJ, Yu C, Orkin SH (1997) Erythroid-cell-specific properties of transcription target gene reveals a positive role for the LIM domain-binding protein Ldb1 in ery- factor GATA-1 revealed by phenotypic rescue of a gene-targeted cell line. Mol Cell throid gene expression and differentiation. Mol Cell Biol 23(21):7585–7599. Biol 17(3):1642–1651. 33. Palii CG, et al. (2011) Differential genomic targeting of the transcription factor TAL1 54. Gregory T, et al. (1999) GATA-1 and erythropoietin cooperate to promote erythroid in alternate haematopoietic lineages. EMBO J 30(3):494–509. cell survival by regulating bcl-xL expression. Blood 94(1):87–96. 34. Shivdasani RA, Mayer EL, Orkin SH (1995) Absence of blood formation in mice lacking 55. Xu Z, Meng X, Cai Y, Koury MJ, Brandt SJ (2006) Recruitment of the SWI/SNF protein the T-cell leukaemia oncoprotein tal-1/SCL. Nature 373(6513):432–434. Brg1 by a multiprotein complex effects transcriptional repression in murine erythroid 35. Warren AJ, et al. (1994) The oncogenic cysteine-rich LIM domain protein rbtn2 is progenitors. Biochem J 399(2):297–304. essential for erythroid development. Cell 78(1):45–57. 56. Kim SI, Bultman SJ, Kiefer CM, Dean A, Bresnick EH (2009) BRG1 requirement for long- 36. Semerad CL, Mercer EM, Inlay MA, Weissman IL, Murre C (2009) E2A proteins main- range interaction of a locus control region with a downstream promoter. Proc Natl tain the hematopoietic stem cell pool and promote the maturation of myelolymphoid Acad Sci USA 106(7):2259–2264. and myeloerythroid progenitors. Proc Natl Acad Sci USA 106(6):1930–1935. 57. Hu G, et al. (2011) Regulation of nucleosome landscape and transcription factor 37. Li L, et al. (2011) Nuclear adaptor Ldb1 regulates a transcriptional program essential targeting at tissue-specific enhancers by BRG1. Genome Res 21(10):1650–1658. for the maintenance of hematopoietic stem cells. Nat Immunol 12(2):129–136. 58. Fujiwara T, Lee HY, Sanalkumar R, Bresnick EH (2010) Building multifunctionality into 38. Ninkovic J, et al. (2013) The BAF complex interacts with Pax6 in adult neural pro- a complex containing master regulators of hematopoiesis. Proc Natl Acad Sci USA genitors to establish a neurogenic cross-regulatory transcriptional network. Cell Stem 107(47):20429–20434. Cell 13(4):403–418. 59. Blobel GA, et al. (2009) A reconfigured pattern of MLL occupancy within mitotic 39. Deng W, et al. (2012) Controlling long-range genomic interactions at a native locus by chromatin promotes rapid transcriptional reactivation following mitotic exit. Mol Cell targeted tethering of a looping factor. Cell 149(6):1233–1244. 36(6):970–983. 40. Song SH, Hou C, Dean A (2007) A positive role for NLI/Ldb1 in long-range beta-globin 60. John S, Workman JL (1998) Bookmarking genes for activation in condensed mitotic locus control region function. Mol Cell 28(5):810–822. chromosomes. Bioessays 20(4):275–279. 41. Mylona A, et al. (2013) Genome-wide analysis shows that Ldb1 controls essential 61. Fujiwara T, et al. (2009) Discovering hematopoietic mechanisms through genome- hematopoietic genes/pathways in mouse early development and reveals novel players wide analysis of GATA factor chromatin occupancy. Mol Cell 36(4):667–681. in hematopoiesis. Blood 121(15):2902–2913. 62. Wilson NK, et al. (2010) Combinatorial transcriptional control in blood stem/pro- 42. Li L, et al. (2013) Ldb1-nucleated transcription complexes function as primary medi- genitor cells: Genome-wide analysis of ten major transcriptional regulators. Cell Stem ators of global erythroid gene activation. Blood 121(22):4575–4585. Cell 7(4):532–544. 43. Soler E, et al. (2010) The genome-wide dynamics of the binding of Ldb1 complexes 63. Shoval O, Alon U (2010) SnapShot: Network motifs. Cell 143(2):326–e1. during erythroid differentiation. Genes Dev 24(3):277–289. 64. Yu Y, et al. (2013) Olig2 targets chromatin remodelers to enhancers to initiate oli- 44. Love PE, Warzecha C, Li L (2014) Ldb1 complexes: The new master regulators of godendrocyte differentiation. Cell 152(1-2):248–261. erythroid gene transcription. Trends Genet 30(1):1–9. 65. Takeuchi JK, et al. (2011) Chromatin remodelling complex dosage modulates tran- 45. Hsu AP, et al. (2013) GATA2 haploinsufficiency caused by mutations in a conserved scription factor function in heart development. Nature Commun 2:187. intronic element leads to MonoMAC syndrome. Blood 121(19):3830–3837, S1–S7. 66. Willis MS, et al. (2012) Functional redundancy of SWI/SNF catalytic subunits in 46. Barski A, et al. (2007) High-resolution profiling of histone methylations in the human maintaining vascular endothelial cells in the adult heart. Circ Res 111(5):e111–e122. genome. Cell 129(4):823–837. 67. Yokomizo T, et al. (2012) Whole-mount three-dimensional imaging of internally lo- 47. Visel A, et al. (2009) ChIP-seq accurately predicts tissue-specific activity of enhancers. calized immunostained cells within mouse embryos. Nat Protoc 7(3):421–431. Nature 457(7231):854–858. 68. Im H, et al. (2005) Chromatin domain activation via GATA-1 utilization of a small 48. Bernstein BE, et al.; ENCODE Project Consortium (2012) An integrated encyclopedia of subset of dispersed GATA motifs within a broad chromosomal region. Proc Natl Acad DNA elements in the human genome. Nature 489(7414):57–74. Sci USA 102(47):17065–17070. 49. Giresi PG, Kim J, McDaniell RM, Iyer VR, Lieb JD (2007) FAIRE (Formaldehyde-Assisted 69. Shen Y, et al. (2012) A map of the cis-regulatory sequences in the mouse genome. Isolation of Regulatory Elements) isolates active regulatory elements from human Nature 488(7409):116–120. chromatin. Genome Res 17(6):877–885. 70. Neph S, et al. (2012) An expansive human regulatory lexicon encoded in transcription 50. Simon JM, Giresi PG, Davis IJ, Lieb JD (2012) Using formaldehyde-assisted isolation of factor footprints. Nature 489(7414):83–90. regulatory elements (FAIRE) to isolate active regulatory DNA. Nat Protoc 7(2): 71. Trompouki E, et al. (2011) Lineage regulators direct BMP and Wnt pathways to cell- 256–267. specific programs during differentiation and regeneration. Cell 147(3):577–589. 51. Song L, et al. (2011) Open chromatin defined by DNaseI and FAIRE identifies regu- 72. Wu W, et al. (2011) Dynamics of the epigenetic landscape during erythroid differ- latory elements that shape cell-type identity. Genome Res 21(10):1757–1767. entiation after GATA1 restoration. Genome Res 21(10):1659–1671.

E1100 | www.pnas.org/cgi/doi/10.1073/pnas.1400065111 Sanalkumar et al. Downloaded by guest on September 27, 2021