DOCSLIB.ORG

Distinct Transcriptomes Define Rostral and Caudal 5Ht Neurons

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Distinct Transcriptomes Define Rostral and Caudal 5Ht Neurons DISTINCT TRANSCRIPTOMES DEFINE ROSTRAL AND CAUDAL 5HT NEURONS by CHRISTI JANE WYLIE Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Dissertation Advisor: Dr. Evan S. Deneris Department of Neurosciences CASE WESTERN RESERVE UNIVERSITY May, 2010 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the thesis/dissertation of ______________________________________________________ candidate for the ________________________________degree *. (signed)_______________________________________________ (chair of the committee) ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ (date) _______________________ *We also certify that written approval has been obtained for any proprietary material contained therein. TABLE OF CONTENTS TABLE OF CONTENTS ....................................................................................... iii LIST OF TABLES AND FIGURES ........................................................................ v ABSTRACT ..........................................................................................................vii CHAPTER 1 INTRODUCTION ............................................................................................... 1 I. Serotonin (5-hydroxytryptamine, 5HT) ....................................................... 1 A. Discovery............................................................................................... 1 B. Processing of Serotonin ........................................................................ 1 1. Synthesis of 5HT (see Figure 1) ....................................................... 2 2. Sites of 5HT synthesis ...................................................................... 2 3. Storage and sequestration ................................................................ 3 4. Reuptake .......................................................................................... 4 5. Degradation ...................................................................................... 5 C. 5HT Receptors ...................................................................................... 5 D. 5HT Neuron Development .................................................................. 12 II. Heterogeneity of 5HT Neurons ................................................................ 13 A. Rhombomere of Origin ........................................................................ 14 B. Transcription Factor Requirements ...................................................... 14 C. Axonal Projections ............................................................................ 15 D. Cotransmission ................................................................................... 17 CHAPTER 2 PURIFICATION AND GENE EXPRESSION PROFILING OF GENETICALLY LABELED 5HT NEURONS REVEALS DISTINCT TRANSCRIPTOMES FOR ROSTRAL AND CAUDAL 5HT NEURONS ........................................................ 24 SUMMARY ......................................................................................................... 24 INTRODUCTION ................................................................................................ 25 RESULTS ........................................................................................................... 27 DISCUSSION ..................................................................................................... 41 iii MATERIALS AND METHODS ............................................................................ 47 ACKNOWLEDGEMENTS ................................................................................... 54 CHAPTER 3 CONDITIONAL DELETION OF NEUROPILIN 2 IN 5HT NEURONS ................. 73 SUMMARY ......................................................................................................... 73 INTRODUCTION ................................................................................................ 74 RESULTS ........................................................................................................... 79 MATERIALS AND METHODS ............................................................................ 83 CHAPTER 4 DISCUSSION ................................................................................................ 117 I. Utility of ePet-EYFP transgenic mice ................................................... 117 II. Development of methodology to purify embryonic rostral and caudal 5HT neurons. ....................................................................................... 118 III. Gene array profiling of rostral and caudal 5HT neurons. .................. 118 A. Identification of developing 5HT neuron transcriptomes ............... 130 B. Genes with enriched expression in 5HT neurons .......................... 130 C. Unique transcriptional profiles of rostral and caudal 5HT neurons 131 1. Homeodomain transcription factors enriched in rostral 5HT neurons ......................................................................................... 132 2. Hox genes mark caudal 5HT neurons ........................................... 133 3. Imprinted gene expression in 5HT neurons .................................. 134 Appendix: Supplemental Tables ..................................................................... 133 LITERATURE CITED ....................................................................................... 277 iv TABLE LIST CHAPTER 2 TABLE 1: Top 50 genes with enriched expression in R+C+ 62 5HT neurons (cluster I). TABLE 2: Gene ontology and pathway enrichment in R+C+ 65 5HT neurons. TABLE 3: Top genes with enriched expression in R+ (cluster II) 66 and R+R- (cluster III). TABLE 4: Top genes with enriched expression in C+ (cluster IV) 69 and C+C- (cluster V). TABLE 5: Gene ontology and pathway enrichment in R+ 72 versus C+ 5HT neurons. FIGURE LIST CHAPTER 1 FIGURE 1: 5HT biosynthesis and breakdown. 20 FIGURE 2: Specification and differentiation of 5HT neurons. 22 CHAPTER 2 FIGURE 1: ePet-EYFP expression marks rostral and caudal 5HT 56 neurons in the embryonic ventral hindbrain. FIGURE 2: Purification and expression profiling of rostral and 58 caudal 5HT neurons. FIGURE 3: Unsupervised hierarchical clustering of serotonergic 60 gene expression. v FIGURE 4: Verification of 5HT neuron-enriched gene 63 expression. FIGURE 5: Verification of rostral 5HT neuron-enriched HD gene 67 expression. FIGURE 6: Verification of Hox gene expression in caudal 5HT 70 neurons CHAPTER 3 FIGURE 1: Genomic organization and alternative splice variants 89 of NRP2 in mouse. FIGURE 2: Classes of semaphorins. 91 FIGURE 3: Semaphorins and their receptors. 93 FIGURE 4: Neuropilin, Semaphorin, and Plexin gene expression 95 in E12.5 5HT neurons and surrounding neural tube as detected by Affymetrix gene arrays. FIGURE 5: Confirmation of NRP2 protein enrichment in rostral 97 5HT neurons. FIGURE 6: Transgenics and conditional deletion of NRP2 in 99 5HT neurons. FIGURE 7: Conditional deletion of NRP2 in 5HT neurons 101 (5HTΔNRP2) results in a loss of 5HT immunoreactive axons and cell bodies. FIGURE 8: High magnification of sections in Figure 7 to detail 103 the profound loss of 5HT axonal fibers in the absence of NRP2. vi FIGURE 9: Loss of NRP2 results in a severe disruption of 5HT 105 neurons at the midline. FIGURE 10: High magnification of stereo confocal images in 107 Figure 9 to illustrate dystrophic growth cone endings in the absence of NRP2. FIGURE 11: 5HT and the 5HT metabolite 5HIAA are decreased 109 in the brains of adult 5HTΔNRP2 mice. FIGURE 12: 5HT immunoreactive axons are decreased in the 111 cortex of 5HTΔNRP2 mice. FIGURE 13: 5HT immunoreactive axonal fibers are decreased 113 in the dentate gyrus of adult 5HTΔNRP2 mice. FIGURE 14: Ingenuity Pathway Analysis (IPA) of Neuropilin 115 associated genes expressed in rostral 5HT neurons. CHAPTER 4 FIGURE 1: Dissociated ePet-EYFP neurons grown in culture. 129 FIGURE 2: Verification of enriched imprinted gene expression 131 in 5HT neurons. Supplemental Datasets (available as annotated excel files at www.jneurosci.org as supplemental material) Dataset 1: An annotated master list of expression signals and Present/Absent calls for 12 arrays. Dataset 2: A database of E12.5 5HT neuron expressed genes (called Present on 3 biological replicates at a minimum threshold intensity of the lowest known 5HT gene) containing 12,559 probe sets corresponding to 8,186 genes, 866 RIKEN cDNAs, and 435 ESTs. vii Dataset 3: R+C+ gene ontology and pathway enrichment. Dataset 4: R+ versus C+ gene ontology and pathway enrichment. Supplemental Tables Supplemental Table S1. 133 Microarray detection of Tph2-like genes identified by the Allen Institute for Brain Science. We filtered the Allen data set for genes with a Tph2-like expression pattern in adult brain and identified 248 genes. Expression of 155 of these Tph2- like genes (with 95 duplicate probe sets) was detected in our R+ and C+ arrays. Supplemental Tables S2-S7 – Expressed Genes 5HT neuron gene expression according to the molecular categories of DNA binding proteins, axon pathfinding/cell adhesion, ion channels, solute carriers, G- protein coupled receptors, and kinases. A combination of Gene Ontology (GO) nomenclature, Ingenuity Pathway Analysis (IPA) software, web-based databases, and Microsoft Access was used for filtering Dataset 3. Each table shows
Load more

Recommended publications
  • Recombinant Human FLRT1 Catalog Number: 2794-FL
    Recombinant Human FLRT1 Catalog Number: 2794-FL DESCRIPTION Source Mouse myeloma cell line, NS0­derived human FLRT1 protein Ile21­Pro524, with a C­terminal 6­His tag Accession # Q9NZU1 N­terminal Sequence Ile21 Analysis Predicted Molecular 56.3 kDa Mass SPECIFICATIONS SDS­PAGE 70­80 kDa, reducing conditions Activity Measured by the ability of the immobilized protein to support the adhesion of Neuro­2A mouse neuroblastoma cells. Recombinant Human FLRT1 immobilized at 2.5 μg/mL, 100 μL/well, will meidate > 50% Neuro­2A cell adhesion. Optimal dilutions should be determined by each laboratory for each application. Endotoxin Level <0.10 EU per 1 μg of the protein by the LAL method. Purity >95%, by SDS­PAGE under reducing conditions and visualized by silver stain. Formulation Lyophilized from a 0.2 μm filtered solution in PBS. See Certificate of Analysis for details. PREPARATION AND STORAGE Reconstitution Reconstitute at 200 μg/mL in sterile PBS. Shipping The product is shipped at ambient temperature. Upon receipt, store it immediately at the temperature recommended below. Stability & Storage Use a manual defrost freezer and avoid repeated freeze­thaw cycles. l 12 months from date of receipt, ­20 to ­70 °C as supplied. l 1 month, 2 to 8 °C under sterile conditions after reconstitution. l 3 months, ­20 to ­70 °C under sterile conditions after reconstitution. BACKGROUND FLRT1 is one of three FLRT (fibronectin, leucine rich repeat, transmembrane) glycoproteins expressed in distinct areas of the developing brain and other tissues (1, 2). The 90 kDa type I transmembrane (TM) human FLRT1 is synthesized as a 646 amino acid (aa) precursor with a 20 aa signal sequence, a 504 aa extracellular domain (ECD), a 21 aa TM segment and a 101 aa cytoplasmic region.
    [Show full text]
  • Global Analysis Reveals the Complexity of the Human Glomerular Extracellular Matrix
    Global analysis reveals the complexity of the human glomerular extracellular matrix Rachel Lennon,1,2 Adam Byron,1,* Jonathan D. Humphries,1 Michael J. Randles,1,2 Alex Carisey,1 Stephanie Murphy,1,2 David Knight,3 Paul E. Brenchley,2 Roy Zent,4,5 and Martin J. Humphries.1 1Wellcome Trust Centre for Cell-Matrix Research, Faculty of Life Sciences, University of Manchester, Manchester, UK; 2Faculty of Medical and Human Sciences, University of Manchester, Manchester, UK; 3Biological Mass Spectrometry Core Facility, Faculty of Life Sciences, University of Manchester, Manchester, UK; 4Division of Nephrology, Department of Medicine, Vanderbilt University Medical Center, Nashville, TN, USA; and 5Veterans Affairs Hospital, Nashville, TN, USA. *Present address: Edinburgh Cancer Research UK Centre, Institute of Genetics and Molecular Medicine, University of Edinburgh, Edinburgh, UK. Running title: Proteome of the glomerular matrix Word count: Abstract: 208, main text 2765 Corresponding author: Dr Rachel Lennon, Wellcome Trust Centre for Cell-Matrix Research, Michael Smith Building, University of Manchester, Manchester M13 9PT, UK. Phone: 0044 (0) 161 2755498. Fax: 0044 (0) 161 2755082. Email: [email protected] Abstract The glomerulus contains unique cellular and extracellular matrix (ECM) components, which are required for intact barrier function. Studies of the cellular components have helped to build understanding of glomerular disease; however, the full composition and regulation of glomerular ECM remains poorly understood. Here, we employed mass spectrometry–based proteomics of enriched ECM extracts for a global analysis of human glomerular ECM in vivo and identified a tissue-specific proteome of 144 structural and regulatory ECM proteins. This catalogue includes all previously identified glomerular components, plus many new and abundant components.
    [Show full text]
  • Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas
    Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo
    [Show full text]
  • NIH Public Access Author Manuscript Science
    NIH Public Access Author Manuscript Science. Author manuscript; available in PMC 2014 September 08. NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: Science. 2014 January 31; 343(6170): 506–511. doi:10.1126/science.1247363. Exome Sequencing Links Corticospinal Motor Neuron Disease to Common Neurodegenerative Disorders A full list of authors and affiliations appears at the end of the article. # These authors contributed equally to this work. Abstract Hereditary spastic paraplegias (HSPs) are neurodegenerative motor neuron diseases characterized by progressive age-dependent loss of corticospinal motor tract function. Although the genetic basis is partly understood, only a fraction of cases can receive a genetic diagnosis, and a global view of HSP is lacking. By using whole-exome sequencing in combination with network analysis, we identified 18 previously unknown putative HSP genes and validated nearly all of these genes functionally or genetically. The pathways highlighted by these mutations link HSP to cellular transport, nucleotide metabolism, and synapse and axon development. Network analysis revealed a host of further candidate genes, of which three were mutated in our cohort. Our analysis links HSP to other neurodegenerative disorders and can facilitate gene discovery and mechanistic understanding of disease. Hereditary spastic paraplegias (HSPs) are a group of genetically heterogeneous neurodegenerative disorders with prevalence between 3 and 10 per 100,000 individuals (1). Hallmark features are axonal degeneration and progressive lower limb spasticity resulting from a loss of corticospinal tract (CST) function. HSP is classified into two broad categories, uncomplicated and complicated, on the basis of the presence of additional clinical features such as intellectual disability, seizures, ataxia, peripheral neuropathy, skin abnormalities, and visual defects.
    [Show full text]
  • Supplementary Information Integrative Analyses of Splicing in the Aging Brain: Role in Susceptibility to Alzheimer’S Disease
    Supplementary Information Integrative analyses of splicing in the aging brain: role in susceptibility to Alzheimer’s Disease Contents 1. Supplementary Notes 1.1. Religious Orders Study and Memory and Aging Project 1.2. Mount Sinai Brain Bank Alzheimer’s Disease 1.3. CommonMind Consortium 1.4. Data Availability 2. Supplementary Tables 3. Supplementary Figures Note: Supplementary Tables are provided as separate Excel files. 1. Supplementary Notes 1.1. Religious Orders Study and Memory and Aging Project Gene expression data1. Gene expression data were generated using RNA- sequencing from Dorsolateral Prefrontal Cortex (DLPFC) of 540 individuals, at an average sequence depth of 90M reads. Detailed description of data generation and processing was previously described2 (Mostafavi, Gaiteri et al., under review). Samples were submitted to the Broad Institute’s Genomics Platform for transcriptome analysis following the dUTP protocol with Poly(A) selection developed by Levin and colleagues3. All samples were chosen to pass two initial quality filters: RNA integrity (RIN) score >5 and quantity threshold of 5 ug (and were selected from a larger set of 724 samples). Sequencing was performed on the Illumina HiSeq with 101bp paired-end reads and achieved coverage of 150M reads of the first 12 samples. These 12 samples will serve as a deep coverage reference and included 2 males and 2 females of nonimpaired, mild cognitive impaired, and Alzheimer's cases. The remaining samples were sequenced with target coverage of 50M reads; the mean coverage for the samples passing QC is 95 million reads (median 90 million reads). The libraries were constructed and pooled according to the RIN scores such that similar RIN scores would be pooled together.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • ELF2 Antibody - N-Terminal Region Rabbit Polyclonal Antibody Catalog # AI10026
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 ELF2 antibody - N-terminal region Rabbit Polyclonal Antibody Catalog # AI10026 Specification ELF2 antibody - N-terminal region - Product Information Application WB Primary Accession Q15723 Other Accession Q15723-3, NP_006865, NM_006874 Reactivity Human, Mouse, Rat, Rabbit, Dog, Guinea Pig, Horse, Bovine Predicted Human, Mouse, ELF2 antibody - N-terminal region (AI10026) Rat, Rabbit, in Hum. Fetal Heart cells using Western Blot Chicken, Dog, Host: Rabbit Guinea Pig, Horse, Bovine Target Name: ELF2 Host Rabbit Sample Tissue: Human Fetal Heart Clonality Polyclonal Antibody Dilution: 1.0μg/ml Calculated MW 57 kDa KDa ELF2 antibody - N-terminal region - Additional Information Gene ID 1998 Alias Symbol EU32, NERF, NERF-2, NERF-1A, NERF-1B, NERF-1a,b Other Names ETS-related transcription factor Elf-2, ELF2 antibody - N-terminal region (AI10026) E74-like factor 2, New ETS-related factor, in Hum. Fetal Lung cells using Western Blot ELF2 {ECO:0000312|EMBL:AAF671951} Host: Rabbit Target Name: ELF2 Target/Specificity Sample Tissue: Human Fetal Lung The ELF2 gene encodes a protein that Antibody Dilution: 1.0μg/ml physically interacts with AML1 and mediates opposing effects on AML1-mediated transcription of the B cell-specific blk gene. Format Liquid. Purified antibody supplied in 1x PBS buffer with 0.09% (w/v) sodium azide and 2% sucrose. Page 1/2 10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 Reconstitution & Storage Add 50 ul of distilled water. Final anti-ELF2 antibody concentration is 1 mg/ml in PBS buffer with 2% sucrose.
    [Show full text]
  • Gene Symbol Category ACAN ECM ADAM10 ECM Remodeling-Related ADAM11 ECM Remodeling-Related ADAM12 ECM Remodeling-Related ADAM15 E
    Supplementary Material (ESI) for Integrative Biology This journal is (c) The Royal Society of Chemistry 2010 Gene symbol Category ACAN ECM ADAM10 ECM remodeling-related ADAM11 ECM remodeling-related ADAM12 ECM remodeling-related ADAM15 ECM remodeling-related ADAM17 ECM remodeling-related ADAM18 ECM remodeling-related ADAM19 ECM remodeling-related ADAM2 ECM remodeling-related ADAM20 ECM remodeling-related ADAM21 ECM remodeling-related ADAM22 ECM remodeling-related ADAM23 ECM remodeling-related ADAM28 ECM remodeling-related ADAM29 ECM remodeling-related ADAM3 ECM remodeling-related ADAM30 ECM remodeling-related ADAM5 ECM remodeling-related ADAM7 ECM remodeling-related ADAM8 ECM remodeling-related ADAM9 ECM remodeling-related ADAMTS1 ECM remodeling-related ADAMTS10 ECM remodeling-related ADAMTS12 ECM remodeling-related ADAMTS13 ECM remodeling-related ADAMTS14 ECM remodeling-related ADAMTS15 ECM remodeling-related ADAMTS16 ECM remodeling-related ADAMTS17 ECM remodeling-related ADAMTS18 ECM remodeling-related ADAMTS19 ECM remodeling-related ADAMTS2 ECM remodeling-related ADAMTS20 ECM remodeling-related ADAMTS3 ECM remodeling-related ADAMTS4 ECM remodeling-related ADAMTS5 ECM remodeling-related ADAMTS6 ECM remodeling-related ADAMTS7 ECM remodeling-related ADAMTS8 ECM remodeling-related ADAMTS9 ECM remodeling-related ADAMTSL1 ECM remodeling-related ADAMTSL2 ECM remodeling-related ADAMTSL3 ECM remodeling-related ADAMTSL4 ECM remodeling-related ADAMTSL5 ECM remodeling-related AGRIN ECM ALCAM Cell-cell adhesion ANGPT1 Soluble factors and receptors
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • (P -Value<0.05, Fold Change≥1.4), 4 Vs. 0 Gy Irradiation
    Table S1: Significant differentially expressed genes (P -Value<0.05, Fold Change≥1.4), 4 vs. 0 Gy irradiation Genbank Fold Change P -Value Gene Symbol Description Accession Q9F8M7_CARHY (Q9F8M7) DTDP-glucose 4,6-dehydratase (Fragment), partial (9%) 6.70 0.017399678 THC2699065 [THC2719287] 5.53 0.003379195 BC013657 BC013657 Homo sapiens cDNA clone IMAGE:4152983, partial cds. [BC013657] 5.10 0.024641735 THC2750781 Ciliary dynein heavy chain 5 (Axonemal beta dynein heavy chain 5) (HL1). 4.07 0.04353262 DNAH5 [Source:Uniprot/SWISSPROT;Acc:Q8TE73] [ENST00000382416] 3.81 0.002855909 NM_145263 SPATA18 Homo sapiens spermatogenesis associated 18 homolog (rat) (SPATA18), mRNA [NM_145263] AA418814 zw01a02.s1 Soares_NhHMPu_S1 Homo sapiens cDNA clone IMAGE:767978 3', 3.69 0.03203913 AA418814 AA418814 mRNA sequence [AA418814] AL356953 leucine-rich repeat-containing G protein-coupled receptor 6 {Homo sapiens} (exp=0; 3.63 0.0277936 THC2705989 wgp=1; cg=0), partial (4%) [THC2752981] AA484677 ne64a07.s1 NCI_CGAP_Alv1 Homo sapiens cDNA clone IMAGE:909012, mRNA 3.63 0.027098073 AA484677 AA484677 sequence [AA484677] oe06h09.s1 NCI_CGAP_Ov2 Homo sapiens cDNA clone IMAGE:1385153, mRNA sequence 3.48 0.04468495 AA837799 AA837799 [AA837799] Homo sapiens hypothetical protein LOC340109, mRNA (cDNA clone IMAGE:5578073), partial 3.27 0.031178378 BC039509 LOC643401 cds. [BC039509] Homo sapiens Fas (TNF receptor superfamily, member 6) (FAS), transcript variant 1, mRNA 3.24 0.022156298 NM_000043 FAS [NM_000043] 3.20 0.021043295 A_32_P125056 BF803942 CM2-CI0135-021100-477-g08 CI0135 Homo sapiens cDNA, mRNA sequence 3.04 0.043389246 BF803942 BF803942 [BF803942] 3.03 0.002430239 NM_015920 RPS27L Homo sapiens ribosomal protein S27-like (RPS27L), mRNA [NM_015920] Homo sapiens tumor necrosis factor receptor superfamily, member 10c, decoy without an 2.98 0.021202829 NM_003841 TNFRSF10C intracellular domain (TNFRSF10C), mRNA [NM_003841] 2.97 0.03243901 AB002384 C6orf32 Homo sapiens mRNA for KIAA0386 gene, partial cds.
    [Show full text]
  • Adaptive History of the Chimpanzee Subspecies in the Genomic Era
    Adaptive History of the Chimpanzee Subspecies in the Genomic Era Jessica Nye TESI DOCTORAL UPF 2018 Directors de la Tesi Jaume Bertranpetit i Hafid Laayouni CIÈNCIES EXPERIMENTALS I DE LA SALUT ii Acknowledgements I would like to thank my advisors Dr. Jaume Bertranpetit and Dr. Hafid Laayouni for guiding me during my doctoral research. I would like to thank my family and friends for supporting me during my many years of education. To my fellow lab mates, I am grateful for the theoretical discussions we had over the last four years. This work was supported by FI Agaur grant FI-DGR 2015. iii iv Abstract Chimpanzees are our closest living genetic cousins. The species consists of four subspecies, each with a unique demographic history. In order to better understand their species, a detailed map of signatures of selection will highlight important genetic differences between the four subspecies. Here, we interrogate the genome using 15 tests of selection. We simulate neutral and selective scenarios taking their unique demographic history into account in the model. We combine all these elements using a machine learning approach to highlight regions of interest in each subspecies. We specifically investigate the regions of the genome that have been selected after introgression with bonobo. We investigate the haplotype changes that have occurred since the divergence with humans in a few specially selected genes. From this, we find that the evolutionary history of each of the four subspecies is unique. That subtle differences in their demographic history and environment have greatly shaped their genetic diversity. In general, we observe signatures in selection in phenotypes involving immunity, muscle function, reproduction, and DNA repair.
    [Show full text]