Gene Expression Profiling of Nfatc1-Knockdown In
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
The Title of the Dissertation
UNIVERSITY OF CALIFORNIA SAN DIEGO Novel network-based integrated analyses of multi-omics data reveal new insights into CD8+ T cell differentiation and mouse embryogenesis A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Bioinformatics and Systems Biology by Kai Zhang Committee in charge: Professor Wei Wang, Chair Professor Pavel Arkadjevich Pevzner, Co-Chair Professor Vineet Bafna Professor Cornelis Murre Professor Bing Ren 2018 Copyright Kai Zhang, 2018 All rights reserved. The dissertation of Kai Zhang is approved, and it is accept- able in quality and form for publication on microfilm and electronically: Co-Chair Chair University of California San Diego 2018 iii EPIGRAPH The only true wisdom is in knowing you know nothing. —Socrates iv TABLE OF CONTENTS Signature Page ....................................... iii Epigraph ........................................... iv Table of Contents ...................................... v List of Figures ........................................ viii List of Tables ........................................ ix Acknowledgements ..................................... x Vita ............................................. xi Abstract of the Dissertation ................................. xii Chapter 1 General introduction ............................ 1 1.1 The applications of graph theory in bioinformatics ......... 1 1.2 Leveraging graphs to conduct integrated analyses .......... 4 1.3 References .............................. 6 Chapter 2 Systematic -
Elephantid Genomes Reveal the Molecular Bases of Woolly Mammoth Adaptations to the Arctic
Article Elephantid Genomes Reveal the Molecular Bases of Woolly Mammoth Adaptations to the Arctic Graphical Abstract Authors Vincent J. Lynch, Oscar C. Bedoya-Reina, Aakrosh Ratan, ..., George H. Perry, Webb Miller, Stephan C. Schuster Correspondence [email protected] (V.J.L.), [email protected] (W.M.) In Brief Lynch et al. sequence complete genomes from three Asian elephants and two woolly mammoths and identify amino acid changes unique to woolly mammoths. Woolly-mammoth-specific amino acid changes underlie cold- adapted traits in mammoths, including small ears, thick fur, and altered temperature sensation. Highlights d Complete genomes of three Asian elephants and two woolly mammoths were sequenced d Mammoth-specific amino acid changes were found in 1,642 protein-coding genes d Genes with mammoth-specific changes are associated with adaptation to extreme cold d An amino acid change in TRPV3 may have altered temperature sensation in mammoths Lynch et al., 2015, Cell Reports 12, 217–228 July 14, 2015 ª2015 The Authors http://dx.doi.org/10.1016/j.celrep.2015.06.027 Cell Reports Article Elephantid Genomes Reveal the Molecular Bases of Woolly Mammoth Adaptations to the Arctic Vincent J. Lynch,1,* Oscar C. Bedoya-Reina,2,4 Aakrosh Ratan,2,5 Michael Sulak,1 Daniela I. Drautz-Moses,2,6 George H. Perry,3 Webb Miller,2,* and Stephan C. Schuster2,6 1Department of Human Genetics, The University of Chicago, 920 East 58th Street, CLSC 319C, Chicago, IL 60637, USA 2Center for Comparative Genomics and Bioinformatics, Pennsylvania State University, 506B -
5045.Full.Pdf
IFN Consensus Sequence Binding Protein (Icsbp) Is Critical for Eosinophil Development This information is current as Maja Milanovic, Grzegorz Terszowski, Daniela Struck, of September 28, 2021. Oliver Liesenfeld and Dirk Carstanjen J Immunol 2008; 181:5045-5053; ; doi: 10.4049/jimmunol.181.7.5045 http://www.jimmunol.org/content/181/7/5045 Downloaded from References This article cites 47 articles, 33 of which you can access for free at: http://www.jimmunol.org/content/181/7/5045.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 28, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2008 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology IFN Consensus Sequence Binding Protein (Icsbp) Is Critical for Eosinophil Development1 Maja Milanovic,2* Grzegorz Terszowski,2† Daniela Struck,2‡ Oliver Liesenfeld,‡ and Dirk Carstanjen3* IFN consensus sequence binding protein (Icsbp) (IFN response factor-8) is a hematopoietic transcription factor with dual functions in myelopoiesis and immunity. -
GATA2 Regulates the Erythropoietin Receptor in T(12;21) ALL
GATA2 regulates the erythropoietin receptor in t(12;21) ALL Gaine, M. E., Sharpe, D. J., Smith, J. S., Colyer, H., Hodges, V. M., Lappin, T. R., & Mills, K. I. (2017). GATA2 regulates the erythropoietin receptor in t(12;21) ALL. Oncotarget, 8(39), 66061-66074. https://doi.org/10.18632/oncotarget.19792 Published in: Oncotarget Document Version: Publisher's PDF, also known as Version of record Queen's University Belfast - Research Portal: Link to publication record in Queen's University Belfast Research Portal Publisher rights © 2017 The Authors. This is an open access article published under a Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution and reproduction in any medium, provided the author and source are cited. General rights Copyright for the publications made accessible via the Queen's University Belfast Research Portal is retained by the author(s) and / or other copyright owners and it is a condition of accessing these publications that users recognise and abide by the legal requirements associated with these rights. Take down policy The Research Portal is Queen's institutional repository that provides access to Queen's research output. Every effort has been made to ensure that content in the Research Portal does not infringe any person's rights, or applicable UK laws. If you discover content in the Research Portal that you believe breaches copyright or violates any law, please contact [email protected]. Download date:04. Oct. 2021 www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 39), pp: 66061-66074 Research Paper GATA2 regulates the erythropoietin receptor in t(12;21) ALL Marie E. -
Increased HOXA5 Expression Provides a Selective Advantage for Gain of Whole Chromosome 7 in IDH Wild-Type Glioblastoma
Downloaded from genesdev.cshlp.org on May 11, 2018 - Published by Cold Spring Harbor Laboratory Press Increased HOXA5 expression provides a selective advantage for gain of whole chromosome 7 in IDH wild-type glioblastoma Patrick J. Cimino,1,2,17 Youngmi Kim,1,17 Hua-Jun Wu,3,4,5 Jes Alexander,1 Hans-Georg Wirsching,1,6 Frank Szulzewsky,1 Ken Pitter,7 Tatsuya Ozawa,1,8 Jiguang Wang,9,10,16 Julio Vazquez,11 Sonali Arora,1 Raul Rabadan,9,10 Ross Levine,12 Franziska Michor,3,4,5,13,14,15 and Eric C. Holland1 1Division of Human Biology, Fred Hutchinson Cancer Research Center, Seattle, Washington 98109, USA; 2Department of Pathology, Division of Neuropathology, University of Washington, Seattle, Washington 98104, USA; 3Department of Biostatistics and Computational Biology, Dana-Farber Cancer Institute, Harvard T.H. Chan School of Public Health, Boston, Massachusetts 02215, USA; 4Department of Biostatistics, Harvard T.H. Chan School of Public Health, Boston, Massachusetts 02115, USA; 5Department of Stem Cell and Regenerative Biology, Harvard University, Cambridge, Massachusetts 02138, USA; 6Department of Neurology, University Hospital Zurich, Zurich 8091, Switzerland; 7Department of Cancer Biology and Genetics, Memorial Sloan Kettering Cancer Center, New York, New York 10065, USA; 8Division of Brain Tumor Translational Research, National Cancer Center Research Institute, Tokyo 104-0045, Japan; 9Department of Biomedical Informatics, Columbia University, New York, New York 10027, USA; 10Department of Systems Biology, Columbia University, New York, -
2020 Program Book
PROGRAM BOOK Note that TAGC was cancelled and held online with a different schedule and program. This document serves as a record of the original program designed for the in-person meeting. April 22–26, 2020 Gaylord National Resort & Convention Center Metro Washington, DC TABLE OF CONTENTS About the GSA ........................................................................................................................................................ 3 Conference Organizers ...........................................................................................................................................4 General Information ...............................................................................................................................................7 Mobile App ....................................................................................................................................................7 Registration, Badges, and Pre-ordered T-shirts .............................................................................................7 Oral Presenters: Speaker Ready Room - Camellia 4.......................................................................................7 Poster Sessions and Exhibits - Prince George’s Exhibition Hall ......................................................................7 GSA Central - Booth 520 ................................................................................................................................8 Internet Access ..............................................................................................................................................8 -
Functional Genomics Atlas of Synovial Fibroblasts Defining Rheumatoid Arthritis
medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Functional genomics atlas of synovial fibroblasts defining rheumatoid arthritis heritability Xiangyu Ge1*, Mojca Frank-Bertoncelj2*, Kerstin Klein2, Amanda Mcgovern1, Tadeja Kuret2,3, Miranda Houtman2, Blaž Burja2,3, Raphael Micheroli2, Miriam Marks4, Andrew Filer5,6, Christopher D. Buckley5,6,7, Gisela Orozco1, Oliver Distler2, Andrew P Morris1, Paul Martin1, Stephen Eyre1* & Caroline Ospelt2*,# 1Versus Arthritis Centre for Genetics and Genomics, School of Biological Sciences, Faculty of Biology, Medicine and Health, The University of Manchester, Manchester, UK 2Department of Rheumatology, Center of Experimental Rheumatology, University Hospital Zurich, University of Zurich, Zurich, Switzerland 3Department of Rheumatology, University Medical Centre, Ljubljana, Slovenia 4Schulthess Klinik, Zurich, Switzerland 5Institute of Inflammation and Ageing, University of Birmingham, Birmingham, UK 6NIHR Birmingham Biomedical Research Centre, University Hospitals Birmingham NHS Foundation Trust, University of Birmingham, Birmingham, UK 7Kennedy Institute of Rheumatology, University of Oxford Roosevelt Drive Headington Oxford UK *These authors contributed equally #corresponding author: [email protected] NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. 1 medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. -
Accompanies CD8 T Cell Effector Function Global DNA Methylation
Global DNA Methylation Remodeling Accompanies CD8 T Cell Effector Function Christopher D. Scharer, Benjamin G. Barwick, Benjamin A. Youngblood, Rafi Ahmed and Jeremy M. Boss This information is current as of October 1, 2021. J Immunol 2013; 191:3419-3429; Prepublished online 16 August 2013; doi: 10.4049/jimmunol.1301395 http://www.jimmunol.org/content/191/6/3419 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2013/08/20/jimmunol.130139 Material 5.DC1 References This article cites 81 articles, 25 of which you can access for free at: http://www.jimmunol.org/content/191/6/3419.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on October 1, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Global DNA Methylation Remodeling Accompanies CD8 T Cell Effector Function Christopher D. Scharer,* Benjamin G. Barwick,* Benjamin A. Youngblood,*,† Rafi Ahmed,*,† and Jeremy M. -
Long Noncoding RNA ANRIL Promotes Non–Small Cell Lung
Published OnlineFirst December 12, 2014; DOI: 10.1158/1535-7163.MCT-14-0492 Cancer Biology and Signal Transduction Molecular Cancer Therapeutics Long Noncoding RNA ANRIL Promotes Non–Small Cell Lung Cancer Cell Proliferation and Inhibits Apoptosis by Silencing KLF2 and P21 Expression Feng-qi Nie1, Ming Sun2, Jin-song Yang3, Min Xie2, Tong-peng Xu1, Rui Xia2, Yan-wen Liu2, Xiang-hua Liu2, Er-bao Zhang2, Kai-hua Lu1, and Yong-qian Shu1 Abstract Recent evidence highlights long noncoding RNAs (lncRNA) was increased in NSCLC tissues, and its expression level was as crucial regulators of cancer biology that contribute to essen- significantly correlated with tumor–node–metastasis stages and tial cancer cell functions such as cell proliferation, apoptosis, tumor size. Moreover, patients with high levels of ANRIL and metastasis. In non–small cell lung cancer (NSCLC), several expression had a relatively poor prognosis. In addition, taking lncRNAs' expressions are misregulated and have been nomi- advantage of loss-of-function experiments in NSCLC cells, we nated as critical actors in NSCLC tumorigenesis. LncRNA ANRIL found that knockdown of ANRIL expression could impair cell was first found to be required for the PRC2 recruitment to and proliferation and induce cell apoptosis both in vitro and vivo. silencing of p15INK4B, the expression of which is induced by the Furthermore, we uncover that ANRIL could not repress p15 ATM–E2F1 signaling pathway. Our previous study showed that expression in PC9 cells, but through silencing of KLF2 and P21 ANRIL was significantly upregulated in gastric cancer, and it transcription. Thus, we conclusively demonstrate that lncRNA could promote cell proliferation and inhibit cell apoptosis by ANRIL plays a key role in NSCLC development by associating silencing of miR99a and miR449a transcription. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
Functional Analysis of Somatic Mutations Affecting Receptor Tyrosine Kinase Family in Metastatic Colorectal Cancer
Author Manuscript Published OnlineFirst on March 29, 2019; DOI: 10.1158/1535-7163.MCT-18-0582 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Functional analysis of somatic mutations affecting receptor tyrosine kinase family in metastatic colorectal cancer Leslie Duplaquet1, Martin Figeac2, Frédéric Leprêtre2, Charline Frandemiche3,4, Céline Villenet2, Shéhérazade Sebda2, Nasrin Sarafan-Vasseur5, Mélanie Bénozène1, Audrey Vinchent1, Gautier Goormachtigh1, Laurence Wicquart6, Nathalie Rousseau3, Ludivine Beaussire5, Stéphanie Truant7, Pierre Michel8, Jean-Christophe Sabourin9, Françoise Galateau-Sallé10, Marie-Christine Copin1,6, Gérard Zalcman11, Yvan De Launoit1, Véronique Fafeur1 and David Tulasne1 1 Univ. Lille, CNRS, Institut Pasteur de Lille, UMR 8161 - M3T – Mechanisms of Tumorigenesis and Target Therapies, F-59000 Lille, France. 2 Univ. Lille, Plateau de génomique fonctionnelle et structurale, CHU Lille, F-59000 Lille, France 3 TCBN - Tumorothèque Caen Basse-Normandie, F-14000 Caen, France. 4 Réseau Régional de Cancérologie – OncoBasseNormandie – F14000 Caen – France. 5 Normandie Univ, UNIROUEN, Inserm U1245, IRON group, Rouen University Hospital, Normandy Centre for Genomic and Personalized Medicine, F-76000 Rouen, France. 6 Tumorothèque du C2RC de Lille, F-59037 Lille, France. 7 Department of Digestive Surgery and Transplantation, CHU Lille, Univ Lille, 2 Avenue Oscar Lambret, 59037, Lille Cedex, France. 8 Department of hepato-gastroenterology, Rouen University Hospital, Normandie Univ, UNIROUEN, Inserm U1245, IRON group, F-76000 Rouen, France. 9 Department of Pathology, Normandy University, INSERM 1245, Rouen University Hospital, F 76 000 Rouen, France. 10 Department of Pathology, MESOPATH-MESOBANK, Centre León Bérard, Lyon, France. 11 Thoracic Oncology Department, CIC1425/CLIP2 Paris-Nord, Hôpital Bichat-Claude Bernard, Paris, France. -
UC Riverside UC Riverside Electronic Theses and Dissertations
UC Riverside UC Riverside Electronic Theses and Dissertations Title The Role of AMPK and miR-92a in the Shear Stress Regulation of KLF2 Permalink https://escholarship.org/uc/item/25z876bc Author Wu, Wei Publication Date 2010 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California UNIVERSITY OF CALIFORNIA RIVERSIDE The Role of AMPK and miR-92a in the Shear Stress Regulation of KLF2 A Dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Cellular, Molecular and Developmental Biology by Wei Wu December 2010 Dissertation Committee: Dr. John Shyy, Chairperson Dr. Ameae Walker Dr. Kathryn Defea Copyright by Wei Wu 2010 ii The Dissertation of Wei Wu is approved: ------------------------------------------ ------------------------------------------ ------------------------------------------ Committee Chairperson University of California, Riverside iii Acknowledgements It is a pleasure to thank those who made this dissertation possible. First of all, I would like to thank CMDB program for giving me the opportunity to pursue my Ph.D degree in UCR. A hearty thanks to Dr. Anthony W. Norman, Dr. Helen Henry and the professors who taught and encouraged me in these past years. I owe my deepest gratitude to my major professor, Dr. John Y-J. Shyy, for his guidance and support. I am also grateful to Dr. Ameae M. Walker and Dr. Kathryn Defea for their valuable discussions and constructive suggestions. I am thankful to all of my colleagues and friends for their generous help and precious discussion on my work. My parents and parents-in-law, thanks for your support and unconditional love. Even though we are thousand of miles away, you were always there whenever I needed you.