sign in sign up
<<
Home , HIC2, IKZF2, MYO1F, NUMBL, Sp8 transcription factor, STX17

1

Supplement to:

Identification of Let-7-Regulated Oncofetal

Benjamin Boyerinas1, Sun-Mi Park1, Noam Shomron2, Mads M. Hedegaard3, Jeppe Vinther3, Jens S. Andersen4, Christine Feig1, Jinbo Xu5, Christopher B. Burge2 and Marcus E. Peter1

1The Ben May Department for Cancer Research, University of Chicago, Chicago, IL 60637, 2Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 02139, 3Molecular Evolution Group, Institute of Molecular Biology, University of Copenhagen, DK-2100 Copenhagen, Denmark, 4Center for Experimental Bioinformatics, Department of Biochemistry and Molecular Biology, University of Southern Denmark, DK-5230 Odense M, Denmark and 5The Toyota Technological Institute at Chicago, Chicago, IL 60637 2

Supplementary Methods Mouse data set. Zhang et al (1) used the following method to normalize expression measurements to median-subtracted arcsinh values. First, measurements were converted to arcsinh values using variance stabilizing transformation (2). The arcsinh transformation is similar to natural logarithmic transformation, but the former is also defined for negative numbers while the latter is not. After arcsinh transformation, the relative expression ratios for each were obtained by subtracting the value of the median expression ratio for that gene obtained across 55 tissues from the value of each of its measured expression ratios. The ratios below zero were considered not to be biologically meaningful and were set to zero. Missing values were also set to zero. Roughly speaking, median-subtracted arcsinh values 0, 1, 2, 3, 4, 5, and 6 corresponded to expression ratios: 1, 2.7, 7.5, 20, 55, 155, and 405, respectively. For our study, the expression data from only three embryonic mouse tissues (i.e., E9.5, E12.5 and E15) were analyzed. The mouse data set was annotated by Zhang et al several years ago, so it was necessary to add more annotations to this data set. We obtained new annotations by sequence match. All the unannotated transcripts in this data set were matched against all the mRNAs in the ENSEMBLE database (as of August 1, 2007) (http://www.ensembl.org/index.html) using the software package SSAHA (3). A match was considered good for an unannotated transcript if the sequence identity in the match was at least 98% and the match bit score was at least 100. Only the best match (i.e., the match with the highest match score) for each transcript was used to annotate that particular unannotated transcript. This new annotation procedure increases the number of annotated transcripts from 13,513 to 21,720. Manual sequence searches to complete the annotation of the mouse data set specifically for all predicted let-7 targets downregulated in the A549 and HepG2 cell lines were performed using SSAHA. Mutagenesis. IMP-1 3'UTR fragments were cloned into psiCHECK-2 by digesting the fragments and vector with Xho1 and NotI (NEB), and ligating with T4 DNA ligase (Promega). Site-directed mutagenesis was performed by using the QuickChange II XL site-directed mutagenesis kit (Stratagene, La Jolla, CA) to change three nucleotides in the second, fourth, and sixth positions in the seed match of LCS2 or LCS5 changing the seed sequence from CTACCTC to CAAGCAC. psiCHECK-HMGA2 3'UTR was previously described (4). Transfections (siRNA and miRNA). A549 cells (2.0x104) were reverse transfected in 12-well plates with either Pre-mir hsa-let-7g or negative control #1 precursor miRNA (Ambion) using siPORT NeoFX (Ambion) following the manufacturer’s protocol. Cells were harvested in RIPA lysis buffer after 72hr. For si-IMP1, A549 cells (6.0x104) were seeded in 6-well plates the day before transfection and transfected with either 50 nM si-IMP1 (5) or si-Scrambled control #1 (Dharmacon) using Interferin transfection reagent (Polyplus, NY, NY). Cells were harvested in RIPA lysis buffer after 72 hours. Luciferase Assay. 293TN cells (2.5x104) were seeded in 48-well plates the day before transfection and transfected with psiCHECK-2 vectors together with either 1 pmol pre-miR let-7g or negative control #1 precursor miRNA (Ambion) using Lipofectamine 2000 (Invitrogen, Carlsbad, CA). HeLa cells (2.5 x 104) were seeded in 48-well plates the day before transfection and transfected with the same constructs as above together with either 50 nM of an LNA let-7 inhibitor (Proligo, Carlsbad, CA) or miRCURY Scramble-miR LNA control (Exiqon, Denmark) using JetPEI transfection reagent (PolyPlus, NY, NY). After 72hr, cells were lysed and measured for Renilla luciferase activity according to the manufacturer’s instructions (Promega). All experiments were performed in triplicate and normalized to the activity of the firefly luciferase gene contained within the psiCHECK-2 vector, which provided as an internal transfection control. 3

shIMP-1 lentiviral infection and let-7g transfection. 60,000 A549 were plated in 6-well dishes and infected 24 hr later with lentiviruses containing a short hairpin targeting IMP-1, or with control transduction particles (Sigma) at an MOI of 4. shIMP-1 #3 (TRCN0000075150) had the sequence 5’-CCGGGCGGACTTGGAGAAAGTGTTTCTCGAGAAACACTTTCTCCAAGTCC GCTTTTTG-3’. After 48hrs, cells were counted and plated at a concentration of 20,000/well in 12 well plates. At the time of plating, cells were reverse-transfected with either 200 pmol of pre-let-7g or 200 pmol scrambled-miR. Cells were collected at days 4 and 6 post infection with shIMP-1 and counted using a brightline hemacytometer. Cells from two wells per condition were counted four separate times. On day 6 post infection, cells were lysed in RIPA buffer for western blot analysis. Western Blot Analysis. The antibodies used were as follows: IMP-1 (1:1000, sc-21026; Santa Cruz), HMGA2 (1:3000, 59170AP; BioCheck), (1:50000, A5441; Sigma). Twenty-five micrograms of cell lysates were separated on SDS/12% PAGE, transferred to nitrocellulose membrane (Amersham Pharmacia Biotech), blocked with 5% milk-PBST, and incubated in primary antibody diluted in 1% BSA-PBS-Tween at 4°C overnight. The blot was then incubated in secondary HRP-conjugated antibody (1:10,000) for 1 h at room temperature, followed by the detection of immunoreactive bands using ECL (Amersham Pharmacia Biotech). SILAC analysis MEFcdko cells. The effect of Dicer KO on levels in MEFcdko cells were analysed using Stable Isotope Labeling by Amino Acids in Cell Culture (SILAC) (6). MEFcdko cells were thawed, inoculated in DMEM (10% FBS) and cultured for 3 days to approximately 80% confluency. Dicer knockout was induced by addition of 4-orthohydroxy tamoxifen (Sigma) to a final concentration of 0.5 µM. Control-cells were kept in DMEM without tamoxifen. 72 hours after knockout, cells were shifted to SILAC medium (10% FCS). Semi-heavy 13 Arginine and Lysine ( C6-Arg, d4-Lys) was added to the control cells media, whereas heavy 13 15 13 15 Arginine and Lysine ( C6 N4-Arg, C6 N2-Lys) media was added to the Dicer knock-out cells. The media was changed daily throughout the experiment. After 48 hours of SILAC labelling Dicer knock-out and control cells were trypsinised, mixed and pelleted by centrifugation (200g/5 minutes). Cells were resuspended in 400 µl ice-cold RIPA buffer and lysed by 10 passages through a 21Gx1µ’’ needle mounted on a pre-chilled 1 ml syringe. Debris was removed by centrifugation (10,000g/ 10 minutes) and the protein content of the supernatant determined by BCA quantification. 200 µg protein was concentrated to 30 µl in a microcon YM-3 spin-column. The concentrate was mixed with NuPAGE LDS sample buffer (Invitrogen) and 1 µl of NuPAGE reducing agent (Invitrogen), heated at 70ºC for 10 minutes and loaded on a 4-12% NuPAGE Novex Bis-Tris gel (Invitrogen). The gel was run in MOPS SDS running buffer according to the manufacturer’s recommendations and stained with Colloidal blue (Invitrogen). After destaining, the lane was excised using a clean scalpel and cut into 32 equally sized gel-pieces. Each of the 32 gel-pieces was subjected to in-gel alkylation and trypsination and the resulting peptides purified on reverse-phase C18 Stage tips. The 32 fractions were analysed using nanoscale liquid chromatography-tandem mass spectrometry (LC-MS/MS) on a linear ion trap Fourier-transform ion-cyclotron resonance mass spectrometer (LTQ-FT-ICR, Thermo Finnigan). Peak lists were extracted from the ms data using in-house developed software (DTA supercharge) and used for protein identification in the International Protein Index database (MSIPI version) using the Mascot program (Matrix Science). The peptide ratios were calculated as the isotope peak area of each single scan mass spectrum and averaged for all Arg- and Lys-containing peptide for each protein. MSQuant, an in-house developed software program was used to evaluate the certainty in peptide identification and in peptide abundance ratio. 4

miRNA microarray analysis. miRNA profiling was carried out as described (7). Briefly, in- house printed arrays (Ambion miRvana probes) were hybridized (16 hr 42oC) to the fraction of labeled small RNA isolated from gel (labeling was carried out using the Ambion miRvana kit). Washes were performed as described by manufacturer (Ambion). Microarrays were scanned (Axon GenePix 4000) then expressed miRNAs were defined as those that were expressed 2 standard deviations above background. 5

Supplementary Results Expression of IMP-1 in the NCI60 cells. To explore the generality of the identification of IMP-1 as a let-7 target across the NCI60 cells expressing different levels of endogenous let-7, we determined the per cell protein expression of IMP-1 (Fig. S2) and correlated it with the per cell let- 7 expression in the NCI60 cell lines. In this analysis, a significant negative correlation was found between the expression of let-7d, let-7g and both HMGA2 and IMP-1 (Fig. S3 and data not shown). These data support the conclusion that both HMGA2 and IMP-1, are under control of let-7 in a set of 59 cell lines representing 9 different human cancer types. This observation is important because it supports the assumption that the reexpression of LOGs may be a general feature of cancer and may not be limited to select types of cancers.

HMGA2 and IMP-1 are two LOGs upregulated in mouse embryonic fibroblasts with globally downreglated miRNA expression. Though most previous global analyses have assessed mRNA levels only, the regulatory roles of miRNAs in mammalian cells involve a substantial component of translational as well as mRNA stability regulation. Let-7 which is expressed from 12 different genes represents a major component of the miRNA content of mammalian cells (4, 8). It is therefore likely that a global block in the processing of miRNAs in cells would result in the upregulation of that are under the control of let-7. To test whether potential LOGs are among the proteins that are upregulated in embryonic cells when global miRNA levels are reduced we tested mouse embryonic fibroblasts (MEFs) in which knock out of the Dicer 1 was induced. In these cells 4 days after knocking out Dicer 1 a number of mature miRNAs were downregulated including members of the let-7 family (Table S3). To determine how these changes in miRNA levels affected expression of proteins we subjected these cells to a proteomics analysis using the SILAC system. Moderate changes in protein levels were observed in response to moderate downregulation of miRNA expression. The 30 proteins whose levels increased the most are shown in Table S3, ranked by the degree of upregulation. Three let-7 targets predicted by TargetRank were among the 10 most highly upregulated proteins that were detected (Table S3, highlighted in yellow). These three genes, GOLT1B, HMGA2 and IMP-1, were also down regulated between E9.5 and E15 during mouse development consistent with roles as endogenous let-7 targets. As mentioned earlier, HMGA2 and IMP-1 were predicted as the strongest and second-strongest targets of let-7 by TargetRank. The mRNA of GOLT1B was only downregulated in A549 cells and not in HepG2 cells upon overexpression of let-7 (9) suggesting its targeting may be tumor type-specific. This analysis confirms HMGA2 and IMP-1 as major protein targets for miRNAs in cells of embryonic origin. 6

Supplementary Figures and Tables

Footnotes to Figure 1B: References: 1 - (10-14). 2 - (15-20). In tumors IMP-1 is reexpressed in the majority of colon, breast, lung, brain, and sarcoma tumors (15-17). It is also expressed in mesenchymal tumors, non-small cell lung carcinoma (15), melanoma (18), and in testicular cancer with 100% of the preinvasive carcinoma in situ being positive (19). In addition, IMP-1 was identified as a biomarker and prognostic marker for non-small cell lung carcinoma and colon cancer (16, 21). When IMP-1 was expressed in mammary epithelial cells as a transgene, up to 95% of transgenic mice developed mammary tumors confirming the activity of IMP-1 as a proto- oncogene (22); 3 - (23); 4 - (24); 5 - (25, 26); 6 - (27); 7 - (28); 8 - (29); 9 - (30); 10 - (31, 32); 11 - (33); 12 - (34).

Figure S1. Generation of a pan-let-7 specific LNA inhibitor. Red bold residues label nucleotide positions that are identical among different let-7 family members. Above the let-7 alignment the designed LNA inhibitor is shown with the position of the LNA nucleotides introduced boxed in yellow.

Figure S2. Western blot analysis of 59 of the NCI60 cell lines for HMGA2 and IMP-1.

Figure S3. Analysis of the protein expression levels of HMGA2, IMP-1, E-cadherin and and correlation with let-7d expression in 59 NCI60 cell lines. Protein expression was determined by Western blotting (Fig. S2). Predicted let-7d values from a univariate linear regression are plotted against protein expression. Pearson correlation coefficients (r) and p-values (p) are reported. The correlations are an underestimate since all cell lines without detectable protein expression were included in the analyses. Analysis with either let-7d or miR-98 looked similar (not shown).

Table S1. Let-7 targets as predicted by TargetScan 4.0 ranked according to their TargetRank score.

Table S2. All annotated mouse genes in the mouse data set of levels at three different stages of mouse embryonic development.

Table S3. Changes in miRNA and protein levels following knock out of Dicer in MEFs 7

Supplementary References 1. Zhang W, Morris QD, Chang R, et al. The functional landscape of mouse gene expression. J Biol 2004;3:21. 2. Durbin BP, Hardin JS, Hawkins DM, Rocke DM. A variance-stabilizing transformation for gene-expression microarray data. Bioinformatics 2002;18 Suppl 1:S105-110. 3. Ning Z, Cox AJ, Mullikin JC. SSAHA: a fast search method for large DNA databases. Genome Res 2001;11:1725-1729. 4. Shell S, Park SM, Radjabi AR, et al. Let-7 expression defines two differentiation stages of cancer. Proc Natl Acad Sci U S A, Vol. 104, pp. 11400-11405, 2007. 5. Vikesaa J, Hansen TV, Jonson L, et al. RNA-binding IMPs promote cell adhesion and invadopodia formation. EMBO J 2006;25:1456-1468. 6. Vinther J, Hedegaard MM, Gardner PP, Andersen JS, Arctander P. Identification of miRNA targets with stable isotope labeling by amino acids in cell culture. Nucleic Acids Res 2006;34:e107. 7. Nielsen CB, Shomron N, Sandberg R, et al. Determinants of targeting by endogenous and exogenous microRNA and siRNAs. RNA 2007;13:1894-1910. 8. Park SM, Shell S, Radjabi AR, et al. Let-7 Prevents Early Cancer Progression by Suppressing Expression of the Embryonic Gene HMGA2. Cell Cycle 2007;6:2585-2590. 9. Johnson CD, Esquela-Kerscher A, Stefani G, et al. The let-7 microRNA represses cell proliferation pathways in human cells. Cancer Res 2007;67:7713-7722. 10. Giannini G, Kim CJ, Di Marcotullio L, et al. Expression of the HMGI(Y) gene products in human neuroblastic tumours correlates with differentiation status. Br J Cancer 2000;83:1503-1509. 11. Abe N, Watanabe T, Suzuki Y, et al. An increased high-mobility group A2 expression level is associated with malignant phenotype in pancreatic exocrine tissue. Br J Cancer 2003;89:2104-2109. 12. Chiappetta G, Bandiera A, Berlingieri MT, et al. The expression of the high mobility group HMGI (Y) proteins correlates with the malignant phenotype of human thyroid neoplasias. Oncogene 1995;10:1307-1314. 13. Miyazawa J, Mitoro A, Kawashiri S, Chada KK, Imai K. Expression of mesenchyme- specific gene HMGA2 in squamous cell carcinomas of the oral cavity. Cancer Res 2004;64:2024-2029. 14. Sarhadi VK, Wikman H, Salmenkivi K, et al. Increased expression of high mobility group A proteins in lung cancer. J Pathol 2006;209:206-212. 15. Yisraeli JK. VICKZ proteins: a multi-talented family of regulatory RNA-binding proteins. Biol Cell 2005;97:87-96. 16. Kato T, Hayama S, Yamabuki T, et al. Increased expression of insulin-like growth factor-II messenger RNA-binding protein 1 is associated with tumor progression in patients with lung cancer. Clin Cancer Res 2007;13:434-442. 17. Ioannidis P, Trangas T, Dimitriadis E, et al. C- and IGF-II mRNA-binding protein (CRD-BP/IMP-1) in benign and malignant mesenchymal tumors. Int J Cancer 2001;94:480-484. 18. Chen YT, Gure AO, Tsang S, et al. Identification of multiple cancer/testis antigens by allogeneic antibody screening of a melanoma cell line library. Proc Natl Acad Sci U S A 1998;95:6919-6923. 8

19. Hammer NA, Hansen TO, Byskov AG, et al. Expression of IGF-II mRNA-binding proteins (IMPs) in gonads and testicular cancer. Reproduction 2005;130:203-212. 20. Dimitriadis E, Trangas T, Milatos S, et al. Expression of oncofetal RNA-binding protein CRD-BP/IMP1 predicts clinical outcome in colon cancer. Int J Cancer, Vol. 121, pp. 486- 494, 2007. 21. Dimitriadis E, Trangas T, Milatos S, et al. Expression of oncofetal RNA-binding protein CRD-BP/IMP1 predicts clinical outcome in colon cancer. Int J Cancer 2007;121:486-494. 22. Tessier CR, Doyle GA, Clark BA, Pitot HC, Ross J. Mammary tumor induction in transgenic mice expressing an RNA-binding protein. Cancer Res 2004;64:209-214. 23. Guo Y, Chen Y, Ito H, et al. Identification and characterization of lin-28 homolog B (LIN28B) in human hepatocellular carcinoma. Gene 2006;384:51-61. 24. Cox GA, Mahaffey CL, Nystuen A, Letts VA, Frankel WN. The mouse fidgetin gene defines a new role for AAA family proteins in mammalian development. Nat Genet 2000;26:198-202. 25. Eliseeva E, Pati D, Diccinanni MB, et al. Expression and localization of the CDC34 ubiquitin-conjugating enzyme in pediatric acute lymphoblastic leukemia. Cell Growth Differ 2001;12:427-433. 26. Tanaka K, Kondoh N, Shuda M, et al. Enhanced expression of mRNAs of antisecretory factor-1, gp96, DAD1 and CDC34 in human hepatocellular carcinomas. Biochim Biophys Acta 2001;1536:1-12. 27. Yaniv K, Yisraeli JK. The involvement of a conserved family of RNA binding proteins in embryonic development and carcinogenesis. Gene 2002;287:49-54. 28. Tsuiki H, Nitta M, Furuya A, et al. A novel human nucleoside diphosphate (NDP) kinase, Nm23-H6, localizes in mitochondria and affects cytokinesis. J Cell Biochem 1999;76:254- 269. 29. Lee YC, Kim YJ. Requirement for a functional interaction between mediator components Med6 and Srb4 in RNA polymerase II transcription. Mol Cell Biol 1998;18:5364-5370. 30. Ikeda K, Iyama K, Ishikawa N, et al. Loss of expression of type IV collagen alpha5 and alpha6 chains in colorectal cancer associated with the hypermethylation of their promoter region. Am J Pathol 2006;168:856-865. 31. Line A, Slucka Z, Stengrevics A, et al. Characterisation of tumour-associated antigens in colon cancer. Cancer Immunol Immunother 2002;51:574-582. 32. Kidd M, Modlin IM, Mane SM, et al. The role of genetic markers--NAP1L1, MAGE-D2, and MTA1--in defining small-intestinal carcinoid neoplasia. Ann Surg Oncol 2006;13:253- 262. 33. Fiermonte G, De Leonardis F, Todisco S, et al. Identification of the mitochondrial ATP- Mg/Pi transporter. Bacterial expression, reconstitution, functional characterization, and tissue distribution. J Biol Chem 2004;279:30722-30730. 34. Tanaka H, Imamura N, Oguma N, et al. Acute myelogenous leukemia with PIG-A gene mutation evolved from aplastic anemia-paroxysmal nocturnal hemoglobinuria syndrome. Int J Hematol 2001;73:206-212. Figure S1

LNA/DNA:! 3’ACTCCATCATCCAACGTATCAA ||||||||||||||||||||||! let-7a:!! 5’UGAGGUAGUAGGUUGUAUAGUU let-7b: !! 5’UGAGGUAGUAGGUUGUGUGGUU let-7c: !! 5’UGAGGUAGUAGGUUGUAUGGUU let-7d: !! 5’AGAGGUAGUAGGUUGCAUAGU let-7e: !! 5’UGAGGUAGGAGGUUGUAUAGU let-7f: !! 5’UGAGGUAGUAGAUUGUAUAGUU let-7g: !! 5’UGAGGUAGUAGUUUGUACAGU let-7i: !! 5’UGAGGUAGUAGUUUGUGCUGU mir-98: !! 5’UGAGGUAGUAAGUUGUAUUGUU H M I Actin M G P A - 2 1

H Hs578T M I Actin M

G SF-268 P A

- SF-539 2 1 SNB-75 CCRE-CEM BT-549 MOLT4 SF-295 HL-60 HOP-62 SR U251 K562 SNB-19 RPMI-8226 NCI-H226 HCC-2998 UO-31

KM12 SC1 cell lines SC2 cell lines ACHN COLO205 RXF-393 HT-29 786-0 HCT-15 CAKI-I SW-620 A498 MCF7 TK-10 T-47D LOXIMVI HCT-116 ADR-Res NCI-H322M OVCAR-8 NCI-H23 SN12C NCI-H522 HOP-92 SK-MEL-28 MDA-MB-231 UACC-257 OVCAR-5 MALME-3M PC-3 M-14 OVCAR-4 UACC-62 OVCAR-3 SK-MEL-2 IGROV-1 MDA-MB435 SKOV3 SK-MEL-5 DU-145 EKVX A549

NCI-H460 F i g u r e S 2 Figure S3

E-cadherin Vimentin r= 0.126 r= -0.110 p= 0.350 p= 0.416 n o i s s e r p x e HMGA2 IMP-1 n i e t

o r= -0.293 r= -0.272 r p p= 0.030 p= 0.041 . l e R

Relative expression of let-7d Table S1: All Let-7 targets predicted by TargetScore 4.0 and ranked accoring to the TargetRank scores

Target gene Refseq ID Gene name con total con 8mercon 7mer-m8con 7mer-1Anon-connon-con total non-con 8mer non-con 7mer-m8Repre- 7mer-1A sentativeTotal contextmiRNA TargetRank score score HMGA2 NM_003483 high mobility group AT-hook 72 1 3 3 0 0 0 0 hsa-let-7b -1.26 1.35 IGF2BP1 NM_006546 insulin-like growth factor 2 mRNA5 binding3 protein1 1 1 0 0 0 0 hsa-let-7d -0.79 1.218 LIN28B NM_001004317lin-28 homolog B (C. elegans)4 2 2 0 1 0 0 1 hsa-let-7d -1.12 1.034 C14orf28 NM_001017923chromosome 14 open reading1 frame 280 1 0 3 2 0 1 hsa-let-7g -1.21 0.706 ARID3B NM_006465 AT rich interactive domain 3B5 (BRIGHT-like)0 1 4 0 0 0 0 hsa-let-7i -0.6 0.635 IGF1R NM_000875 insulin-like growth factor 1 receptor2 1 1 0 1 0 0 1 hsa-let-7a -0.53 0.628 FIGN NM_018086 fidgetin 2 1 0 1 1 0 0 1 hsa-let-7g -0.65 0.597 PUNC NM_004884 putative neuronal cell adhesion3 molecule3 0 0 1 0 1 0 hsa-let-7d -0.73 0.594 HIC2 NM_015094 hypermethylated in cancer 2 4 1 3 0 0 0 0 0 hsa-let-7a -0.4 0.586 BACH1 NM_001186 BTB and CNC homology 1, basic2 leucine2 zipper 0transcription0 factor0 1 0 0 0 hsa-let-7c -0.47 0.538 CCNJ NM_019084 cyclin J 1 1 0 0 1 0 0 1 hsa-let-7g -0.51 0.534 CPEB2 NM_182485 cytoplasmic polyadenylation element3 0binding protein1 2 2 0 0 0 0 hsa-let-7d -0.33 0.533 2'-PDE NM_177966 2'-phosphodiesterase 1 1 0 0 1 0 1 0 hsa-let-7a -0.5 0.518 TGFBR1 NM_004612 transforming growth factor, beta2 receptor1 I (activin0 A receptor1 type0 II-like0 kinase,0 53kDa)0 hsa-let-7g -0.54 0.518 TRIM71 NM_001039111tripartite motif-containing 712 2 0 0 0 0 0 0 hsa-let-7d -0.91 0.495 NAP1L1 NM_139207 nucleosome assembly protein2 1-like 11 0 1 0 0 0 0 hsa-let-7b -0.41 0.49 YOD1 NM_018566 YOD1 OTU deubiquinating enzyme2 1 homolog1 (S.1 cerevisiae)0 0 0 0 0 hsa-let-7g -0.62 0.483 PRTG NM_173814 protogenin homolog (Gallus gallus)1 1 0 0 1 0 0 1 hsa-let-7d -0.6 0.478 C10orf6 NM_018121 10 open reading2 frame 60 2 0 0 0 0 0 hsa-miR-98 -0.41 0.474 P18SRP NM_173829 P18SRP protein 1 0 0 1 2 1 0 1 hsa-let-7d -0.27 0.47 PAPPA NM_002581 pregnancy-associated plasma2 protein 1A, pappalysin1 1 0 1 0 0 1 hsa-miR-98 -0.26 0.466 NIPA1 NM_144599 non imprinted in Prader-Willi/Angelman1 0 syndrome1 1 0 1 0 0 1 hsa-let-7a -0.3 0.458 PPP1R15B NM_032833 protein phosphatase 1, regulatory1 (inhibitor)1 subunit0 15B0 1 0 1 0 hsa-let-7c -0.55 0.455 SMARCAD1 NM_020159 SWI/SNF-related, matrix-associated2 actin-dependent0 2 regulator0 0of chromatin,0 subfamily0 a,0 containinghsa-let-7f DEAD/H box-0.62 1 0.446 STARD13 NM_052851 START domain containing 131 0 0 1 1 0 0 1 hsa-miR-98 -0.45 0.434 FNDC3A NM_001079673fibronectin type III domain containing2 0 3A 1 1 0 0 0 0 hsa-let-7f -0.43 0.418 PXDN NM_012293 peroxidasin homolog (Drosophila)2 0 0 2 0 0 0 0 hsa-let-7f -0.16 0.406 BZW1 NM_014670 basic and W2 domains2 01 2 0 0 0 0 0 hsa-let-7f -0.5 0.404 CPEB3 NM_014912 cytoplasmic polyadenylation element2 0binding protein0 3 2 0 0 0 0 hsa-let-7d -0.18 0.394 DLC1 NM_006094 deleted in liver cancer 1 2 0 0 2 0 0 0 0 hsa-let-7a -0.24 0.394 PKN2 NM_006256 protein kinase N2 1 0 0 1 1 0 0 1 hsa-let-7b -0.12 0.394 PTPRD NM_001040712protein tyrosine phosphatase,2 receptor1 type, D0 1 0 0 0 0 hsa-let-7a -0.27 0.382 ACVR2A NM_001616 activin A , type IIA 2 0 0 2 0 0 0 0 hsa-let-7a -0.23 0.378 PGRMC1 NM_006667 membrane1 component0 10 1 1 0 1 0 hsa-let-7d -0.44 0.378 INSR NM_000208 insulin receptor 1 1 0 0 0 0 0 0 hsa-let-7i -0.19 0.377 CDC25A NM_001789 cell division cycle 25 homolog1 A (S. pombe)0 1 0 2 0 1 1 hsa-let-7d -0.33 0.375 CCND2 NM_001759 cyclin D2 3 0 0 3 0 0 0 0 hsa-let-7f -0.09 0.364 LOC285636 NM_175921 hypothetical protein LOC2856361 1 0 0 1 0 1 0 hsa-let-7d -0.41 0.364 MIB1 NM_020774 mindbomb homolog 1 (Drosophila)2 0 2 0 0 0 0 0 hsa-let-7f -0.31 0.36 RAB15 NM_198686 RAB15, member RAS onocogene1 family0 1 0 2 0 2 0 hsa-let-7a -0.18 0.359 RNF165 NM_152470 ring finger protein 165 1 0 0 1 1 1 0 0 hsa-let-7a -0.2 0.354 PGM2L1 NM_173582 phosphoglucomutase 2-like 12 0 1 1 0 0 0 0 hsa-let-7d -0.08 0.35 RP11-50D16.3NM_001012754similar to RIKEN cDNA 8030451K011 1 0 0 0 0 0 0 hsa-let-7a -0.36 0.349 LIMD2 NM_030576 LIM domain containing 2 1 0 1 0 3 0 3 0 hsa-let-7d -0.45 0.348 RANBP2 NM_006267 RAN binding protein 2 1 1 0 0 0 0 0 0 hsa-let-7f -0.41 0.344 KIAA1305 NM_025081 KIAA1305 1 1 0 0 2 0 2 0 hsa-let-7d -0.38 0.343 IGF2BP2 NM_001007225insulin-like growth factor 2 mRNA2 binding1 protein0 2 1 0 0 0 0 hsa-let-7b -0.34 0.342 MYCN NM_005378 v-myc myelocytomatosis viral2 related0 oncogene,0 neuroblastoma2 0 derived0 (avian)0 0 hsa-let-7i -0.36 0.342 CD164 NM_006016 CD164 molecule, sialomucin 1 0 0 1 1 0 0 1 hsa-miR-98 -0.16 0.338 CPEB4 NM_030627 cytoplasmic polyadenylation element2 0binding protein0 4 2 0 0 0 0 hsa-let-7d -0.13 0.338 RICTOR NM_152756 rapamycin-insensitive companion1 of mTOR1 0 0 0 0 0 0 hsa-let-7g -0.27 0.337 ACSL6 NM_001009185acyl-CoA synthetase long-chain1 family1 member0 6 0 0 0 0 0 hsa-let-7d -0.38 0.337 AHCTF1 NM_015446 AT hook containing transcription1 factor1 1 0 0 0 0 0 0 hsa-let-7f -0.46 0.337 FNIP1 NM_001008738folliculin interacting protein 11 1 0 0 0 0 0 0 hsa-miR-98 -0.3 0.337 GAN NM_022041 giant axonal neuropathy ()1 1 0 0 0 0 0 0 hsa-let-7f -0.33 0.337 GDF6 NM_001001557growth differentiation factor 61 1 0 0 0 0 0 0 hsa-let-7g -0.5 0.337 IGF2BP3 NM_006547 insulin-like growth factor 2 mRNA1 binding1 protein0 3 0 0 0 0 0 hsa-let-7a -0.38 0.337 MAP4K3 NM_003618 mitogen-activated protein kinase1 kinase1 kinase0 kinase 30 0 0 0 0 hsa-miR-98 -0.51 0.337 PRPF38B NM_018061 PRP38 pre-mRNA processing 1factor 381 (yeast) 0domain containing0 0 B 0 0 0 hsa-let-7d -0.38 0.337 UHRF2 NM_152896 ubiquitin-like, containing PHD1 and RING1 finger 0domains,0 2 0 0 0 0 hsa-let-7d -0.43 0.337 SUHW2 NM_080764 suppressor of hairy wing homolog1 2 (Drosophila)1 0 0 1 0 1 0 hsa-let-7d -0.33 0.336 DIAPH2 NM_006729 diaphanous homolog 2 (Drosophila)1 0 1 0 1 0 1 0 hsa-let-7i -0.57 0.331 PDPR NM_017990 pyruvate dehydrogenase phosphatase1 1 regulatory0 subunit0 0 0 0 0 hsa-let-7d -0.36 0.33 FNDC3B NM_022763 fibronectin type III domain containing2 0 3B 0 2 0 0 0 0 hsa-let-7c -0.14 0.322 IKZF2 NM_001079526IKAROS family 2 (Helios)1 0 0 1 1 0 0 1 hsa-let-7g -0.16 0.322 PBX3 NM_006195 pre-B-cell leukemia homeobox2 3 0 1 1 0 0 0 0 hsa-miR-98 -0.36 0.322 DMD NM_004016 (muscular dystrophy,1 Duchenne1 and0 Becker0 types) 0 0 0 0 hsa-let-7d -0.35 0.321 EDEM3 NM_025191 ER degradation enhancer, mannosidase1 1 alpha-like0 3 0 0 0 0 0 hsa-let-7a -0.27 0.321 PCDH19 NM_020766 protocadherin 19 1 1 0 0 0 0 0 0 hsa-let-7d -0.24 0.321 UTRN NM_007124 1 1 0 0 0 0 0 0 hsa-let-7a -0.37 0.321 ADRB2 NM_000024 adrenergic, beta-2-, receptor,1 surface1 0 0 0 0 0 0 hsa-let-7a -0.46 0.309 ARHGAP28 NM_001010000Rho GTPase activating protein1 28 1 0 0 0 0 0 0 hsa-let-7a -0.39 0.309 COIL NM_004645 coilin 1 1 0 0 0 0 0 0 hsa-let-7f -0.5 0.309 DUSP16 NM_030640 dual specificity phosphatase 161 0 0 1 1 0 1 0 hsa-let-7a -0.29 0.307 GALNT1 NM_020474 UDP-N-acetyl-alpha-D-galactosamine:polypeptide2 1 0 N-acetylgalactosaminyltransferase1 0 0 0 1 (GalNAc-T1)0 hsa-let-7a -0.45 0.307 FLJ90709 NM_173514 hypothetical protein FLJ907091 0 0 1 1 0 0 1 hsa-let-7g -0.17 0.303 LRIG3 NM_153377 leucine-rich repeats and immunoglobulin-like1 1 domains0 30 0 0 0 0 hsa-let-7a -0.51 0.302 INTS2 NM_020748 integrator complex subunit 21 1 0 0 1 0 0 1 hsa-let-7a -0.28 0.299 ACVR2B NM_001106 activin A receptor, type IIB 2 0 0 2 0 0 0 0 hsa-let-7a -0.03 0.295 CPA4 NM_016352 carboxypeptidase A4 1 1 0 0 0 0 0 0 hsa-let-7d -0.39 0.293 E2F6 NM_198256 6 1 1 0 0 0 0 0 0 hsa-let-7c -0.29 0.293 CPM NM_001005502carboxypeptidase M 1 0 1 0 1 0 0 1 hsa-let-7a -0.29 0.289 ZNF512B NM_020713 zinc finger protein 512B 3 0 3 0 0 0 0 0 hsa-let-7d -0.34 0.288 AAK1 NM_014911 AP2 associated kinase 1 1 0 1 0 1 0 0 1 hsa-let-7g -0.05 0.282 LPGAT1 NM_014873 lysophosphatidylglycerol acyltransferase1 0 1 0 1 1 0 0 1 hsa-let-7g -0.21 0.282 NRK NM_198465 Nik related kinase 1 0 0 1 1 0 0 1 hsa-let-7i -0.17 0.282 COL3A1 NM_000090 collagen, type III, alpha 1 (Ehlers-Danlos1 1 syndrome0 type0 IV, autosomal0 0 dominant)0 0 hsa-let-7a -0.42 0.281 FLJ36031 NM_175884 hypothetical protein FLJ360311 1 0 0 0 0 0 0 hsa-let-7g -0.31 0.281 ACVR1C NM_145259 activin A receptor, type IC 1 1 0 0 0 0 0 0 hsa-miR-98 -0.51 0.281 ADRB1 NM_000684 adrenergic, beta-1-, receptor1 1 0 0 0 0 0 0 hsa-let-7d -0.29 0.281 APBB3 NM_006051 amyloid beta (A4) precursor protein-binding,1 1 family0 B, 0member0 3 0 0 0 hsa-let-7a -0.38 0.281 CDV3 NM_017548 CDV3 homolog (mouse) 1 1 0 0 0 0 0 0 hsa-let-7c -0.36 0.281 COL1A2 NM_000089 collagen, type I, alpha 2 1 1 0 0 0 0 0 0 hsa-let-7g -0.45 0.281 CPEB1 NM_001079533cytoplasmic polyadenylation element1 1binding protein0 1 0 0 0 0 0 hsa-let-7a -0.42 0.281 LIN28 NM_024674 lin-28 homolog (C. elegans) 1 1 0 0 0 0 0 0 hsa-let-7i -0.33 0.281 LRIG2 NM_014813 leucine-rich repeats and immunoglobulin-like1 1 domains0 20 0 0 0 0 hsa-let-7d -0.48 0.281 MAPK6 NM_002748 mitogen-activated protein kinase1 6 1 0 0 0 0 0 0 hsa-let-7b -0.41 0.281 TTL NM_153712 tyrosine ligase 1 1 0 0 0 0 0 0 hsa-let-7a -0.14 0.281 ZNF583 NM_152478 zinc finger protein 583 1 1 0 0 0 0 0 0 hsa-let-7f -0.47 0.281 ZNF644 NM_016620 zinc finger protein 644 2 0 1 1 0 0 0 0 hsa-let-7d -0.26 0.28 C3orf64 NM_173654 chromosome 3 open reading 1frame 640 0 1 1 0 1 0 hsa-let-7b -0.23 0.278 TBKBP1 NM_014726 TBK1 binding protein 1 1 1 0 0 0 0 0 0 hsa-let-7g -0.37 0.278 WDR37 NM_014023 WD repeat domain 37 1 1 0 0 0 0 0 0 hsa-let-7a -0.23 0.278 ETNK1 NM_018638 ethanolamine kinase 1 1 0 1 0 0 0 0 0 hsa-let-7b -0.11 0.277 HOOK1 NM_015888 hook homolog 1 (Drosophila)1 0 1 0 0 0 0 0 hsa-let-7a -0.16 0.277 RSPO2 NM_178565 R-spondin 2 homolog (Xenopus1 laevis)0 1 0 0 0 0 0 hsa-let-7d -0.34 0.277 SFRS12 NM_001077199splicing factor, arginine/serine-rich1 120 0 1 0 0 0 0 hsa-let-7a -0.05 0.277 ULK2 NM_014683 unc-51-like kinase 2 (C. elegans)1 0 1 0 0 0 0 0 hsa-miR-98 -0.31 0.277 CDC34 NM_004359 cell division cycle 34 homolog1 (S. cerevisiae)0 0 1 1 1 0 0 hsa-let-7a -0.36 0.273 ARPP-19 NM_006628 cyclic AMP phosphoprotein, 191 kD 1 0 0 0 0 0 0 hsa-miR-98 -0.21 0.269 GOLT1B NM_016072 golgi transport 1 homolog B (S.1 cerevisiae)1 0 0 0 0 0 0 hsa-let-7g -0.27 0.269 DCX NM_000555 doublecortex; lissencephaly, 1X-linked 0(doublecortin)1 0 1 0 1 0 hsa-let-7d -0.19 0.264 ITGB3 NM_000212 integrin, beta 3 (platelet glycoprotein1 0IIIa, antigen1 CD61)0 1 0 0 1 hsa-let-7a -0.2 0.26 CLDN12 NM_012129 claudin 12 1 1 0 0 0 0 0 0 hsa-let-7a -0.39 0.259 OSMR NM_003999 oncostatin M receptor 1 1 0 0 0 0 0 0 hsa-let-7c -0.46 0.259 COL5A2 NM_000393 collagen, type V, alpha 2 1 1 0 0 0 0 0 0 hsa-let-7d -0.2 0.257 DCUN1D3 NM_173475 DCN1, defective in cullin neddylation1 11, domain0 containing0 3 (S.0 cerevisiae)0 0 0 hsa-let-7d -0.21 0.257 ERCC6 NM_000124 excision repair cross-complementing1 rodent1 repair0 deficiency,0 complementation0 0 0group 6 0 hsa-let-7d -0.45 0.257 TRHDE NM_013381 thyrotropin-releasing hormone2 degrading0 enzyme0 2 0 0 0 0 hsa-let-7d -0.2 0.254 GCNT4 NM_016591 glucosaminyl (N-acetyl) transferase1 4,1 core 2 (beta-1,6-N-acetylglucosaminyltransferase)0 0 0 0 0 0 hsa-let-7a -0.35 0.253 MST150 NM_032947 MSTP150 1 1 0 0 0 0 0 0 hsa-let-7d -0.35 0.253 RASGRP1 NM_005739 RAS guanyl releasing protein 11 (calcium1 and DAG-regulated)0 0 0 0 0 0 hsa-let-7f -0.34 0.253 RDX NM_002906 radixin 1 1 0 0 0 0 0 0 hsa-let-7a -0.29 0.253 SLAMF6 NM_052931 SLAM family member 6 1 1 0 0 0 0 0 0 hsa-miR-98 -0.27 0.253 SLC2A12 NM_145176 solute carrier family 2 (facilitated1 glucose1 transporter),0 0member0 12 0 0 0 hsa-let-7f -0.26 0.253 NAT12 NM_001011713N-acetyltransferase 12 2 0 1 1 0 0 0 0 hsa-let-7a -0.34 0.252 SMCR7L NM_019008 Smith-Magenis syndrome chromosome1 0 region, 1candidate0 7-like1 0 0 1 hsa-let-7f -0.17 0.251 ZBTB39 NM_014830 zinc finger and BTB domain containing1 1 39 0 0 0 0 0 0 hsa-let-7d -0.14 0.25 MASP1 NM_001879 mannan-binding lectin serine1 peptidase0 1 (C4/C21 activating0 component1 0 of Ra-reactive1 factor)0 hsa-let-7a -0.57 0.249 OSBPL3 NM_015550 oxysterol binding protein-like1 3 0 1 0 0 0 0 0 hsa-let-7a -0.25 0.249 MGC61598 NM_001004354similar to -repeat protein1 Nrarp0 1 0 1 0 1 0 hsa-let-7a -0.11 0.248 RGS16 NM_002928 regulator of G-protein signalling2 16 0 1 1 0 0 0 0 hsa-let-7d -0.28 0.248 SRGAP3 NM_001033117SLIT-ROBO Rho GTPase activating1 protein0 3 0 1 1 0 1 0 hsa-miR-98 -0.17 0.248 DTX2 NM_020892 deltex homolog 2 (Drosophila)2 1 0 1 0 0 0 0 hsa-let-7d -0.37 0.247 TRIM67 NM_001004342tripartite motif-containing 672 1 1 0 0 0 0 0 hsa-let-7c -0.19 0.247 GNPTAB NM_024312 N-acetylglucosamine-1-phosphate1 transferase,1 0 alpha and0 beta subunits0 0 0 0 hsa-let-7a -0.45 0.246 CBL NM_005188 Cas-Br-M (murine) ecotropic 2retroviral1 transforming1 sequence0 0 0 0 0 hsa-let-7f -0.13 0.243 B3GNT1 NM_006876 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase1 1 0 0 01 0 0 0 hsa-let-7f -0.29 0.241 KCTD21 NM_001029859potassium channel tetramerisation1 domain1 containing0 210 1 0 1 0 hsa-miR-98 -0.51 0.241 MAP3K3 NM_002401 mitogen-activated protein kinase2 kinase0 kinase0 3 2 0 0 0 0 hsa-let-7b 0.07 0.239 ADAMTS8 NM_007037 ADAM metallopeptidase with 1thrombospondin1 type0 1 motif,0 8 0 0 0 0 hsa-let-7f -0.44 0.238 NDST2 NM_003635 N-deacetylase/N-sulfotransferase1 (heparan1 glucosaminyl)0 0 2 0 0 0 0 hsa-let-7a -0.25 0.238 NOPE NM_020962 likely ortholog of mouse neighbor1 of Punc1 E11 0 0 0 0 0 0 hsa-let-7a -0.25 0.238 PLEKHG6 NM_018173 pleckstrin homology domain containing,1 1 family 0G (with 0RhoGef 0domain)0 member0 6 0 hsa-let-7d -0.35 0.238 ZFYVE26 NM_015346 zinc finger, FYVE domain containing1 261 0 0 0 0 0 0 hsa-let-7a -0.39 0.238 C15orf29 NM_024713 chromosome 15 open reading1 frame 290 1 0 0 0 0 0 hsa-let-7b -0.21 0.237 RIOK3 NM_003831 RIO kinase 3 (yeast) 1 0 1 0 0 0 0 0 hsa-let-7f -0.28 0.237 BCL7A NM_001024808B-cell CLL/lymphoma 7A 1 0 0 1 0 0 0 0 hsa-let-7f -0.08 0.237 BNC2 NM_017637 basonuclin 2 1 0 0 1 0 0 0 0 hsa-let-7g -0.08 0.237 COL19A1 NM_001858 collagen, type XIX, alpha 1 1 0 0 1 0 0 0 0 hsa-let-7f -0.14 0.237 EEA1 NM_003566 early endosome antigen 1 1 0 1 0 0 0 0 0 hsa-let-7a -0.26 0.237 IKBKAP NM_003640 inhibitor of kappa light polypeptide1 gene0 enhancer1 in B-cells,0 kinase0 complex-associated0 0 0proteinhsa-let-7a -0.27 0.237 KLF9 NM_001206 Kruppel-like factor 9 1 0 1 0 0 0 0 0 hsa-let-7a -0.23 0.237 RDH10 NM_172037 retinol dehydrogenase 10 (all-trans)1 0 1 0 0 0 0 0 hsa-miR-98 -0.32 0.237 RPS6KA3 NM_004586 ribosomal protein S6 kinase, 190kDa, polypeptide0 1 3 0 1 0 0 1 hsa-miR-98 -0.15 0.237 SNX16 NM_022133 sorting nexin 16 1 0 1 0 0 0 0 0 hsa-let-7f -0.24 0.237 TAF5 NM_006951 TAF5 RNA polymerase II, TATA1 box binding0 protein0 (TBP)-associated1 0 factor,0 100kDa0 0 hsa-let-7d -0.16 0.237 USP38 NM_032557 ubiquitin specific peptidase 381 0 1 0 0 0 0 0 hsa-let-7g -0.36 0.237 VASH2 NM_024749 vasohibin 2 1 0 0 1 0 0 0 0 hsa-let-7d -0.13 0.237 PLCXD3 NM_001005473phosphatidylinositol-specific phospholipase1 0 C, X1 domain0 containing1 3 0 1 0 hsa-let-7a -0.23 0.236 C22orf9 NM_001009880chromosome 22 open reading1 frame 91 0 0 1 0 0 1 hsa-let-7a -0.01 0.228 SPRYD4 NM_207344 SPRY domain containing 4 1 0 1 0 0 0 0 0 hsa-let-7f -0.2 0.225 CECR6 NM_031890 cat eye syndrome chromosome1 region,0 candidate1 6 0 0 0 0 0 hsa-let-7d -0.18 0.221 COL24A1 NM_152890 collagen, type XXIV, alpha 1 1 0 1 0 0 0 0 0 hsa-let-7a -0.22 0.221 IL10 NM_000572 interleukin 10 1 0 0 1 0 0 0 0 hsa-let-7e -0.11 0.221 MGAT4A NM_012214 mannosyl (alpha-1,3-)-glycoprotein1 beta-1,4-N-acetylglucosaminyltransferase,0 1 0 0 0 isozyme0 0A hsa-let-7a -0.29 0.221 NLK NM_016231 nemo-like kinase 1 0 1 0 0 0 0 0 hsa-let-7a -0.14 0.221 RAB11FIP4 NM_032932 RAB11 family interacting protein2 4 (class0 II) 2 0 0 0 0 0 hsa-let-7d -0.29 0.221 RAB8B NM_016530 RAB8B, member RAS oncogene1 family0 0 1 0 0 0 0 hsa-let-7f -0.13 0.221 ZNF318 NM_014345 zinc finger protein 318 1 0 1 0 0 0 0 0 hsa-let-7g -0.22 0.221 CYP19A1 NM_000103 cytochrome P450, family 19, 1subfamily1 A, polypeptide0 10 0 0 0 0 hsa-let-7f -0.44 0.219 KLHL24 NM_017644 kelch-like 24 (Drosophila) 1 0 0 1 1 0 0 1 hsa-let-7a 0.04 0.219 MXD1 NM_002357 MAX dimerization protein 1 1 1 0 0 0 0 0 0 hsa-miR-98 -0.29 0.213 PPARGC1B NM_133263 peroxisome proliferator-activated2 receptor0 gamma,0 coactivator2 01 beta 0 0 0 hsa-let-7c -0.18 0.212 UGCGL1 NM_001025777UDP-glucose ceramide glucosyltransferase-like2 0 0 1 2 0 0 0 0 hsa-let-7d -0.08 0.211 ADRB3 NM_000025 adrenergic, beta-3-, receptor1 1 0 0 0 0 0 0 hsa-let-7d -0.28 0.21 KIAA1446 NM_020836 likely ortholog of rat brain-enriched1 guanylate1 0kinase-associated0 0 protein0 0 0 hsa-let-7b -0.34 0.21 ANKFY1 NM_016376 ankyrin repeat and FYVE domain1 containing1 1 0 0 0 0 0 0 hsa-let-7a -0.08 0.21 DPP3 NM_005700 dipeptidyl-peptidase 3 1 1 0 0 0 0 0 0 hsa-let-7a -0.33 0.21 EFHD2 NM_024329 EF-hand domain family, member1 D2 1 0 0 0 0 0 0 hsa-let-7f -0.2 0.21 FZD4 NM_012193 frizzled homolog 4 (Drosophila)1 1 0 0 0 0 0 0 hsa-let-7f -0.35 0.21 HAND1 NM_004821 heart and neural crest derivatives1 expressed1 10 0 0 0 0 0 hsa-let-7a -0.41 0.21 SLC35D2 NM_007001 solute carrier family 35, member1 D2 1 0 0 0 0 0 0 hsa-let-7d -0.44 0.21 C11orf57 NM_001082969chromosome 11 open reading1 frame 570 1 0 0 0 0 0 hsa-let-7f -0.29 0.209 KIAA0776 NM_015323 KIAA0776 1 0 1 0 0 0 0 0 hsa-let-7f -0.23 0.209 NID2 NM_007361 nidogen 2 (osteonidogen) 1 0 0 1 0 0 0 0 hsa-let-7g -0.14 0.209 POLR3D NM_001722 polymerase (RNA) III (DNA directed)1 0polypeptide1 D, 44kDa0 1 0 0 1 hsa-let-7d -0.19 0.209 SMAD2 NM_001003652SMAD family member 2 1 0 1 0 0 0 0 0 hsa-let-7b -0.15 0.209 ZNF294 NM_015565 zinc finger protein 294 1 0 1 0 0 0 0 0 hsa-let-7d -0.29 0.209 ADAMTS5 NM_007038 ADAM metallopeptidase with 1thrombospondin0 type1 1 motif,0 5 (aggrecanase-2)0 0 0 0 hsa-let-7a -0.13 0.207 FLJ25476 NM_152493 FLJ25476 protein 2 0 2 0 0 0 0 0 hsa-let-7b -0.1 0.206 DOT1L NM_032482 DOT1-like, histone H3 methyltransferase1 1 (S. cerevisiae)0 0 0 0 0 0 hsa-let-7a 0 0.203 LRIG1 NM_015541 leucine-rich repeats and immunoglobulin-like1 1 domains0 10 0 0 0 0 hsa-let-7a 0 0.203 PCGF3 NM_006315 polycomb group ring finger 31 1 0 0 0 0 0 0 hsa-let-7a -0.23 0.203 SCD NM_005063 stearoyl-CoA desaturase (delta-9-desaturase)1 1 0 0 0 0 0 0 hsa-miR-98 -0.31 0.201 FASLG NM_000639 Fas ligand (TNF superfamily, 1member1 6) 0 0 0 0 0 0 hsa-let-7d -0.24 0.201 FRAS1 NM_025074 Fraser syndrome 1 1 1 0 0 0 0 0 0 hsa-let-7b -0.35 0.201 MLL2 NM_003482 myeloid/lymphoid or mixed-lineage1 leukemia1 20 0 0 0 0 0 hsa-let-7d -0.23 0.201 RRM2 NM_001034 ribonucleotide reductase M2 polypeptide1 1 0 0 0 0 0 0 hsa-let-7a -0.35 0.201 TMEM2 NM_013390 transmembrane protein 2 1 1 0 0 0 0 0 0 hsa-let-7g -0.38 0.201 HDLBP NM_005336 high density lipoprotein binding1 protein1 (vigilin)0 0 1 0 1 0 hsa-let-7d -0.2 0.2 GIPC1 NM_005716 GIPC PDZ domain containing 1family, member1 10 0 0 0 0 0 hsa-let-7g -0.17 0.198 XYLT1 NM_022166 xylosyltransferase I 1 1 0 0 0 0 0 0 hsa-let-7b -0.03 0.198 DNAJC1 NM_022365 DnaJ (Hsp40) homolog, subfamily1 C, 0member 10 1 0 0 0 0 hsa-let-7d -0.23 0.197 FAM96A NM_032231 family with sequence similarity1 96, member0 A 0 1 0 0 0 0 hsa-let-7c -0.16 0.197 FLJ31818 NM_152556 hypothetical protein FLJ318181 0 0 1 0 0 0 0 hsa-let-7a -0.13 0.197 FLJ45187 NM_207371 hypothetical protein LOC3876401 0 0 1 0 0 0 0 hsa-let-7d -0.12 0.197 IL6 NM_000600 interleukin 6 (interferon, beta1 2) 0 0 1 0 0 0 0 hsa-let-7d -0.11 0.197 MEIS2 NM_170675 Meis 2 1 0 0 1 0 0 0 0 hsa-let-7d -0.17 0.197 SH2B3 NM_005475 SH2B adaptor protein 3 1 0 0 1 0 0 0 0 hsa-let-7g -0.15 0.197 A2BP1 NM_145893 ataxin 2-binding protein 1 1 0 0 1 0 0 0 0 hsa-let-7f -0.19 0.197 ACTA1 NM_001100 actin, alpha 1, skeletal muscle1 0 0 1 0 0 0 0 hsa-let-7c -0.24 0.197 ARL5A NM_001037174ADP-ribosylation factor-like 5A1 0 0 1 0 0 0 0 hsa-let-7g -0.14 0.197 BTBD3 NM_014962 BTB (POZ) domain containing1 3 0 0 1 0 0 0 0 hsa-let-7c -0.2 0.197 BTG2 NM_006763 BTG family, member 2 1 0 0 1 0 0 0 0 hsa-let-7a -0.04 0.197 CHD9 NM_025134 chromodomain helicase DNA 1binding protein0 9 0 1 0 0 0 0 hsa-let-7a -0.03 0.197 DDEF1 NM_018482 development and differentiation1 enhancing0 factor0 1 1 0 0 0 0 hsa-let-7d -0.11 0.197 DUSP1 NM_004417 dual specificity phosphatase 11 0 0 1 0 0 0 0 hsa-let-7a -0.18 0.197 EIF2C3 NM_024852 eukaryotic translation initiation1 factor0 2C, 3 0 1 0 0 0 0 hsa-let-7f -0.1 0.197 EPHA3 NM_005233 EPH receptor A3 1 0 0 1 0 0 0 0 hsa-let-7b -0.15 0.197 FBXO30 NM_032145 F-box protein 30 1 0 0 1 0 0 0 0 hsa-let-7g -0.16 0.197 FRS2 NM_001042555fibroblast growth factor receptor1 substrate0 2 0 1 0 0 0 0 hsa-let-7i -0.11 0.197 GDPD1 NM_182569 glycerophosphodiester phosphodiesterase1 0 domain0 containing1 1 0 0 0 0 hsa-let-7a -0.2 0.197 HAND2 NM_021973 heart and neural crest derivatives1 expressed0 20 1 0 0 0 0 hsa-let-7f -0.15 0.197 HECTD2 NM_182765 HECT domain containing 2 1 0 0 1 0 0 0 0 hsa-let-7a -0.21 0.197 KPNA4 NM_002268 karyopherin alpha 4 (importin1 alpha 3)0 0 1 0 0 0 0 hsa-let-7f -0.15 0.197 POGZ NM_015100 pogo transposable element with1 ZNF domain0 0 1 0 0 0 0 hsa-let-7a -0.13 0.197 PPTC7 NM_139283 PTC7 protein phosphatase homolog1 (S.0 cerevisiae)0 1 0 0 0 0 hsa-let-7d -0.07 0.197 PREI3 NM_015387 preimplantation protein 3 1 0 0 1 0 0 0 0 hsa-let-7a -0.18 0.197 RAB11FIP2 NM_014904 RAB11 family interacting protein1 2 (class0 I) 0 1 0 0 0 0 hsa-let-7a -0.17 0.197 RALGPS1 NM_014636 Ral GEF with PH domain and 1SH3 binding0 motif0 1 1 0 0 0 0 hsa-let-7g -0.11 0.197 RB1 NM_000321 retinoblastoma 1 (including osteosarcoma)1 0 0 1 0 0 0 0 hsa-let-7a -0.11 0.197 RNF44 NM_014901 ring finger protein 44 1 0 0 1 0 0 0 0 hsa-let-7i -0.14 0.197 SBK1 NM_001024401SH3-binding domain kinase 11 0 0 1 0 0 0 0 hsa-let-7b -0.1 0.197 SEC14L1 NM_001039573SEC14-like 1 (S. cerevisiae) 1 0 0 1 0 0 0 0 hsa-let-7g -0.18 0.197 SENP5 NM_152699 SUMO1/sentrin specific peptidase1 5 0 0 1 0 0 0 0 hsa-let-7b -0.15 0.197 SLC25A4 NM_001151 solute carrier family 25 (mitochondrial1 0 carrier; 0adenine 1nucleotide0 translocator),0 0 member0 4hsa-let-7g -0.11 0.197 SLC4A7 NM_003615 solute carrier family 4, sodium1 bicarbonate0 cotransporter,0 1 member0 7 0 0 0 hsa-let-7g -0.06 0.197 TRIB1 NM_025195 tribbles homolog 1 (Drosophila)1 0 0 1 0 0 0 0 hsa-let-7d -0.07 0.197 TSC22D2 NM_014779 TSC22 domain family, member1 2 0 0 1 0 0 0 0 hsa-let-7b -0.14 0.197 VAV3 NM_001079874vav 3 oncogene 1 0 0 1 0 0 0 0 hsa-let-7a -0.11 0.197 WAPAL NM_015045 wings apart-like homolog (Drosophila)1 0 0 1 0 0 0 0 hsa-let-7f -0.14 0.197 YTHDF3 NM_152758 YTH domain family, member 13 0 0 1 0 0 0 0 hsa-let-7g -0.12 0.197 ZBTB10 NM_023929 zinc finger and BTB domain containing1 0 10 0 1 0 0 0 0 hsa-let-7a -0.11 0.197 ZCCHC11 NM_001009881zinc finger, CCHC domain containing1 110 0 1 0 0 0 0 hsa-let-7a -0.08 0.197 ZNF697 NM_001080470zinc finger protein 697 1 0 1 0 0 0 0 0 hsa-let-7g -0.21 0.193 TSC1 NM_000368 tuberous sclerosis 1 1 0 1 0 0 0 0 0 hsa-let-7a -0.16 0.193 ABCB9 NM_019624 ATP-binding cassette, sub-family1 B (MDR/TAP),0 1 member0 9 0 0 0 0 hsa-miR-98 -0.25 0.185 SLC20A1 NM_005415 solute carrier family 20 (phosphate1 transporter),0 1 member0 1 0 0 0 0 hsa-let-7a -0.3 0.185 ATP2B4 NM_001001396ATPase, Ca++ transporting, plasma2 membrane0 0 4 2 0 0 0 0 hsa-let-7f -0.07 0.183 SNAP23 NM_003825 synaptosomal-associated protein,1 23kDa0 0 1 1 0 0 1 hsa-let-7a -0.21 0.182 C15orf41 NM_032499 chromosome 15 open reading1 frame 410 1 0 0 0 0 0 hsa-let-7b -0.28 0.181 FAM104A NM_032837 family with sequence similarity1 104, member0 A1 0 0 0 0 0 hsa-let-7d -0.24 0.181 FLJ20309 NM_017759 hypothetical protein FLJ203091 0 0 1 0 0 0 0 hsa-let-7a -0.06 0.181 KIAA1147 NM_001080392KIAA1147 1 0 0 1 0 0 0 0 hsa-let-7f -0.11 0.181 RGAG1 NM_020769 retrotransposon gag domain containing1 0 1 0 1 0 0 0 0 hsa-let-7f -0.12 0.181 ANKRD43 NM_175873 ankyrin repeat domain 43 1 0 1 0 0 0 0 0 hsa-let-7a -0.25 0.181 BZW2 NM_014038 basic leucine zipper and W2 domains1 02 1 0 0 0 0 0 hsa-let-7a -0.25 0.181 CPD NM_001304 carboxypeptidase D 1 0 1 0 0 0 0 0 hsa-let-7d -0.21 0.181 CTDSPL2 NM_016396 CTD (carboxy-terminal domain,1 RNA polymerase0 0 II, polypeptide1 0 A) small0 phosphatase0 like0 hsa-let-7g2 -0.05 0.181 EIF4G2 NM_001042559eukaryotic translation initiation1 factor0 4 gamma,1 2 0 0 0 0 0 hsa-let-7d -0.3 0.181 GHR NM_000163 growth 1 0 0 1 0 0 0 0 hsa-miR-98 -0.16 0.181 HMGA1 NM_002131 high mobility group AT-hook 1 0 1 0 0 0 0 0 hsa-let-7i -0.3 0.181 LCORL NM_153686 ligand dependent nuclear receptor1 corepressor-like0 1 0 0 0 0 0 hsa-let-7a -0.22 0.181 PLAGL2 NM_002657 pleiomorphic adenoma gene-like1 2 0 1 0 0 0 0 0 hsa-let-7b -0.22 0.181 PLDN NM_012388 pallidin homolog (mouse) 1 0 1 0 0 0 0 0 hsa-let-7f -0.15 0.181 PPP1R16B NM_015568 protein phosphatase 1, regulatory1 (inhibitor)0 subunit1 16B0 0 0 0 0 hsa-let-7g -0.12 0.181 RASL10B NM_033315 RAS-like, family 10, member 1B 0 1 0 0 0 0 0 hsa-let-7d -0.09 0.181 RFXDC1 NM_173560 regulatory factor X domain containing1 0 1 1 0 0 0 0 0 hsa-let-7d -0.25 0.181 SMARCC1 NM_003074 SWI/SNF related, matrix associated,1 actin0 dependent1 regulator0 0of chromatin,0 subfamily0 c,0 memberhsa-let-7g 1 -0.2 0.181 SP8 NM_182700 1 0 1 0 0 0 0 0 hsa-let-7a -0.18 0.181 TMED5 NM_016040 transmembrane emp24 protein1 transport0 domain1 containing0 5 0 0 0 0 hsa-let-7f -0.22 0.181 ZNF354A NM_005649 zinc finger protein 354A 1 0 1 0 0 0 0 0 hsa-let-7d -0.26 0.181 GPX7 NM_015696 glutathione peroxidase 7 1 0 0 1 1 0 0 1 hsa-let-7f -0.3 0.18 CASP3 NM_004346 caspase 3, apoptosis-related 1cysteine1 peptidase0 0 0 0 0 0 hsa-let-7b -0.38 0.179 MAP4K4 NM_004834 mitogen-activated protein kinase1 kinase1 kinase0 kinase 40 0 0 0 0 hsa-let-7a -0.26 0.179 C19orf47 NM_178830 open reading1 frame 470 1 0 0 0 0 0 hsa-let-7b -0.19 0.178 LOC144097 NM_138471 hypothetical protein BC0075401 0 1 0 0 0 0 0 hsa-let-7a -0.1 0.178 DOCK3 NM_004947 dedicator of cytokinesis 3 1 0 1 0 0 0 0 0 hsa-let-7a -0.08 0.178 KREMEN1 NM_001039570kringle containing transmembrane1 protein0 1 1 0 1 0 1 0 hsa-let-7b -0.15 0.178 MNT NM_020310 MAX binding protein 1 0 0 1 0 0 0 0 hsa-let-7d 0.02 0.178 TOB2 NM_016272 transducer of ERBB2, 2 1 0 1 0 0 0 0 0 hsa-let-7d -0.03 0.178 ZBTB5 NM_014872 zinc finger and BTB domain containing1 0 5 1 0 0 0 0 0 hsa-let-7f -0.25 0.178 LSM11 NM_173491 LSM11, U7 small nuclear RNA1 associated1 0 0 0 0 0 0 hsa-let-7b -0.26 0.177 DDX19A NM_018332 DEAD (Asp-Glu-Ala-As) box polypeptide1 1 19A 0 0 0 0 0 0 hsa-let-7g -0.39 0.173 DDX19B NM_001014449DEAD (Asp-Glu-Ala-As) box polypeptide1 1 19B 0 0 0 0 0 0 hsa-let-7g -0.39 0.173 HDHD1A NM_012080 haloacid dehalogenase-like hydrolase1 1domain containing0 0 1A 0 0 0 0 hsa-let-7f -0.3 0.173 KIF21B NM_017596 family member 21B 1 1 0 0 0 0 0 0 hsa-let-7d 0.02 0.17 FLJ21986 NM_024913 hypothetical protein FLJ219861 0 0 1 0 0 0 0 hsa-let-7g -0.17 0.169 KTELC1 NM_152305 KTEL (Lys-Tyr-Glu-Leu) containing1 1 0 0 1 0 0 0 0 hsa-let-7f -0.12 0.169 ATXN1 NM_000332 ataxin 1 1 0 0 1 0 0 0 0 hsa-let-7d 0.02 0.169 BCAP29 NM_018844 B-cell receptor-associated protein1 29 0 0 1 0 0 0 0 hsa-let-7a -0.18 0.169 C6orf211 NM_024573 chromosome 6 open reading 1frame 2110 0 1 0 0 0 0 hsa-let-7a -0.18 0.169 DIAPH3 NM_001042517diaphanous homolog 3 (Drosophila)1 0 0 1 0 0 0 0 hsa-let-7d -0.19 0.169 DZIP1 NM_014934 DAZ interacting protein 1 1 0 0 1 0 0 0 0 hsa-let-7g -0.15 0.169 GABPA NM_002040 GA binding protein transcription1 factor,0 alpha subunit0 60kDa1 0 0 0 0 hsa-let-7g -0.09 0.169 LRRFIP1 NM_004735 leucine rich repeat (in FLII) interacting1 0 protein 01 1 0 0 0 0 hsa-let-7a -0.08 0.169 RBM9 NM_001082577RNA binding motif protein 9 1 0 0 1 0 0 0 0 hsa-miR-98 -0.21 0.169 SLC31A2 NM_001860 solute carrier family 31 (copper1 transporters),0 0member1 2 0 0 0 0 hsa-let-7a -0.16 0.169 TMC7 NM_024847 transmembrane channel-like 17 0 0 1 0 0 0 0 hsa-let-7d -0.22 0.169 TRIM33 NM_015906 tripartite motif-containing 331 0 0 1 0 0 0 0 hsa-let-7f -0.02 0.169 CCDC100 NM_153223 coiled-coil domain containing 1100 0 1 0 0 0 0 0 hsa-let-7a -0.22 0.167 ELOVL4 NM_022726 elongation of very long chain 1fatty acids0 (FEN1/Elo2,1 SUR4/Elo3,0 0 yeast)-like0 4 0 0 hsa-let-7f -0.18 0.167 NKD1 NM_033119 naked cuticle homolog 1 (Drosophila)1 0 1 0 0 0 0 0 hsa-let-7a -0.23 0.167 USP32 NM_032582 ubiquitin specific peptidase 321 0 1 0 0 0 0 0 hsa-let-7a -0.23 0.167 USP6 NM_004505 ubiquitin specific peptidase 6 1(Tre-2 oncogene)0 1 0 0 0 0 0 hsa-let-7a -0.2 0.167 POU2F2 NM_002698 POU domain, class 2, transcription2 factor0 2 1 1 0 0 0 0 hsa-let-7b -0.18 0.166 CHSY-2 NM_175856 chondroitin synthase-2 1 0 0 1 0 0 0 0 hsa-let-7a -0.13 0.162 KIAA1411 NM_020819 KIAA1411 1 0 0 1 0 0 0 0 hsa-let-7f -0.19 0.162 COL4A2 NM_001846 collagen, type IV, alpha 2 1 0 0 1 0 0 0 0 hsa-miR-98 -0.15 0.162 TMEM65 NM_194291 transmembrane protein 65 1 0 0 1 0 0 0 0 hsa-let-7g -0.22 0.162 ACVR1B NM_004302 activin A receptor, type IB 1 0 1 0 0 0 0 0 hsa-let-7g -0.1 0.16 PLXND1 NM_015103 plexin D1 1 1 0 0 0 0 0 0 hsa-let-7g -0.29 0.16 XKR8 NM_018053 XK, Kell blood group complex1 subunit-related1 family,0 member0 81 0 1 0 hsa-let-7e -0.44 0.16 NXT2 NM_018698 nuclear transport factor 2-like1 export 0factor 2 1 0 0 0 0 0 hsa-let-7g -0.27 0.159 KIAA1539 NM_025182 KIAA1539 1 1 0 0 0 0 0 0 hsa-let-7a -0.19 0.158 SYT7 NM_004200 synaptotagmin VII 1 1 0 0 0 0 0 0 hsa-miR-98 -0.26 0.158 ABCC5 NM_005688 ATP-binding cassette, sub-family1 C (CFTR/MRP),1 0 member0 5 0 0 0 0 hsa-let-7g -0.3 0.158 AMMECR1L NM_031445 AMME chromosomal region gene1 1-like1 0 0 0 0 0 0 hsa-let-7d -0.09 0.158 ANKRD49 NM_017704 ankyrin repeat domain 49 1 1 0 0 0 0 0 0 hsa-let-7g -0.25 0.158 ATP2A2 NM_170665 ATPase, Ca++ transporting, cardiac1 muscle,1 slow0 twitch0 2 0 0 0 0 hsa-let-7d -0.3 0.158 BCL2L1 NM_001191 BCL2-like 1 1 1 0 0 0 0 0 0 hsa-let-7b -0.13 0.158 DAGLA NM_006133 diacylglycerol lipase, alpha 1 1 0 0 0 0 0 0 hsa-let-7d -0.21 0.158 EGR3 NM_004430 early growth response 3 1 1 0 0 0 0 0 0 hsa-let-7a -0.03 0.158 IRS2 NM_003749 insulin receptor substrate 2 1 1 0 0 0 0 0 0 hsa-let-7b -0.25 0.158 KLHL6 NM_130446 kelch-like 6 (Drosophila) 1 1 0 0 0 0 0 0 hsa-let-7d -0.27 0.158 SEMA4C NM_017789 sema domain, immunoglobulin1 domain1 (Ig), transmembrane0 0 domain0 (TM)0 and short0 cytoplasmic0 hsa-let-7i domain, (semaphorin)-0.25 4C 0.158 SEMA4G NM_017893 sema domain, immunoglobulin1 domain1 (Ig), transmembrane0 0 domain0 (TM)0 and short0 cytoplasmic0 hsa-let-7a domain, (semaphorin)-0.17 4G 0.158 APPBP2 NM_006380 amyloid beta precursor protein1 (cytoplasmic0 tail)0 binding1 protein0 2 0 0 0 hsa-let-7g -0.04 0.153 ASAH3L NM_001010887N-acylsphingosine amidohydrolase1 3-like0 1 0 0 0 0 0 hsa-let-7g -0.18 0.153 CLASP2 NM_015097 cytoplasmic linker associated1 protein 02 1 0 0 0 0 0 hsa-let-7g -0.21 0.153 CLP1 NM_006831 CLP1, cleavage and polyadenylation1 factor0 I subunit,1 homolog0 (S.0 cerevisiae)0 0 0 hsa-let-7a -0.32 0.153 EEF2K NM_013302 eukaryotic elongation factor-21 kinase 0 1 0 0 0 0 0 hsa-let-7d -0.25 0.153 HOXD1 NM_024501 homeobox D1 1 0 1 0 0 0 0 0 hsa-let-7d -0.25 0.153 MYO1F NM_012335 IF 1 0 1 0 0 0 0 0 hsa-let-7a -0.23 0.153 NME6 NM_005793 non-metastatic cells 6, protein1 expressed0 in (nucleoside-diphosphate1 0 0 kinase)0 0 0 hsa-let-7d -0.25 0.153 PPAPDC2 NM_203453 phosphatidic acid phosphatase1 type 20 domain containing1 0 2 0 0 0 0 hsa-miR-98 -0.22 0.153 RNF20 NM_019592 ring finger protein 20 1 0 1 0 0 0 0 0 hsa-let-7g -0.29 0.153 SLC25A27 NM_004277 solute carrier family 25, member1 27 0 1 0 0 0 0 0 hsa-let-7a -0.28 0.153 ZCCHC3 NM_033089 zinc finger, CCHC domain containing1 30 1 0 0 0 0 0 hsa-let-7d -0.16 0.153 NOVA1 NM_002515 neuro-oncological ventral antigen1 1 0 1 0 0 0 0 0 hsa-let-7d -0.13 0.151 ADCY9 NM_001116 adenylate cyclase 9 1 0 0 1 0 0 0 0 hsa-let-7d 0.04 0.15 EGLN2 NM_080732 egl nine homolog 2 (C. elegans)1 0 0 1 0 0 0 0 hsa-let-7g -0.06 0.145 FARP1 NM_005766 FERM, RhoGEF (ARHGEF) and1 pleckstrin0 domain0 protein1 1 (chondrocyte-derived)0 0 0 0 hsa-let-7f -0.11 0.145 PLEKHO1 NM_016274 pleckstrin homology domain containing,1 0 family 0O member1 1 0 0 0 0 hsa-let-7d -0.19 0.145 C11orf51 NM_014042 chromosome 11 open reading1 frame 510 0 1 0 0 0 0 hsa-let-7b 0 0.141 DNAJB9 NM_012328 DnaJ (Hsp40) homolog, subfamily1 B, member0 90 1 0 0 0 0 hsa-miR-98 -0.08 0.141 HOXA9 NM_152739 homeobox A9 1 0 0 1 0 0 0 0 hsa-let-7d -0.15 0.141 VSNL1 NM_003385 visinin-like 1 1 0 0 1 0 0 0 0 hsa-let-7d -0.1 0.141 ACTR2 NM_001005386ARP2 actin-related protein 2 homolog1 0 (yeast) 0 1 0 0 0 0 hsa-let-7d -0.1 0.141 ANGPTL2 NM_012098 angiopoietin-like 2 1 0 0 1 0 0 0 0 hsa-let-7a -0.07 0.141 ARL6IP2 NM_022374 ADP-ribosylation factor-like 61 interacting0 protein0 2 1 0 0 0 0 hsa-let-7g -0.2 0.141 C6orf120 NM_001029863chromosome 6 open reading 1frame 1200 0 1 0 0 0 0 hsa-let-7c -0.11 0.141 CACNA1D NM_000720 calcium channel, voltage-dependent,1 0L type, alpha0 1D subunit1 0 0 0 0 hsa-let-7b -0.04 0.141 CHD7 NM_017780 chromodomain helicase DNA 1binding protein0 7 0 1 0 0 0 0 hsa-let-7a -0.1 0.141 CNOT2 NM_014515 CCR4-NOT transcription complex,1 subunit0 2 0 1 0 0 0 0 hsa-let-7d -0.12 0.141 CNOT6L NM_144571 CCR4-NOT transcription complex,1 subunit0 6-like0 1 0 0 0 0 hsa-miR-98 -0.04 0.141 COL4A1 NM_001845 collagen, type IV, alpha 1 1 0 0 1 0 0 0 0 hsa-let-7a -0.11 0.141 COL4A5 NM_000495 collagen, type IV, alpha 5 (Alport1 syndrome)0 0 1 0 0 0 0 hsa-let-7a -0.08 0.141 CROP NM_016424 cisplatin resistance-associated1 overexpressed0 protein0 1 0 0 0 0 hsa-let-7g 0 0.141 DST NM_183380 1 0 0 1 0 0 0 0 hsa-let-7a -0.06 0.141 EIF2C4 NM_017629 eukaryotic translation initiation1 factor0 2C, 4 0 1 0 0 0 0 hsa-let-7f -0.14 0.141 HAS2 NM_005328 hyaluronan synthase 2 1 0 0 1 0 0 0 0 hsa-let-7d -0.08 0.141 IDH2 NM_002168 isocitrate dehydrogenase 2 (NADP+),1 0mitochondrial0 1 0 0 0 0 hsa-let-7d -0.07 0.141 ITSN1 NM_001001132intersectin 1 (SH3 domain protein)1 0 0 1 0 0 0 0 hsa-let-7d -0.15 0.141 JMJD1A NM_018433 jumonji domain containing 1A1 0 0 1 0 0 0 0 hsa-let-7a -0.11 0.141 MAP3K7IP2 NM_015093 mitogen-activated protein kinase1 kinase0 kinase0 7 interacting1 protein0 2 0 0 0 hsa-let-7b -0.16 0.141 MESDC1 NM_022566 mesoderm development candidate1 1 0 0 1 0 0 0 0 hsa-let-7g -0.11 0.141 MGC17330 NM_052880 HGFL gene 1 0 0 1 0 0 0 0 hsa-let-7a -0.21 0.141 MTPN NM_145808 myotrophin 1 0 0 1 0 0 0 0 hsa-let-7d -0.1 0.141 MYCL1 NM_001033081v-myc myelocytomatosis viral1 oncogene0 homolog0 1, lung1 carcinoma0 derived0 (avian)0 0 hsa-let-7a -0.06 0.141 NAB1 NM_005966 NGFI-A binding protein 1 (EGR11 binding0 protein0 1) 1 0 0 0 0 hsa-let-7f -0.11 0.141 NEFM NM_005382 , medium polypeptide1 150kDa0 0 1 0 0 0 0 hsa-let-7f -0.14 0.141 P4HA2 NM_001017973procollagen-proline, 2-oxoglutarate1 4-dioxygenase0 0 (proline1 4-hydroxylase),0 0 alpha0 polypeptide0 hsa-let-7d II -0.08 0.141 PAX3 NM_181459 paired box gene 3 (Waardenburg1 syndrome0 1)0 1 0 0 0 0 hsa-let-7d -0.11 0.141 PLCB4 NM_182797 phospholipase C, beta 4 1 0 0 1 0 0 0 0 hsa-let-7a -0.12 0.141 PPP3CA NM_000944 protein phosphatase 3 (formerly1 2B), 0catalytic 0subunit, 1alpha isoform0 0 0 0 hsa-let-7g -0.08 0.141 PRDM1 NM_001198 PR domain containing 1, with1 ZNF domain0 0 1 0 0 0 0 hsa-let-7a -0.08 0.141 SENP2 NM_021627 SUMO1/sentrin/SMT3 specific1 peptidase0 2 0 1 0 0 0 0 hsa-let-7a -0.14 0.141 SLC30A4 NM_013309 solute carrier family 30 (zinc 1transporter),0 member0 4 1 0 0 0 0 hsa-let-7a -0.11 0.141 SLC9A9 NM_173653 solute carrier family 9 (sodium/hydrogen1 0 exchanger),0 member1 09 0 0 0 hsa-let-7g -0.07 0.141 STRBP NM_018387 spermatid perinuclear RNA binding1 protein0 0 1 0 0 0 0 hsa-let-7g -0.13 0.141 SYT1 NM_005639 synaptotagmin I 1 0 0 1 0 0 0 0 hsa-let-7f -0.13 0.141 TRIB2 NM_021643 tribbles homolog 2 (Drosophila)1 0 0 1 0 0 0 0 hsa-let-7d -0.05 0.141 USP47 NM_017944 ubiquitin specific peptidase 471 0 0 1 0 0 0 0 hsa-let-7d -0.15 0.141 VCPIP1 NM_025054 valosin containing protein (p97)/p471 complex0 interacting0 1 protein0 1 0 0 0 hsa-let-7c 0.02 0.141 ITGB8 NM_002214 integrin, beta 8 1 0 1 0 0 0 0 0 hsa-let-7i -0.2 0.139 CALM1 NM_006888 calmodulin 1 (phosphorylase 1kinase, delta)0 0 1 0 0 0 0 hsa-let-7f -0.08 0.138 SCRT2 NM_033129 scratch homolog 2, zinc finger1 protein0 (Drosophila)1 0 0 0 0 0 hsa-let-7d -0.04 0.138 ZNF710 NM_198526 zinc finger protein 710 1 0 1 0 0 0 0 0 hsa-let-7i -0.1 0.138 ADIPOR2 NM_024551 adiponectin receptor 2 1 0 0 1 0 0 0 0 hsa-let-7f -0.15 0.138 CHRD NM_003741 chordin 1 0 1 0 0 0 0 0 hsa-let-7b -0.13 0.138 COL1A1 NM_000088 collagen, type I, alpha 1 1 0 1 0 0 0 0 0 hsa-let-7d -0.19 0.138 ELF4 NM_001421 E74-like factor 4 (ets domain1 transcription0 factor)1 0 0 0 0 0 hsa-let-7a -0.17 0.138 GGA3 NM_014001 golgi associated, gamma adaptin1 ear 0containing,1 ARF binding0 protein0 3 0 0 0 hsa-let-7a -0.14 0.138 LEPROTL1 NM_015344 leptin receptor overlapping transcript-like1 0 1 0 1 0 0 0 0 hsa-let-7d -0.08 0.138 LOC653319 NM_001040715hypothetical protein LOC6533191 0 1 0 0 0 0 0 hsa-let-7i -0.15 0.138 LOXL3 NM_032603 lysyl oxidase-like 3 1 0 0 1 0 0 0 0 hsa-let-7d -0.02 0.138 MECP2 NM_004992 methyl CpG binding protein 21 (Rett syndrome)0 1 0 0 0 0 0 hsa-let-7b -0.08 0.138 NCOA3 NM_006534 coactivator 31 0 1 0 0 0 0 0 hsa-let-7g -0.14 0.138 PCYT1B NM_004845 phosphate cytidylyltransferase1 1, choline,0 beta1 0 0 0 0 0 hsa-let-7d -0.05 0.138 PLD3 NM_001031696phospholipase D family, member1 3 0 1 0 0 0 0 0 hsa-let-7a -0.1 0.138 SLC8A2 NM_015063 solute carrier family 8 (sodium-calcium1 0 exchanger),1 member0 2 0 0 0 0 hsa-let-7b -0.07 0.138 STK40 NM_032017 serine/threonine kinase 40 1 0 1 0 0 0 0 0 hsa-let-7d -0.27 0.138 FAM118A NM_017911 family with sequence similarity1 118, member1 A0 0 0 0 0 0 hsa-let-7d -0.29 0.13 IL13 NM_002188 interleukin 13 1 1 0 0 0 0 0 0 hsa-let-7g -0.27 0.13 DCUN1D2 NM_001014283DCN1, defective in cullin neddylation1 11, domain0 containing0 2 (S.0 cerevisiae)0 0 0 hsa-let-7b -0.14 0.13 FBXL12 NM_017703 F-box and leucine-rich repeat1 protein 112 0 0 0 0 0 0 hsa-let-7a -0.33 0.13 KCTD17 NM_024681 potassium channel tetramerisation1 domain1 containing0 170 0 0 0 0 hsa-let-7b -0.19 0.13 LMX1A NM_001033507LIM homeobox transcription factor1 1, 1alpha 0 0 0 0 0 0 hsa-miR-98 -0.21 0.13 RBM38 NM_183425 RNA binding motif protein 381 1 0 0 0 0 0 0 hsa-let-7a -0.16 0.13 SYT11 NM_152280 synaptotagmin XI 1 1 0 0 0 0 0 0 hsa-let-7e -0.13 0.13 TNFRSF1B NM_001066 tumor necrosis factor receptor1 superfamily,1 member0 1B0 0 0 0 0 hsa-let-7c -0.12 0.13 NRTN NM_004558 neurturin 1 1 0 0 0 0 0 0 hsa-let-7a 0 0.123 SCN11A NM_014139 sodium channel, voltage-gated,1 type XI,1 alpha 0subunit 0 0 0 0 0 hsa-let-7b -0.23 0.123 CCR7 NM_001838 chemokine (C-C motif) receptor1 7 1 0 0 0 0 0 0 hsa-let-7f -0.3 0.123 FGF11 NM_004112 fibroblast growth factor 11 1 1 0 0 0 0 0 0 hsa-miR-98 -0.26 0.123 QARS NM_005051 glutaminyl-tRNA synthetase 1 1 0 0 0 0 0 0 hsa-let-7i -0.28 0.123 SLC25A18 NM_031481 solute carrier family 25 (mitochondrial1 1 carrier),0 member0 18 0 0 0 0 hsa-let-7d -0.31 0.123 STX17 NM_017919 syntaxin 17 1 1 0 0 0 0 0 0 hsa-let-7a -0.22 0.123 TRAPPC1 NM_021210 trafficking protein particle complex1 1 1 0 0 0 0 0 0 hsa-let-7a 0 0.123 TTLL4 NM_014640 tubulin tyrosine ligase-like family,1 member1 4 0 0 0 0 0 0 hsa-let-7d -0.25 0.123 ZC3H3 NM_015117 zinc finger CCCH-type containing1 3 1 0 0 0 0 0 0 hsa-let-7d -0.23 0.123 CEP164 NM_014956 centrosomal protein 164kDa 1 0 0 1 0 0 0 0 hsa-let-7f -0.03 0.119 UBXD2 NM_014607 UBX domain containing 2 1 0 0 1 0 0 0 0 hsa-let-7a -0.15 0.119 BRD3 NM_007371 bromodomain containing 3 1 0 0 1 0 0 0 0 hsa-let-7a -0.18 0.117 DMP1 NM_001079911dentin matrix acidic phosphoprotein1 0 0 1 0 0 0 0 hsa-let-7c -0.22 0.117 GPR137 NM_020155 G protein-coupled receptor 1371 0 1 0 0 0 0 0 hsa-let-7b -0.15 0.115 CDYL NM_004824 chromodomain protein, Y-like1 0 0 1 0 0 0 0 hsa-let-7g -0.06 0.113 LIMD1 NM_014240 LIM domains containing 1 1 0 0 1 0 0 0 0 hsa-let-7b -0.1 0.113 OLR1 NM_002543 oxidized low density lipoprotein1 (lectin-like)0 receptor0 1 1 0 0 0 0 hsa-let-7a -0.11 0.113 CALD1 NM_004342 caldesmon 1 1 0 0 1 0 0 0 0 hsa-let-7g -0.06 0.113 COL15A1 NM_001855 collagen, type XV, alpha 1 1 0 0 1 0 0 0 0 hsa-let-7g -0.16 0.113 DUSP4 NM_001394 dual specificity phosphatase 41 0 0 1 0 0 0 0 hsa-let-7f -0.16 0.113 MON2 NM_015026 MON2 homolog (S. cerevisiae)1 0 0 1 0 0 0 0 hsa-let-7d -0.11 0.113 PSCD3 NM_004227 pleckstrin homology, Sec7 and1 coiled-coil0 domains0 3 1 0 0 0 0 hsa-miR-98 -0.02 0.113 PSD3 NM_015310 pleckstrin and Sec7 domain containing1 0 3 0 1 0 0 0 0 hsa-let-7d -0.02 0.113 RAVER2 NM_018211 ribonucleoprotein, PTB-binding1 2 0 0 1 0 0 0 0 hsa-let-7f -0.05 0.113 RNF38 NM_022781 ring finger protein 38 1 0 0 1 0 0 0 0 hsa-let-7g -0.13 0.113 WDFY3 NM_014991 WD repeat and FYVE domain 1containing0 3 0 1 0 0 0 0 hsa-let-7a -0.03 0.113 ZCCHC5 NM_152694 zinc finger, CCHC domain containing1 50 0 1 0 0 0 0 hsa-let-7a -0.01 0.113 SOCS1 NM_003745 suppressor of cytokine signaling1 1 0 1 0 0 0 0 0 hsa-let-7d -0.2 0.111 CGNL1 NM_032866 cingulin-like 1 1 0 1 0 0 0 0 0 hsa-let-7d -0.18 0.111 HLF NM_002126 hepatic leukemia factor 1 0 1 0 0 0 0 0 hsa-let-7g -0.1 0.111 KLHL13 NM_033495 kelch-like 13 (Drosophila) 1 0 1 0 0 0 0 0 hsa-let-7d -0.16 0.111 LGR4 NM_018490 leucine-rich repeat-containing1 G protein-coupled0 1 receptor0 4 0 0 0 0 hsa-let-7f -0.21 0.111 RNF7 NM_183237 ring finger protein 7 1 0 1 0 0 0 0 0 hsa-let-7a -0.13 0.111 C9orf7 NM_017586 open reading 1frame 7 0 1 0 0 0 0 0 hsa-let-7a -0.12 0.11 CEECAM1 NM_016174 cerebral endothelial cell adhesion1 molecule0 1 1 0 0 0 0 0 hsa-let-7d -0.14 0.11 SNN NM_003498 stannin 1 0 1 0 0 0 0 0 hsa-let-7a -0.13 0.11 VANGL2 NM_020335 vang-like 2 (van gogh, Drosophila)2 0 1 1 0 0 0 0 hsa-let-7b -0.05 0.11 ABCC10 NM_033450 ATP-binding cassette, sub-family1 C (CFTR/MRP),0 1 member0 10 0 0 0 0 hsa-let-7d -0.13 0.11 ARHGEF15 NM_173728 Rho guanine nucleotide exchange1 factor0 (GEF) 115 0 0 0 0 0 hsa-let-7b -0.19 0.11 DHX57 NM_198963 DEAH (Asp-Glu-Ala-Asp/His) 1box polypeptide0 571 0 0 0 0 0 hsa-let-7a -0.25 0.11 DLST NM_001933 dihydrolipoamide S-succinyltransferase1 0 (E2 component1 0 of 2-oxo-glutarate0 0 complex)0 0 hsa-let-7d -0.2 0.11 MGLL NM_001003794monoglyceride lipase 2 0 1 1 0 0 0 0 hsa-let-7i 0.01 0.11 PLEKHH1 NM_020715 pleckstrin homology domain containing,1 0 family 1H (with 0MyTH4 domain)0 0member0 1 0 hsa-let-7a -0.24 0.11 RAB40C NM_021168 RAB40C, member RAS oncogene1 family0 1 0 0 0 0 0 hsa-let-7a -0.1 0.11 RUFY3 NM_014961 RUN and FYVE domain containing1 3 0 1 0 0 0 0 0 hsa-let-7f -0.16 0.11 SEMA3F NM_004186 sema domain, immunoglobulin1 domain0 (Ig), short1 basic0 domain,0 secreted,0 (semaphorin)0 0 3Fhsa-let-7b -0.15 0.11 TMEM110 NM_198563 transmembrane protein 110 1 0 1 0 0 0 0 0 hsa-let-7d -0.19 0.11 FAM84B NM_174911 family with sequence similarity1 84, member0 B 1 0 1 0 1 0 hsa-let-7g -0.16 0.108 HOXC11 NM_014212 homeobox C11 1 0 1 0 0 0 0 0 hsa-let-7d -0.07 0.108 WNT1 NM_005430 wingless-type MMTV integration1 site family,0 member1 1 0 0 0 0 0 hsa-let-7d -0.05 0.108 C2orf29 NM_017546 open reading 1frame 290 0 1 0 0 0 0 hsa-let-7a 0 0.106 MED6 NM_005466 mediator of RNA polymerase 1II transcription,0 subunit0 6 1homolog0 (S. cerevisiae)0 0 0 hsa-let-7d -0.1 0.106 NPEPL1 NM_024663 aminopeptidase-like 1 1 0 0 1 0 0 0 0 hsa-let-7f -0.11 0.106 PPARGC1A NM_013261 peroxisome proliferator-activated1 receptor0 gamma,0 coactivator1 01 alpha 0 0 0 hsa-let-7d -0.02 0.106 NME4 NM_005009 non-metastatic cells 4, protein1 expressed0 in 1 0 0 0 0 0 hsa-let-7d -0.18 0.103 COL14A1 NM_021110 collagen, type XIV, alpha 1 (undulin)1 0 1 0 0 0 0 0 hsa-miR-98 -0.33 0.103 EIF2C1 NM_012199 eukaryotic translation initiation1 factor0 2C, 1 0 1 1 0 1 0 hsa-let-7a 0.02 0.103 GALNTL2 NM_054110 UDP-N-acetyl-alpha-D-galactosamine:polypeptide1 0 1 N-acetylgalactosaminyltransferase-like0 0 0 0 0 2hsa-let-7a -0.24 0.103 LOC90379 NM_138353 hypothetical protein BC0029261 0 1 0 0 0 0 0 hsa-let-7b -0.13 0.103 TIMM17B NM_005834 translocase of inner mitochondrial1 membrane0 171 homolog0 B (yeast)0 0 0 0 hsa-let-7f -0.12 0.103 BIN3 NM_018688 bridging integrator 3 1 0 1 0 0 0 0 0 hsa-let-7g -0.25 0.1 FLJ39779 NM_207442 FLJ39779 protein 1 0 0 1 0 0 0 0 hsa-miR-98 -0.09 0.098 ATG16L1 NM_017974 ATG16 autophagy related 16-like1 1 (S.0 cerevisiae)0 1 0 0 0 0 hsa-let-7a 0 0.098 BAHD1 NM_014952 bromo adjacent homology domain1 containing0 10 1 0 0 0 0 hsa-let-7a 0.04 0.098 CALU NM_001219 calumenin 1 0 0 1 0 0 0 0 hsa-let-7b 0.01 0.098 CAP1 NM_006367 CAP, adenylate cyclase-associated1 protein0 1 (yeast)0 1 0 0 0 0 hsa-let-7b -0.08 0.098 GALNT2 NM_004481 UDP-N-acetyl-alpha-D-galactosamine:polypeptide1 0 0 N-acetylgalactosaminyltransferase1 0 0 0 2 (GalNAc-T2)0 hsa-let-7g -0.18 0.098 GNS NM_002076 glucosamine (N-acetyl)-6-sulfatase1 (Sanfilippo0 0disease 1IIID) 0 0 0 0 hsa-let-7a 0.01 0.098 KIF2A NM_004520 kinesin heavy chain member 12A 0 0 1 0 0 0 0 hsa-let-7d -0.08 0.098 LCOR NM_032440 ligand dependent nuclear receptor1 corepressor0 0 1 0 0 0 0 hsa-let-7f -0.08 0.098 MGA NM_001080541MAX gene associated 1 0 0 1 0 0 0 0 hsa-let-7f -0.07 0.098 MYRIP NM_015460 myosin VIIA and Rab interacting1 protein0 0 1 0 0 0 0 hsa-let-7d -0.03 0.098 ODZ2 NM_001080428odz, odd Oz/ten-m homolog 21 (Drosophila)0 0 1 0 0 0 0 hsa-let-7c -0.08 0.098 RAI16 NM_022749 retinoic acid induced 16 1 0 0 1 0 0 0 0 hsa-let-7a 0.03 0.098 SEC24C NM_004922 SEC24 related gene family, member1 C0 (S. cerevisiae)0 1 0 0 0 0 hsa-miR-98 -0.08 0.098 SLCO5A1 NM_030958 solute carrier organic anion transporter1 0 family,0 member1 5A1 0 0 0 0 hsa-let-7c -0.03 0.098 SPTBN4 NM_020971 , beta, non-erythrocytic1 4 0 0 1 0 0 0 0 hsa-let-7a 0.03 0.098 ZSWIM4 NM_023072 zinc finger, SWIM-type containing1 4 0 0 1 0 0 0 0 hsa-let-7a 0.05 0.098 PIGA NM_002641 phosphatidylinositol glycan anchor1 biosynthesis,0 1 class A0 (paroxysmal0 nocturnal0 hemoglobinuria)0 0 hsa-let-7a -0.29 0.089 SLC25A24 NM_013386 solute carrier family 25 (mitochondrial1 0 carrier; 1phosphate0 carrier),0 member0 24 0 0 hsa-let-7a -0.24 0.089 OPRM1 NM_000914 opioid receptor, mu 1 1 0 1 0 0 0 0 0 hsa-let-7c -0.24 0.087 C1orf26 NM_017673 chromosome 1 open reading 1frame 260 1 0 0 0 0 0 hsa-let-7b -0.23 0.083 PNKD NM_015488 paroxysmal nonkinesiogenic dyskinesia1 0 1 0 0 0 0 0 hsa-let-7a -0.07 0.083 RPUSD2 NM_152260 RNA pseudouridylate synthase1 domain0 containing1 2 0 0 0 0 0 hsa-let-7c -0.2 0.083 SMAP1L NM_022733 stromal membrane-associated1 protein0 1-like 1 0 0 0 0 0 hsa-let-7c -0.19 0.083 SSH1 NM_018984 slingshot homolog 1 (Drosophila)1 0 1 0 0 0 0 0 hsa-let-7a -0.19 0.083 TBX5 NM_000192 T-box 5 1 0 1 0 0 0 0 0 hsa-let-7g -0.13 0.083 ZNF740 NM_001004304zinc finger protein 740 1 0 1 0 0 0 0 0 hsa-let-7d -0.03 0.08 GALE NM_000403 UDP-galactose-4-epimerase 1 1 0 0 0 0 0 0 hsa-let-7a -0.19 0.08 MEF2D NM_005920 MADS box transcription enhancer1 factor0 2, polypeptide1 0D (myocyte1 enhancer0 factor1 2D) 0 hsa-let-7a 0.01 0.08 RRP1B NM_015056 ribosomal RNA processing 1 homolog1 0B (S. cerevisiae)1 0 0 0 0 0 hsa-let-7d -0.08 0.08 TRABD NM_025204 TraB domain containing 1 1 0 0 0 0 0 0 hsa-let-7b -0.18 0.08 RPUSD3 NM_173659 RNA pseudouridylate synthase1 domain0 containing1 3 0 0 0 0 0 hsa-let-7g -0.09 0.077 ARRDC4 NM_183376 arrestin domain containing 4 1 0 1 0 0 0 0 0 hsa-let-7a -0.17 0.073 SLC16A14 NM_152527 solute carrier family 16, member1 14 (monocarboxylic0 1 acid0 transporter0 14)0 0 0 hsa-miR-98 -0.17 0.073 RORC NM_001001523RAR-related orphan receptor 1C 0 0 1 0 0 0 0 hsa-let-7d -0.1 0.07 UBFD1 NM_019116 ubiquitin family domain containing1 1 0 0 1 0 0 0 0 hsa-let-7i -0.04 0.07 --- NM_138396 membrane-associated ring finger1 (C3HC4)0 9 0 1 0 0 0 0 hsa-let-7a -0.01 0.07 C21orf29 NM_144991 chromosome 21 open reading1 frame 290 0 1 0 0 0 0 hsa-let-7a -0.18 0.07 CACNA1E NM_000721 calcium channel, voltage-dependent,1 0R type, alpha0 1E subunit1 0 0 0 0 hsa-let-7g -0.03 0.07 CASKIN1 NM_020764 CASK interacting protein 1 1 0 0 1 0 0 0 0 hsa-let-7i -0.02 0.07 DUSP9 NM_001395 dual specificity phosphatase 91 0 0 1 0 0 0 0 hsa-let-7d 0.03 0.07 HK2 NM_000189 hexokinase 2 1 0 0 1 0 0 0 0 hsa-let-7a -0.04 0.07 LBH NM_030915 limb bud and heart development1 homolog0 (mouse)0 1 0 0 0 0 hsa-let-7g -0.07 0.07 LRFN4 NM_024036 leucine rich repeat and fibronectin1 type0 III domain0 containing1 40 0 0 0 hsa-let-7a -0.02 0.07 MMP11 NM_005940 matrix metallopeptidase 11 (stromelysin1 0 3) 0 1 0 0 0 0 hsa-let-7d -0.08 0.07 NKIRAS2 NM_001001349NFKB inhibitor interacting Ras-like1 2 0 0 1 0 0 0 0 hsa-let-7a 0 0.07 NUMBL NM_004756 homolog (Drosophila)-like1 0 0 1 0 0 0 0 hsa-let-7d 0.02 0.07 PANX2 NM_052839 pannexin 2 1 0 0 1 0 0 0 0 hsa-let-7b -0.02 0.07 POM121 NM_172020 POM121 membrane glycoprotein1 (rat)0 0 1 0 0 0 0 hsa-let-7d -0.03 0.07 STAB2 NM_017564 stabilin 2 1 0 0 1 0 0 0 0 hsa-let-7i -0.07 0.07 USP21 NM_001014443ubiquitin specific peptidase 211 0 0 1 0 0 0 0 hsa-let-7d -0.05 0.07 AP1S1 NM_057089 adaptor-related protein complex1 1, sigma0 1 subunit1 0 0 0 0 0 hsa-let-7a -0.1 0.068 CHD4 NM_001273 chromodomain helicase DNA 1binding protein0 4 1 0 0 0 0 0 hsa-let-7a -0.16 0.068 DPF2 NM_006268 D4, zinc and double PHD fingers1 family0 2 1 0 0 0 0 0 hsa-let-7g -0.25 0.068 EDA NM_001005609ectodysplasin A 1 0 1 0 0 0 0 0 hsa-let-7a -0.05 0.068 GNAL NM_182978 guanine nucleotide binding protein1 (G0 protein),1 alpha activating0 0 activity0 polypeptide,0 olfactory0 hsa-let-7a type -0.09 0.068 HTR4 NM_000870 5-hydroxytryptamine (serotonin)1 receptor0 4 1 0 0 0 0 0 hsa-let-7a -0.12 0.068 PAK1 NM_002576 p21/Cdc42/Rac1-activated kinase1 1 (STE200 homolog,1 yeast)0 0 0 0 0 hsa-let-7d -0.15 0.068 PHF8 NM_015107 PHD finger protein 8 1 0 1 0 0 0 0 0 hsa-let-7d -0.01 0.068 RASL10A NM_001007279RAS-like, family 10, member 1A 0 1 0 0 0 0 0 hsa-let-7d -0.04 0.068 SCUBE3 NM_152753 signal peptide, CUB domain, EGF-like1 03 1 0 0 0 0 0 hsa-let-7i 0.01 0.068 SGCD NM_000337 sarcoglycan, delta (35kDa dystrophin-associated1 0 1 glycoprotein)0 0 0 0 0 hsa-let-7a -0.03 0.068 SLC6A1 NM_003042 solute carrier family 6 (neurotransmitter1 0 transporter,1 GABA),0 member0 10 0 0 hsa-let-7a -0.16 0.068 SOX13 NM_005686 SRY (sex determining region 1Y)-box 130 1 0 0 0 0 0 hsa-let-7g -0.2 0.068 SPATA2 NM_006038 spermatogenesis associated 21 0 1 0 0 0 0 0 hsa-let-7a -0.12 0.068 TUSC2 NM_007275 tumor suppressor candidate 21 0 1 0 0 0 0 0 hsa-let-7d -0.12 0.068 UNC5A NM_133369 unc-5 homolog A (C. elegans)1 0 1 0 0 0 0 0 hsa-let-7d -0.11 0.068 ARID3A NM_005224 AT rich interactive domain 3A1 (BRIGHT-like)0 0 1 0 0 0 0 hsa-let-7f -0.06 0.063 LOXL4 NM_032211 lysyl oxidase-like 4 1 0 0 1 0 0 0 0 hsa-let-7a -0.07 0.063 REEP1 NM_022912 receptor accessory protein 1 1 0 0 1 0 0 0 0 hsa-let-7g -0.1 0.063 THRB NM_000461 , beta1 (erythroblastic0 0 leukemia1 viral (v-erb-a)0 0 oncogene0 homolog0 hsa-let-7b 2, avian) -0.09 0.063 CBFA2T3 NM_005187 core-binding factor, runt domain,1 alpha0 subunit1 2; translocated0 0 to, 3 0 0 0 hsa-let-7e -0.06 0.06 FAM125B NM_033446 family with sequence similarity1 125, member0 B0 1 0 0 0 0 hsa-let-7a 0.09 0.06 SNAI3 NM_178310 snail homolog 3 (Drosophila)1 0 1 0 0 0 0 0 hsa-let-7i -0.2 0.06 CBX2 NM_005189 chromobox homolog 2 (Pc class1 homolog,0 Drosophila)1 0 1 0 0 1 hsa-let-7b -0.1 0.06 MDFI NM_005586 MyoD family inhibitor 1 0 1 0 0 0 0 0 hsa-let-7g -0.1 0.06 SLC5A6 NM_021095 solute carrier family 5 (sodium-dependent1 0 vitamin1 transporter),0 0 member0 6 0 0 hsa-let-7f -0.22 0.06 TEAD3 NM_003214 TEA domain family member 31 0 1 0 0 0 0 0 hsa-let-7a -0.07 0.06 CACNG4 NM_014405 calcium channel, voltage-dependent,1 0gamma subunit1 40 0 0 0 0 hsa-let-7f -0.19 0.04 ATXN7L2 NM_153340 ataxin 7-like 2 1 0 0 1 0 0 0 0 hsa-let-7d -0.04 0.04 CPSF4 NM_001081559cleavage and polyadenylation1 specific0 factor 4,1 30kDa 0 0 0 0 0 hsa-let-7a -0.1 0.04 CYP46A1 NM_006668 cytochrome P450, family 46, 1subfamily0 A, polypeptide1 10 0 0 0 0 hsa-let-7a -0.16 0.04 DKK3 NM_001018057dickkopf homolog 3 (Xenopus1 laevis) 0 1 0 0 0 0 0 hsa-let-7d -0.1 0.04 IKBKE NM_014002 inhibitor of kappa light polypeptide1 gene0 enhancer1 in B-cells,0 kinase0 epsilon0 0 0 hsa-let-7b -0.11 0.04 LYPLA3 NM_012320 lysophospholipase 3 (lysosomal1 phospholipase0 1A2) 0 0 0 0 0 hsa-let-7b -0.07 0.04 MLLT4 NM_001040000myeloid/lymphoid or mixed-lineage1 leukemia0 (trithorax1 0 homolog,0 Drosophila);0 translocated0 0 hsa-let-7c to, 4 -0.12 0.04 SCN5A NM_000335 sodium channel, voltage-gated,1 type V,0 alpha subunit1 0 0 0 0 0 hsa-let-7d -0.04 0.04 SLC26A9 NM_134325 solute carrier family 26, member1 9 0 1 0 0 0 0 0 hsa-let-7b -0.05 0.04 SLC45A4 NM_001080431solute carrier family 45, member1 4 0 1 0 0 0 0 0 hsa-let-7d -0.08 0.04 ARHGAP20 NM_020809 Rho GTPase activating protein1 20 0 1 0 0 0 0 0 hsa-let-7a -0.14 0.033 EZH2 NM_004456 enhancer of zeste homolog 2 1(Drosophila)0 1 0 0 0 0 0 hsa-let-7a 0 0.033 NSMCE2 NM_173685 non-SMC element 2, MMS21 1homolog0 (S. cerevisiae)1 0 0 0 0 0 hsa-let-7b -0.12 0.033 SURF4 NM_033161 surfeit 4 1 0 0 1 0 0 0 0 hsa-let-7a 0 0.02 CRTAP NM_006371 cartilage associated protein 1 0 0 1 0 0 0 0 hsa-let-7d -0.04 0.02 GPATCH3 NM_022078 G patch domain containing 3 1 0 0 1 0 0 0 0 hsa-let-7d -0.03 0.02 PYGO2 NM_138300 pygopus homolog 2 (Drosophila)1 0 0 1 0 0 0 0 hsa-let-7d -0.05 0.02 SCYL3 NM_020423 SCY1-like 3 (S. cerevisiae) 1 0 0 1 0 0 0 0 hsa-let-7f -0.18 0.02 CTNS NM_004937 cystinosis, nephropathic 1 0 1 0 0 0 0 0 hsa-let-7d -0.12 -0.01 IQSEC2 NM_015075 IQ motif and Sec7 domain 2 1 0 1 0 0 0 0 0 hsa-let-7a 0.01 -0.01

Genes downregulated during embryonic development >1.4 fold

Genes not found in the mouse gene data set Table S3: Changes in miRNA and protein levels following knock out of Dicer in MEFs.

miRNA quantitation Protein quantitation mRNA miRNA* FC decrease** Gene FC increase*** E9.5 E12.5 E15 miR-214 2.30 AKR1C2 1.48 nid nid nid miR-30a-5p 1.96 GOLT1B**** 1.37 1.31 1.36 0 miR-26 1.88 IDE 1.36 0 0 0 let-7 1.60 HCK 1.34 nid nid nid miR-200 1.58 LYN 1.34 0.24 0 0 miR-19 1.49 SERPINE1 1.31 0 0.20 0 miR-181a 1.49 HMGA2 1.30 5.13 4.52 1.96 miR-182 1.49 UQCRB 1.28 nid nid nid miR-142-5p 1.36 IGF2BP1 1.21 3.43 1.94 0.89 miR-155 1.36 NOMO2 1.19 nid nid nid miR-106 1.30 RSN 1.18 0 0 0 miR-15 1.24 PSMC4 1.18 0 0.92 0 PSAT1 1.18 1.13 1.14 0.61 COPS7B 1.17 1.35 1.47 0 XP_900204 1.15 unknown unkown unknown CBR3 1.15 0 0 0 NQO1 1.14 0 0.24 0 PTGS2 1.14 0 0.02 0 XP_9868816 1.14 unknown unkown unknown PARVB 1.13 0 0.11 0.25 ITM1 1.13 0.42 0.58 0 LYPLA2 1.13 nid nid nid DCXR 1.13 0.50 0.30 0.21 ITPR3 1.13 0 0 0 PXN 1.12 0 0 0 TXNDX12 1.12 0.75 0 0 PEA15 1.12 0 0.48 0.10 BLMH 1.11 1.16 1.37 0.15 SDHD 1.11 0.37 0.66 0 PSMB7 1.11 0.43 0.87 0.11 * A sample of miRNAs which were selected based on their detection level and 'responsive' targets (Nielson et al., 2007). ** Based on Significance Analysis of Microarrays (SAM) and corrected based on Northern blot analysis for several miRNAs *** Protein levels of Dicer knockout cells over control cells **** Only downregulated in A549 cells nid: Not in data base FC: Fold change