DISTINCT TRANSCRIPTOMES DEFINE ROSTRAL AND CAUDAL 5HT NEURONS
by
CHRISTI JANE WYLIE
Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy
Dissertation Advisor: Dr. Evan S. Deneris
Department of Neurosciences CASE WESTERN RESERVE UNIVERSITY
May, 2010
CASE WESTERN RESERVE UNIVERSITY
SCHOOL OF GRADUATE STUDIES
We hereby approve the thesis/dissertation of
______candidate for the ______degree *.
(signed)______(chair of the committee)
______
______
______
______
______
(date) ______
*We also certify that written approval has been obtained for any proprietary material contained therein.
TABLE OF CONTENTS
TABLE OF CONTENTS ...... iii LIST OF TABLES AND FIGURES ...... v ABSTRACT ...... vii CHAPTER 1 INTRODUCTION ...... 1 I. Serotonin (5-hydroxytryptamine, 5HT) ...... 1 A. Discovery...... 1 B. Processing of Serotonin ...... 1 1. Synthesis of 5HT (see Figure 1) ...... 2 2. Sites of 5HT synthesis ...... 2 3. Storage and sequestration ...... 3 4. Reuptake ...... 4 5. Degradation ...... 5 C. 5HT Receptors ...... 5 D. 5HT Neuron Development ...... 12 II. Heterogeneity of 5HT Neurons ...... 13 A. Rhombomere of Origin ...... 14 B. Transcription Factor Requirements ...... 14 C. Axonal Projections ...... 15 D. Cotransmission ...... 17 CHAPTER 2 PURIFICATION AND GENE EXPRESSION PROFILING OF GENETICALLY LABELED 5HT NEURONS REVEALS DISTINCT TRANSCRIPTOMES FOR ROSTRAL AND CAUDAL 5HT NEURONS ...... 24 SUMMARY ...... 24 INTRODUCTION ...... 25 RESULTS ...... 27 DISCUSSION ...... 41
iii MATERIALS AND METHODS ...... 47 ACKNOWLEDGEMENTS ...... 54 CHAPTER 3 CONDITIONAL DELETION OF NEUROPILIN 2 IN 5HT NEURONS ...... 73 SUMMARY ...... 73 INTRODUCTION ...... 74 RESULTS ...... 79 MATERIALS AND METHODS ...... 83 CHAPTER 4 DISCUSSION ...... 117 I. Utility of ePet-EYFP transgenic mice ...... 117 II. Development of methodology to purify embryonic rostral and caudal 5HT neurons...... 118 III. Gene array profiling of rostral and caudal 5HT neurons...... 118 A. Identification of developing 5HT neuron transcriptomes ...... 130 B. Genes with enriched expression in 5HT neurons ...... 130 C. Unique transcriptional profiles of rostral and caudal 5HT neurons 131 1. Homeodomain transcription factors enriched in rostral 5HT neurons ...... 132 2. Hox genes mark caudal 5HT neurons ...... 133 3. Imprinted gene expression in 5HT neurons ...... 134 Appendix: Supplemental Tables ...... 133 LITERATURE CITED ...... 277
iv TABLE LIST
CHAPTER 2
TABLE 1: Top 50 genes with enriched expression in R+C+ 62 5HT neurons (cluster I). TABLE 2: Gene ontology and pathway enrichment in R+C+ 65 5HT neurons. TABLE 3: Top genes with enriched expression in R+ (cluster II) 66 and R+R- (cluster III). TABLE 4: Top genes with enriched expression in C+ (cluster IV) 69 and C+C- (cluster V). TABLE 5: Gene ontology and pathway enrichment in R+ 72 versus C+ 5HT neurons.
FIGURE LIST CHAPTER 1 FIGURE 1: 5HT biosynthesis and breakdown. 20 FIGURE 2: Specification and differentiation of 5HT neurons. 22
CHAPTER 2 FIGURE 1: ePet-EYFP expression marks rostral and caudal 5HT 56
neurons in the embryonic ventral hindbrain.
FIGURE 2: Purification and expression profiling of rostral and 58 caudal 5HT neurons. FIGURE 3: Unsupervised hierarchical clustering of serotonergic 60 gene expression.
v FIGURE 4: Verification of 5HT neuron-enriched gene 63 expression. FIGURE 5: Verification of rostral 5HT neuron-enriched HD gene 67
expression.
FIGURE 6: Verification of Hox gene expression in caudal 5HT 70
neurons
CHAPTER 3 FIGURE 1: Genomic organization and alternative splice variants 89 of NRP2 in mouse.
FIGURE 2: Classes of semaphorins. 91
FIGURE 3: Semaphorins and their receptors. 93
FIGURE 4: Neuropilin, Semaphorin, and Plexin gene expression 95 in E12.5 5HT neurons and surrounding neural tube as detected by Affymetrix gene arrays. FIGURE 5: Confirmation of NRP2 protein enrichment in rostral 97 5HT neurons. FIGURE 6: Transgenics and conditional deletion of NRP2 in 99 5HT neurons. FIGURE 7: Conditional deletion of NRP2 in 5HT neurons 101 (5HTΔNRP2) results in a loss of 5HT immunoreactive axons and cell bodies. FIGURE 8: High magnification of sections in Figure 7 to detail 103
the profound loss of 5HT axonal fibers in the absence
of NRP2.
vi FIGURE 9: Loss of NRP2 results in a severe disruption of 5HT 105
neurons at the midline.
FIGURE 10: High magnification of stereo confocal images in 107
Figure 9 to illustrate dystrophic growth cone endings
in the absence of NRP2.
FIGURE 11: 5HT and the 5HT metabolite 5HIAA are decreased 109
in the brains of adult 5HTΔNRP2 mice.
FIGURE 12: 5HT immunoreactive axons are decreased in the 111
cortex of 5HTΔNRP2 mice.
FIGURE 13: 5HT immunoreactive axonal fibers are decreased 113
in the dentate gyrus of adult 5HTΔNRP2 mice.
FIGURE 14: Ingenuity Pathway Analysis (IPA) of Neuropilin 115
associated genes expressed in rostral 5HT neurons.
CHAPTER 4
FIGURE 1: Dissociated ePet-EYFP neurons grown in culture. 129
FIGURE 2: Verification of enriched imprinted gene expression 131
in 5HT neurons.
Supplemental Datasets (available as annotated excel files at www.jneurosci.org as supplemental material)
Dataset 1: An annotated master list of expression signals and Present/Absent calls for 12 arrays. Dataset 2: A database of E12.5 5HT neuron expressed genes (called Present on 3 biological replicates at a minimum threshold intensity of the lowest known 5HT gene) containing 12,559 probe sets corresponding to 8,186 genes, 866 RIKEN cDNAs, and 435 ESTs.
vii Dataset 3: R+C+ gene ontology and pathway enrichment. Dataset 4: R+ versus C+ gene ontology and pathway enrichment.
Supplemental Tables
Supplemental Table S1. 133
Microarray detection of Tph2-like genes identified by the Allen Institute for Brain
Science. We filtered the Allen data set for genes with a Tph2-like expression pattern in adult brain and identified 248 genes. Expression of 155 of these Tph2- like genes (with 95 duplicate probe sets) was detected in our R+ and C+ arrays.
Supplemental Tables S2-S7 – Expressed Genes
5HT neuron gene expression according to the molecular categories of DNA
binding proteins, axon pathfinding/cell adhesion, ion channels, solute carriers, G- protein coupled receptors, and kinases. A combination of Gene Ontology (GO) nomenclature, Ingenuity Pathway Analysis (IPA) software, web-based databases, and Microsoft Access was used for filtering Dataset 3. Each table shows the Affymetrix probe ID, gene symbol, gene title, average R+C+ signal intensity, average R+ signal intensity, and average C+ signal intensity. Online versions also contain ENSEMBL IDs and Gene Ontology definitions for biological process, cellular component, and molecular function.
Supplemental Table S2 - DNA binding. 142 Gene Ontology (GO) recognizes 9,828 gene products with the molecular function of DNA binding. This includes not only transcription factors but also for example,
viii genes encoding histones and chromatin remodeling proteins such as histone
deacetylases. 1,542 probe sets corresponding to 1,009 genes with the molecular
function of DNA binding were consistently expressed in R+C+ 5HT neurons.
Supplemental Table S3- Axon guidance/adhesion. 191 Ingenuity Pathway Analysis software identified191 genes including receptors,
ligands, and intracellular signaling molecules that mediate axonal pathfinding.
Other cell adhesion families were manually filtered using Microsoft Access.
Supplemental Table S4-Ion channels. 202 We have identified 84 probe sets corresponding to 63 ion channel genes that were expressed in 5HT neurons.
Supplemental Table S5- Solute carriers. 205 The solute carrier (Slc) gene family includes 300 genes organized into 47 gene families. We have identified 175 probe sets corresponding to 129 solute carrier genes that were expressed in 5HT neurons. Table S5 is organized by gene family.
Supplemental Table S6-GPCRs. 210 A list of known G-protein coupled receptors was downloaded from the
International Union of Basic and Clinical Pharmacology (IUPHAR) and cross-
referenced to Supplementary Table S3 in Microsoft Access. We identified 65
probes sets corresponding to 49 GPCRs expressed in 5HT neurons. These are
grouped according to Class A, B, C or Frizzled GPCR families.
Supplemental Table S7- Kinases. 213
ix A list of 9 kinase families was obtained from http://kinase.com/kinbase/ and
cross-referenced to Supplementary Table S3. We identified 218 probe sets corresponding to 179 kinases expressed in 5HT neurons.
Supplemental Table S8-Cluster I, R+C+ enriched. 222 Cluster I comprises 309 probe IDs corresponding to 243 individual genes and 23
RIKEN cDNAs enriched in rostral and caudal 5HT neurons (R+C+) relative to
rostral non-5HT and caudal non-5HT cells (R-C-). Shown are the Affymetrix
probe ID, the fold increase, gene symbol, and gene title. Online excel files also
contain Gene Ontology classifications for biological process, molecular function,
and cellular component. At least 15 of these are well known 5HT enriched genes
however the vast majority of these 5HT enriched genes are previously
unreported and uncharacterized in 5HT neurons.
Supplemental Table S9-Cluster II, R+ enriched. 232 Cluster II contains 95 probes corresponding to 75 named genes and 8 RIKEN
cDNAs that are enriched in R+ 5HT neurons relative to R-, C+, and C- cell
populations. Shown are the Affymetrix probe ID, the fold increase, gene symbol,
and gene title. Online excel files also contain Gene Ontology classifications for
biological process, molecular function, and cellular component. Only 2 of these
genes (Slc22a3 and Ddc) have known expression in 5HT neurons.
Supplemental Table S10-Cluster III, R+R- enriched. 236 Identification of genes enriched in both rostral 5HT (R+) and rostral non-5HT neurons (R-). Cluster III comprises 26 probes corresponding to 23 named genes and 3 RIKEN cDNAs.
x Supplemental Table S11-Cluster IV, C+ enriched. 237 Identification of genes enriched in caudal 5HT (C+) neurons (cluster IV). Cluster
IV consists of 300 probes corresponding to 270 genes and 29 RIKEN cDNAs.
The majority if not all of these genes are unreported in caudal 5HT neurons.
Supplemental Table S12-Imprinted Genes. 247 We used the Catalogue of Imprinted Genes from www.otago.ac.nz/IGC (Morison,
2001 #224)to cross-reference our R+C+ gene list. We identified 63 probes
corresponding to 40 imprinted genes expressed in 5HT neurons. The number of
imprinted genes with enriched expression in Clusters I-IV as follows: R+C+(10);
R+(1); R+R-(0); C+(6); C+C-(2).
SupplementalTable S13-Cluster V, C+C- enriched. 249 Identification of genes enriched in both caudal 5HT (C+) and caudal non-5HT (C-)
(cluster V). Cluster V comprises 146 probes corresponding to 113 genes and 9
RIKEN cDNAs.
Supplemental Table S14-Disease-associated genes 264 Genes expressed in 5HT neurons that are associated with anxiety, bipolar disorder, pervasive developmental disorders and autism, schizophrenia, sudden infant death syndrome (SIDS), and unipolar depression. Ingenuity Pathway
Analysis software was used identify genes consistently expressed in R+C+ 5HT neurons that are associated with neuropsychiatric and neurodevelopmental disorders with a suspected serotonergic component.
xi Distinct Transcriptomes Define Rostral and Caudal 5HT Neurons
Abstract by
CHRISTI JANE WYLIE
The central 5HT (5-hydroxytryptamine, 5-HT) neurotransmitter system has a broad influence over a wide range of physiological functions including appetite, sleep, locomotion, pain perception, regulation of body temperature, cardiovascular function, and mood. Dysfunction of 5HT neuronal signaling and circuitry has been implicated in many disorders including depression, anxiety, schizophrenia, obsessive compulsive disorder, sudden infant death syndrome
(SIDS), and autism. Many of these disorders are believed in part to result from alterations in serotonergic neuron development therefore necessitating a better knowledge of the genes required for 5HT neuron development.
5HT neurons of the mammalian brain are divided into rostral and caudal subdivisions with distinct anatomical positions and axonal trajectories in the developing hindbrain. We hypothesized that distinct molecular programs are responsible for the disparate migration patterns and axonal trajectories of rostral and caudal 5HT neurons. To investigate this hypothesis we set out to determine which genes are differentially expressed by rostral and caudal 5HT neurons during an early critical stage of their development when migration and axonal pathfinding are underway. To facilitate this approach we have generated a
xii transgenic mouse line in which developing rostral and caudal 5HT neurons are
marked with enhanced yellow fluorescent protein (EYFP). We then developed
methods for using fluorescent activated cell sorting (FACS) to purify these
genetically labeled rostral and caudal neurons for gene expression profiling. Our
results reveal shared genetic programs between rostral and caudal 5HT neurons
and confirm that postmitotic rostral and caudal 5HT neurons are differentially marked by more than 400 genes including transcription factors, axon guidance and cell adhesion molecules, ion channels, and genes involved in intracellular signaling.
We confirmed the differential expression of a number of homeodomain transcription factors and further identified subpopulations within the rostral and caudal 5HT systems based on their differential expression of transcription factors.
We then focused on the enriched expression of Neuropilin 2 (NRP2) in rostral 5HT neurons. NRP2 is well known in other cell types for its role in axonal guidance and cell migration. Conditional deletion of NRP2 in 5HT neurons indicates that it is required for the proper development of rostral 5HT neuronal circuitry.
xiii CHAPTER 1
INTRODUCTION
I. Serotonin (5-hydroxytryptamine, 5HT)
A. Discovery
More than 50 years ago in 1939 a substance “enteramine” was isolated from enterochromaffin cells (Erspamer & Asero, 1952) and independently a constriction or tonic factor known as serotonin was isolated from serum (Rapport et al, 1948). Later it was shown that they had identical structures and actually were the same molecule. Serotonin’s presence in the brain was discovered in
1953 (Twarog & Page, 1953) and since then has been studied extensively for its role in normal and abnormal brain function.
B. Processing of Serotonin
1. Synthesis of 5HT (see Figure 1)
Serotonin is a monoamine transmitter that is synthesized from the precursor amino acid L-tryptophan. Tryptophan is an essential amino acid for many organisms including humans indicating that it cannot be synthesized de novo and therefore must be supplied through dietary means. Tryptophan is plentiful in protein based foods such as meat and milk and also bananas, chickpeas, and peanuts. The first step in the synthesis of serotonin is the facilitated transport of tryptophan from the blood into the brain. Most of the tryptophan in blood is bound by protein with only about 5% free and available for transport into the central nervous system. Transport occurs via an active protein
1 shuttle for which five other large neutral amino acids (valine, leucine, isoleucine,
phenylalanine, and tyrosine) compete (Bell et al, 2001). The second step in 5HT
synthesis is the hydroxylation of L-tryptophan by tryptophan hydroxylase (TPH)
to produce 5-Hydroxytryptophan (5-HTP) (Joh, 1997). TPH exists in two
isoforms: TPH1 is found in several body tissues and TPH2 is found selectively in
the serotonergic neurons of the brainstem raphe and adjacent recticular
formations. (Shaltiel et al, 2005; Walther et al, 2003; Zhang et al, 2004). TPH2 is
only about 50% saturated in the CNS which means that the rate of synthesis of
5HT is dependent on the availability of its substrate, tryptophan. Therefore, this is
the rate-limiting step for 5HT synthesis. TPH2 activity is dependent on the
tetrahydrobiopterin (BH4) cofactor for the donation of proteins. The last step in
the 5HT synthetic pathway is the conversion of 5-hydroxytryptophan to 5-
hydroxytryptamine by aromatic L-amino decarboxylase (AADC). AADC is also used in the production of dopamine. To summarize, there are three important factors that determine the amount of 5HT in the CNS: the amount of free tryptophan in the blood which is controlled in part by diet, the amount of tryptophan that successfully crosses the blood brain barrier, and the level of activity of the enzyme TPH2.
2. Sites of 5HT synthesis
5HT is present in both central and peripheral neurons. In the periphery,
5HT is synthesized in enterochromaffin cells that line the epithelia of the
gastrointestinal tract. Enterochromaffin cells produce 90% of 5HT in the body.
Free 5HT is taken up and stored by platelets where it is subsequently released
2 upon platelet activation. 5HT is important in the periphery for regulating vascular
tone, gut motility, primary hemostasis, and cell-mediated immune responses.
In the CNS, 5HT cell bodies are located in the brainstem with the majority
of 5HT neurons within the raphe nuclei, however some 5HT neurons lie outside
the boundaries of the raphe, and not all raphe cells are serotonergic. Although
there are a relatively small number of 5HT cells bodies (about 20,000 in the rat
brain and 300,000 in humans), the serotonergic system comprises one of the most expansive neurotransmitter systems known (Jacobs & Azmitia, 1992). This is due to their extensive axonal projections which innervate nearly every area of the brain. At the time of the discovery of 5HT neurons in the brainstem, 5HT neuron clusters were classified into nine (B1-B9) nuclei with the majority situated on or near the midline and some situated more laterally (Dahlstrom & Fuxe,
1964). These B nuclei can be grouped into two domains, a superior domain
(rostral) that consists of B5-B9 which send ascending axonal projections to virtually all areas of the brain and an inferior (caudal) group that includes B4-B1 which send descending projections to the cerebellum and spinal cord (Azmitia &
Whitaker-Azmitia, 1991). The parcellation of 5HT neurons into B nuclei is evident as early as E13-14 in the rat, suggesting that distinct genetic programs operate to organize 5HT neurons into discrete subgroups (Wallace & Lauder,
1983).
3. Storage and sequestration
After synthesis, 5HT is actively kept away from the structures that respond to it by packaging into vesicles. The transport of 5HT into vesicles is
3 performed by one of two cloned vesicular monoamine transporters (VMATS),
VMAT1 and VMAT2 (Peter, 1997). Vesicles containing 5HT then undergo exocytosis in response to neural activity. There are two types of secretory vesicles involved in regulated endocytosis of neurotransmitter. Typically, large dense-core vesicles (LDCVs) store neural peptides (Kelly, 1991), while small synaptic vesicles (SSVs) store classical transmitters (Sudhof & Jahn, 1991).
LDCVs undergo exocytosis at a longer latency and their release requires high frequency stimulation. LDCVs are found at low numbers at synapses and are also found localized to the cell body and dendrites. SSVs, on the other hand, are clustered primarily at synapses. Interestingly, 5HT as well as other monoamines are stored in both large dense core vesicles and small synaptic vesicles. LDCVs containing 5HT can be found in chromaffin granules of the adrenal medulla
(Johnson, 1988) while SSVs are found in the brain (Thureson-Klein, 1983) .
There also appears to be differential expression of the VMATs with VMAT1 expressed primarily outside the CNS while VMAT2 expression is confined to monoaminergic neurons in the CNS. Thus, both the packaging and release of
5HT are differentially regulated and may contribute to the varying roles of the transmitter.
4. Reuptake After 5HT synthesis and release, it may bind to any of fourteen pre- or post-synaptic receptors or it can be taken up by the serotonin transporter, SERT
(SLC6A4). SERT belongs to a gene family of Na+/Cl- dependent transporter proteins. Uptake of 5HT by SERT back into the 5HT neuron serves to terminate the action of 5HT and is an important mechanism by which the neurotransmitter’s
4 signals are terminated. The human SERT is a 630 amino acid protein with 12
membrane-spanning domains. SERT is approximately 48% homologous to both
norepinephrine (NE) and dopamine (DA) transporters. SERT mRNA is localized
almost exclusively to raphe nuclei with highest levels in the dorsal and median
raphe. SERT protein is found throughout the brain and spinal cord consistent
with its transport to the ends of extensively projecting 5HT axons.
5. Degradation Once back inside the neuron, 5HT can be repackaged into vesicles or
enzymatically degraded by monoamine oxidase (MAO). There are two forms of
monoamine oxidase, MAO-A and MAO-B. MAO-A preferentially oxidizes 5HT
and norepinephrine (NE) while MAO-B preferentially oxidizes phenylethylamine
(PEA), a naturally occurring monoamine synthesized from the amino acid
phenylalanine. MAO-A and MAO-B knockout mice exhibit distinct differences in
neurotransmitter metabolism and behavior. In MAO-A knockout mice, elevated brain levels of 5HT, NE, and dopamine (DA) occur along with an increase in aggressive behavior. MAO-B mice have only increased levels of PEA and do not show increased aggression. Both MAO-A and MAO-B mice show heightened reactivity to stress (Shih, 2004).
C. 5HT Receptors The existence of more than one 5HT receptor was first suggested by
Gaddum and Picarelli in 1957 (Gaddum & Picarelli, 1957; Naughton et al, 2000).
To date, there are now fourteen genetically, pharmacologically, and functionally
distinct 5HT receptors in the mammalian genome. Six of these are seven
transmembrane G-protein coupled receptors (GPCR) and the remaining one, the
5 5HT3 receptor is a ligand gated ion channel (Barnes & Sharp, 1999). They have
been grouped into seven different classes based on sequence homology in their
seven transmembrane spanning portions which is the region believed to
encompass the 5HT and drug binding sites (Strader et al, 1994).
Five genes (5HT1A, 5HT1B, 5HT1D, 5HT1E, and 5HT1F) make up the
5HT1 receptor family. All 5HT1 receptors have high affinity for 5HT, are coupled
to G proteins that are inhibitory to adenylate cyclase and inhibit neuronal
excitability upon 5HT binding (Albert et al, 1996). All are seven transmembrane
receptors encoded by intronless genes of between 365 to 422 amino acids with
an overall sequence homology of 40%.
The 5HT1A receptor was the first 5HT receptor to be fully sequenced.
The 5HT1A receptor is highly expressed during early development and then
decreases with age in rats, humans, and sheep (Hillion et al, 1994). 5HT1A
receptors can be located both postsynaptically and presynaptically on the 5HT
neurons themselves on cell bodies and dendrites in the mesencephalic and
medullary raphe. The presynaptic 5HT1A receptors are autoinhibitory in that
there stimulation has been shown to result in decreases in 5HT synthesis, 5HT
release, and firing rate of 5HT neurons (Blier & de Montigny, 1987). Although
distributed heterogeneously throughout the brain, areas of high postsynaptic
expression include hippocampus, lateral septum, and cortical areas. 5HT1A
receptor binding sites are nearly absent in the basal ganglia and cerebellum.
Consistent with its wide-spread expression domains, the 5HT1A receptor has
been implicated in a multitude of functions including mood, temperature
6 regulation, sleep, sexual behavior, appetite, learning and memory, and regulation of blood pressure. In early postnatal development application of the 5HT1A receptor agonist 8-hydroxy-2-(di-n-propylamino)tetralin (8-OHDPAT) can cause decreased suckling, decreased calling for the mother, and increased activity
(Kirstein & Spear, 1988). The 5HT1A receptor is well characterized and highly unique in its pharmacological properties compared to both other 5HT1 family members and other 5HT receptor families. It is well studied because of the therapeutic role of 5HT1A agonists in the treatment of anxiety and depression
(Cryan & Leonard, 2000).
The 5HT1B receptor can be found as an autoreceptor on 5HT neurons of the dorsal and median raphe as well as postsynaptically on cells in the CA1 region of the hippocampus, the striatum, layer 4 of the cerebral cortex, and
Purkinje cells of the cerebellum (Maroteaux et al, 1992; Middlemiss & Hutson,
1990). The presynaptic 1B receptors play a role in the control of 5HT release while postsynaptic 1B receptors exert an inhibitory influence on other neurotransmitters such as glutamate, dopamine, GABA, acetylcholine, norephinephrin, and other neuropeptides (Barnes & Sharp, 1999; Middlemiss &
Hutson, 1990). 5HT1B receptors found on arteries play a role in the vasoconstrictive effects of 5HT.
The 5HT1D receptor is expressed at very low levels in brain tissues.
5HT1D sites of expression have been detected in the basal ganglia (globus pallidus, substantia nigra, and caudate putatmen) and also the hippocampus and cortex (Bruinvels et al, 1993). There is limited functional data concerning the
7 5HT1D receptor due to its low level of expression and the lack of drug reagents
that can discriminate between the 1D and 1B receptor.
The human 5HT1E receptor was cloned independently by three research
groups (Gudermann et al, 1993; McAllister et al, 1992; Zgombick et al, 1992).
5HT1E binding sites are found mainly in the caudate putamen and at lower levels in the cortex, hippocampus, and amygdala (Barone et al, 1993; Hoyer et al,
1994).
The 5HT1F receptor has a similar pharmacological profile as the 5HT1E receptor but shows quite a different distribution in the brain. 5HT1F receptor expression is found at high levels in CA1-CA3 of the hippocampus, cortex, and dorsal raphe nucleus (Adham et al, 1997).
The 5HT2A family currently includes three receptor subtypes: 5HT2A,
5HT2B, and 5HT2C which are similar in their structure, pharmacology, and signal transduction pathways. The 5HT2 receptors have high sequence homology in their seven transmembrane domains but are structurally distinct from other 5HT receptors (Baxter et al, 1995). A shared characteristic of the 5HT2 receptors is that they have either two or three introns in their coding sequence. All are coupled positively to phospholipase C and lead to increased accumulation of intracellular Ca2+ and inositol phosphates.
The 5HT2A receptor is primarily postsynaptic and expressed in many regions including neocortex, entorhinal, and pyriform cortex, caudate nucleus, nucleus accumbens, olfactory tubercle, and hippocampus (Barnes & Sharp,
8 1999; Pazos et al, 1987). Activation of 5HT2A receptors in the CNS can inhibit
glutamate, dopamine, acetylcholine, and noradrenaline release, regulate slow- wave sleep, and endocrine responses (Staner et al, 1992) 5HT2A receptors are also expressed in the periphery on vascular, bronchial, urinary smooth muscles and on platelets. Here they function in vaso- and broncho-constriction and platelet aggregation. 5HT2A receptors have been implicated in numerous psychiatric disorders including depression, pyschosis, sleep disturbances, and anxiety (discussed later in D. serotonin function and dysfunction).
The 5HT2B receptor is found peripherally in the stomach, liver, kidney, muscle, and intestine. In the stomach, 5HT2B receptor activation causes contraction (Foguet et al, 1992). Other functions for the 2B receptor in the periphery have not yet been demonstrated. In the brain, the presence of 5HT2B receptors is controversial. One study detected 5HT2B immunoreactivity at low levels in a very restricted manner in cerebellum, lateral septum, dorsal hypothalamus, and medial amygdala (Duxon et al, 1997). Stimulation of 5HT2B receptors in rodent studies has been reported to cause mild reduction in anxiety, increased feeding and decreased grooming (Kennett et al, 1997; Kennett et al,
1996).
The 5HT2C receptor was initially detected at high levels in the choroid plexus but is also present in cortex, limbic system, basal ganglia, and olfactory tubercles. A proposed role for the 5HT2C receptor in the choroid plexus is the regulation of cerebral spinal fluid volume and transferrin levels (Esterle &
Sanders-Bush, 1992).
9 The 5HT3a receptor is unique from other 5HT receptors because it is a non-selective Na+/K+ ion channel receptor. The 5HT3 receptor is most similar to
other members of the ligand-gated ion channel superfamily which include the
nicotinic, GABAA, and glycine receptors. The 5HT3 receptor consists of five
subunits (3A-E) arranged around a central ion conducting pore which is
permeable to sodium, potassium, and calcium (Maricq et al, 1991). Activation of
the 5HT3 receptor upon binding of 5HT leads to channel opening (Na+, Ca+ influx
and K+ efflux) and an excitatory response in neurons. 5HT3 receptors were first
detected in the peripheral nervous system and subsequently have been identified
at high levels within the dorsal vagal complex of the brainstem. This is an area
important for the initiation and coordination of the vomiting reflex and 5HT3
receptor antagonists are effective for treatment of chemotherapy-induced vomiting (Falkson & van Zyl, 1989).
The 5HT4 receptor gene was cloned in 1995 and initially only two splice variants were identified (Gerald et al, 1995). Since then there have been 8 possible carboxy terminal variants identified for the 5HT4 receptor gene
(Bockaert et al, 2004). The 5HT4 receptor variants have high constitutive activity even when transfected at low levels with activity increasing as the C-terminus shortens (Claeysen et al, 1999). 5HT4 receptors are expressed in the gut and in the brain are localized to hypothalamus, nucleus accumbens, amygdala, hippocampus, basal ganglia, substantia nigra, and olfactory tubercles. Some studies have suggested differential distribution of the splice variant in the brain
(Gerald et al, 1995), however other studies have failed to confirm this differential
10 distribution (Claeysen et al, 1996). 5HT4 receptors are being targeted for their potential therapeutic value in the treatment of cognitive deficits, gastrointestinal disorders, and feeding disorders.
The 5HT5 receptor family has two members, 5HT5A and 5HT5B, which are
77% homologous (Matthes et al, 1993; Plassat et al, 1992). There are no
selective pharmacological tools for the 5HT5 receptors therefore they remain the
least understood of all the 5HT receptors. Localization studies of the 5HT5
receptors are also conflicting with some reporting expression on astrocytes
(Carson et al, 1996) while others have reported pre- and postsynaptic neuronal
expression (Duncan et al, 2000).
The 5HT6 receptor was identified in 1993 (Ruat et al, 1993a) . It is of
particular interest because of its high affinity for a number of tricyclic
antidepressant and antipsychotic drugs. The 5HT6 transcript is largely confined
to the CNS but low levels have been detected in the stomach and adrenal
glands. In the brain, high levels of expression have been detected in the
striatum, nucleus accumbens, and olfactory tubercles, moderate levels in cortex,
CA1,CA2, and CA3 of the hippocampus, hypothalamus, amygdala, and
thalamus, and no detectable expression in cerebellum (Kohen et al, 1996;
Monsma et al, 1993; Ruat et al, 1993a). Recent studies suggest that combined
antagonism of 5HT2A and 5HT6 receptors was useful in promoting sleep
(Morairty et al, 2008). 5HT6 receptor antagonists are also being evaluated in the
treatment of Alzheimer’s disease and as combined therapy to treat cognitive
impairment seen in schizophrenia.
11 The 5HT7 receptor is the most recently identified receptor and has been
cloned in a number of species (for review see (Barnes & Sharp, 1999)). There
are at least four splice variants of the receptor (5HT7A-D) however rat and
human tissues appear to express only 2 of the variants (Ruat et al, 1993b).
D. 5HT Neuron Development The entire brain and spinal cord are generated from a homogenous group of ectoderm cells that are situated directly above a cylindrical group of midline mesodermal cells known as the notochord. Through inductive signals from the notochord, the ectoderm gives rise to a group of neural precursor cells which initially form the neural plate. The neural plate then folds to form a structure known as the neural tube. The cells at the ventral midline immediately adjacent to the notochord differentiate into a group of epithelial-like cells called the floorplate. The neural tube then becomes subdivided into the prosencephalon
(most anterior), mescencephalon, rhombencephalon, and spinal cord. The rhombencephalon also known as the hindbrain where 5HT neurons are generated is initially organized into a series of 7 swellings or compartments known as rhombomeres (r1-r7) (Lumsden & Krumlauf, 1996). In mouse, 5HT neurons are generated in rhombomeres r1-r3 and r5-r7, with an absence of 5HT neuron generation in r4 (Pattyn et al, 2003).
5HT neurons arise from a progenitor population immediately adjacent to the floorplate that also gives rise to visceral motor neurons (vMNs). In mouse, vMNs are generated first beginning at E9 followed by a wave of 5HT neuron generation starting at E10.5 in mouse (Pattyn et al, 2003). The floorplate is a
12 source of the morphogen, sonic hedgehog which induces the progenitors that
give rise to both vMNs and 5HT neurons in part by inducing the expression of the
transcription factor, Nkx2.2 (Briscoe & Ericson, 1999). Other secreted factors that
are important for setting up the 5HT progenitor domain include Fgf8 from the
mid-hindbrain organizer and Fg4 from the primitive streak (Ye et al, 1998a).
During motorneuron generation, Nkx2.2 is coexpressed with Nkx2.9 and Phox2b.
Phox2b acts a repressor of 5HT neuron fate and the cessation of Nkx2.9 and
Phox2b is required for the generation of 5HT neurons which occurs in all
rhombomeres except r4 (Pattyn et al, 2003). The proneural gene Asc1 or Mash1 which is a basic helix-loop-helix (bHLH) transcription factor is also required for
5HT neuron differentiation (Pattyn et al, 2004). Other transcription factors important for the development of 5HT neurons include Gata2 and Gata3 (Craven et al, 2004; van Doorninck et al, 1999). Downstream of Gata2 and Gata3, the transcription factors Lmx1b and Pet1 are both required for differentiation of postmitotic 5HT neurons (Ding et al, 2003; Hendricks et al, 2003). Pet-1 is unique among other members of the 5HT neuron transcriptional cascade in that it is expressed exclusively in 5HT neurons in the brain (Hendricks et al, 1999b). See
Figure 2 for summary. It should be noted that the outline of 5HT neuron specification given above is not absolute. This is because the 5HT neuronal system is composed of discrete subclasses that differ in their requirements for morphogens and transcription factors which will be discussed below.
II. Heterogeneity of 5HT Neurons The 5HT neurotransmitter system is visibly heterogeneous from the onset of development evidenced by the generation of 5HT neurons in rostral and
13 caudal domains in the embryonic hindbrain. Later, in the adult brain, 5HT
neurons are further distinguished by their positions in discrete B nuclei. Other
obvious differences are the opposite axonal projection patterns of the rostral and
caudal 5HT neuronal populations. These and other sources of heterogeneity are
discussed further.
A. Rhombomere of Origin Recent studies have demonstrated that 5HT neurons can be defined by their rhombomere of origin (Jensen et al, 2008). Using a technique known as intersectional fate mapping which allows for the tracing of two independently driven genetic reporters (in this case Engrailed and Pet-1), it was shown that 5HT progenitors from rhombomere 1 (r1) populate the entirety of B7, B6, and B4 5HT nuclei. The ventral pontine nucei, B8, B9, and B5 also received contributions from r1 but also were populated by cells derived from other rhombomeres. It remains to be determined if rhombomere derived genetic lineage has functional relevance for 5HT neurons.
B. Transcription Factor Requirements
Now that much of the transcriptional cascade that drives the
differentiation of 5HT neurons has been delineated, it has become clear that the
requirement for a given transcription factor is not uniform amongst all 5HT
neurons. These differences are summarized below.
The earliest difference observed among rostral and caudal 5HT neuronal
populations is in their requirement for FGF. Blocking FGF signaling prevented the
appearance of 5HT neurons in rostral but not caudal hindbrain explants (Ye et al,
14 1998a). Therefore rostral 5HT neurons require a FGF signal whereas caudal 5HT
neurons do not.
Nkx2.2 is induced in response to graded Shh signals. In the absence of
Nkx2.2 signalling, 5HT neurons fail to develop except for in the dorsal raphe
where they are generated in normal numbers (Briscoe et al, 1999).
Gata2 and Gata3 are induced after the appearance of Nkx2.2. Analysis of
mutants has demonstrated that Gata2 is required for the development of 5HT
neurons in rhombomere 1 whereas Gata3 is dispensable. Gata3 however is
required for the development of caudal 5HT neurons (van Doorninck et al, 1999).
Studies of Pet-1 in our lab have demonstrated that 30% of 5HT neurons
remain in Pet-1 null mice equally distributed across all B nuclei, suggesting a
Pet-1 independent pathway for the generation of 5HT neurons or perhaps
compensation by a related Ets domain transcription factor (Hendricks et al,
2003).
C. Axonal Projections As mentioned earlier, the rostral and caudal 5HT populations have opposite axonal projections with rostral 5HT axons ascending to innervate virtually all areas of the brain and caudal 5HT axons descending to target the spinal cord. However, further heterogeneity exists within the rostral and caudal
5HT axonal projections and they can be additionally distinguished based on pathways, morphology of the axons, mode of innervation, and sensitivity to neurotoxins.
15 Axonal projections from rostral 5HT neurons are visible soon after 5HT immunoreactivity is first detectable in the developing hindbrain. They initially grow as unbranched fibers in the marginal zone within the median forebrain bundle (MFB) and reach the midbrain by E15 in rat studies. Upon reaching the midbrain the fibers diverge and reach the rostral end of the brain by E17 (Aitken
& Tork, 1988). A major question regarding the organization of 5HT axons was whether they are diffusely organized or if individual 5HT cell groups have restricted projection patterns to cortical areas. The answer after numerous studies by many different laboratories is that there are at least two distinct axonal pathways that originate from the dorsal raphe and the median raphe and further they differ in their morphology and sensitivity to neurotoxins. Axons from the dorsal raphe project primarily to the striatum and neocortex, are very fine with small varicosities, and are sensitive to the toxics effects of amphetamines.
Analysis of dorsal raphe projections has shown that they do not form true chemical synapses but rather operate via volume transmission. Axons from the median raphe project to the hippocampus and cortex, have a “beaded” appearance with large, spherical varicosities, and are resistant to the neurotoxic effects of amphetamine. Axons originating from the median raphe have been shown to form true synapses (Jacobs et al, 1974; Kosofsky & Molliver, 1987;
Molliver, 1987).
Axons from the caudal 5HT neuron population (B1-B3) are visible in the spinal cord beginning at E14. Projections from the caudal 5HT system have been classified into 3 distinct pathways: 1) a dorsal pathway of axons originating from
16 B3 send fibers mainly to the dorsal horn of the spinal cord at all levels 2) an
intermediate pathway originating from B1 and B2 that terminates in the
intermediate grey at thoracic and upper sacral levels and 3) a ventral pathway
originating from B1and B2 that innervates the ventral horn at all spinal cord levels
(Bregman, 1987; Rajaofetra et al, 1989; Skagerberg & Bjorklund, 1985). Further
studies aimed at conditionally disrupting a subset of 5HT axonal projections will
be useful in determining whether a given set of projections regulates specific
behavioral and/or physiological processes.
D. Cotransmission
Cotransmission is the phenomenon where a single neuron contains and
releases more than one chemical acting as a neurotransmitter or
neuromodulator. The coexistence of several neuropeptides in 5HT synthesizing
neurons is well established including substance P, thyrotropin releasing hormone
(TRH), galanin, enkephalin, and calcitonin gene related peptide (Arvidsson et al,
1990a; Arvidsson et al, 1994; Arvidsson et al, 1990b; Chan-Palay et al, 1978;
Melander et al, 1986). In addition to the coexpression of neuropeptides in 5HT neurons, several studies have demonstrated the presence of other classical neurotransmitters such as GABA and glutamate in 5HT neurons. The presence of both GABA and its synthesizing enzyme GAD has been demonstrated in medullary 5HT neurons (Belin et al, 1983; Millhorn et al, 1987). A number of studies have documented the presence of glutamate in 5HT neurons based on
the expression of a third isoform of vesicular glutamate transporter (VGLUT3)
which is needed to package glutamate into vesicles (Commons, 2009; Gras et al,
17 2002). Further, a recent study suggests that 5HT neurons from the median raphe which send afferents to the hippocampus and form synapses on GABAergic interneurons can contribute to fast synaptic activation due to the cotransmission of glutamate (Varga et al, 2009).
Of particular interest is that the coexpression of neuropeptides and the neurotransmitters glutamate and GABA is not common to all 5HT neurons. For example, the coexistence of 5HT, substance P, and TRH was observed more frequently at caudal levels with relatively few peptide containing 5HT neurons found in the rostral raphe magnus nucleus (Johansson et al, 1981). Further studies now suggest that 5HT neurons projecting to ventral spinal cord are highly colocalized with substance P and TRH, while 5HT axons innervating the dorsal horn show very little peptide expression (Wessendorf & Elde, 1987). However, a population of GAD+/5HT+ fibers innervating the dorsal horn has been described
(Antal et al, 1996). Taken together, these studies suggest the existence of two functionally distinct axonal pathways originating from 5HT neurons of the medullary raphe: 1) a ventrally projecting population (B1 and B2) that is associated with peptide expression and regulation of motor function and 2) a dorsally (B3) projecting population associated with GABA cotransmission and sensory processing (Hokfelt et al, 2000).
Given the numerous sources of heterogeneity present early on in the developing 5HT system, we were interested in generating a high-throughput method for analyzing gene expression differences in rostral and caudal 5HT
18 neurons. The methodology for purifying rostral and caudal 5HT neurons for gene expression profiling and the findings are presented next in Chapter 2.
19
http://en.wikipedia.org/wiki/Serotonin
20 Figure 1. 5HT biosynthesis and breakdown.
Serotonin is synthesized from the essential amino acid tryptophan which is taken up into neurons by a plasma membrane transporter. Next, tryptophan is hydroxylated in a reaction catalyzed by tryptophan hydroxylase (TPH) resulting in the formation of 5-hydroxytryptophan. The final step to produce 5HT is carried about by aromatic amino acid decarboxylase (AADC). After reuptake by the serotonin transporter (SERT), 5HT can be either degraded or recycled into vesicles. Degradation of 5HT occurs via oxidative deamination into 5- hydroxyindolacetic acid (5HIAA).
21
22 Figure 2. Specification and differentiation of 5HT neurons.
The diffusible factors Shh from the floorplate, Fgf4 from the primitive streak, and
Fgf8 from the mid-hindbrain organizer set up an inductive zone for the production of 5HT neurons. The transcription factors Nkx2.2, Nkx6.1, Mash1, and FoxA2 are expressed early on in precursor cells. Gata2 and Gata3 operate downstream but before 5HT neurons have become postmitotic. Lmx1b and Pet1 are required in postmitotic 5HT neurons for the differentiation and maintenance of neurotransmitter traits.
23 CHAPTER 2
PURIFICATION AND GENE EXPRESSION PROFILING OF GENETICALLY LABELED 5HT NEURONS REVEALS DISTINCT TRANSCRIPTOMES FOR ROSTRAL AND CAUDAL 5HT NEURONS
SUMMARY
In the past neurons have been classified according to neurotransmitter phenotype, morphology, electrophysiological properties, and connectivity. Today in the post-genomic era and with recent advances in microarray technology, we now have the ability to classify neurons according to the genes that they express.
This is a significant advance because the transcriptome or gene expression profile of a particular cell ultimately determines cellular phenotype. Currently there is insufficient data concerning the transcriptional profiles of defined cell populations, particularly with regard to different neuronal cell types in the brain.
The genes specifically expressed by serotonin neurons are of particular interest since dysregulation of the serotonergic system has been implicated in many neuropsychiatric disorders. With this in mind, we sought to use gene array technology to discover the genes that are expressed in developing serotonin neurons. In order to do this, we first had to generate a transgenic mouse line in which 5HT neurons are specifically labeled with a fluorescent reporter. A 40 kb
Pet-1 enhancer element which is sufficient to drive transgene expression solely in 5HT neurons of the brain was identified by a former student in the lab, Mike
Scott (Scott et al, 2005a). Like endogenous Pet-1 expression, the Pet-1 enhancer element drives reporter expression that appears before 5HT in the
24 developing hindbrain. I used this same enhancer element to create a transgenic line (ePet-EYFP) with expression of enhanced yellow fluorescent protein (EYFP) solely in 5HT neurons (Scott et al, 2005b). This transgenic line is currently facilitating the study of many aspects of 5HT neuron biology both in vivo and in vitro. Next we developed methods for purifying ePet-EYFP neurons which also has many applications aside from gene array technology. We describe here the results of gene array profiling of rostral and caudal 5HT neurons and present a database of 5HT neuron genes that will be a valuable resource for further understanding serotonin neuron function and dysfunction.
INTRODUCTION Genetic perturbation of embryonic brain serotonin (5HT) neuron gene expression causes developmental alterations in numerous rodent behaviors
(Hendricks et al, 2003; Hodges et al, 2008; Lerch-Haner et al, 2008b) and is thought to significantly contribute to susceptibility of human emotional and stress- related neurodevelopmental pathogenesis in adulthood (Ansorge et al, 2007).
Evidence in support of these ideas is primarily derived from the study of genes encoding the rate limiting biosynthetic enzyme tryptophan hydroxylase 2 (TPH2), the 5HT transporter (Sert) and the serotonin 1a autoreceptor (Holmes, 2008; Le
Francois et al, 2008; Leonardo & Hen, 2006). As these proteins operate in complex networks of poorly defined cellular regulatory pathways (Prasad et al,
2005) many other genes are likely to be important for serotonergic function and many of them may be relevant to human mental disease pathogenesis. Yet their
25 identity is largely obscure in part because of a lack of an approach to isolate 5HT neurons for comprehensive gene expression profiling of this CNS cell type.
Gene expression profiles of 5HT neurons may be complex despite their common monoaminergic character if, as is evident, these cells are heterogeneous. 5HT neurons can be distinguished according to their axonal trajectories and physiological properties (Beck et al, 2004; Kocsis et al, 2006).
Rostral 5HT neurons, born anterior to rhombomere 4 (r4) give rise to ascending axonal projections, which modulate circuitry needed for emotional responses, circadian rhythms, and energy balance (Lucki, 1998; Sodhi & Sanders-Bush,
2004). A caudal cluster, posterior to r4 gives rise to descending pathways, which modulate a diversity of physiological processes including cardiorespiratory homeostasis, thermoregulation, and nociception (Erickson et al, 2007;
Gargaglioni et al, 2008; Hodges et al, 2008; Mason, 2001; Zhao et al, 2007).
Differences in progenitor identities (Jacob et al, 2007; Lillesaar et al, 2007), extrinsic signaling dependencies (Ye et al, 1998b), transcription factor requirements (Hendricks et al, 2003) and distinct rhombomere-specific neuron sublineages (Jensen et al, 2008) suggest complexity in rostrocaudal serotonergic differentiation programs that generate these cells. These potentially distinct programs may direct different patterns of 5HT neuron gene expression and account for the diversity of behaviors and physiological processes under serotonergic modulation as well as the large number of neuropsychiatric disorders in which serotonergic dysfunction has been implicated (Holmes, 2008).
26 Few genetic markers distinguish differentiated 5HT neurons, however, and therefore their molecular differences are poorly defined.
Whole genome profiling is a powerful approach for analysis of molecular complexity in CNS neuronal and glia cell types and the developmental programs specifying their diversity (Cahoy et al, 2008; Sugino et al, 2006). Here, we report a purification protocol for enrichment of embryonic postmitotic 5HT neurons followed by microarray analysis of 5HT neuron gene expression profiles. Our microarray, verification, and bioinformatics studies identify several hundred genes and many biological pathways whose expression distinguishes rostral and caudal 5HT neurons. Our transcriptome datasets provide an abundance of new markers to enable molecular classification of 5HT neuron subtypes and a rich resource for identification of new serotonergic genes of potential relevance to mental disease pathogenesis.
RESULTS
Purification and gene expression profiling of embryonic rostral and caudal
5HT neurons
The ePet-EYFP transgenic mouse line expresses enhanced yellow fluorescent protein (EYFP) specifically in adult 5HT neurons (Scott et al, 2005c).
To determine whether this line would be suitable for identification and purification
27 of embryonic 5HT neurons we determined the pattern of EYFP expression in the
developing hindbrain. Both rostral and caudal embryonic 5HT neurons and their
axons could be readily visualized by expression of YFP in the ePet-EYFP line
(Figure 1 and data not shown). YFP was colocalized with 5HT immunoreactivity but was not detected elsewhere in the hindbrain (Figure 1B-D and data not shown) consistent with endogenous Pet-1 expression (Hendricks et al, 1999a).
As expected, there was an absence of EYFP fluorescence in rhombomere 4 where 5HT neurons are not generated (Figures 1A). Thus, the embryonic expression pattern of the ePet-EYFP line indicated that it could be used for identification and purification by flow cytometry of differentiating 5HT neurons from the rostral and caudal hindbrain.
We chose to profile gene expression at E12.5 when 5HT neurons are actively differentiating and cell migration and axon pathfinding are underway. At this developmental stage virtually all rostral 5HT neurons have differentiated
(Pattyn et al, 2003). However, in the caudal hindbrain 5HT neuron differentiation is not yet complete at E12.5 and therefore the serotonergic cells at this stage are a mixture of postmitotic precursors and mature 5HT neurons. Rostral and caudal hindbrain domains were dissected from E12.5 ePet-EYFP embryos (Figure 2A), dissociated with trypsin digestion and triturated in preparation for flow cytometry.
For each sort (Figure 2B) we also collected rostral YFP- (R-) and caudal YFP- (C-)
reference cells, which comprise primarily neighboring hindbrain motoneurons and
interneurons. The purity of sorted R+ and C+ neurons was analyzed by examining
a portion of the cells under fluorescence and phase contrast microscopy to
28 determine the number of cells that were also YFP+ (Figure 2C). About 98% of
rostral and caudal cells were YFP+ using our sorting parameters. We confirmed
the purity of our sorted 5HT neurons by assaying for the expression of Fev (Pet-
1) and Tph2, two genes whose expression in the CNS is restricted to 5HT
neurons. Taqman real-time RT-PCR analyses of R+, C+, R-, and C- total RNAs
showed at least a 10-fold enrichment of Fev and Tph2 in R+ and C+ relative to R-
and C- (Figure 2D).
Probes (Figure 2E) were generated from 200,000 sorted rostral and
caudal YFP+ cells and hybridized to Affymetrix 430 2.0 arrays. These
hybridizations were used to generate present/absent calls as described in the
Materials and Methods. An annotated master list of expression signals and P/A
calls for all twelve array profiles is presented in Dataset 1 (available at
www.jneurosci.org as supplemental material). The data discussed in this publication have been deposited in NCBI's Gene Expression Omnibus (Edgar et al., 2002) and are accessible through GEO Series accession number GSE19474 at (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc= GSE19474). We first
analyzed our data set to confirm that known serotonergic genes were
reproducibly detected. The arrays confirmed the enriched expression of 15
known serotonergic genes in R+ and C+ relative to R- and C- (Figure 2F, G).
Average signal intensities for these known 5HT neuron expressed genes ranged
from 15,154 for probe set, 1435750_at, representing the GTP cyclohydrolase
feedback regulator (Gchfr) to 335 for one of the probe sets, 1442676_at, that represents monoamine oxidase A (MaoA). We note, however, that our array
29 studies failed to detect expression of some genes known to be expressed in 5HT
neurons such as those encoding the htr1b receptor and alpha 1b adrenergic
receptor. The reason for these discrepancies is unclear but may reflect immature
levels of expression at E12.5. Nevertheless, the detection of all of the major
traditional markers of 5HT neurons further indicates that the process of hindbrain
dissociation and flow cytometry did not result in qualitative changes in the
phenotype of these purified cells and therefore supports strong confidence in our
approach for discovery of serotonergic gene expression.
We next analyzed the array data to assemble 5HT neuron gene
expression profiles. 5HT neuron development and function depends on the activity of broadly expressed genes such as housekeeping genes as well as genes whose expression is highly selective for 5HT neurons such as Fev or
TPH2. Thus, our first goal was to assemble a list of all genes expressed in E12.5
5HT neurons without consideration of their possible enrichment in R+ and C+ cell
groups. We based our conservative estimate of the number of unique genes
expressed in E12.5 5HT neurons on the number of probe sets in Dataset 1
(available at www.jneurosci.org as supplemental material) whose expression was reproducibly detected at a selected minimum threshold signal intensity level.
Expression of a probe set was considered reproducibly detected if it was scored as present (P) in all three biological replicates of R+ or C+ profiles. The threshold
signal intensity was set to the level of signal intensity for monoamine oxidase A
probe set 1442676_at, whose mean expression level (335) was lowest of all
probe sets for known serotonergic genes (Figure 2G). Using these criteria, we
30 estimated 12,559 probe sets were expressed in R+C+ cells, which corresponds to
8,186 individual genes, 866 RIKEN cDNAs and 435 ESTs. A database of E12.5
5HT neuron expressed genes with respective mean signal intensity levels in R+
and C+ is available in Dataset 2 (available at www.jneurosci.org as supplemental
material). A search of the Allen Institute Brain Atlas (Ng et al, 2009) revealed
250 genes with a TPH2-like expression pattern in the adult brain (Supplemental
Table S1). We detected expression of 155 of these genes in R+ and C+
indicating that many but not all TPH2-like genes initiate expression during embryogenesis.
A major goal of this study was to identify new potential transcriptional
determinants of 5HT neuron development. Therefore, we searched our list of
5HT neuron expressed genes according to protein molecular function and
identified > 800 genes encoding DNA binding proteins (Supplemental Table S2;
available at www.jneurosci.org as supplemental material). The complex
inneveration patterns of serotonergic axons that initiate around E12.5 prompted
us to search for genes encoding axon pathfinding/cell adhesion molecules and
191 such genes were identified as expressed in R+ and C+ (Supplemental Table
S3; available at www.jneurosci.org as supplemental material). Finally, the
neurochemically rich afferent input to 5HT neurons and the prominent role of the
5HT system in maintenance of homeostatic states prompted a search for genes
encoding ion transport proteins, receptors and kinases. These searches
uncovered 65 ion channel genes (Supplemental Table S4; available at
www.jneurosci.org as supplemental material), 118 solute carrier genes
31 (Supplemental Table S5; available at www.jneurosci.org as supplemental
material), 38 G-protein coupled receptors (Supplemental Table S6; available at
www.jneurosci.org as supplemental material), and 175 unique kinases
(Supplemental Table S7; available at www.jneurosci.org as supplemental
material) expressed in R+ and C+.
5HT neuron enriched gene expression
We next sought to determine differentially expressed genes in our four groups of profiled cell populations. Using the ANOVA test, we found 1806 probe sets that were differentially expressed across the 4 groups based on the criteria described in the Material and Methods. Unsupervised hierarchical clustering was applied to reveal clusters of biological samples and clusters of genes with similar expression pattern (Figure 3). As shown in the dendrogram in Figure 3A two distinct sample clusters were identified that correspond to the serotonergic and non-serotonergic cell groups we examined. Interestingly, the six serotonergic profiles sorted into two sub-clusters that correspond to the rostrocaudal origins of serotonin neurons, thus providing the first clear indication of large gene expression differences in rostral and caudal serotonin neurons. Not surprisingly, however, rostral and caudal serotonin neurons were more similar to each other than to non-serotonergic neurons from the same rostrocaudal level while profiles of rostral and caudal non-serotonergic neurons were more similar two each other than to those of serotonergic neurons. Biological replicates for each of the different cell groups showed the highest similarities in gene expression patterns thus further demonstrating the high reproducibility of our overall profiling method.
32 Hierarchical clustering of the genes revealed eight distinct gene
expression clusters (I-VIII) that segregated according to serotonergic identity and
rostrocaudal positions (Figure 3B). Clusters I-V comprise unique profiles of about
800 transcripts differentially enriched in R+ and C+ serotonin neurons while clusters VI-VIII comprise transcripts enriched in R- and C- non-serotonergic
reference cell populations.
We systematically examined each of the five serotonergic clusters to
identify prominent molecular features of the 5HT neuron transcriptome. Cluster I
is comprised of 317 probe sets corresponding to 274 unique transcripts enriched
in both rostral and caudal 5HT neurons (Supplemental Table S8; available at
www.jneurosci.org as supplemental material). Only 13 of these genes have been
shown by the Allen Institute to have a TPH2-like expression pattern in the adult brain. Further filtering of the Cluster I list to exclude additional known serotonergic genes revealed 250 new genes with several fold enrichment in R+
and C+ cells, thus validating our approach for discovery of 5HT neuron gene
expression in the developing hindbrain (Table I, Top 50). Several of these
potential new markers of developing 5HT neurons have well defined functions in
other neural and non-neural cell types while the function of others have not been
elucidated.
Because of our interest in genes controlling 5HT neuron development we
focused our enrichment verification studies primarily on genes encoding known
and putative transcriptional regulators. The genes we selected for confirmation
spanned the full range of probe set signal intensities (15,000-1350, Supplemental
33 Table S8; available at www.jneurosci.org as supplemental material). Taqman RT-
PCR (Figure 4A) confirmed the highly enriched expression of the zinc finger
factor, Zcchc12, which is also known as Smad-interacting zinc finger protein
(Sizn1) and whose known sequence variants are associated with mental retardation (Cho et al, 2008a). Zcchc12 is an X linked gene that has been shown to promote cholinergic transmitter phenotype by stimulating bone morphogenetic protein-dependent regulation of choline acetyltransferase and vesicular acetylcholine transporter genes in basal forebrain cholinergic neurons (Cho et al,
2008b). These known functions raise the possibility that Zcchc12 also regulates serotonergic neuron neurochemical properties. Rnf112, (also known as Zfp179 or Znf179) is thought to encode a zinc finger transcription factor (Seki et al,
1999). We verified Rnf112 enrichment in rostral and caudal 5HT neurons by
Taqman RT-PCR (Figure 4A). The Rnf112 gene maps within the common chromosomal 17p11.2 duplicated region that is responsible for Potocki-Lupski syndrome (PLS) (Kimura et al, 1997). This syndrome is characterized by neurodevelopmental and behavioral phenotypes including anxiety and autism spectrum features (Potocki et al, 2007). We confirmed expression of some other genes exhibiting more modest enrichment in R+ and C+. For example, Tox
(thymocyte selection-associated high mobility group box) is a gene required for
T-cell maturation and is also strongly expressed in the developing cingulate and motor cortex of the E16 mouse brain (Muhlfriedel et al, 2007). We found a 3.0
fold enrichment of Tox expression in R+ and C+ by array analysis and a similar
level of enrichment was also detected by Taqman assays (Figure 4A). RIKEN
34 cDNA 1700042O10RIK, showed a 20-fold enrichment in R+C+ by array detection
and 30-fold and 150-fold enrichment in R+ and C+ respectively by Taqman RT-
PCR (Figure 4B). Interestingly, 1700042O10RIK encodes a non-coding RNA of
unknown function whose gene is imbedded in the dopa decarboxylase gene but
on opposite strands. This finding raises the intriguing hypothesis that
1700042O10RIK RNA is a novel regulator of ddc transcription in 5HT neurons by
a cis antisense mechanism. We also verified expression of other genes whose
functions cannot be predicted by homology comparisons. RIKEN cDNA
2010204K13RIK encodes a predicted single transmembrane 83 amino acid
protein and was enriched 10-fold in both R+ and C+. In addition, we conformed
the strong expression of EST AW551984 by both Taqman RT-PCR (Figure 4B) and double label in situ hybridization (Figure 4C). Confirmation of the 5HT neuron specific expression of these uncharacterized protein-coding genes suggests novel proteins carry out functions specifically in 5HT neurons. FoxP1, a forkhead domain transcription factor, is required for motorneuron diversity and ultimately the development of spinal cord motor circuitry (Rousso et al, 2008).
We found a 2.1 fold enrichment of FoxP1 in R+ and C+. Immunohistochemical
detection of FoxP1 indicated that FoxP1 protein was expressed by a large
number of both rostral and caudal 5HT neurons at E12.5 (Figure 4D-F).
Altogether, the verified highly enriched expression of these genes in R+ and C+
suggests new candidate regulators of 5HT neuron development.
35 Gene ontology and pathway enrichment in 5HT neurons
The distinct gene expression profiles detected in 5HT neurons versus reference non-serotonergic cell types suggest 5HT neurons may selectively utilize particular signaling and biological pathways. We used our recently developed parametric approach (Wang et al, 2008) based on mixed linear models to search for enrichment of sets of genes that operate together in a common signaling pathways or are associated with Gene Ontology (GO) categories: molecular function, biological process and cellular component. We queried gene sets for canonical pathways and gene ontology terms in the
Molecular Signatures Database (MSigDB) collection. Because many gene sets were examined, to control for the rate of false positive findings by chance, we adjusted nominal p-values using Bonferroni correction. We identified highly significant enrichment of numerous gene sets for canonical pathways and GO categories in R+C+ profiles relative to reference R-C- profiles (Table 2, see dataset
3; available at www.jneurosci.org as supplemental material for a complete list), which suggests that 5HT neurons perform a variety of specialized functions.
Enrichment of numerous gene sets associated with peptide processing is consistent with the known peptidergic activity of some 5HT neurons and further reveals the molecules that may be required for use of these peptides as serotonergic signals. A large number of gene sets associated with ion transport and G protein coupled receptor pathways may reflect the complexity of afferent signaling systems regulating 5HT neuron activity and is consistent with the idea that cell surface channels and receptors are a major determinant of cell type
36 heterogeneity in the nervous system (Doyle et al, 2008). Finally, our analyses
identified nine significantly enriched gene sets associated with lipid and
specifically sphingolipid (SL) metabolism in R+ and C+ compared to reference
groups R- and C- (Table 2).
Rostral 5HT neuron transcriptome landscape
The segregation of several hundred R+ or C+ expressed genes into four
additional clusters (Clusters II-IV) suggested previously unrecognized deep molecular heterogeneity in these two groups of embryonic 5HT neurons. We, therefore, examined these clusters individually to identify molecular signatures
that distinguish rostral and caudal 5HT neurons.
Cluster II (Table 3) is comprised of 94 probe sets corresponding to 84
unique transcripts enriched in R+ (Supplemental Table S9; available at
www.jneurosci.org as supplemental material). This list revealed the highly
enriched expression of two genes, Hmx2 (Nkx5.2) and Hmx3 (Nkx5.1) encoding
related homeodomain proteins in R+ with little or no expression detected in C+.
Taqman RT-PCR confirmed the enriched expression of both Hmx2 (80-fold) and
Hmx3 (120-fold) in R+ (Figure 5A). In situ hybridization double-label
immunohistochemistry at E12.5 demonstrated that Hmx2 (Figure 5B) marked all
rostral 5HT neurons, while Hmx3 expression was observed in a subpopulation of
rostral 5HT neurons (Figure 5C). Hmx2 expression was maintained at E16.5
(Figure 5D) while Hmx3 transcript was detectable at a lower level at E14.5 (data
not shown). The expression of these genes provides a molecular signature of
37 serotonergic neurons in the rostral hindbrain. Verification of Pou3f1, a POU
homeodomain transcription factor, indicated enriched expression to a lesser
extent than the Hmx genes in R+ (Figure 5A).
Cluster III comprises 27 probe sets that correspond to 25 unique
transcripts enriched in both R+ and R- cells (Table 3 and Supplemental Table
S10; available at www.jneurosci.org as supplemental material). Of particular
interest in this list are the engrailed homoedomain transcription factor genes, En1
and En2, which have been extensively studied for their multiple roles in nervous
system development including establishment of the midbrain-hindbrain boundary,
cerebellum development, axonal guidance, and dopamine neuron development
and survival (Joyner, 1996; Simon et al, 2004). Taqman RT-PCR confirmed their
enrichment in R+ as well as R- and C- reference cell populations but not C+
(Figure 5E). In situ hybridization for En2 at E12.5 showed a broad domain of
expression that spanned the mid-hindbrain boundary (MHB) (Figure 5F). Post-
mitotic rostral 5HT neurons at E12.5 have migrated from the ventricular zone and
are situated in the En2+ region below the MHB. Immunohistochemical detection
with a pan-engrailed antibody showed strong and persistent expression of
En1/En2 proteins in a subset of post-mitotic rostral 5HT neurons in rhombomere
1 (r1) at least through E14.5 (Figure 5G, H). These findings raise the possibility
that engrailed genes play cell-autonomous roles in the differentiation and maintenance of rostral 5HT neurons.
38 Caudal 5HT neuron transcriptome landscape
We next examined Clusters IV and V to identify transcripts enriched in
caudal 5HT neurons. Cluster IV comprises 300 probe sets, which correspond to
270 unique transcripts and 29 RIKEN cDNAs enriched in C+ neurons (Table 4
and Supplemental Table S11; available at www.jneurosci.org as supplemental
material). We identified several imprinted genes, Dlk1, Meg3, Magel2, and
Copg2as2, each with several fold-enriched expression in C+. However, unlike
the Hmx and En genes whose expression was overwhelmingly enriched in rostral
5HT neurons, these C+ enriched genes also showed significant but less
enrichment in R+ cells (Dataset 2; available at www.jneurosci.org as
supplemental material). These genes are members of three distinct imprinted
domains present on different chromosome and thus raise the possibility that
stringent regulation of gene dosage is important for proper 5HT neuron
development and function. Further examination of our databases revealed an
additional 70 probe sets corresponding to 43 unique imprinted genes showing
expression in rostral and caudal 5HT neurons (Supplemental Table S12;
available at www.jneurosci.org as supplemental material). Only three of these,
Ancient, Magel2, Ddc, are reported in the Allen Brain Library list of genes with a
TPH2-like expression pattern in the adult mouse brain.
Cluster V represents an additional group of serotonergic genes whose
expression was enriched in both C+ and C- cells. This cluster comprises 146
probe sets, which corresponds to 113 unique genes and 9 RIKEN cDNAs (Table
4 and Supplemental Table S13; available at www.jneurosci.org as supplemental
39 material). A striking feature of this profile is the numerous Hox paralogues whose expression was enriched in C+ and C- up to 70-fold relative to R+ and R-.
Our array studies detected highly enriched expression of 14 Hox genes and their cofactors Meis1 and Meis 2 in C+ whereas there was little or no expression of these Hox genes in R+ (Dataset 2; available at www.jneurosci.org as supplemental material). Hox genes are well known for their early roles in patterning morphological identities of embryonic structures along the anterior- posterior body axis (Pearson et al, 2005) and more recently they have been implicated in repression of serotonergic fate in rhombomere 4 (Pattyn et al, 2003) and specifying spinal motor-neuron pool identity (Dasen et al, 2005). We verified enrichment of Hox3, Hox4, and Hox5 paralogues by Taqman RT-PCR (Figure
6A-C). Expression of Meis1 and Meis2 (Figure 6D-F), HoxC4 (Figure 6G-I), and
HoxA3 (Figure 6J-L) proteins was confirmed by immunohistochemistry in caudal
5HT neurons. At E12.5, Meis1/2 and HoxA3 expression spanned the caudal hindbrain and marked most caudal 5HT neurons. HoxC4 expression extended from the spinal cord and into the most posterior hindbrain thus marking only subset of caudal 5HT neurons. The expression of Hox genes was also reported in array studies of differentiated 5HT neurons derived from a rhesus monkey embryonic stem cell line (Bethea et al, 2009). Together, these findings suggest
Hox proteins and their co-factors play important roles in the maturation of postmitotic caudal 5HT neurons.
Gene ontology and differential pathway enrichment in rostral and caudal
5HT neurons
40 We compared gene set enrichment in R+ vs. C+ expression profiles to
further explore the potential functional and metabolic differences between rostral
and caudal 5HT neurons. Numerous gene sets were differentially enriched in R+
and C+ neurons including those associated with intracellular signaling pathways,
GPCR pathways, channel activity, integrin pathways, axon guidance, and ion
transport. Gene sets associated with several metabolic pathways were also
differentially enriched in either R+ or C+ thus further indicating major differences
in R+ and C+ gene expression and further supporting possibility of significant
physiological differences in these serotonergic cell types (Table 5, see Dataset 4;
available at www.jneurosci.org as supplemental material).
DISCUSSION
This study reports the isolation of postmitotic 5HT neurons from the
embryonic mouse hindbrain by flow cytometry and the use of these cells to
profile 5HT neuron gene expression. Our array studies detected expression of
roughly 9000 unique gene products in E12.5 5HT neurons with enriched
expression of nearly 800 of these genes. The number of unique genes we
detected as expressed in 5HT neurons corresponds strikingly well to the roughly
10,000 unique genes that are expressed in a single Aplysia 5HT interneuron but
few of the most highly enriched 5HT genes were common to these two kinds of
5HT neurons (Moroz et al, 2006). We identified 250 genes whose expression was comparably enriched in both rostral and caudal 5HT neurons and therefore these genes represent potential new markers of developing 5HT neurons.
Several of these genes encode proteins with well-defined functions in other
41 neural and non-neural cell types. We also detected enriched expression of non- coding RNAs and genes encoding potential proteins whose functions are not predictable from primary structure. Furthermore, gene set enrichment analysis identified potential signaling and biological pathways in 5HT neurons that may support specialized functional roles of these cells. Our findings provide an unprecedented knowledge of the expressed genetic architecture of 5HT neurons and continued verification will sharpen our understanding of this architecture.
5HT neurons are anatomically and functionally heterogeneous but the molecular mechanisms that determine these distinctions are obscure because of a lack of comprehensive expression profiling of these cells. Our findings demonstrate deep molecular and biological pathway distinctions between neurons that give rise to the ascending and descending serotonergic subsystems. Previous immunohistochemical studies have reported the differential expression of a small number of genes encoding various neuropeptides, receptors and the transmitters GABA and glutamate in adult 5HT neurons (Belin et al, 1983; Chan-Palay et al, 1978; Day et al, 2004; Hokfelt et al,
2000; Hokfelt et al, 1978; Lacoste et al, 2006). The Allen Institute identified 248 genes a Tph2-like expression pattern in adults but it is not known whether these genes are differentially expressed in developing rostral and caudal 5HT neurons.
Here we demonstrate the power of whole genome profiling of purified embryonic
5HT neurons by identifying about 500 genes with major expression differences between developing rostral and caudal 5HT neurons. Many of these genes encode various types of transcription factors although we also detected
42 differential expression of genes encoding ion channels, intracellular signaling
factors and axonal guidance cues. Rostral and caudal 5HT neurons also display
differential enrichment of gene sets that suggest different biological pathways
operate in these two anatomically defined populations of 5HT neurons. These
findings substantiate the concept derived from genetic fate mapping of 5HT
progenitors (Jensen et al, 2008) that despite their common neurotransmitter
character distinct developmental programs generate 5HT neurons in the rostral
and caudal hindbrain.
The differential expression of numerous homeodomain (HD) genes,
including En1, En2, Hmx2, and Hmx3 in rostral 5HT neurons and several Hox in
caudal 5HT neurons raises the possibility that different intrinsic transcriptional
cascades comprising different HDs may operate in developing postmitotic 5HT
neurons. Hmx2 and Hmx3 are required for inner ear development and
differentiation of specific hypothalamic neuronal cell types (Wang et al, 2004a)
but they have not been investigated for a role in 5HT neuron development. En1,
2 are required in a redundant manner for 5HT neuron development (Simon et al,
2005). As En expression was reported to be undetected in 5HT neurons these
findings were interpreted as indicating a cell non-autonomous role for En1, 2 in
5HT neuron development. However, more recent intersectional/subtractive
genetic cell fate mapping studies have demonstrated that a pool of En+
progenitors in r1 give rise to all 5HT neurons that populate the adult B4, B6 and
B7 raphe nuclei as well as some 5HT neurons in the B5 and B8 median raphe and B9 nuclei (Jensen et al, 2008). In addition, our array, RT-qPCR and
43 immunohistochemical verification findings presented here indicated highly enriched expression of En1 and En2 in an anterior subset of postmitotic rostral
5HT neurons in r1. Together, these findings strongly suggest that rather than playing a cell non-autonomous role, En1/2 genes have intrinsic roles in rostral
5HT neurons.
Our array and verification studies showed highly enriched expression of
Hmx2 and Hmx3 in rostral 5HT neurons with no detectable expression of these genes in caudal 5HT neurons. Furthermore, Hox expression was detected in caudal 5HT neurons but not in rostral ones. Thus, rostral 5HT neurons can be defined as an Hmx+ subtype and caudal 5HT neurons as a Hox+ subtype. Our findings also define two rostral postmitotic 5HT neuron subtypes (Hmx+En+ and
Hmx+En-) based on the differential expression of En1/2 hence further corroborating serotonergic heterogeneity even greater than suggested by simple rostral and caudal anatomical distinctions (Jensen et al, 2008). An important question to address experimentally is whether or not En1/2 and the other HD expression constitute an HD code that is required in specific subsets of postmitotic 5HT neurons to direct and maintain heterogeneous programs of serotonergic differentiation, cell body migration, axonal trajectories or electrophysiological properties.
Our transcriptome studies have identified many previously unrecognized serotonergic genes with potential roles in disease pathogenesis. Of particular interest are the cell adhesion genes, Cntnap2, Nrxn1, and Cdh10, which we have shown here to be expressed in 5HT neurons and whose common and rare
44 genetic variants have been associated with autism susceptibility (Arking et al,
2008) (Kim et al, 2008) (Wang et al, 2009). These genes can now be investigated to determine what role they play in 5HT neurons and whether their disrupted function results in specific disease endophenotypes. Thus, our databases provide a unique bioinformatics resource to help determine serotonergic expression of genes identified in human psychiatric genome association and linkage studies (Supplemental Table 14).
Interestingly, we found expression of 43 different imprinted genes in rostral and caudal 5HT neurons (Supplemental Table 11; available at www.jneurosci.org as supplemental material) of which 19 were enriched in 5HT neurons. There are 131 currently known mouse imprinted genes including snoRNAs and miRNAs (http://www.har.mrc.ac.uk/). Many imprinted genes are expressed in the brain and are thought to play critical roles in neurodevelopmental disorders such as autism (Wilkinson et al, 2007).
Serotonergic expression of imprinted genes, however, has not been investigated and thus our findings raise the intriguing concept that maternal versus paternal gene expression dosage is important for normal serotonergic function and serotonergic modulation of behavior. An interesting example is Magel2, a paternally imprinted gene that encodes a member of MAGE domain family of proteins (Barker & Salehi, 2002) that is nearly 5-fold enriched in C+. Magel2 and necdin, another MAGE domain imprinted gene, are located near one another in the chromosomal 15q11-q13 region, which when deleted from the paternal allele results in Prader-Willi syndrome (PWS) and when deleted from the maternal
45 allele results in Angelman syndrome (Horsthemke & Wagstaff, 2008). Among the many behavioral and physiological defects present in children with PWS are severe respiratory abnormalities including frequent apneas and irregular rhythms
(Nixon & Brouillette, 2002). Recent studies in mice have shown that Necdin is also expressed in developing and adult 5HT neurons (Zanella et al, 2008) and as shown here (Supplemental Table S3) at least as early as E12.5. Loss of Necdin function in mice results in defects in 5HT neuron axonal outgrowth and transmitter vesicles (Lee et al, 2005; Zanella et al, 2008). In addition, Necdin-/- mice have respiratory deficits that resemble those in PWS (Ren et al, 2003;
Zanella et al, 2008) and is consistent with our finding of severe respiratory deficits in 5HT deficient Pet-1-/- neonates (Erickson et al, 2007). Similarly,
Magel2-/- mice have serotonergic deficits (Mercer et al, 2009) and therefore combined loss of function of Necdin and Magel2 in 5HT neurons may contribute to the respiratory deficits seen in PWS. Further support for an important role of
Magel2 in 5HT neuron development is the additional behavioral similarities of
Pet-1-/- and Magel2-/- mice including increased anxiety in novel environments and maternal behavior defects (Mercer et al, 2009; Mercer & Wevrick, 2009). The latter abnormality is likely to account for the poor survival of neonates born to
Magel2-/- dams and is consistent with recent findings from our lab using Pet-1-/- females (Lerch-Haner et al, 2008b) and confirmed with TPH2 nulls (Alenina et al,
2009) that brain 5HT is critical for reproductive success. Finally, the PWS imprinted region contains several other imprinted and non-imprinted genes.
Examination of our array database indicates serotonergic expression of
46 additional genes in this region including the imprinted genes, MKRN3,
SNRF/SNRPN, UBE3a and the biallelically expressed GABRB3 gene. Together,
these findings suggest expression of the 15q11-q13 region may play an
important role in 5HT neuron development and its altered dosage in these cells
may contribute to neurodevelopmental disorders.
In conclusion, we have identified numerous potential new determinants of
5HT neuron development and function including several homeodomain-encoding
genes whose differential expression offers a molecular classification of 5HT
neuron subtypes. Our findings provide a wealth of new knowledge and
experimentally testable hypotheses about the genetic networks that generate
serotonin neuron subtypes and the potential roles of serotonergic genes in
disease pathogenesis.
MATERIALS AND METHODS
Transgenic mice
ePet-EYFP mice were generated in a C57/SJL background. E0.5 was identified as 12:00 noon the day of the plug. Embryos were genotyped either by
PCR with primers 5’-GAA CTC CAG CAG GAC CAT GT-3’ and 5’-TAT ATC ATG
GCC GAC AAG CA-3’ or by a fluorescence dissecting microscope.
Dissection of ePet-EYFP+ neural tubes
E12.5 timed pregnant mice (E0.5 defined as the morning of plug
formation) were sacrificed by cervical dislocation in accordance with IACUC
regulations. Embryos were removed from uteri into ice-cold L15 media
47 (Invitrogen). Hindbrains were dissected from E12.5 embryos and visualized under an inverted fluorescent dissecting microscope to identify ePet-EYFP+ transgenics. A non-transgenic embryo was identified and processed simultaneously as a negative control in order to gate for background fluorescence on the cell sorter. Hindbrains were dissected into rostral and caudal regions using the absence of YFP fluorescence in rhombomere 4 as a landmark. Specifically, the neural tube was isolated from the mesecenphalic flexure to the spinal cord and cut at the pontine flexure to separate rostral and caudal hindbrain regions (Figure 2A).
Cell dissociation
Rostral and caudal hindbrains were enzymatically digested in 1X trypsin-
EDTA (Invitrogen) diluted in Ca2+/Mg2+ free DPBS (Invitrogen) at 37°C for 17min.
Tissues were washed 3 times in ice-cold Liebovitz L15 media (Invitrogen).
Samples were re-suspended in L15 containing 0.1% BSA (Invitrogen) and 0.1
µg/mL DNAse (Sigma) and then mechanically dissociated by gentle trituration with a fire-polished glass pipette to create a single cell suspension. Cells were pelleted and re-suspended in L15 containing 0.1% BSA.
Flow cytometry
Cells were passed through a 40µm filter and immediately sorted on a
Becton Dickinson FACS Aria digital cell sorter equipped with an argon laser providing excitation of 200 mW at 488 nm. YFP fluorescence was detected with the standard FL2 filter set (560 nm dichroic, 585/42 nm bandpass). Sort pressure
48 was 35 psi with an 85µm nozzle tip driven at 39.5 kHz. Maximum event rate was
conservatively limited to 5000 / sec. Forward scatter height versus width gating
was used to eliminate aggregates. YFP fluorescent cells were identified by
characteristic red versus orange fluorescence and were sorted directly into tubes
containing Trizol for subsequent RNA extraction or into L15 media for
confirmation of sort purity. A typical sort with 4-5 transgenic embryos at E12.5
yielded roughly 45,000 YFP+ rostral and 30,000 YFP+ caudal 5HT neurons.
Litters from 6-7 E12.5 timed pregnant were sorted and pooled to collect 200,000
cells for each of the 4 cell groups to be profiled: R+ (rostral YFP+ ) R- (rostral YFP-
), C+ (caudal YFP+), and C- (caudal YFP-).
RNA isolation, amplification, and microarray hybridization
Total RNA was isolated from 200,000 cells for each of the 4 cell types collected directly into Trizol (Invitrogen) with the addition of tRNA as carrier during the precipitation step. RNA quality was inspected by Bioanalyser 2100
(Agilent, Palo Alto, CA). One round of amplification was performed using the
MessageAmp II Kit (Ambion). In vitro transcription with biotin incorporation
(Bioarray High Yield RNA Transcript Labeling, Enzo) was used to generate cRNA probes. The quantity of cRNA was measured by Nanodrop 1000 (Nanodrop
Technologies). 10 µg of cRNA for each cell type was fragmented and hybridized overnight at 42◦C to Affymetrix whole genome arrays (Mouse Genome 430 2.0).
Each Affymetrix 430 2.0 array contains 45,037 oligonucleotide probe sets which represent 20,832 unique genes. After hybridization, the chips underwent stringency washes in a Genechip Fluidics Station (Affymetrix) and were scanned
49 at high resolution (Affymetrix High Density GeneChip Scanner 3000). Three biological replicates with different pools of litters, independent FACS-isolation, amplification, and hybridization were performed to assess reproducibility. DAT files were later used to generate CEL files. Affymetrix GCOS using MAS 5.0 statistical algorithms was used to convert CEL files into Excel spread sheets.
Standard quality assessment procedures were performed for all hybridizations according to Affymetrix recommendations.
Microarray data processing
Present/Absent calls for each probe set were calculated by the mas5calls function in the affy package of Bioconductor (Reimers & Carey, 2006). Default parameters were used for the calculation. Cel files from 12 chips were normalized (Supplemental Table S1) using the Robust MultiChip Averaging
(RMA) algorithm as implemented in Bioconductor (Reimers & Carey, 2006).
Multiple-group comparison and hierarchical clustering
The ANOVA test in the Limma package (Smyth, 2005) was used to identify probe sets that were differentially expressed across the 4 test groups.
The p values generated from the ANOVA test were further adjusted using the
Benjamini and Hochberg correction (Benjamini & Hochberg, 1995). In this comparison, differentially expressed probe sets were selected based on two criteria: 1) adjusted p values less than 0.001, and 2) at least a 2-fold change between the groups with higheset and lowest average expression values.
Hierarchical clustering analysis (Eisen et al, 1998) was then applied to the
50 selected probe sets. Average linkage was used in the clustering analysis with
Pearson’s correlation coefficient as the similarity measurement.
Pairwise comparisons
For pairwise comparisons, the t-test in the Limma package was used to
identify differentially expressed probe sets between the two groups under
comparison. The implementation of t-test in limma uses an empirical Bayes
method to moderate the standard errors of the estimated log-fold changes, this
results in more stable inference and improved power, especially for experiments
with small number of arrays. The p-values generated from the t-test were further adjusted using the Benjamini and Hochberg correction (Benjamini & Hochberg,
1995) to account for multiple comparisons. An adjusted p value of 0.01 (i.e. 1%
False Discovery Rate) was used to select differentially expressed probe sets.
Knowledge-guided gene set level analysis
We used the mixed models approach (Wang et al, 2008) to assess coordinated changes of genes at the gene set level in serotonin neurons. Gene sets derived from the Gene Ontology (GO) were downloaded from the MsigDB database http://www.broad.mit.edu/gsea/msigdb/index.jsp. For each geneset,
this approach compares the average gene expression levels of the two groups
(e.g. serotonin neurons vs. non-serotonin neurons) for gene sets versus other
genes while controlling for correlations between genes. Mixed models analysis
uses continuous evidence from each gene so that the results do not depend on
any significance cutoff for single genes as in conventional over-representation
51 analysis. It was shown to have more favorable statistical properties compared to
traditional gene set analysis methods (Wang et al, 2008). Because many gene
sets were examined, to control for the rate of false positive findings by chance,
we adjusted nominal p-values using Bonferroni correction.
Double-label in situ hybridization/immunohistochemistry
DIG-labeled antisense probes were synthesized with digoxigenin-11-UTP
according to the manufacturer’s instructions (Roche, Burlington, NC). Tissues
were fixed with 4% paraformaldehyde overnight and then cryoprotected in 30%
sucrose. Ten-twenty µm cryostat sections were collected on Superfrost Plus
slides (Fisher, Pittsburgh, PA). Sections were fixed again for 5 min, washed 3x
with 1X PBS, treated with proteinase K (1 µg/mL) for 3 min, washed 3x with 1X
PBS, acetylated in 0.35% (v/v) acetic anhydride at room temperature in 100 mM
triethanolamine pH 8.0 for 10 min, and then rinsed 3X in 1X PBS. Sections were
prehybridized for 1 hour at RT in hybridization buffer (50% deionized formamide,
5X SSC, 5X Denhardt’s solution, 250 µg/mL Baker’s yeast tRNA, 500 µg/mL
salmon sperm DNA). Probe was diluted 1:100 in hybridization buffer and applied
to slides which were coverslipped with Hybrislips (Grace Biolabs, Bend, OR).
Hybridization was carried out overnight at 65-68◦C. The next day coverslips were
removed in 5X SSC. Sections were then washed for 2 hours in 0.2X SSC at 65-
68◦C. Sections were then equilibrated in 1X B1 (100 mM Tris pH 7.4, 150 mM
NaCl) for 10 min, blocked for 1 hour in 10% heat inactivated goat serum diluted
in B1, and then incubated overnight at 4◦C with sheep anti-DIG-alkaline
phosphatase-conjugated Fab fragments (Roche) diluted 1:5,000 in blocking
52 buffer. The next day slides were washed 3x 15 min in 1X B1, equilibrated in
freshly prepared B2 (300 mM Tris pH 9.5, 300 mM NaCl, 150 mM MgCl2) for 10
min, and then developed in chromagen solution containing 340 µg/mL NBT, 180
µg/mL BCIP, and 240 µg/mL levamisole (all Sigma) in B2 at RT for 2-16 hours.
For double labeling slides were washed 3x 5 min in 1X PBS, blocked 1 hour in
10% goat serum in 1X PBST, and incubated with anti-rabbit GFP (Clontech) at
1:1,000 overnight at 4◦C. Sections were then washed 3x 5 min in 1X PBS and incubated with a 1:1000 dilution of biotinylated goat anti-rabbit IgG antibody for 2 hours at RT. Horseradish peroxidase staining was carried out using the avidin- biotin-peroxidase complex (Vectastain ABC kit, Vector Burlingame, CA) and
SigmaFast DAB tablets (Sigma). Sections were dehydrated through graded ethanols and xylene and coverslipped with DPX (Electron Microscopy Sciences,
Ft. Washington, PA).
Immunohistochemistry and antibodies
Immunohistochemistry was performed on 20 µm cryostat sections from
embryos that were fixed in 4% PFA for 1-2 hours and then cryoprotected in 30%
sucrose. Pan-engrailed antiserum was a gift from Alexandra Joyner (Sloan-
Kettering Institute). Hox antibodies were a gift from Thomas Jessell (Columbia
University Medical Center). Pan-Meis antibody was a gift from Steve O’Gorman
(Case Western Reserve University). Dilutions were 1:8000 for rabbit anti-HoxA3,
1:5,000 for rabbit anti-HoxC4, and 1:1,000 for rabbit anti-pan-Meis. Goat-anti-
rabbit Texas Red secondary antibody (Jackson Immunoresearch Laboratories)
was used at 1:400.
53 Confocal microscopy
Twenty-thirty µm sections were imaged on a Zeiss LSM 510 Meta confocal microscope. For z-stacks, images were collected every 2-3 µm and compressed using Zeis LSM Image software.
Quantitative real-time RT-PCR
Total RNA was extracted from FACS-isolated cells according to the Trizol method (Invitrogen). R+, R-, C+, and C- RNA samples were delivered to the Gene
Expression and Genotyping Facility at Case Western Reserve. Samples were then converted to cDNA and then assayed by Taqman (Applied Biosystems) in triplicate for candidate gene confirmation. The CT (cycle number at threshold) was used to calculate the relative amounts of mRNA molecules for a given gene.
The CT of each target gene was normalized by subtracting the CT value of the housekeeping gene β-actin which gave the value Δ CT. The difference in the Δ
CT from the cell type of interest and a control cell type gave ΔΔ CT. The relative quantitative change was shown as 2- ΔΔ CT.
ACKNOWLEDGEMENTS
This work was supported by a National Institute of Mental Health Silvio Conte
Center Grant P50 MH078028 (Project 1) to E.S.D. We thank Randy Blakely,
Elaine Sanders-Bush, Doug McMahon, Ron Emeson, Pat Levitt, other members of Vanderbilt Conte Center, and Robert Miller in the Case Western Reserve
University Neuroscience Department for helpful suggestions and comments on this project. We thank Kathy Lobur for help with timed pregnancies and
54 genotyping. We thank A. Joyner and Brian Bai for pan-engrailed antiserum and
T. Jessell for Hox antibodies.
55
56 Figure 1. ePet-EYFP expression marks rostral and caudal 5HT neurons in
the embryonic ventral hindbrain.
A, Whole-mount view of an ePet-EYFP transgenic brain at E14.5. Both rostral
and caudal 5HT neuronal cell bodies and axonal projections were brightly
marked by EYFP fluorescence. A, High-magnification view (8X) of caudal 5HT
axonal projections to the spinal cord. B–D, Tiled confocal z-stack images of 5HT
immunoreactivity (red) and EYFP fluorescence at E12.5 (B, sagittal view) and at
E14.5 in the caudal (C, sagittal view) and rostral (D, coronal view) domains.
Scale bars: B, 100 µm; C, D, 200 µm.
57
58 Figure 2. Purification and expression profiling of rostral and caudal 5HT
neurons.
A, E12.5 ePet-EYFP neural tubes were dissected and incisions made at the mesencephalic flexure, pontine flexure, and spinal cord to separate the rostral and caudal domains. B, Single-cell suspensions of rostral and caudal neural tubes were subjected to FACS. EYFP + cells were collected in gate P7 (top) and nonfluorescent cells were collected in gate P8 (bottom). The fluorescent and nonfluorescent fractions were separated by one log unit to ensure pure populations for gene expression profiling. C, Sorting efficiency was verified by examining purified cells under fluorescence (top) and phase-contrast (bottom) microscopy.D, RNA was isolated from rostral YFP+ (R+), rostral YFP- (R-), caudal YFP+ (C+), and caudal YFP- (C-) sorted cells and then assayed by
Taqman RT-PCR for two known 5HT neuron specific genes, Fev and Tph2. E,
Total RNA from 200,000 sorted cells each for rostral 5HT YFP+ (R+), rostral non-
5HT (R-), caudal 5HT YFP+ (C+), and caudal non-5HT (C-) was used for one round of amplification to generate cRNA probes. F, G, Enriched expression of well established highly expressed (F ) and more moderately expressed (G) markers of 5HT neurons were detected in R+ and C+ neurons by microarray hybridization. The y-axis equals the gene expression level determined by MAS
5.0. Error bars represent SEM. Scale bars: A, C, 100 µm.
59
60 Figure 3. Unsupervised hierarchical clustering of serotonergic gene expression.
A, Dendrogram showing unsupervised hierarchical clustering of R+, C+, R-, and
C- gene expression profiles from the 12 arrays. Biological replicates show a high degree of reproducibility. B, Heat map displays eight distinct clusters of enriched gene expression in R+, C+, R-, and C- cell populations at E12.5. Each row represents the relative levels of expression for a single gene. The red or green color indicates high or low expression, respectively. Each column shows the expression profile for a single biological sample. Cluster I, Enriched gene expression in rostral 5HT and caudal 5HT neurons (R+C+); cluster II, enriched
gene expression in rostral 5HT neurons (R+); cluster III, enriched gene
expression in rostral 5HT and rostral non-5HT neurons (R+R-); cluster
IV, enriched gene expression in caudal 5HT neurons (C+); cluster V, enriched
gene expression in caudal 5HT and caudal non-5HT neurons (C+C-); cluster VI,
enriched gene expression in rostral non-5HT neurons (R-); cluster VII, enriched gene expression in caudal non-5HT neurons (C-); and cluster VIII, enriched gene expression in rostral and caudal non-5HT neurons (R-C-).
61
62
63 Figure 4. Verification of 5HT neuron-enriched gene expression.
A, B, Taqman RT-PCR verified 5HT neuron-enriched expression of transcription factors Rnf112, Zcchc12, Tox and RIKEN genes 2010204K13Rik, AW551984, and 1700042O10Rik. C, Double-label immunohistochemistry for EYFP (brown) and in situ hybridization for AW551984 transcript (purple) verified the enriched expression of est AW551984 in 5HT neurons. D–F, Coimmunohistochemical staining of E12.5 neural tube confirmed FoxP1 (E) expressionin YFP+ (D) 5HT neurons (F, overlay). Scale bars: C, 40 µm; D–F, 100 µm.
64
65
66
67 Figure 5. Verification of rostral 5HT neuron-enriched HD gene expression.
A, Taqman RT-PCR confirmed enriched expression of Hmx2, Hmx3, and
Pou3f1 homeodomain genes in rostral (R+) but not caudal (C+) 5HT neurons. B–
D, Double-label in situ hybridization (blue) and immunohistochemistry for EYFP
(brown) confirmed expression of Hmx2 (B) and Hmx3 (C) in E12.5 rostral 5HT neurons. D, Hmx2 expression was maintained in rostral 5HT neurons at E16.5.
E, Taqman RT-PCR verification of enriched En1 and En2 gene expression in
E12.5 rostral 5HT neurons (R+) as well as non-5HT cells (R- and C-) but not caudal 5HT neurons (C+). F, In situ hybridization for En2 at E12.5 shows a broad domain of expression on either side of the MHB. G, Immunohistochemical staining with a pan-engrailed antibody (red) detected En1 and En2 proteins in
EYFP+ (green) 5HT neurons in rhombomere 1 at E12.5. H, En1/2 protein expression persisted in rostral 5HT neurons at E14.5. Scale bars: B, C, G, 50
µm; D, H, 100 µm; F, 500 µm.
68
69
70 Figure 6. Verification of Hox gene expression in caudal 5HT neurons.
A–C, Taqman RT-PCR confirmed the expression of Hox3 (A), Hox4 (B), and
Hox5 (C) paralogues in caudal (C+) but not rostral (R+) 5HT neurons. D–L,
Immunohistochemical staining for the Hox cofactors, Meis 1 and Meis 2, and Hox proteins. D–F, Meis1 and Meis2 (E) were detected in caudal 5HT neurons (D) with a pan-anti-Meis antibody (F, overlay). G–I, HoxC4 protein (H) was detected in caudal 5HT neurons (G, I, overlay). J–L, HoxA3 protein (K ) was detected in most caudal 5HT neurons (J ) at E12.5 (L, overlay). Scale bars: D–L, 50 µm.
71
72 CHAPTER 3
CONDITIONAL DELETION OF NEUROPILIN 2 IN 5HT NEURONS
SUMMARY Rostral 5HT neurons provide ascending axonal innervation to virtually all
areas of the brain while axons from caudal 5HT neurons descend to innervate
the cerebellum and spinal cord. The molecules responsible for the disparate
projection patterns of rostral and caudal 5HT neurons are not known but likely
involve both cell-intrinsic and extrinsic factors such as the differential expression
of receptors and downstream effector molecules that respond to varying
gradients of chemoattractive and repulsive signals in the extracellular
environment. We chose gene array profiling because as a high-throughput
method it is an ideal starting point for the discovery of axon pathfinding genes
expressed by rostral and caudal 5HT neurons.
Neuropilin 2 (NRP2) is a co-receptor for a class of molecules known as
semaphorins which are involved in numerous neurodevelopmental processes
including axonal pathfinding, cell migration, and apoptosis. Our gene array
experiments detected the enriched expression of NRP2 in E12.5 rostral 5HT
neurons relative to caudal 5HT neurons thus providing one potential molecular
mechanism for the opposite axonal projection patterns of rostral and caudal 5HT
neurons. To explore the functional role of NRP2 in 5HT neurons, we obtained
transgenic mice with a floxed NRP2 allele (Walz et al, 2002) which we crossed
with ePet-Cre transgenics to selectively delete NRP2 in 5HT neurons
(5HTΔNRP2). Our preliminary findings reveal a severe loss of ascending 5HT
73 immunoreactive axonal projections and cell bodies in the rostral 5HT system as
early as E13.5 in 5HTΔNRP2 mice. High performance liquid chromatography
(HPLC) analysis of 5HTΔNRP2 adult brains compared to wild-type brains revealed a 35-45% reduction in the amounts of 5HT in forebrain areas and the raphe where 5HT neurons are situated but not in the spinal cord which is targeted by caudal 5HT axons. 5HT immunohistochemistry on adult brains revealed a substantial loss of 5HT immunoreactive axons in the cortex and dentate gyrus. Further experiments are needed to fully clarify the role of NRP2 in rostral 5HT axonal pathfinding, cell migration, and survival.
INTRODUCTION
The 5HT neurotransmitter system is comprised of a relatively small number of neurons; approximately 20,000 in rat and mouse and 300,000 in humans (Jacobs & Azmitia, 1992). Yet this single neurotransmitter exerts a broad neuromodulatory role on numerous behavioral and physiological processes through its extensive axonal projections to virtually all areas of the brain and spinal cord. Further, dysfunction of the 5HT system has been implicated in numerous neuropsychiatric disorders such as anxiety and depression which may in part originate due to variations in gene expression during early neurodevelopment that impact 5HT circuitry (Ansorge et al, 2007).
For example, a polymorphism in the promoter region of the human serotonin transporter (SERT) gene has been shown to affect the transcription of SERT and individuals expressing this polymorphism tended to have an increased propensity for anxiety and depression in many but not all studies (Collier et al, 1996; Lesch
74 et al, 1996; Levinson, 2006). The behavioral consequences of alterations in
serotonergic tone have focused on a relatively small number of genes (Holmes et
al, 2003; Lerch-Haner et al, 2008a; Lira et al, 2003). Because genes operate in a
network there are likely many other candidate genes that impact serotonin levels
and circuitry and ultimately susceptibility to psychiatric disorders. Therefore,
understanding the genes that are required for the proper development of 5HT
axonal circuits could provide us with a better understanding of how perturbations
in 5HT circuitry may contribute to disease.
To date, very few regulators of 5HT axonal guidance have been reported
in the literature. Further, there are no reports in the literature which provide a
molecular mechanism for the opposite axonal innervation patterns of the rostral
and caudal 5HT neuronal populations. Our 5HT neuron gene array databases
provide us with a rich resource for the discovery of critical regulators of 5HT
neuronal projections and circuitry. We were particularly interested in genes with
established roles in axon pathfinding with differential expression in rostral and
caudal 5HT neurons. As shown in our gene array cluster analysis (cluster II R+
enriched, Supplemental Table S9; available at www.jneurosci.org as supplemental material) gene expression of Neuropilin 2 (NRP2) was 3 fold enriched in rostral 5HT neurons (R+) relative to R-, C+, and C- cell populations providing us with a potential candidate regulator of rostral 5HT axonal guidance.
The Neuropilin gene family is comprised of 2 members, Neuropilin 1 and
Neuropilin 2 (NRP1 and NRP2) which are conserved in birds and mammals. The
NRP2 gene is subject to alternative splicing with 6 possible transcripts recorded
75 to date (Chen et al, 1997) (Figure 1). The ligands for neuropilins are the semaphorins which are one of the largest phylogenetically conserved families of guidance cues that function both in the central and peripheral nervous systems
(Figure 2). The unifying feature of semaphorins is a ~500 amino acid domain
(sema) located extracellularly. There are at least 30 semaphorins grouped into 8 subclasses based on phylogeny and sequence conservation in the sema domain and carboxy terminus regions. Semaphorins exist as secreted molecules, transmembrane proteins, or GPI (glycosylphosphatidylinositol) anchored proteins which are secreted when cleaved (Figure 2). Classes 1, 4, 5, 6, and 7 are transmembrane or GPI-linked while classes 3 and V are secreted. Some transmembrane proteins can also be proteolytically cleaved to generate soluble proteins (Zhu et al, 2007). Originally, semaphorins were characterized as chemorepellents with the ability to trigger axon steering and growth cone collapse (Kolodkin et al, 1997) but are now known to also act as chemoattractants (Ding et al, 2007). Since semaphorins exist as both transmembrane and secreted proteins, they have the ability to act as both short and long range signals.
NRP1 and NRP2 can combine to form homodimers or heterodimers which results in differential affinity for the secreted class 3 semaphorins. NRP2-NRP1 heterodimers preferentially bind Sema3C, NRP2-NRP2 homodimers bind
Sema3B and Sema3F, while NRP1-NRP1 homodimers bind Sema3A (Chen et al, 1998; Raper, 2000; Zou et al, 2000). Further adding to the complexity, neuropilins interact with a family of transmembrane proteins known as the plexins
76 forming distinct receptor complexes which utilize a multitude of intracellular signaling cascades. The plexins are the main signaling component for neuropilin and semaphorin interactions. There are 9 plexins found in vertebrates that are grouped into 4 subfamilies (Plexin As, -Bs, -C, and D) (Rohm et al, 2000;
Tamagnone et al, 1999). With the exception of Sema3E, the class 3 secreted semaphorins require neuropilins as obligatory co-receptors to signal through class A plexins (Tran et al, 2007). Other co-receptors for semaphorins include
L1 cell adhesion molecule (L1CAM) (Castellani et al, 2000), neuronal cell adhesion molecule (NrCAM) (Falk et al, 2005), vascular endothelial growth factor receptor 2 (VEGFR2) (Fuh et al, 2000), and integrins (Pasterkamp et al, 2003).
The class 5 semaphorins are modulated by the binding of heparan sulfate proteoglycans or chondroitin sulfate proteoglycans which are required for Sema5 mediated attraction or repulsion, respectively (Kantor et al, 2004).
Structurally (Figure 3), neuropilins are composed of two CUB (for complement C1r/C1s, Uegf, Bmp1) domains which are motifs found almost exclusively in extracellular and plasma membrane-associated proteins and are often involved in dimerisation and/or recognition of binding partners and ligands
The CUB domains together with two coagulation –factor-like domains which are involved in cell adhesion determine semaphorin specificity. The MAM
(Meprin/A5-protein/PTPmu) domain is essential for oligomerization of neuropilins at the cell surface (Feiner et al, 1997; Nakamura et al, 1998; Renzi et al, 1999;
Tamagnone & Comoglio, 2000). Neuropilins have an intracellular domain that is not required for intracellular signaling but has a highly conserved sequence
77 which can interact with PDZ (PSD-95/Dlg/Z0-1 homology) domains which are known to regulate protein clustering and in neurons are important for the assembly of synaptic proteins that are transported by molecular motors (Cai &
Reed, 1999; Kim & Sheng, 2004).
Semaphorins mediate diverse biological effects and depending on the molecular context, i.e., the repertoire of membrane receptor complexes and the intracellular signal transduction machinery within a cell, an individual semaphorin is capable of eliciting either an attractive or a repulsive response. While the
intracellular signaling and resulting biological effects of semaphorins are quite
diverse, for cell migration and axonal guidance the most common downstream
target is the cytoskeleton (Pasterkamp & Kolodkin, 2003; Tamagnone &
Comoglio, 2004). Plexins which are the known signaling component of neuropilin
receptor complexes have a large conserved cytoplasmic domain which contains
GTPase activating motifs that can bind G-proteins upon semaphorin binding
(Uesugi et al, 2009; Vastrik et al, 1999). G-proteins then act through a variety of
downstream effectors which ultimately converge to regulate cytoskeletal
dynamics.
Neuropilin expression is widespread during neuronal development.
However, the complexity of neuropilins including splice variants, interactions with
other molecules to form distinct receptor complexes, and the number of
semaphorin interactions, and downstream signaling pathways make it a possible
candidate for neuronal-type specific regulation of axon guidance and cell
migration.
78 RESULTS
Detection of Neuropilin, Plexin, and Semaphorin expression by gene array.
At E12.5, we detected a 3 fold enriched expression of NRP2 (Affymetrix
probe ID-1435349_at) in rostral 5HT neurons (R+) relative to R-, C+, and C- cell populations (Figure 3A). We also filtered the gene array data to determine all of the plexins (Figure 3B) and semaphorins (Figure 3C) that were consistently expressed (given present calls on all 3 replicates) and at minimum signal intensity of 300. The knowledge of which neuropilin interacting proteins are also expressed in rostral 5HT neurons should guide the design of future experiments.
Further, because NRP2 interacts with NRP1 and the plexins, deletion of NRP2 in
5HT neurons will eliminate these interactions as well which could result in a more dramatic and complicated phenotype.
Confirmation of NRP2 protein expression in rostral 5HT neurons.
Immunohistochemical staining of E12.5 ePet-EYFP embryos was performed in order to independently verify that NRP2 was expressed in rostral
5HT neurons. NRP2 protein was localized predominately on rostral 5HT axons but was also detectable around the periphery of rostral 5HT neuronal cell bodies
(Figure 4, A-I). As expected NRP2 expression was visible in other neuronal populations in the developing brain and spinal cord. However, NRP2 protein was not detectable at this stage in caudal 5HT neurons (Figure 4, J-K)
79 Conditional deletion of NRP2 in 5HT neurons.
Floxed NRP2 mice (Walz et al, 2002) which have loxP sites in exon
1upstream of the ATG start codon and preceding a cassette encoding tauGFP
(Figure 5A) were crossed with ePet-Cre (Scott et al, 2005b) mice to generate
5HTΔNRP2 mice . When the allele is recombined, the mRNA lacks the first exon
of NRP2, thereby greatly reducing or precluding mutant NRP2 protein from being
targeted to the plasma membrane. In addition, the axonal marker, tau-GFP is
now brought under the control of the NRP2 promoter. The addition of a poly-
adenylation site at the end of the tau-GFP sequence further reduces the chance
of the formation of functional NRP2 protein. As expected, NRP2 protein was not
detected in immunostained sections from mice deleted for NRP2 (data not
shown) (Walz et al, 2002). After ePet-Cre recombination (Figure 5B), tau-GFP
now labels the developing 5HT system at E11.5 in both the rostral and caudal
domains. However, tau-GFP expression is brightest at the mid-hindbrain
boundary (MHB) where rostral 5HT axons are just beginning to cross perhaps
substantiating the enriched expression of NRP2 in rostral 5HT neurons as
detected by gene array.
Analysis of 5HTΔNRP2 mice by 5HT immunohistochemistry and confocal
microscopy.
5HTΔNRP2 (NRP2fl/fl Cre+) embryos were collected at E13.5 and
compared to “wild-type” (NRP2fl/fl Cre-) embryos. After fixation and
cryoprotection, 20-30µM serial sections were collected and processed for 5HT
immunohistochemistry. Z-stack images were gathered by confocal microscopy.
80 As shown in Figure 6A, C, E (sections from lateral hindbrain to midline), the 5HT axonal system at E13.5 is organized into fascicles that form network of fibers that run both parallel and transverse to the neural tube and then project forward crossing the mid-hindbrain boundary. In 5HTΔNRP2 mutant embryos (Figure 6
B, D, and F), there is a severe loss of 5HT immunoreactive fibers. The mesh-like arrangement of axons is significantly disrupted. Higher magnification (Figure 7 A and B) of sections further demonstrate the profound loss of 5HT immunoreactive fibers in the absence of NRP2.
5HT axons that cross the midline are disrupted in the absence of NRP2.
Serial 30 µM coronal sections of the presumptive median raphe at E13.5 were immunostained for 5HT and imaged by confocal stereo microscopy. In
“wild-type” (NRP2fl/fl Cre-) embryos (Figure 9 A, C, E, G) 5HT neurons are organized into bilateral columns with axons that traverse the midline in a highly organized fashion, crossing once and then projecting locally or toward the forebrain. In the absence of NRP2 (Figure 9 B, D, F, H) there is a loss of 5HT immunoreactive cell bodies and a profound decrease in axons crossing the midline. Higher magnification (Figure 10 A and B) of sections show that in the absence of NRP2, growth cones with enlarged dystrophic endings (arrows in
Figure 9 B) appear to be stalled in crossing the midline. This suggests that deletion of NRP2 (and therefore also its interactions with NRP1 and the Plexin genes) from 5HT neurons switches the midline from an attractive cue to an inhibitory or chemorepulsive environment.
81 HPLC analysis of 5HT levels in the CNS of 5HTΔNRP2 mice.
Based on the apparent decrease of 5HT immunoreactivity in the brains of
embryos with a conditional deletion of NRP2 in 5HT neurons, we wanted to
investigate if 5HT levels were also decreased in adult brains. The CNS from adult
mice was divided into 3 areas: ascending axonal target areas included the
cortical lobes, the raphe which contains 5HT cell bodies, and descending axonal
target areas included the cerebellum and spinal cord. Homogenates of the 3
areas were subjected to HPLC analysis for 5HT and its metabolites, dopamine,
and neuroepinephrine. 5HT levels were decreased by 35% in the raphe (cell
bodies) and by 45% in the ascending axonal target areas in 5HTΔNRP2
(NRP2fl/fl Cre+) compared to “wild-type” (NRP2fl/fl Cre-) mice. There was not a statistically significant decrease in 5HT levels of descending axonal target areas
(Figure 10 A). The 5HT metabolite 5-hydroxyindoleacetic acid, 5HIAA, was decreased by 37% in ascending axonal target areas of 5HTΔNRP2 but was not significantly different in the cell body or descending target areas compared to wild-type mice (Figure 10 B). Levels of dopamine, noradrenaline, and adrenaline were also measured but no differences were detected (data not shown).
Analysis of 5HT axonal projections in adult 5HTΔNRP2 brains by
immunohistochemistry.
30 µm serial sections of cortex and the dentate gyrus were processed for
5HT immunohistochemistry and z-stack images collected by confocal microscopy. As seen in “wild-type” (NRP2fl/fl Cre-), the cortex is densely
82 innervated by 5HT axons (Figure 11 A, C, E). However, in the absence of NRP2,
cortical areas have substantially less 5HT immunoreactive fibers (Figure 11 B, D,
F). The dentate gyrus was also analyzed because it is easier to ascertain that sections being compared are of the same area. Again, in “wild-type” (NRP2fl/fl
Cre-), the dentate gryus is heavily innervated by 5HT axons in nearly all layers
(Figure 12 A, C). In the dentate gyrus from 5HTΔNRP2 mice (Figure 12 B, D),
the number of 5HT immunoreactive projections is noticeably decreased. These
findings, although preliminary (n=1 for each genotype) substantiate the HPLC
findings in adult brains which show a 45% decrease of 5HT in ascending 5HT
projection target areas which include cortex and dentate gyrus. Further
experiments are needed to confirm the immunohistochemistry data presented
here and to determine whether other 5HT axonal target areas are affected in the
absence of NRP2.
MATERIALS AND METHODS
Transgenics. Generation of mice with a specific deletion of NRP2 in 5HT
neurons.
NRP2 floxed mice (NRP2fl/fl) were obtained from Peter Mombaert’s lab at
Rockefeller University (Walz et al, 2002) and crossed to ePet-Cre mice (Scott et
al, 2005b) to generate NRP2fl/fl ePetCre+ transgenics (5HTΔNRP2). Timed
pregnancies were set and 5HTΔNRP2 embryos were harvested at E13.5 and
compared to NRP2fl/fl Cre- embryos. E0.5 was identified as 12:00 noon the day
of the plug. Genotyping was performed using the following PCR primers for
83 NRP2: 5’ AGC TTT TGC CTC AGG AGG CA3’;
5’CAGGTGACTGGGGATAGGGTA3’; 5’ CCT GAC TAC TCC CAG TCA TAG3’;
and ePet-Cre: 5’ CAT TTG CTT CTA GCC TGC AG 3’; 5’ ATG TTT AGC TGG
CCC AAA TG 3’.
Immunohistochemistry and confocal microscopy.
Embryos were fixed overnight in 4% paraformaldehyde (PFA) and then
transferred to 30% sucrose in PBS until embryos had sunk. Embryos were
embedded in OCT and stored at -80 °C until analysis. Sections were cut at 20-30
µM and collected on Superfrost Plus slides (Fisher, Pittsburgh, PA).
Immunostaining was performed with rabbit anti-5HT (Immunostar) at 1:10,000 followed by secondary detection with goat anti-rabbit Texas Red at 1:400. Adult brains were collected after transcardial perfusion with PBS for 5 minutes followed by perfusion with 4% PFA for 20 minutes. Brains were post-fixed for 2 hours in
4% PFA and then cryoprotected in 30% sucrose in PBS overnight. Brains were embedded in OCT and processed as described above for embryos.
Confocal microscopy.
Twenty-thirty µm sections were imaged on a Zeiss LSM 510 Meta confocal microscope. For z-stacks, images were collected every 2-3 µm and compressed using Zeis LSM Image software.
84 HPLC analysis.
The adult CNS of wild-type (NRP2fl/fl Cre-) and 5HTΔNRP2 (NRP2fl/fl Cre+) was dissected into 3 areas representing ascending axonal target (cortical lobes), cell bodies (raphe), and descending axonal target areas (cerebellum and spinal cord) and subjected to HPLC analysis for 5HT, its metabolite 5-hydroxyindoleacetic acid or 5HIAA, dopamine, noradrenaline and adrenaline.
Ingenuity Pathway Analysis (IPA) of Neuropilin interactions in rostral 5HT neurons.
Gene array data of genes consistently given present calls (PPP) on all 3 biological replicates in rostral 5HT neurons were uploaded to IPA software for pathway analysis.
DISCUSSION AND FUTURE DIRECTIONS
In this chapter we explored whether NRP2 was required by 5HT neurons by using ePetCre to selectively delete NRP2 in 5HT neurons. NRP2 has well established roles in axon guidance and cell migration. Based on the enriched expression of NRP2 in rostral 5HT neurons by gene array, we focused on examining the embryonic rostral 5HT system for defects in axonal pathfinding and neuronal migration. Our embryonic studies suggest that in the absence of
NRP2, rostral 5HT axons at the pontine level near the floorplate no longer interpret the midline as an attractive cue and the majority of axons are unable to cross. Those few that do enter the midline exhibit enlarged dystrophic growth
85 cone endings suggesting that the midline is now interpreted as repulsive in the absence of NRP2.
In both grasshopper and fly, 5HT axons do not express the serotonin transporter (Sert) until after they have crossed the midline and entered the contralateral neuropil (Condron, 1999; Couch et al, 2004). If 5HT axons are severed so that they do not contact the midline, a loss of Sert expression is observed but can be rescued by bath application of fibroblast growth factor
(FGF2) demonstrating that 5HT neuron differentiation is dependent on a midline derived FGF signal (Condron, 1999). 5HT neuron differentiation in mouse and rat is also dependent on FGF (Ye et al, 1998a). In mouse, Sert expression is first evident at E12 in rostral and caudal 5HT neurons(Bruning & Liangos, 1997).
However it is not known if in mouse the onset of Sert expression occurs after midline crossing as it does in grasshopper and fly. A feasible scenario for the midline crossing defect observed in 5HTΔNRP2 mice is that the loss of NRP2 switches the midline from an attractive to a repulsive cue to rostral 5HT axons.
This likely means that NRP2 expressed on rostral 5HT axons at the pontine level is responding to a semaphorin that is expressed at the midline as an attractive signal. When NRP2 is removed, the midline is now interpreted as repulsive possibly due to the expression of other semaphorins or inhibitory molecules. In
5HTΔNRP2 mice, rostral 5HT midline neurons not only fail to cross the midline but there are fewer 5HT immunoreactive cell bodies and axons. Those 5HT neurons that do remain appear to contain less 5HT and look as if they are dying.
A possible explanation for this is that because they do not cross the midline, they
86 do not receive their required FGF signal for differentiation and also do not initiate expression of Sert. Sert levels in 5HTΔNRP2 mice could be measured by immunostaining or RT-PCR. To determine if rostral 5HT neurons die in the absence of NRP2, tunel or caspase staining could be performed to determine if apoptosis is occurring. Alternatively, rostral 5HT neurons may not migrate to their correct position at the midline and could potentially switch fate or fail to become serotonergic. 5HTΔNRP2 transgenics were bred to carry a Rosa26 Cre responsive report gene that produces beta-galactosidase in 5HT neurons after ePetCre mediated recombination. Therefore, beta-galactosidase staining could be used to fate-map 5HTΔNRP2 neurons to determine if they migrate inappropriately or switch cell fate.
Our preliminary analysis of adult 5HTΔNRP2 brains indicates that there is a substantial reduction in the amount of 5HT in rostral 5HT axonal target areas by both HPLC (n=4) and immunostaining (n=1). Further experiments are need to verify these findings. If a near 50% reduction in 5HT levels is true, 5HTΔNRP2 mice would be particularly useful in behavioral assays. Based on the analysis of embryos, it seems that the presumptive median raphe may be selectively disrupted in 5HTΔNRP2 mice. It would be interesting to determine if select target areas are denervated which would allow us to determine which behaviors and physiological processes are modulated by the median raphe 5HT system.
More recent studies have focused on the role of semaphorin signaling in the juvenile and adult nervous system (see (Pasterkamp & Giger, 2009) for review). During the early postnatal and juvenile stages, semaphorin signaling has
87 been implicated in synaptogenesis, axon pruning, and the regulation of the density and maturation of dendritic spines. In the adult brain, semaphorins have been shown to play a role in synaptic transmission and neuronal excitability.
Therefore, if NRP2 expression is maintained in adult 5HT neurons it would be interesting to conditionally delete NRP2 in adult 5HT neurons using the recently developed tamoxifen-inducible targeting which allows for temporally defined ablation of genes in 5HT neurons (Lui et al., publication under review).
88
89 Figure 1. Genomic organization and alternative splice variants of NRP2 in mouse. The mouse NRP2 gene is comprised of 18 exons with 6 possible transcripts resulting from alternative splice sites at the 3 prime end.
90
91 Figure 2. Classes of semaphorins.
There are at least 30 known semaphorins which exist as secreted, transmembrane, or GPI (glycosylphosphatidylinositol) linked molecules. The semaphorins are grouped into 8 classes based on sequence similarity and their phylogenetic relations. Classes 1and 2 are expressed in invertebrates, classes 3-
7 are found in vertebrates, and V are present in viruses. Semaphorins are defined by a conserved ~500 amino acid (sema) motif located extracellularly at the amino terminus.
92
93 Figure 3. Semaphorins and their receptors.
Neuropilins can be homo or heterodimeric. They contain two CUB domains
(involved in dimerisation and/or recognition of subtrates and binding partners), two coagulation factors, a MAM domain (interaction or adhesion domain), and a short (~40 amino acid) cytoplasmic domain. Plexins which are likely dimeric determine the semaphorin binding specificity and mediate intracellular signalling.
They contain a sema domain, Met-related sequences (MRS), a transmembrane domain, and conserved region.
94
95 Figure 4. Neuropilin, Semaphorin, and Plexin gene expression in E12.5 5HT
neurons and surrounding neural tube as detected by Affymetrix gene
arrays.
A, Neuropilin 2 (NRP2) shows enriched expression (3 fold) in rostral 5HT
neurons (R+) relative to R-, C+, and C- cell populations. The Neuropilin 1 (NRP1)
gene which can form heterodimers with NRP2 is also expressed in R+ 5HT
neurons but at lower levels. A related molecule, Neuropilin and tolloid (TLL)-like 2
(Neto2) is also expressed in rostral 5HT neurons. B, The plexins are the signal transducers for the semaphorins and couple with neuropilins to determine semaphorin specificity. 7 of the 9 known Plexin genes are consistently expressed in rostral 5HT neurons with Plexin B2 exhibiting the highest expression. C, 10 of the 20 known semaphorin genes are consistently expressed in rostral 5HT neurons.
96
.
97 Figure 5. Confirmation of NRP2 protein enrichment in rostral 5HT neurons.
A-L, Immunohistochemistry with an antibody against NRP2 at E12.5 in a ePet-
EYFP embryo. A-I, NRP2 protein is detected in ePet-EYFP+ rostral 5HT neurons at multiple levels of the hindbrain and is localized primarily to axons. J-K, NRP2 protein expression is not detected in caudal ePet-EYFP+ neurons but is visible on axonal fibers from other caudal cell populations.
98
99 Figure 6. Transgenics and conditional deletion of NRP2 in 5HT neurons.
A, Schematic of targeting vector used to conditionally disrupt NRP2 (modified from (Walz et al, 2002)). B, An NRP2 flox/flox ePet-Cre+ (5HTΔNRP2 ) embryo at E11.5. Tau-GFP is visible in both rostral and caudal 5HT domains but with a greater level of fluorescence at the mid-hindbrain (MHB) boundary where rostral
5HT axons are just beginning to traverse.
100
101 Figure 7. Conditional deletion of NRP2 in 5HT neurons (5HTΔNRP2) results
in a loss of 5HT immunoreactive axons and cell bodies.
Serial 30 µM sagital E13.5 hindbrain sections starting laterally and proceeding
toward the midline from “wildtype” (NRP2fl/fl ePetCre-) mice (A, C, E) were
stained for 5HT and compared to sections from 5HTΔNRP2 mice (NRP2fl/fl
ePetCre+) (B, D, F) after imaging by z-stack confocal microscopy. Images are shown in glow-scale which indicates levels of 5HT immunoreactivity with white to red pixels representing highest to lowest intensities respectively.
102
103 Figure 8. High magnification of sections in Figure 7 to detail the profound loss of 5HT axonal fibers in the absence of NRP2.
A, Representative image of the highly organized mesh-like 5HT axonal network observed in “wild-type” (NRP2fl/fl Cre-) E13.5 embryos. B, 5HT immunoreactive axons are severely deficient in 5HTΔNRP2 (NRP2fl/fl Cre+) hindbrains.
104
105 Figure 9. Loss of NRP2 results in a severe disruption of 5HT neurons at the midline.
Serial coronal sections of the presumptive median raphe at E13.5 were immunostained for 5HT and imaged by confocal stereo microscopy. A,C, E, G,
“Wild-type” (NRP2fl/fl Cre-) 5HT neurons are organized into 2 columns with their axons crossing the midline. B, D, F, H, 5HTΔNRP2 (NRP2fl/fl Cre+) mice have a severe deficit in 5HT immunoreactive cell bodies and axons that cross the midline.
106
107 Figure 10. High magnification of stereo confocal images in Figure 9 to
illustrate dystrophic growth cone endings in the absence of NRP2.
A, Wild-type (NRP2fl/fl Cre -) 5HT immunoreactive axons cross the midline in a highly organized fashion. B, In the absence of NRP2, very few 5HT
immunoreactive axons are visible crossing the midline. Growth cones with
dystrophic endings and membrane blebbing (arrows) are visible suggesting that
the midline is interpreted as respulsive in the absence of NRP2.
108
109 Figure 11. 5HT and the 5HT metabolite 5HIAA are decreased in the brains of adult 5HTΔNRP2 mice.
Tissues from “wild-type” (NRP2fl/fl Cre-) and 5HTΔNRP2 (NRP2fl/fl Cre+) were dissected and divided into 3 areas. Ascending comprises both cortical lobes, the cell body area consisted of the underlying raphe, and descending was composed of the cerebellum and spinal cord. A, 5HT levels were decreased in 5HTΔNRP2 mice by 35% in the 5HT cell body area and a 45% reduction of 5HT was observed in the ascending axonal target areas. There was not a statistically significant difference in 5HT levels in the descending projections to the cerebellum and spinal cord. B, The 5HT metabolite, 5HIAA, was decreased by
37% in 5HTΔNRP2 in ascending target areas but was not significantly different in the cell body area or descending target areas. N=4 for each genotype.
110
111 Figure 12. 5HT immunoreactive axons are decreased in the cortex of
5HTΔNRP2 mice.
A,C,E, “Wild-type” (NRP2fl/flCre-) serial 30 µM sections of cortex compared to 5HTΔNRP2 (NRP2fl/flCre+) B, D, F. 5HT axons innervate all layers of the cortex in wild-type mice. In the absence of NRP2, there is a loss of 5HT immunoreactive axons in all layers.
112
113 Figure 13. 5HT immunoreactive axonal fibers are decreased in the dentate gyrus of adult 5HTΔNRP2 mice.
A,C, “Wild-type” (NRP2fl/flCre-) serial 30 µM sections of dentate gyrus compared to 5HTΔNRP2 (NRP2fl/flCre+) B, D. 5HT projections to the dentate gyrus are profoundly decreased in the absence of NRP2.
114
115 Figure 14. Ingenuity Pathway Analysis (IPA) of Neuropilin associated genes in rostral 5HT neurons.
Genes that were consistently detected by gene array in rostral 5HT neurons were uploaded to Ingenuity software which allows for network modeling of known gene interactions. Shown is an example of some of the potential NRP2 gene pathways that might operate in rostral 5HT neurons to control axon guidance and/or cell migration.
116 CHAPTER 4
DISCUSSION
I. Utility of ePet-EYFP transgenic mice
A major accomplishment of this thesis was the generation of a transgenic mouse line (ePet-EYFP) with EYFP expressed solely in 5HT neurons. This transgenic line is currently being used by many laboratories to explore various aspects of 5HT neuron biology. The ePet-EYFP reporter recapitulates endogenous Pet1 expression and therefore is expressed prior to 5HT synthesis making this line particularly amenable to the study of the development of 5HT neurons. One example carried out by Alicia Hawthorne in Jerry Silver’s lab was to use the ePet-EYFP mice to study 5HT neuronal migration in live brain slices
(Hawthorne, In press). Other studies underway include examining the impact of embryonic exposure to several drugs such as selective serotonin reuptake inhibitors (SSRIs) and MDMA or ecstasy on the development of 5HT neuronal circuitry. Electrophysiology studies of 5HT neurons are clearly much more straightforward with the presence of a fluorescent marker and several labs are using the ePet-EYFP mice for this purpose.
The ability to culture 5HT neurons with a fluorescent label has numerous applications and the methods for growing dissociated ePet-EYFP neurons have been established during this thesis work. Dissociated ePet-EYFP at E12.5 neurons grown 1 day in vitro exhibit extraordinarily diverse morphologies (Figure
1). It would be interesting to determine if a given morphology of a 5HT neuron is correlated with specific electrophysiological properties, anatomical location, or
117 function. Live confocal imaging of ePet-EYFP cultures allows for the
visualization of growth cone dynamics and cell-cell interactions (data not shown).
II. Development of methodology to purify embryonic rostral and caudal
5HT neurons.
After generating the ePet-EYFP transgenic line, the next goal of this thesis was to develop methods to purify 5HT neurons. We demonstrate here that ePet-
EYFP+ E12.5 neurons can be purified by FACS. Using our sorting parameters, approximately 98% of sorted cells are YFP+. The ability to obtain pure populations of 5HT neurons has a number of other applications. The sorting technique is now being used in our lab to identify microRNAs in 5HT neurons and to identify target genes of Pet1 by comparing wild-type 5HT neurons to Pet1 knockout 5HT neurons that are labeled by ePet-EYFP. The objective for this thesis was to use FACS to separate rostral and caudal 5HT neurons for gene expression profiling.
III. Gene array profiling of rostral and caudal 5HT neurons.
The heterogeneous nature of the central 5HT system is well established and likely is the basis for the broad range of physiological processes and behaviors that are modulated by 5HT. Further, perturbations in 5HT signaling have been associated with a number of neurodevelopmental and psychiatric disorders. However, the disease association studies have focused on a handful of serotonergic genes such as Sert, Tph2, and the 5HT1a autoreceptor. Given that genes and their protein products do not operate alone but rather in a
118 network, there are likely many undiscovered genes that contribute to aberrant
5HT signaling and circuitry. With the advent of our ePet-EYFP transgenic line
and the methodology to purify 5HT neurons, we now had the ability to investigate
the developmental gene expression programs of rostral and caudal 5HT neurons
using Affymetrix gene arrays.
A. Identification of developing 5HT neuron transcriptomes
Our microarray studies have lead to the identification of
approximately 8,000 genes, 850 RIKEN cDNAs, and 400 ESTs that are
consistently expressed in 5HT neurons at E12.5 (Dataset 2 available at
www.jneurosci.org as supplemental material). Importantly, we detected many
genes with known expression in 5HT neurons adding to the validity of our
microarray approach (Figure 2F and G, Chapter 2). We then classified these
genes according to important functional categories including: 1) DNA binding, 2)
axon pathfinding/cell adhesion, 3) ion channels, 4) solute carriers, 5) G-protein-
coupled receptors, and 6) kinases (supplemental tables S3-S7). This dataset is
easily searchable for other important functional categories providing a wealth of
knowledge to essentially any discipline in the field of 5HT neuron development.
B. Genes with enriched expression in 5HT neurons
We identified 250 genes with enriched expression in 5HT neurons that were previously unknown to be expressed in 5HT neurons (Cluster I). The verification and potential significance of several of these genes encoding
119 transcription factors and genes of unknown function have been described in
Chapter 2 (Figure 4, Chapter 2).
One gene of particular interest is the EST, AW55198 which showed 18.6 to a 7.1 enriched expression by gene array (Table 1, Chapter 2). Taqman RT-
PCR showed approximately and 11 fold enrichment in both rostral and caudal
5HT neurons (Figure 4B, Chapter 2). Double-label in situ hybridization for
AW551984 at E12.5 showed expression only in 5HT neurons, the hypothalamus, and the heart (Figure 4C, Chapter 2 and data not shown). AW551984 is predicted to be involved in integrin mediated signaling based on gene ontology.
Further, sequence analysis identifies two predicted protein domains in
AW551984: 1) a von Willebrand factor A (vWA) and 2) an interalpha trypsin inhibitor (ITI). vWA domains are often found in cell adhesion molecules, extracellular matrix proteins, and integrin receptors (Tuckwell, 1999). ITI domains are frequently found in proteins that bind and stabilize the extracellular matrix
(Bost et al, 1998). Thus, the enriched expression of AW551984 in rostral and caudal 5HT neurons together with the predicted protein domains suggests a novel regulator of cell adhesion in 5HT neurons.
C. Unique transcriptional profiles of rostral and caudal 5HT neurons
A major hypothesis driving the rationale for our gene array experiments was that rostral and caudal 5HT neurons must have underlying gene expression differences that in part explain their discrete anatomical locations and disparate axonal projection patterns. Indeed, we identified a total of 492 genes and 38
RIKEN cDNAs with several fold differential expression in rostral and caudal 5HT
120 neurons (Table 3 and 4, Supplemental Tables 8-11 available at www.jneurosci.org). A striking feature was the differential expression of many homeodomain transcription factors by rostral and caudal 5HT neurons.
1. Homeodomain transcription factors enriched in rostral
5HT neurons
Homeodomain containing proteins are often transcriptional regulators that are involved in development and cellular differentiation. The homedomain is a highly conserved 60 amino acid region which can bind to a region of DNA in other genes (McGinnis et al, 1984; Scott & Weiner, 1984). Homeodomain transcription factors are recognized for their role in establishing progenitor domains and neuronal identity in the ventral neural tube in response to graded
Shh signals (Briscoe et al, 2000). However to date, a homeodomain code that operates specifically in 5HT neurons has not been identified. Our gene array studies show that rostral 5HT neurons are characterized by the enriched expression of the homeodomain transcription factors Hmx2, Hmx3, En1, En2, and Pou3f1 (Figure 5, Chapter 2). Our immunostaining and in situ hybridization studies suggest that subpopulations exist within the rostral domain based on their differential expression of these homedomain transcription factors. It will be important to determine if these and other expressed homeodomain transcription factors constitute a homeodomain code that specifies the positioning, axonal connectivity, and function of subpopulations of rostral 5HT neurons.
121 2. Hox genes mark caudal 5HT neurons
Hox genes are well known for their roles in patterning the anterior- posterior body axis. In the hindbrain, they are well studied for their roles in the specification of rhombomere segment identity and cell fate (for reviews see
(McGinnis & Krumlauf, 1992; Narita & Rijli, 2009; Tumpel et al, 2009). However, the functions of Hox genes in postmitotic neurons are less understood. We detected the enriched expression of 14 Hox genes and their cofactors, Meis1 and
Meis2, in caudal but not rostral 5HT neurons (Figure 6 and Supplementary Table
S17, Chapter 2). Caudal 5HT neurons are organized into three bilateral B (B1-
B3) nuclei (or pools) with targeted axonal connectivity reminiscent of motor neuron pools (Tork, 1990). The B1 and B2 nuclei are situated near the midline whereas the B3 nuclei are located more laterally. The caudal 5HT system projects to the spinal cord and can be divided into three primary pathways: 1) a dorsal pathway that originates from B3 and terminates at all spinal cord levels; 2) an intermediate pathway that originates from B1 and B2 and terminates in the intermediate grey at thoracic and upper sacral levels; and 3) a ventral pathway also originating from B1 and B2 that terminates in the ventral horn at all spinal cord levels (Tanaka et al, 2006). The repertoire of Hox genes identified and verified as expressed by caudal 5HT neurons should facilitate future studies aimed at determining the role of Hox genes in the positioning and target connectivity of caudal 5HT neurons.
122 3. Imprinted gene expression in 5HT neurons
The phenomenon known as genomic imprinting was suggested in 1984
when it was shown that mouse embryos which were parthenogenetic (2 maternal
genome copies) or androgenetic (2 maternal genome copies) displayed early
embryonic lethality and never developed to term (Barton et al, 1984; McGrath &
Solter, 1984). These results contradicted Mendel’s theory that the gene expression was not influenced by parental origin. The first imprinted genes, paternally expressed Igf2 and maternally expressed Igf2r and H19 were identified in mouse in 1991 (Barlow et al, 1991; Bartolomei et al, 1991; DeChiara et al,
1991).
Genomic imprinting is an epigenetic process where diploid cells that contain two parental copies of all genes will express only one parental copy of an
imprinted gene and completely or partially silence the other parental copy. In
other words, imprinted genes will only be expressed from the allele inherited from
the mother or in other instances from the allele inherited from the father.
Imprinting occurs via a cis-acting mechanism that primarily involves methylation
of the DNA but can also entail histone modification (Reik & Walter, 2001). After
fertilization, the parental imprint marks are maintained in somatic tissues of the
embryo including the brain leading to parent-specific monoallelic gene expression. In the germline of the embryo, the imprint is erased and later a new set of imprints is established according to the sex of the developing embryo.
Known imprinted genes account for less than 1% of the mammalian
genome. Many of the genes that are subject to imprinting are expressed in the
123 placenta and the brain. Accordingly, genes that are imprinted often encode for
factors that regulate embryonic and neonatal growth while others influence
behavior and cognition (Isles & Wilkinson, 2000). In general, paternally
expressed imprinted genes function as embryonic growth promoters while
maternally expressed imprinted genes function as growth repressors. This
observation has led to the theory known as intragenomic conflict (Moore & Haig,
1991). According to this notion, the paternal genomic interest is to maximize
transfer of nutrients from mother to embryo in the current pregnancy, while it is in
the maternal interest to share resources equally across all of her offspring.
Experiments using chimeric parthenogenetic and androgenetic embryos
have demonstrated that imprinted genes can affect brain size and organization
(Allen et al, 1995; Keverne et al, 1996). When normal cells were added to
parthenogenetic (PG-N) and androgenetic (AG-N) embryos at an early stage of development in equal numbers, the results were surprising. PG-N embryos had larger brains especially the forebrain despite having an overall smaller body size.
AG-N embryos on the other hand had smaller brains and larger bodies. Next by coupling PG and AG cells to a lac-z reporter, it was possible to visualize the distribution of PG and AG cells in the brain. During early development, PG and
AG cells were distributed equally throughout the brain. Later, however PG cells were found enriched in the cortex and striatum and excluded from hypothalamic and preoptic areas. AG cells, on the other hand, were found to exist in the exact opposite pattern with enrichment in hypothalamic and preoptic areas and exclusion from the cortex and striatum. Adding to the complexity of genomic
124 imprinting is the fact that it can be both developmentally regulated and cell-type
specific (Albrecht et al, 1997; Rougeulle et al, 1997; Wang et al, 2004b). Our
gene array data allowed us to explore which imprinted genes are expressed in
5HT neurons. Future experiments will be needed to verify the presence of the
imprint, if it is developmentally regulated, and the potential impact on brain
development and behavior when the imprint is disrupted.
We cross referenced our gene array data to a list of 131 known imprinted
genes in mouse and human (http://www.har.mrc.ac.uk/). 43 imprinted genes were consistently expressed in 5HT neurons and 19 (10 of these were enriched
(supplemental Table 12; available at www.jneurosci.org as supplemental
material). The number of imprinted genes with enriched expression in Clusters I-
IV is as follows: R+C+(10); R+(1); R+R-(0); C+(6); C+C-(2). This suggests that
proper 5HT neuron development may be particularly dependent on genomic
imprinting. It is intriguing to consider that both 5HT and imprinted gene
expression are important for regulating behavior.
Our gene expression data showed a 7 to 15 fold enrichment (2 separate
probes) of paternally expressed delta-like 1 homolog (Dlk1) in caudal 5HT
neurons (C+). Taqman RT-PCR of sorted cells showed a near 12 fold enrichment
in caudal 5HT neurons (Figure 2). Dlk1 is imprinted in both mouse (chromosome
12) and human (chromosome 14). Targeted deletion of Dlk1 in mouse results in
partial neonatal lethality and survivors display growth retardation with skeletal
malformation and increased obesity (Moon et al, 2002). Dlk1 is one of the ligands
for Notch receptor signaling which has well established roles both in maintaining
125 neuronal progenitor availability and also cell type diversification. For review see
(Louvi & Artavanis-Tsakonas, 2006). More recently, it was shown that Dlk expression prevents premature differentiation of neural progenitors in the retina and pV2 domain of the spinal cord (Rocha et al, 2009). Taking into account that caudal 5HT neurons at E12.5 are not yet fully differentiated, enriched expression of Dlk1 in caudal 5HT neurons relative to rostral 5HT neurons may explain the delay of 5HT neuron maturation in the caudal domain. Another study has shown that targeted deletion of bHLH transcriptional components downstream of Notch signaling results in mice with thinner neural tubes (Fischer et al, 2004). Given that 5HT neurons have been reported to influence differentiation of other cell types in the developing nervous system, it is interesting to speculate that the transmembrane expression of Dlk1on caudal 5HT neurons may influence the differentiation of neighboring Notch expressing cells.
Maternally expressed 3 (Meg3) was enriched 4.7 fold by gene array and nearly 4 fold by Taqman RT-PCR in caudal 5HT neurons. Meg 3 (also known as
Gtl2) is in the same chromosomal region as Dlk1. A common feature of imprinted genes is that they tend to appear in clusters. Meg3 however is not protein coding and appears to function as an RNA molecule with multiple splice variants
(Schuster-Gossler et al, 1998). Most imprinted gene clusters are associated with a non-coding RNA (ncRNA) and are thought to play a role in repression of transcription of nearby genes in the cluster (O'Neill, 2005). Meg3 has been proposed to function in pattern specification, differentiation of cells, and
126 maintenance of terminally differentiated cell types in the inner ear (Manji et al,
2006).
Paternally expressed 3 (Peg3) was enriched 2.9 fold by gene array in both
rostral and caudal 5HT neurons. Taqman RT-PCR showed a 3 fold enrichment in rostral 5HT neurons and nearly a 6 fold enrichment of Peg3 in caudal 5HT neurons. Peg3 belongs to the Kruppel C2H2-type zinc finger protein family.
Disruptions of Peg3 result in maternal behavioral deficits such as postpartum licking and grooming (Champagne et al, 2009). Recent studies from our lab have demonstrated that brain 5HT can regulate maternal behavior and offspring survival (Lerch-Haner et al, 2008a). Therefore, Peg3 may also play a role in maternal behavior through serotonergic mechanisms.
Magel2 was enriched by 4.6 fold in caudal 5HT neurons by gene array and 9 fold by Taqman RT-PCR (Figure 2). Magel2 is in the imprinted chromosomal region 15q11-13 which when deleted from the paternal allele
results in Prader-Willi syndrome while deletion of the maternal allele results in
Angelmann syndrome (Horsthemke & Wagstaff, 2008). Inactivation of Magel2 in
mice results in a phenotype similar to Prader-Willi syndrome (Bischof et al,
2007). Several other imprinted genes in chromosome region 15q11-13 are also expressed in E12.5 5HT neurons as described in the Discussion of Chapter 2.
This is the first report showing that these imprinted genes are expressed in embryonic 5HT neurons.
In conclusion, this thesis work has generated novel tools, new methodology, and a wealth of information for the study of 5HT neuron biology.
127 Candidate genes derived from these gene array studies can be selectively and
temporally deleted in 5HT neurons using ePet-Cre transgenics developed in our
lab to determine function during development and in the maintenance of 5HT
circuitry (Lui, Manuscript in submission; Scott et al, 2005b). Our transcriptome databases define a large number of new markers to enable molecular classification of serotonin neuron subtypes. These databases also identify new candidate genes for investigation of disease relevance and as potential therapeutic targets.
128
129 Figure 1. Dissociated ePet-EYFP neurons grown in culture. ePet-EYFP neurons grown 1 day in culture exhibit elaborate and diverse morphologies. The ability to culture 5HT neurons that are genetically labeled with a fluorescent report will have numerous applications.
130
131 Figure 2. Verification of enriched imprinted gene expression in 5HT
neurons.
The enriched expression of the imprinted genes Dlk1, Magel2, Meg3, and Peg3 was detected by gene array and verified by Taqman RT-PCR on sorted cells.
132 Supplementary Table S1. Microarray detection of Tph2-like genes identified by the Allen Institute for Brain Science.
Affy ID Gene Symbol Gene Title Av R+C+ Av R+ Av C+ 1415849_s_at Stmn1 stathmin 1 36424 37839 35009 1430288_x_at Rps21 ribosomal protein S21 29275 31156 27394 1433721_x_at Rps21 ribosomal protein S21 28112 29611 26614 1434358_x_at Rps21 ribosomal protein S21 26745 27947 25542 1451989_a_at Mapre2 "microtubule-associated protein, RP/EB family, member 2" 17822 17874 17770 1450708_at Scg2 secretogranin II 17764 18990 16537 1426385_x_at Ywhae "tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, 16760 15649 17872 1438839_a_at Ywhae "tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, 16424 15487 17361 1447640_s_at Pbx3 pre B-cell leukemia transcription factor 3 15700 17507 13893 1435750_at Gchfr GTP cyclohydrolase I feedback regulator 15154 19533 10774 133 1428434_at Zcchc12 "zinc finger, CCHC domain containing 12" 14907 11773 18042 1448513_a_at Npc2 Niemann Pick type C2 14277 14652 13902 1426956_a_at Trp53bp1 transformation related protein 53 binding protein 1 14174 13534 14814 1422433_s_at Idh1 "isocitrate dehydrogenase 1 (NADP+), soluble" 13517 12886 14149 1423451_at Pgrmc1 progesterone receptor membrane component 1 13058 13301 12814 1433884_at Syt1 synaptotagmin I 12329 13342 11317 1417150_at Slc6a4 "solute carrier family 6 (neurotransmitter transporter, serotonin), member 4" 11640 13939 9341 1426384_a_at Ywhae "tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, 10938 10554 11323 1426215_at Ddc dopa decarboxylase 10760 15044 6475 1426930_at Brunol4 "bruno-like 4, RNA binding protein (Drosophila)" 9860 10782 8938 1425628_a_at Gtf2i general transcription factor II I 9689 9847 9531 1448886_at Gata3 GATA binding protein 3 9300 8462 10138 1455148_at Tmem130 transmembrane protein 130 8991 9807 8175 1422449_s_at Rcn2 reticulocalbin 2 8925 9406 8444 1435190_at Chl1 cell adhesion molecule with homology to L1CAM 8867 9592 8142 1433549_x_at Rps21 ribosomal protein S21 8793 11068 6518 1451162_at Hsbp1 heat shock factor binding protein 1 8510 10061 6958 1423537_at Gap43 growth associated protein 43 8097 9519 6674 1455416_at C130021I20Rik Riken cDNA C130021I20 gene 8081 8570 7592 1435083_at Ctxn1 cortexin 1 7638 8024 7253 1441930_x_at Vat1 Vesicle amine transport protein 1 homolog (T californica) 7622 7341 7903 1435486_at Pak3 p21 (CDKN1A)-activated kinase 3 7187 7295 7079 1416901_at Npc2 Niemann Pick type C2 7116 7984 6249 1428156_at Gng2 "guanine nucleotide binding protein (G protein), gamma 2" 6980 6509 7451 1452240_at Brunol4 "bruno-like 4, RNA binding protein (Drosophila)" 6925 6756 7095 1436640_x_at Agpat4 "1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid 6809 6522 7096 1426710_at Calm3 calmodulin 3 6781 8000 5562 1454978_at Ttyh3 tweety homolog 3 (Drosophila) 6329 4810 7847 1420295_x_at Clcn5 chloride channel 5 6302 6165 6440 1423906_at Hsbp1 heat shock factor binding protein 1 6158 6211 6105 1436153_a_at Zmynd11 "zinc finger, MYND domain containing 11" 5851 5441 6261 134 1415961_at Itm2c integral membrane protein 2C 5452 5617 5287 1454764_s_at Slc38a1 "solute carrier family 38, member 1" 5372 4618 6127 1437556_at Zfhx4 zinc finger homeodomain 4 5290 5251 5330 1419964_s_at Hdgf hepatoma-derived growth factor 5247 5441 5053 1448656_at Cacnb3 "calcium channel, voltage-dependent, beta 3 subunit" 5190 5652 4728 1437331_a_at Arf3 ADP-ribosylation factor 3 4970 4878 5062 1417217_at Magel2 "melanoma antigen, family L, 2" 4760 2321 7199 1418451_at Gng2 "guanine nucleotide binding protein (G protein), gamma 2" 4594 5044 4143 1419821_s_at Idh1 "isocitrate dehydrogenase 1 (NADP+), soluble" 4549 4718 4379 1460578_at Fgd5 "FYVE, RhoGEF and PH domain containing 5" 4385 4049 4722 1435702_s_at Ywhae "tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, 4359 4314 4404 1420859_at Pkia "protein kinase inhibitor, alpha" 4296 4254 4338 1417343_at Fxyd6 FXYD domain-containing ion transport regulator 6 4279 5077 3481 1437079_at Slc18a2 "solute carrier family 18 (vesicular monoamine), member 2" 4204 6307 2102 1431390_a_at Grinl1a "glutamate receptor, ionotropic, N-methyl D-aspartate-like 1A" 4160 4033 4287 1421193_a_at Pbx3 pre B-cell leukemia transcription factor 3 4046 4992 3100 1434028_at Arnt2 aryl hydrocarbon receptor nuclear translocator 2 4034 3515 4554 1426245_s_at Mapre2 "microtubule-associated protein, RP/EB family, member 2" 3911 3896 3926 1454630_at Samd14 sterile alpha motif domain containing 14 3866 4061 3671 1417441_at Dnajc12 "DnaJ (Hsp40) homolog, subfamily C, member 12" 3818 4246 3389 1420631_a_at Blcap bladder cancer associated protein homolog (human) 3808 4456 3160 1417056_at Psme1 "proteasome (prosome, macropain) 28 subunit, alpha" 3805 4560 3049 1415975_at Carhsp1 calcium regulated heat stable protein 1 3730 3742 3717 1448788_at Cd200 CD200 antigen 3703 3536 3870 1416181_at Mesdc2 mesoderm development candidate 2 3517 3367 3667 1426929_at Brunol4 "bruno-like 4, RNA binding protein (Drosophila)" 3451 3682 3221 1420499_at Gch1 GTP cyclohydrolase 1 3316 4250 2382 1454761_at BC005764 cDNA sequence BC005764 3314 3899 2729 1423418_at Fdps farnesyl diphosphate synthetase 3267 4894 1641 1421201_a_at Tro trophinin 3158 2427 3890 1432195_s_at Ccnl2 cyclin L2 3157 1993 4321 135 1433827_at Atp8a1 "ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1" 3040 2675 3405 1447864_s_at Pogk pogo transposable element with KRAB domain 3030 3016 3045 1437618_x_at Gpr85 G protein-coupled receptor 85 2820 3013 2628 1428336_at Agpat4 "1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid 2818 2632 3003 1454728_s_at Atp8a1 "ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1" 2815 2150 3480 1452142_at Slc6a1 "solute carrier family 6 (neurotransmitter transporter, GABA), member 1" 2786 2254 3318 1426957_at Trp53bp1 transformation related protein 53 binding protein 1 2746 2384 3108 1426531_at Zmynd11 "zinc finger, MYND domain containing 11" 2712 2459 2964 1436818_a_at Msi2 Musashi homolog 2 (Drosophila) 2596 2683 2508 1435609_at Trp53bp1 transformation related protein 53 binding protein 1 2564 2181 2947 1429692_s_at Gch1 GTP cyclohydrolase 1 2555 2748 2362 1424222_s_at Rad23b RAD23b homolog (S. cerevisiae) 2516 2675 2356 1422773_at Myt1 myelin transcription factor 1 2377 2438 2317 1424441_at Slc27a4 "solute carrier family 27 (fatty acid transporter), member 4" 2367 2332 2402 1448568_a_at Slc20a1 "solute carrier family 20, member 1" 2331 1836 2826 1421152_a_at Gnao1 "guanine nucleotide binding protein, alpha O" 2331 1801 2860 1421152_a_at Gnao1 "guanine nucleotide binding protein, alpha O" 2331 1801 2860 1423078_a_at Sc4mol sterol-C4-methyl oxidase-like 2306 2458 2154 1435885_s_at Itsn1 intersectin 1 (SH3 domain protein 1A) 2271 2223 2320 1423973_a_at Arf3 ADP-ribosylation factor 3 2232 2215 2249 1453634_a_at Erp29 endoplasmic reticulum protein 29 2197 2595 1800 1457589_at Fat3 FAT tumor suppressor homolog 3 (Drosophila) 2179 2612 1746 1433965_at Atp8a1 "ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1" 2098 1680 2516 1455048_at Igsf3 "immunoglobulin superfamily, member 3" 2090 2249 1930 1417923_at Pak3 p21 (CDKN1A)-activated kinase 3 2067 2328 1805 1417542_at Rps6ka2 "ribosomal protein S6 kinase, polypeptide 2" 2066 1990 2142 1417404_at Elovl6 "ELOVL family member 6, elongation of long chain fatty acids (yeast)" 2065 1718 2412 1416222_at Nsdhl NAD(P) dependent steroid dehydrogenase-like 2037 2208 1866 1433485_x_at Gpr56 G protein-coupled receptor 56 1986 1750 2223 1427674_a_at Sez6 seizure related gene 6 1972 2357 1587 1452981_at Cntn1 contactin 1 1964 2623 1305 136 1448928_at Hdac6 histone deacetylase 6 1912 2137 1687 1418784_at Grik5 "glutamate receptor, ionotropic, kainate 5 (gamma 2)" 1898 1917 1878 1450903_at Rad23b RAD23b homolog (S. cerevisiae) 1885 1668 2103 1441429_at Irs4 insulin receptor substrate 4 1838 326 3349 1428157_at Gng2 "guanine nucleotide binding protein (G protein), gamma 2" 1801 1752 1849 1455515_at 1810041L15Rik RIKEN cDNA 1810041L15 gene 1782 1996 1568 1439128_at Zbtb20 zinc finger and BTB domain containing 20 1780 2001 1559 1424897_at Gpr85 G protein-coupled receptor 85 1750 1911 1589 1416920_at Rbm4 RNA binding motif protein 4 1715 2001 1428 1421433_at Zfhx4 zinc finger homeodomain 4 1672 1716 1627 1454149_a_at Ccnl2 cyclin L2 1671 1046 2297 1416997_a_at Hap1 huntingtin-associated protein 1 1618 1782 1453 1416997_a_at Hap1 huntingtin-associated protein 1 1618 1782 1453 1424216_a_at Papola poly (A) polymerase alpha 1587 1579 1594 1438165_x_at Vat1 vesicle amine transport protein 1 homolog (T californica) 1575 1494 1656 1421118_a_at Gpr56 G protein-coupled receptor 56 1513 1246 1781 1454671_at Insig1 insulin induced gene 1 1510 1781 1239 1442039_at Tox thymocyte selection-associated high mobility group box 1505 1389 1621 1429938_at A930009E05Rik RIKEN cDNA A930009E05 gene 1501 1557 1445 1429400_at Clcn5 chloride channel 5 1445 1424 1465 1435720_at Kcnd3 "potassium voltage-gated channel, Shal-related family, member 3" 1433 1274 1591 1423726_at Vat1 vesicle amine transport protein 1 homolog (T californica) 1430 1383 1477 1437339_s_at Pcsk5 proprotein convertase subtilisin/kexin type 5 1428 2463 393 1426539_at Usp11 ubiquitin specific peptidase 11 1355 1464 1246 1437318_at Pak3 p21 (CDKN1A)-activated kinase 3 1336 1671 1000 1449563_at Cntn1 contactin 1 1319 1893 745 1420296_at Clcn5 Chloride channel 5 1288 1433 1143 1418128_at Adcy6 adenylate cyclase 6 1287 1087 1487 1415888_at Hdgf hepatoma-derived growth factor 1275 1537 1012 1424896_at Gpr85 G protein-coupled receptor 85 1262 1346 1178 1437598_at Zbtb20 zinc finger and BTB domain containing 20 1228 1326 1130 137 1417568_at Ncald neurocalcin delta 1222 1574 871 1415976_a_at Carhsp1 calcium regulated heat stable protein 1 1193 1615 771 1436849_x_at Gaa "glucosidase, alpha, acid" 1178 1090 1266 1436849_x_at Gaa "glucosidase, alpha, acid" 1178 1090 1266 1434354_at Maob monoamine oxidase B 1156 1234 1078 1416561_at Gad1 glutamic acid decarboxylase 1 1155 184 2125 1455517_at Rbm4 RNA binding motif protein 4 1127 1059 1194 1448711_at Mcm3ap minichromosome maintenance deficient 3 (S. cerevisiae) associated protein 1107 1051 1163 1449944_a_at Sec61a2 "Sec61, alpha subunit 2 (S. cerevisiae)" 1102 928 1275 1422208_a_at Gnb5 "guanine nucleotide binding protein (G protein), beta 5" 1097 1203 990 1429310_at Flrt3 fibronectin leucine rich transmembrane protein 3 1088 1698 479 1438441_at Id4 Inhibitor of DNA binding 4 1078 1585 571 1426016_a_at Tro trophinin 1051 1142 960 1439148_a_at Pfkl "phosphofructokinase, liver, B-type" 1051 1140 962 1455420_at Rad23b RAD23b homolog (S. cerevisiae) 1043 944 1142 1456197_x_at Ajap1 Adherens junction associated protein 1 999 995 1003 1435884_at Itsn1 intersectin 1 (SH3 domain protein 1A) 997 945 1049 1437086_at Ascl1 achaete-scute complex homolog 1 (Drosophila) 996 647 1345 1435157_at Hook3 hook homolog 3 (Drosophila) 976 693 1260 1438443_at Zbtb20 zinc finger and BTB domain containing 20 970 1176 764 1451008_at St8sia3 "ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3" 965 1086 844 1440029_at St8sia3 "ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3" 965 915 1015 1422858_at Trip4 thyroid hormone receptor interactor 4 957 872 1041 1417795_at Chl1 cell adhesion molecule with homology to L1CAM 953 1207 699 1434640_at Nrsn2 neurensin 2 929 829 1030 1452338_s_at Itsn1 intersectin 1 (SH3 domain protein 1A) 924 966 883 1415911_at Impact imprinted and ancient 923 632 1214 1459579_at Cacng8 "Calcium channel, voltage-dependent, gamma subunit 8" 912 877 947 1421970_a_at Gria2 "glutamate receptor, ionotropic, AMPA2 (alpha 2)" 906 662 1151 1433998_at 4933427D14Rik RIKEN cDNA 4933427D14 gene 897 596 1198 1451990_at Mapre2 "microtubule-associated protein, RP/EB family, member 2" 869 768 970 138 1419719_at Gabrb1 "gamma-aminobutyric acid (GABA-A) receptor, subunit beta 1" 859 1352 366 1427929_a_at Pdxk "pyridoxal (pyridoxine, vitamin B6) kinase" 854 861 848 1416199_at Kifc3 kinesin family member C3 852 680 1024 1455049_at Igsf3 "immunoglobulin superfamily, member 3" 849 995 703 1431569_a_at Lypd1 Ly6/Plaur domain containing 1 837 1368 305 1416098_at Syngr3 synaptogyrin 3 836 752 920 1434787_at Arf3 ADP-ribosylation factor 3 824 833 814 1433788_at Nrxn3 neurexin III 817 547 1086 1424137_at Gprin1 G protein-regulated inducer of neurite outgrowth 1 806 817 794 1419428_a_at Gaa "glucosidase, alpha, acid" 782 673 890 1419428_a_at Gaa "glucosidase, alpha, acid" 782 673 890 1425277_at Slit1 slit homolog 1 (Drosophila) 767 677 857 1422064_a_at Zbtb20 zinc finger and BTB domain containing 20 736 868 604 1457683_at Grik2 "glutamate receptor, ionotropic, kainate 2 (beta 2)" 731 641 821 1435050_at D10Bwg1379e "DNA segment, Chr 10, Brigham & Women's Genetics 1379 expressed" 731 606 855 1427509_at Baiap3 BAI1-associated protein 3 730 691 769 1435971_at Rims3 regulating synaptic membrane exocytosis 3 728 623 833 1454034_a_at Usp21 ubiquitin specific peptidase 21 725 747 702 1438710_at Htr1a 5-hydroxytryptamine (serotonin) receptor 1A 679 508 850 1449979_a_at Spock3 "sparc/osteonectin, cwcv and kazal-like domains proteoglycan 3" 674 864 484 1417954_at Sst somatostatin 665 730 601 1424308_at Slc24a3 "solute carrier family 24 (sodium/potassium/calcium exchanger), member 3" 646 518 773 1429514_at Ppap2b phosphatidic acid phosphatase type 2B 645 404 886 1450897_at Arhgap5 Rho GTPase activating protein 5 633 594 671 1436579_s_at Itsn1 intersectin 1 (SH3 domain protein 1A) 626 591 661 1435520_at Msi2 Musashi homolog 2 (Drosophila) 626 651 601 1438540_at Col25a1 "collagen, type XXV, alpha 1" 621 165 1077 1434146_at Gria2 "glutamate receptor, ionotropic, AMPA2 (alpha 2)" 620 424 815 1433855_at Abat 4-aminobutyrate aminotransferase 615 565 665 1423597_at Atp8a1 "ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1" 613 586 639 1417403_at Elovl6 "ELOVL family member 6, elongation of long chain fatty acids (yeast)" 601 613 588 139 1426244_at Mapre2 "microtubule-associated protein, RP/EB family, member 2" 586 549 622 1437065_at Zbtb20 zinc finger and BTB domain containing 20 585 600 570 1426739_at Donson downstream neighbor of SON 579 442 716 1441185_at Msi2 Musashi homolog 2 (Drosophila) 577 573 581 1415903_at Slc38a1 "solute carrier family 38, member 1" 557 631 483 1418908_at Pam peptidylglycine alpha-amidating monooxygenase 519 444 594 1434849_at Tspyl2 TSPY-like 2 505 469 541 1420644_a_at Sec61a2 "Sec61, alpha subunit 2 (S. cerevisiae)" 500 527 473 1427544_a_at Papola poly (A) polymerase alpha 500 432 568 1437091_at Accn4 "amiloride-sensitive cation channel 4, pituitary" 481 379 583 1455288_at 1110036O03Rik RIKEN cDNA 1110036O03 gene 476 515 437 1422756_at Slc32a1 "solute carrier family 32 (GABA vesicular transporter), member 1" 462 304 620 1455836_at Papola poly (A) polymerase alpha 452 555 349 1450269_a_at Pfkl "phosphofructokinase, liver, B-type" 446 495 397 1455995_at D10Bwg1379e "DNA segment, Chr 10, Brigham & Women's Genetics 1379 expressed" 442 364 520 1453018_at Nvl nuclear VCP-like 434 399 469 1437322_at Rbm4 RNA binding motif protein 4 422 461 383 1417569_at Ncald neurocalcin delta 419 537 301 1437066_at Zbtb20 zinc finger and BTB domain containing 20 418 604 233 1431322_at Igsf3 "immunoglobulin superfamily, member 3" 415 547 283 1438968_x_at Spint2 "serine protease inhibitor, Kunitz type 2" 396 438 354 1443471_at Zbtb20 zinc finger and BTB domain containing 20 392 393 391 1421230_a_at Msi2 Musashi homolog 2 (Drosophila) 385 367 403 1434470_at Syt13 synaptotagmin XIII 379 350 407 1419158_a_at Hars2 "histidyl-tRNA synthetase 2, mitochondrial (putative)" 361 347 375 1453098_at Gria2 "glutamate receptor, ionotropic, AMPA2 (alpha 2)" 344 324 363 1436888_at Nhlh2 nescient helix loop helix 2 340 370 310 1453060_at Rgs8 regulator of G-protein signaling 8 324 319 329 1457812_at Trp53bp1 transformation related protein 53 binding protein 1 320 256 384 1440681_at Chrna7 "cholinergic receptor, nicotinic, alpha polypeptide 7" 311 269 353 1453019_at Nvl nuclear VCP-like 297 245 349 140 1417216_at Pim2 proviral integration site 2 294 285 302 1455768_at Npc2 Niemann Pick type C2 289 306 273 1446737_a_at Hook3 hook homolog 3 (Drosophila) 286 246 326 1438916_x_at 6720401G13Rik RIKEN cDNA 6720401G13 gene 284 191 377 1449371_at Hars2 "histidyl-tRNA synthetase 2, mitochondrial (putative)" 275 241 309 1444248_at Rcn2 reticulocalbin 2 271 314 228 1442316_x_at Trp53bp1 transformation related protein 53 binding protein 1 270 209 331 1420858_at Pkia "protein kinase inhibitor, alpha" 267 318 216 1441536_at Hmgcs1 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 258 290 225 1421990_at Syt1 synaptotagmin I 256 316 196 1438915_at 6720401G13Rik RIKEN cDNA 6720401G13 gene 244 188 299 1457410_at Arhgap5 Rho GTPase activating protein 5 228 173 282 1449681_at Hdgf Hepatoma-derived growth factor 209 251 166 1423258_at Syt9 synaptotagmin IX 208 177 240 1443857_at Hook3 hook homolog 3 (Drosophila) 196 161 230 1450896_at Arhgap5 Rho GTPase activating protein 5 193 189 196 1426532_at Zmynd11 "zinc finger, MYND domain containing 11" 183 203 162 1442637_at Itsn1 Intersectin 1 (SH3 domain protein 1A) 175 170 180 1436444_at 6030405A18Rik RIKEN cDNA 6030405A18 gene 171 218 123 1417111_at Man1a "mannosidase 1, alpha" 170 200 140 1418599_at Col11a1 "collagen, type XI, alpha 1" 154 141 167 1456137_at Nrxn3 neurexin III 152 126 178 1459197_at Cntn1 contactin 1 141 139 142 141 Supplemental Table S2 Expressed Genes-DNA binding.
Affy ID Gene Symbol Gene Title Av R+C+ Av R+ Av C+ 1435873_a_at Rpl13a /// Zfp526 ribosomal protein L13a /// zinc finger protein 526 36253 39248 33258 1437853_x_at Ndn necdin 33098 31707 34489 1434127_a_at EG544973 /// "predicted gene, EG544973 /// predicted gene, 29563 31368 27757 1428572_at Basp1 /// "brain abundant, membrane attached signal protein 1 /// 28373 29721 27024 1415923_at Ndn necdin 24319 24236 24402 1422495_a_at Hmgn1 /// high mobility group nucleosomal binding domain 1 /// 24259 25005 23514 1455897_x_at Hmgn1 /// high mobility group nucleosomal binding domain 1 /// 24149 24137 24160 1429051_s_at Sox11 SRY-box containing gene 11 24015 25116 22913 1454971_x_at Tsc22d1 "TSC22 domain family, member 1" 22643 22313 22973
142 1438925_x_at Atp6v0c /// Atp6v0c- "ATPase, H+ transporting, lysosomal V0 subunit C /// 22535 23003 22066 1438940_x_at 100040836 /// "predicted gene, 100040836 /// predicted gene, 22125 21805 22444 1423263_at EG544973 /// "predicted gene, EG544973 /// predicted gene, 21532 23446 19617 1455855_x_at Hnrnpab heterogeneous nuclear ribonucleoprotein A/B 20622 20935 20310 1416415_a_at H2afz "H2A histone family, member Z" 19683 21841 17524 1455316_x_at ENSMUSG00000073 "predicted gene, ENSMUSG00000073624" 19575 19595 19555 1423262_a_at EG623365 /// "predicted gene, EG623365 /// predicted gene, 18867 19857 17877 1448430_a_at Naca nascent polypeptide-associated complex alpha 18856 19779 17932 1460547_a_at Hnrnpk heterogeneous nuclear ribonucleoprotein K 18695 18261 19128 1455725_a_at H3f3a /// H3f3b /// "H3 histone, family 3A /// H3 histone, family 3B /// 18338 20687 15989 1433575_at Sox4 SRY-box containing gene 4 16795 19028 14562 1425742_a_at Tsc22d1 "TSC22 domain family, member 1" 16311 15552 17070 1420811_a_at Ctnnb1 "catenin (cadherin associated protein), beta 1" 16110 16116 16103 1456308_x_at Trim28 tripartite motif-containing 28 15969 16290 15647 1424251_a_at Hnrpdl heterogeneous nuclear ribonucleoprotein D-like 15871 14947 16795 1448642_at Pcbp1 poly(rC) binding protein 1 15713 15857 15568 1447640_s_at Pbx3 pre B-cell leukemia transcription factor 3 15700 17507 13893 1448715_x_at 100043821 /// "predicted gene, 100043821 /// CCR4 carbon catabolite 15486 15250 15722 1415914_at Hnrnpab heterogeneous nuclear ribonucleoprotein A/B 14742 15179 14304 1418324_at Fem1b feminization 1 homolog b (C. elegans) 14434 13543 15324 1433852_at C330002I19Rik RIKEN cDNA C330002I19 gene 14309 13083 15536 1448103_s_at Nono "non-POU-domain-containing, octamer binding protein" 14272 14184 14359 1426956_a_at Trp53bp1 transformation related protein 53 binding protein 1 14174 13534 14814 1425886_at Fev FEV (ETS oncogene family) 13864 14597 13131 1416392_a_at Atp6v0c /// Atp6v0c- "ATPase, H+ transporting, lysosomal V0 subunit C /// 13830 14855 12805 1453002_at Sox11 SRY-box containing gene 11 13685 13995 13374 1420376_a_at H3f3a /// H3f3b /// "H3 histone, family 3A /// H3 histone, family 3B /// 13629 14539 12718 1445684_s_at Hdac2 histone deacetylase 2 13301 12741 13860
143 1425966_x_at Ubc ubiquitin C 13152 11103 15202 1416669_s_at Naca nascent polypeptide-associated complex alpha 12944 13367 12521 1449947_s_at Zfhx3 zinc finger homeobox 3 12934 12471 13398 1421743_a_at Pcbp2 poly(rC) binding protein 2 12927 12993 12861 1422693_a_at Sub1 SUB1 homolog (S. cerevisiae) 12663 12977 12349 1415839_a_at Npm1 nucleophosmin 1 12362 11416 13307 1420952_at Son Son DNA binding protein 12269 14222 10315 1433507_a_at ENSMUSG00000066 "predicted gene, ENSMUSG00000066826 /// predicted 12182 12131 12232 1427442_a_at App amyloid beta (A4) precursor protein 12000 11613 12386 1415820_x_at Nono "non-POU-domain-containing, octamer binding protein" 11978 12452 11503 1438091_a_at EG626950 /// H2afz "predicted gene, EG626950 /// H2A histone family, 11511 12934 10088 1451286_s_at Fus "fusion, derived from t(12;16) malignant liposarcoma 11357 10378 12337 1428296_at ENSMUSG00000074 "predicted gene, ENSMUSG00000074846 /// polymerase 11295 12628 9963 1449482_at Hist3h2ba "histone cluster 3, H2ba" 11053 14208 7898 1415702_a_at Ctbp1 /// C-terminal binding protein 1 /// similar to CtBP1 protein 11031 11631 10430 1433658_x_at Pcbp4 poly(rC) binding protein 4 10933 11751 10116 1416155_at Hmgb3 high mobility group box 3 10706 10598 10813 1452143_at Spnb2 spectrin beta 2 10526 9934 11118 1448176_a_at Hnrnpk heterogeneous nuclear ribonucleoprotein K 10340 10273 10407 1454758_a_at Tsc22d1 "TSC22 domain family, member 1" 10314 9860 10767 1459861_s_at Fbxl10 /// "F-box and leucine-rich repeat protein 10 /// predicted 10309 10630 9988 1425048_a_at ENSMUSG00000060 "predicted gene, ENSMUSG00000060128 /// high 10250 10360 10139 1438503_x_at Edf1 /// "endothelial differentiation-related factor 1 /// predicted 10235 11571 8899 1416082_at Rab1 "RAB1, member RAS oncogene family" 10159 10001 10317 1427917_s_at Ssbp3 single-stranded DNA binding protein 3 10065 10636 9493 1450638_at Pdcd5 programmed cell death 5 10056 10564 9548 1426853_at 671392 /// Set "predicted gene, 671392 /// SET translocation" 9833 9776 9890 1425628_a_at Gtf2i general transcription factor II I 9689 9847 9531
144 1452596_at Polr2k polymerase (RNA) II (DNA directed) polypeptide K 9653 10169 9136 1423042_at Ddx3x "DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3, X- 9522 8886 10158 1429372_at Sox11 SRY-box containing gene 11 9517 10379 8654 1418624_at LOC100045189 /// similar to transcription factor EF1(A) /// similar to 9366 9454 9278 1457632_s_at Meis2 Meis homeobox 2 9346 3120 15571 1438042_at Shox2 short stature homeobox 2 9342 478 18206 1448886_at Gata3 GATA binding protein 3 9300 8462 10138 1428029_a_at H2afv "H2A histone family, member V" 9240 12199 6281 1438625_s_at Pctk1 PCTAIRE-motif protein kinase 1 9108 8995 9220 1422676_at Smarce1 "SWI/SNF related, matrix associated, actin dependent 9097 8800 9395 1426804_at Smarca4 "SWI/SNF related, matrix associated, actin dependent 8935 9562 8307 1423684_at Hnrnpk heterogeneous nuclear ribonucleoprotein K 8840 8225 9456 1449643_s_at Btf3 basic transcription factor 3 8806 9846 7766 1437239_x_at Phc2 polyhomeotic-like 2 (Drosophila) 8802 9275 8328 1435865_at Hist3h2a /// Trim17 "histone cluster 3, H2a /// tripartite motif-containing 17" 8626 10188 7065 1448476_at Nap1l4 nucleosome assembly protein 1-like 4 8416 8010 8822 1448234_at Dnajb6 "DnaJ (Hsp40) homolog, subfamily B, member 6" 8333 8455 8210 1451770_s_at Dhx9 DEAH (Asp-Glu-Ala-His) box polypeptide 9 8285 9044 7526 1419653_a_at Ddx5 DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 8277 7173 9381 1415869_a_at Trim28 tripartite motif-containing 28 8255 8560 7949 1420649_at Zfhx3 zinc finger homeobox 3 8184 7222 9146 1424029_at Tspyl4 TSPY-like 4 8176 7848 8505 1451254_at Ikbkap "inhibitor of kappa light polypeptide enhancer in B-cells, 8110 7334 8885 1441948_x_at Zfand3 "zinc finger, AN1-type domain 3" 7992 8494 7489 1438250_s_at OTTMUSG00000006 "predicted gene, OTTMUSG00000006515 /// TAF9 RNA 7972 8618 7326 1416244_a_at Cnbp cellular nucleic acid binding protein 7930 7497 8364 1454675_at Thra thyroid hormone receptor alpha 7873 7665 8081 1416908_s_at Tsn translin 7839 7448 8229
145 1416083_at LOC100047896 /// "similar to zinc finger protein ZNF216 /// zinc finger, AN1- 7776 7697 7855 1419839_x_at Prpf19 PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. 7409 7930 6889 1427965_at Ssbp1 single-stranded DNA binding protein 1 7400 7642 7157 1415751_at Hp1bp3 "heterochromatin protein 1, binding protein 3" 7257 7056 7458 1450333_a_at Gata2 GATA binding protein 2 7191 6251 8130 1426762_s_at Aof2 /// amine oxidase (flavin containing) domain 2 /// similar to 7030 6481 7579 1454641_at Cggbp1 CGG triplet repeat binding protein 1 6999 7341 6657 1455591_at Zfp618 zinc fingerprotein 618 6793 6629 6957 1424572_a_at H2afy "H2A histone family, member Y" 6788 8239 5338 1449635_at Prpf19 PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. 6775 7262 6287 1435324_x_at ENSMUSG00000060 "predicted gene, ENSMUSG00000060128 /// high- 6750 8544 4955 1437223_s_at Xbp1 X-box binding protein 1 6742 7282 6201 1454670_at Rere arginine glutamic acid dipeptide (RE) repeats 6683 5394 7972 1438320_s_at Mcm7 minichromosome maintenance deficient 7 (S. cerevisiae) 6632 6171 7093 1428433_at Hipk2 homeodomain interacting protein kinase 2 6561 6946 6177 1448709_at Arid1a AT rich interactive domain 1A (SWI-like) 6550 6608 6493 1423795_at Sfpq splicing factor proline/glutamine rich (polypyrimidine 6512 6655 6370 1423645_a_at Ddx5 DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 6465 6079 6850 1443779_s_at Lcor ligand dependent nuclear receptor corepressor 6447 5923 6971 1460669_at Ilf3 interleukin enhancer binding factor 3 6413 6000 6826 1453125_at Sox11 SRY-box containing gene 11 6389 8380 4399 1428494_a_at LOC100048301 /// similar to RNA Polymerase II subunit 14.5 kD /// 6353 7357 5348 1425142_a_at Hnrnpd heterogeneous nuclear ribonucleoprotein D 6214 5505 6923 1422697_s_at Jarid2 "jumonji, AT rich interactive domain 2" 6178 6488 5867 1448515_at Tsn translin 6106 6692 5519 1435866_s_at Hist3h2a "histone cluster 3, H2a" 5990 7351 4630 1434704_at Mll5 myeloid/lymphoid or mixed-lineage leukemia 5 5970 5791 6149 1422032_a_at Zfand6 "zinc finger, AN1-type domain 6" 5969 6094 5845
146 1448505_at C1d nuclear DNA binding protein 5922 6397 5446 1439438_a_at 1110005A23Rik /// "RIKEN cDNA 1110005A23 gene /// predicted gene, 5921 6472 5371 1449117_at Jund Jun proto-oncogene related gene d 5906 6963 4849 1421082_s_at Banf1 barrier to autointegration factor 1 5887 6801 4972 1436153_a_at Zmynd11 "zinc finger, MYND domain containing 11" 5851 5441 6261 1453849_s_at Hnrnpab heterogeneous nuclear ribonucleoprotein A/B 5763 6609 4917 1448784_at Taf10 "TAF10 RNA polymerase II, TATA box binding protein 5739 6331 5147 1424802_a_at 3300001P08Rik RIKEN cDNA 3300001P08 gene 5691 4382 6999 1422778_at Taf9 "TAF9 RNA polymerase II, TATA box binding protein (TBP)- 5682 6034 5330 1432416_a_at Npm1 nucleophosmin 1 5584 5679 5488 1451285_at Fus "fusion, derived from t(12;16) malignant liposarcoma 5526 6674 4378 1447320_x_at OTTMUSG00000008 "predicted gene, OTTMUSG00000008305 /// RNA 5417 5653 5180 1420650_at Zfhx3 zinc finger homeobox 3 5375 5340 5409 1438092_x_at H2afz "H2A histone family, member Z" 5349 5686 5011 1437556_at Zfhx4 zinc finger homeodomain 4 5290 5251 5330 1416438_at Puf60 poly-U binding splicing factor 60 5281 4930 5631 1416095_x_at 1110005A23Rik /// "RIKEN cDNA 1110005A23 gene /// predicted gene, 5189 5754 4624 1417720_at Polr2j polymerase (RNA) II (DNA directed) polypeptide J 5186 5999 4373 1456037_x_at Preb prolactin regulatory element binding 5163 4455 5872 1426877_a_at Pbrm1 polybromo 1 5157 5095 5218 1433537_at Atrx alpha thalassemia/mental retardation syndrome X-linked 5145 4230 6059 1428906_at Gtf2h5 "general transcription factor IIH, polypeptide 5" 5061 5626 4496 1423043_s_at Ddx3x "DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3, X- 4999 5314 4683 1448868_at Scand1 SCAN domain-containing 1 4933 6947 2918 1428260_at Spg3a spastic paraplegia 3A homolog (human) 4933 5055 4810 1455222_a_at Ubp1 upstream binding protein 1 4890 3654 6125 1423702_at H1f0 "H1 histone family, member 0" 4850 5381 4319 1420886_a_at Xbp1 X-box binding protein 1 4820 5747 3893
147 1423839_a_at Btf3 basic transcription factor 3 4809 4999 4620 1422698_s_at Jarid2 "jumonji, AT rich interactive domain 2" 4803 5228 4377 1428382_at Smarcc2 "SWI/SNF related, matrix associated, actin dependent 4750 5087 4412 1449815_a_at Ssbp2 single-stranded DNA binding protein 2 4665 5111 4220 1437454_a_at EG433144 /// "predicted gene, EG433144 /// similar to thioredoxin- 4662 4116 5209 1434875_a_at Hmgn3 high mobility group nucleosomal binding domain 3 4580 4830 4330 1416731_at Top2b topoisomerase (DNA) II beta 4578 4024 5131 1452207_at Cited2 "Cbp/p300-interacting transactivator, with Glu/Asp-rich 4569 4961 4177 1440151_s_at Edf1 endothelial differentiation-related factor 1 4556 5305 3807 1448135_at Atf4 activating transcription factor 4 4491 4261 4721 1456229_at Hoxb3 homeo box B3 4485 148 8822 1454776_at Ehmt1 euchromatic histone methyltransferase 1 4439 4256 4622 1427396_a_at Csde1 "cold shock domain containing E1, RNA binding" 4429 5140 3718 1437670_x_at Cd151 CD151 antigen 4413 4365 4461 1448287_at Rpo1-3 RNA polymerase 1-3 4396 4830 3961 1424970_at Purg purine-rich element binding protein G 4365 4536 4195 1452198_at Fbxl10 F-box and leucine-rich repeat protein 10 4337 4134 4540 1427670_a_at Tcf12 transcription factor 12 4331 3910 4753 1417242_at Eif4a3 "eukaryotic translation initiation factor 4A, isoform 3" 4320 4590 4049 1455246_at Smarcc1 "SWI/SNF related, matrix associated, actin dependent 4292 4093 4490 1425231_a_at Zfp46 zinc finger protein 46 4280 4648 3913 1435197_at Pou3f3 "POU domain, class 3, transcription factor 3" 4259 4402 4116 1428647_at LOC676870 /// Pbx1 region containing RIKEN cDNA 2310056B04 gene; pre B- 4238 5385 3090 1422487_at LOC100048076 /// similar to MAD homolog 4 (Drosophila) /// MAD 4223 4670 3775 1451244_a_at Zfp422 zinc finger protein 422 4167 4210 4123 1426788_a_at Ssrp1 structure specific recognition protein 1 4162 3860 4464 1449439_at Klf7 Kruppel-like factor 7 (ubiquitous) 4145 3993 4297 1416176_at Hmgb1 /// "high mobility group box 1 /// predicted gene, 4111 4043 4178
148 1417947_at Pcna proliferating cell nuclear antigen 4093 4712 3473 1448960_at Cxxc5 CXXC finger 5 4067 4568 3566 1415771_at Ncl nucleolin 4060 3731 4389 1454851_at Nr2c2 "nuclear receptor subfamily 2, group C, member 2" 4059 3808 4309 1421193_a_at Pbx3 pre B-cell leukemia transcription factor 3 4046 4992 3100 1418157_at LOC100046044 /// "similar to COUP-TFI /// nuclear receptor subfamily 2, 4034 3090 4978 1438930_s_at Mecp2 methyl CpG binding protein 2 4017 3791 4243 1426583_at Atf2 /// activating transcription factor 2 /// similar to Cyclic AMP- 4015 3763 4267 1433676_at Wnk1 WNK lysine deficient protein kinase 1 3955 3288 4622 1442465_s_at Strbp spermatid perinuclear RNA binding protein 3930 3681 4179 1454774_at Zfp445 zinc finger protein 445 3918 3205 4630 1423997_at Csde1 "cold shock domain containing E1, RNA binding" 3872 3841 3903 1422418_s_at 100041294 /// "predicted gene, 100041294 /// suppressor of Ty 4 3840 4625 3056 1435800_a_at Csda cold shock domain protein A 3840 3568 4112 1456698_s_at Hnrpdl heterogeneous nuclear ribonucleoprotein D-like 3836 3614 4058 1448208_at Smad1 MAD homolog 1 (Drosophila) 3835 3874 3795 1424632_a_at Rev3l "REV3-like, catalytic subunit of DNA polymerase zeta 3833 2888 4777 1423723_s_at Tardbp TAR DNA binding protein 3807 3372 4242 1454896_at Rbpj recombination signal binding protein for immunoglobulin 3798 3699 3896 1426878_at Pbrm1 polybromo 1 3778 3995 3561 1422692_at Sub1 SUB1 homolog (S. cerevisiae) 3767 3162 4372 1435368_a_at Parp1 "poly (ADP-ribose) polymerase family, member 1" 3754 3594 3915 1428466_at Chd3 chromodomain helicase DNA binding protein 3 3752 3591 3912 1415975_at Carhsp1 calcium regulated heat stable protein 1 3730 3742 3717 1417129_a_at Meis2 Meis homeobox 2 3723 978 6468 1460429_at Cdc5l cell division cycle 5-like (S. pombe) 3700 3506 3894 1422801_at G3bp1 Ras-GTPase-activating protein SH3-domain binding 3687 3532 3841 1447349_s_at Ep400 E1A binding protein p400 3656 3149 4162
149 1423773_at Gpbp1 GC-rich promoter binding protein 1 3653 3063 4242 1419633_at Uncx UNC homeobox 3652 4603 2701 1416907_at Tsn translin 3645 3165 4126 1426363_x_at H2afy2 "H2A histone family, member Y2" 3638 3609 3666 1456699_s_at Ythdc1 YTH domain containing 1 3635 3078 4193 1422569_at Yy1 YY1 transcription factor 3600 3376 3824 1438376_s_at Trim27 tripartite motif-containing 27 3590 3720 3460 1434063_at Zfp664 zinc finger protein 664 3586 3661 3512 1449080_at Hdac2 histone deacetylase 2 3575 3334 3817 1420093_s_at Hnrpdl heterogeneous nuclear ribonucleoprotein D-like 3573 3347 3799 1423474_at Top1 topoisomerase (DNA) I 3559 3366 3752 1426789_s_at Ssrp1 structure specific recognition protein 1 3541 3142 3941 1424170_at Phf5a PHD finger protein 5A 3537 4005 3069 1423100_at Fos FBJ osteosarcoma oncogene 3521 2845 4198 1449039_a_at Hnrpdl heterogeneous nuclear ribonucleoprotein D-like 3520 3334 3707 1415754_at Polr2f polymerase (RNA) II (DNA directed) polypeptide F 3516 4768 2264 1437309_a_at Rpa1 replication protein A1 3505 3415 3596 1436600_at Tox3 TOX high mobility group box family member 3 3472 2836 4109 1434148_at Tcf4 transcription factor 4 3468 3523 3412 1433528_at Gtf2a2 "general transcription factor II A, 2" 3443 3854 3033 1456731_x_at Polr3k Polymerase (RNA) III (DNA directed) polypeptide K 3411 3566 3255 1440831_at Bach1 BTB and CNC homology 1 3409 3180 3638 1419155_a_at Sox4 SRY-box containing gene 4 3391 4659 2124 1460545_at Thrap3 thyroid hormone receptor associated protein 3 3359 3127 3591 1417536_at Zmat2 "zinc finger, matrin type 2" 3349 3418 3279 1439266_a_at Polr3k polymerase (RNA) III (DNA directed) polypeptide K 3317 3756 2878 1434434_s_at Tcerg1 transcription elongation regulator 1 (CA150) 3240 2816 3665 1434179_at Mll3 myeloid/lymphoid or mixed-lineage leukemia 3 3237 2893 3581
150 1428416_at 3110050N22Rik RIKEN cDNA 3110050N22 gene 3232 3119 3345 1419406_a_at Bcl11a B-cell CLL/lymphoma 11A (zinc finger protein) 3228 3098 3359 1450711_at Brd4 bromodomain containing 4 3136 2808 3464 1439460_a_at Arfgap2 ADP-ribosylation factor GTPase activating protein 2 3119 3294 2944 1428219_at Rybp RING1 and YY1 binding protein 3102 3098 3107 1437622_x_at Mrpl28 mitochondrial ribosomal protein L28 3088 3478 2698 1419650_at Zfr zinc finger RNA binding protein 3086 2802 3371 1434320_at Gtf3c4 "general transcription factor IIIC, polypeptide 4" 3081 2683 3479 1417400_at Rai14 retinoic acid induced 14 3079 2109 4048 1455260_at Lcorl ligand dependent nuclear receptor corepressor-like 3074 3197 2951 1426525_at 1700124K17Rik /// "RIKEN cDNA 1700124K17 gene /// AT rich interactive 3068 2700 3435 1423200_at Ncor1 nuclear receptor co-repressor 1 3065 2874 3255 1428418_s_at 3110050N22Rik RIKEN cDNA 3110050N22 gene 3064 3514 2614 1439463_x_at 100042515 /// "predicted gene, 100042515 /// predicted gene, 3063 3520 2605 1416048_at Phc2 polyhomeotic-like 2 (Drosophila) 3049 3467 2632 1422486_a_at LOC100048076 /// similar to MAD homolog 4 (Drosophila) /// MAD 3032 3547 2517 1447864_s_at Pogk pogo transposable element with KRAB domain 3030 3016 3045 1436931_at Rfx4 "regulatory factor X, 4 (influences HLA class II 3030 1999 4061 1460006_at Zfhx3 zinc finger homeobox 3 3030 2612 3448 1425455_a_at Churc1 churchill domain containing 1 3012 3137 2886 1437297_at Chd8 chromodomain helicase DNA binding protein 8 2999 3230 2767 1436315_at Myst3 MYST histone acetyltransferase (monocytic leukemia) 3 2994 2733 3255 1420326_s_at Cramp1l "Crm, cramped-like (Drosophila)" 2964 2810 3118 1423416_at Smarcc1 "SWI/SNF related, matrix associated, actin dependent 2950 3523 2378 1424252_at Hnrpdl heterogeneous nuclear ribonucleoprotein D-like 2940 2162 3718 1421083_x_at Banf1 barrier to autointegration factor 1 2935 3560 2309 1416544_at Ezh2 enhancer of zeste homolog 2 (Drosophila) 2934 2675 3192 1417065_at Egr1 early growth response 1 2931 2381 3480
151 1417948_s_at Ilf2 interleukin enhancer binding factor 2 2927 3007 2847 1448516_at Tsn translin 2925 3285 2564 1456375_x_at Trim27 tripartite motif-containing 27 2922 2866 2979 1460324_at Dnmt3a DNA methyltransferase 3A 2917 2714 3119 1422946_a_at Dnmt1 DNA methyltransferase (cytosine-5) 1 2915 2545 3285 1451984_at Hnrnpul1 heterogeneous nuclear ribonucleoprotein U-like 1 2874 2906 2842 1456022_at Hipk2 homeodomain interacting protein kinase 2 2816 3305 2326 1452116_s_at Atf2 /// activating transcription factor 2 /// similar to Cyclic AMP- 2810 2498 3122 1454990_at 1700124K17Rik /// "RIKEN cDNA 1700124K17 gene /// AT rich interactive 2807 2665 2949 1435122_x_at Dnmt1 DNA methyltransferase (cytosine-5) 1 2802 2724 2880 1448210_at Rab1 "RAB1, member RAS oncogene family" 2800 2437 3163 1452061_s_at Strbp spermatid perinuclear RNA binding protein 2798 2278 3317 1435669_at Zfp532 zinc finger protein 532 2796 2696 2895 1421081_a_at Banf1 barrier to autointegration factor 1 2791 3334 2248 1434022_at Zbtb33 zinc finger and BTB domain containing 33 2783 2884 2682 1416723_at Tcf4 transcription factor 4 2770 2831 2709 1435362_at Foxj3 forkhead box J3 2746 2323 3170 1426957_at Trp53bp1 transformation related protein 53 binding protein 1 2746 2384 3108 1421612_a_at H2afy2 /// H2afy3 "H2A histone family, member Y2 /// H2A histone family, 2744 2710 2777 1460038_at LOC100045707 /// "similar to long overlapping ORF; NH2 terminus uncertain 2741 4011 1471 1460403_at Psip1 PC4 and SFRS1 interacting protein 1 2736 2571 2901 1448266_at Edf1 endothelial differentiation-related factor 1 2733 3731 1735 1426531_at Zmynd11 "zinc finger, MYND domain containing 11" 2712 2459 2964 1436790_a_at Sox11 SRY-box containing gene 11 2672 2875 2469 1454793_x_at Ddx5 DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 2660 2514 2805 1423739_x_at Aplp2 amyloid beta (A4) precursor-like protein 2 2656 2738 2573 1426860_at Ep400 E1A binding protein p400 2654 2291 3018 1428231_at Cpsf6 cleavage and polyadenylation specific factor 6 2652 2215 3090
152 1455712_at Hist3h2a "histone cluster 3, H2a" 2647 2718 2575 1434757_at Cbfa2t2 "core-binding factor, runt domain, alpha subunit 2, 2644 2525 2764 1459843_s_at Smad1 MAD homolog 1 (Drosophila) 2618 2715 2521 1419979_s_at Creb3 cAMP responsive element binding protein 3 2615 2541 2689 1418926_at Zeb1 zinc finger E-box binding homeobox 1 2614 2249 2979 1436762_x_at Elp3 Elongation protein 3 homolog (S. cerevisiae) 2598 2532 2663 1448144_at Hnrnpab heterogeneous nuclear ribonucleoprotein A/B 2586 2824 2347 1423212_at Phc1 polyhomeotic-like 1 (Drosophila) 2571 2404 2739 1435609_at Trp53bp1 transformation related protein 53 binding protein 1 2564 2181 2947 1417269_at Cdk9 cyclin-dependent kinase 9 (CDC2-related kinase) 2555 2393 2717 1454927_at Zfp41 zinc finger protein 41 2551 2604 2497 1440817_x_at LOC100047782 /// similar to crooked legs CG14938-PB /// zinc finger 2549 2630 2469 1421887_a_at Aplp2 amyloid beta (A4) precursor-like protein 2 2541 2502 2581 1422610_s_at Igf2bp3 insulin-like growth factor 2 mRNA binding protein 3 2540 2033 3046 1419354_at Klf7 Kruppel-like factor 7 (ubiquitous) 2536 2898 2174 1433899_x_at Tsc22d1 "TSC22 domain family, member 1" 2526 2708 2344 1449055_x_at Pcbp4 poly(rC) binding protein 4 2521 2833 2208 1433482_a_at Fubp1 far upstream element (FUSE) binding protein 1 2520 2337 2704 1449732_at Zscan21 zinc finger and SCAN domain containing 21 2520 2592 2448 1452616_s_at Ssbp1 single-stranded DNA binding protein 1 2517 2656 2378 1457072_at Bcl11a B-cell CLL/lymphoma 11A (zinc finger protein) 2504 2581 2426 1452659_at Dek DEK oncogene (DNA binding) 2502 2179 2824 1416746_at H2afx "H2A histone family, member X" 2493 2507 2479 1436050_x_at Hes6 hairy and enhancer of split 6 (Drosophila) 2491 2610 2372 1455651_at Terf2 telomeric repeat binding factor 2 2482 2581 2384 1428779_at Zbtb41 zinc finger and BTB domain containing 41 homolog 2476 2371 2581 1456032_x_at EG666634 /// H2afz "predicted gene, EG666634 /// H2A histone family, 2467 2676 2257 1455121_at Lcor ligand dependent nuclear receptor corepressor 2462 2387 2538
153 1418367_x_at Hist1h2ab /// "histone cluster 1, H2ab /// histone cluster 1, H2ac /// 2446 3389 1502 1448963_at Nfyc nuclear transcription factor-Y gamma 2441 2380 2501 1454689_at Srrm1 serine/arginine repetitive matrix 1 2438 2507 2369 1417026_at Pfdn1 prefoldin 1 2437 2834 2040 1428760_at Snapc3 "small nuclear RNA activating complex, polypeptide 3" 2433 2450 2416 1418330_at Ctcf CCCTC-binding factor 2418 2108 2727 1424771_at H2afj "H2A histone family, member J" 2408 2934 1882 1421112_at Nkx2-2 "NK2 transcription factor related, locus 2 (Drosophila)" 2398 2592 2203 1424206_at Smarca5 "SWI/SNF related, matrix associated, actin dependent 2383 2258 2507 1427142_s_at Jarid1b "jumonji, AT rich interactive domain 1B (Rbp2 like)" 2383 2520 2245 1426954_at Trim33 tripartite motif-containing 33 2379 2188 2570 1422773_at Myt1 myelin transcription factor 1 2377 2438 2317 1416085_s_at LOC100047896 /// "similar to zinc finger protein ZNF216 /// zinc finger, AN1- 2375 2638 2113 1423431_a_at Mybbp1a MYB binding protein (P160) 1a 2371 2363 2380 1437351_at Cxxc4 CXXC finger 4 2366 2130 2602 1447500_at Cux2 cut-like homeobox 2 2365 2219 2510 1435224_at Crebbp CREB binding protein 2363 2137 2589 1456042_s_at Cramp1l "Crm, cramped-like (Drosophila)" 2346 2157 2535 1428755_at Creb1 cAMP responsive element binding protein 1 2339 2251 2427 1416967_at Sox2 SRY-box containing gene 2 2336 2328 2344 1426982_at Flywch1 FLYWCH-type zinc finger 1 2334 2360 2308 1449054_a_at Pcbp4 poly(rC) binding protein 4 2330 2748 1913 1435824_at Yy1 YY1 transcription factor 2330 2141 2520 1423796_at Sfpq splicing factor proline/glutamine rich (polypyrimidine 2313 2249 2377 1428063_at Ankrd46 ankyrin repeat domain 46 2298 2362 2234 1436475_at Nr2f2 "nuclear receptor subfamily 2, group F, member 2" 2293 3101 1484 1416722_at Hmg20a high mobility group 20A 2290 1978 2601 1450008_a_at Ctnnb1 "catenin (cadherin associated protein), beta 1" 2286 2393 2178
154 1420142_s_at Pa2g4 proliferation-associated 2G4 2279 2034 2524 1426298_at Irx2 /// Iroquois related homeobox 2 (Drosophila) /// similar to 2270 2911 1629 1421819_a_at 671392 /// Set "predicted gene, 671392 /// SET translocation" 2265 2771 1759 1433453_a_at Abtb2 ankyrin repeat and BTB (POZ) domain containing 2 2244 1650 2838 1419181_at Zfp326 zinc finger protein 326 2243 1920 2566 1451209_at Lass5 "LAG1 homolog, ceramide synthase 5" 2224 2080 2368 1419954_s_at Zfand3 "zinc finger, AN1-type domain 3" 2219 2397 2041 1428845_at Bclaf1 BCL2-associated transcription factor 1 2215 1903 2527 1417657_s_at Dnajc2 "DnaJ (Hsp40) homolog, subfamily C, member 2" 2212 1650 2774 1420626_at Gtf3c6 "general transcription factor IIIC, polypeptide 6, alpha" 2204 2373 2036 1447447_s_at Srrm1 serine/arginine repetitive matrix 1 2198 1886 2510 1455943_at Zfp451 zinc finger protein 451 2192 1878 2506 1418801_at Zkscan1 zinc finger with KRAB and SCAN domains 1 2189 1985 2393 1426924_at Rc3h2 ring finger and CCCH-type zinc finger domains 2 2173 2050 2296 1434268_at Adar "adenosine deaminase, RNA-specific" 2173 1972 2374 1429615_at Zfp91 zinc finger protein 91 2167 1841 2493 1416341_at Polr2c polymerase (RNA) II (DNA directed) polypeptide C 2165 2457 1874 1436813_x_at Khsrp KH-type splicing regulatory protein 2148 2116 2179 1420095_s_at Zscan21 zinc finger and SCAN domain containing 21 2146 2160 2132 1460292_a_at Smarca1 "SWI/SNF related, matrix associated, actin dependent 2112 1997 2227 1416990_at Rxrb retinoid X receptor beta 2107 2112 2102 1438992_x_at Atf4 activating transcription factor 4 2101 1854 2349 1427120_at Zfp26 zinc finger protein 26 2093 1951 2235 1455633_at Zfp647 zinc finger protein 647 2092 2124 2059 1435778_at Ankrd11 ankyrin repeat domain 11 2087 1803 2371 1418516_at Mtf2 metal response element binding transcription factor 2 2063 2193 1933 1418515_at Mtf2 metal response element binding transcription factor 2 2053 1798 2307 1417166_at Psip1 PC4 and SFRS1 interacting protein 1 2049 1808 2289
155 1451435_at Cux1 cut-like homeobox 1 2041 1990 2091 1418893_at Pbx2 pre B-cell leukemia transcription factor 2 2036 2297 1776 1433669_at Akap8 A kinase (PRKA) anchor protein 8 2036 1594 2477 1444157_a_at Jarid1c "jumonji, AT rich interactive domain 1C (Rbp2 like)" 2024 2000 2048 1435372_a_at Pa2g4 proliferation-associated 2G4 2018 2129 1907 1416065_a_at Ankrd10 ankyrin repeat domain 10 2017 1695 2339 1435240_at Baz2b "bromodomain adjacent to zinc finger domain, 2B" 2006 1575 2436 1421910_at Tcf20 transcription factor 20 1975 2067 1883 1415908_at Tspyl1 "testis-specific protein, Y-encoded-like 1" 1974 2039 1909 1452276_at Smarcad1 "SWI/SNF-related, matrix-associated actin-dependent 1970 1647 2292 1455228_at Whsc1 Wolf-Hirschhorn syndrome candidate 1 (human) 1970 1665 2274 1451046_at LOC100047651 /// "similar to FOG /// zinc finger protein, multitype 1" 1968 2213 1724 1425350_a_at Myef2 "myelin basic protein expression factor 2, repressor" 1968 1956 1980 1452981_at Cntn1 contactin 1 1964 2623 1305 1428616_at LOC100040573 /// similar to putative transcription factor ZNF131 /// zinc 1960 1861 2058 1416370_at Zscan21 zinc finger and SCAN domain containing 21 1956 1951 1960 1426643_at Elp3 elongation protein 3 homolog (S. cerevisiae) 1956 1843 2068 1434066_at Gtf3c1 general transcription factor III C 1 1951 1758 2144 1423063_at Dnmt3a DNA methyltransferase 3A 1941 1837 2045 1453247_at Zfp618 zinc fingerprotein 618 1939 1841 2037 1452130_at EG433144 /// "predicted gene, EG433144 /// similar to thioredoxin- 1939 2045 1832 1450992_a_at Meis1 Meis homeobox 1 1938 774 3102 1434521_at Rfx7 "regulatory factor X, 7" 1932 1814 2049 1416253_at 100043858 /// "predicted gene, 100043858 /// cyclin-dependent kinase 1928 2243 1612 1428564_at Zfp579 zinc finger protein 579 1926 1934 1919 1422517_a_at Znrd1 "zinc ribbon domain containing, 1" 1926 2238 1614 1445710_x_at Duxbl double homeobox B-like 1918 1726 2110 1426846_at Cenpt centromere protein T 1913 1801 2024
156 1448884_at Gtf2e2 "general transcription factor II E, polypeptide 2 (beta 1911 2128 1693 1431830_at Zfp329 zinc finger protein 329 1908 1835 1982 1418589_a_at Mlf1 myeloid leukemia factor 1 1904 491 3317 1448707_at Taf13 "TAF13 RNA polymerase II, TATA box binding protein 1896 1816 1976 1436911_at Ss18l1 synovial sarcoma translocation gene on chromosome 18- 1895 2046 1743 1424741_s_at Creb3 cAMP responsive element binding protein 3 1890 2095 1685 1452844_at Pou6f1 "POU domain, class 6, transcription factor 1" 1883 1563 2203 1433946_at Zik1 zinc finger protein interacting with K protein 1 1881 1883 1879 1419258_at Tcea1 transcription elongation factor A (SII) 1 1873 2017 1729 1452153_at Fbxo18 F-box protein 18 1865 1808 1923 1436883_at Mbtps2 "membrane-bound transcription factor peptidase, site 2" 1860 1668 2052 1436495_s_at Zfp260 zinc finger protein 260 1852 1848 1855 1434777_at Mycl1 "v-myc myelocytomatosis viral oncogene homolog 1, 1849 1727 1972 1448376_at Wrnip1 Werner helicase interacting protein 1 1848 1641 2054 1424053_a_at Tcf25 transcription factor 25 (basic helix-loop-helix) 1846 2215 1478 1451081_a_at Tcf25 transcription factor 25 (basic helix-loop-helix) 1842 1939 1745 1417850_at Rb1 retinoblastoma 1 1831 1737 1925 1451151_s_at Zfp410 zinc finger protein 410 1825 1499 2151 1455129_at Mtdh Metadherin 1818 2158 1478 1438459_x_at Sfpq splicing factor proline/glutamine rich (polypyrimidine 1815 1602 2027 1418284_at Vps72 vacuolar protein sorting 72 (yeast) 1807 2348 1267 1422636_at Dmtf1 cyclin D binding myb-like transcription factor 1 1805 1488 2123 1440152_x_at Edf1 /// "endothelial differentiation-related factor 1 /// predicted 1800 2034 1565 1436513_at Tanc2 "tetratricopeptide repeat, ankyrin repeat and coiled-coil 1796 1468 2124 1423395_at LOC100039215 /// similar to translin associated protein X /// translin- 1793 1764 1822 1428417_at 3110050N22Rik RIKEN cDNA 3110050N22 gene 1793 2055 1530 1426208_x_at Plagl1 pleiomorphic adenoma gene-like 1 1791 1347 2234 1448199_at Ankrd10 ankyrin repeat domain 10 1790 1555 2026
157 1434079_s_at Mcm2 minichromosome maintenance deficient 2 mitotin (S. 1784 1879 1689 1415703_at Huwe1 "HECT, UBA and WWE domain containing 1" 1782 1619 1945 1426761_at Aof2 /// amine oxidase (flavin containing) domain 2 /// similar to 1781 1784 1777 1439128_at Zbtb20 zinc finger and BTB domain containing 20 1780 2001 1559 1427266_at Pbrm1 polybromo 1 1776 1695 1857 1419490_at AW049604 expressed sequence AW049604 1775 2061 1489 1417791_a_at Zfml "zinc finger, matrin-like" 1775 1367 2182 1434389_at Sos1 Son of sevenless homolog 1 (Drosophila) 1770 1578 1963 1418388_s_at Mphosph8 M-phase phosphoprotein 8 1769 1402 2136 1455562_at Sox12 SRY-box containing gene 12 1763 1751 1774 1421175_at Myt1l myelin transcription factor 1-like 1751 1917 1584 1415689_s_at Zkscan3 zinc finger with KRAB and SCAN domains 3 1748 1621 1875 1433738_at Papd5 PAP associated domain containing 5 1747 1666 1828 1440999_at Zfp697 zinc finger protein 697 1743 1539 1946 1435233_at Ncoa2 nuclear receptor coactivator 2 1741 1532 1951 1452085_at Gatad1 GATA zinc finger domain containing 1 1740 1803 1677 1427233_at Tshz1 teashirt zinc finger family member 1 1739 1060 2417 1433939_at Aff3 "AF4/FMR2 family, member 3" 1730 1253 2206 1426895_at Zfp191 zinc finger protein 191 1728 1689 1767 1428124_at Gtf2e1 "general transcription factor II E, polypeptide 1 (alpha 1726 1471 1981 1436515_at Bach2 BTB and CNC homology 2 1718 1452 1983 1452856_at Crebzf CREB/ATF bZIP transcription factor 1714 1399 2028 1432750_at Zfp711 zinc finger protein 711 1706 1403 2008 1416284_at Mrpl28 mitochondrial ribosomal protein L28 1701 2205 1196 1421147_at Terf2 telomeric repeat binding factor 2 1694 1914 1474 1456405_at Dido1 death inducer-obliterator 1 1687 1616 1758 1434009_at Grlf1 glucocorticoid receptor DNA binding factor 1 1681 1583 1778 1417666_at Dnttip1 "deoxynucleotidyltransferase, terminal, interacting 1680 1626 1734
158 1426889_at Zfp821 zinc finger protein 821 1680 1566 1794 1418192_at Mnt max binding protein 1679 1504 1855 1421433_at Zfhx4 zinc finger homeodomain 4 1672 1716 1627 1423202_a_at Ncor1 nuclear receptor co-repressor 1 1662 1587 1737 1454999_at Phf21b PHD finger protein 21B 1662 1684 1640 1429251_at Prdm2 "PR domain containing 2, with ZNF domain" 1638 1483 1792 1416008_at Satb1 special AT-rich sequence binding protein 1 1633 1633 1633 1452036_a_at Tmpo thymopoietin 1633 1637 1628 1451509_at Taf9 "TAF9 RNA polymerase II, TATA box binding protein (TBP)- 1632 1726 1537 1438729_at Sox1 SRY-box containing gene 1 1629 2133 1124 1453097_a_at Ubtf "upstream binding transcription factor, RNA polymerase 1622 1640 1605 1435078_at Tanc2 "tetratricopeptide repeat, ankyrin repeat and coiled-coil 1622 1284 1960 1455046_a_at Pogz pogo transposable element with ZNF domain 1622 1580 1664 1437423_a_at Sra1 steroid receptor RNA activator 1 1620 1833 1406 1451120_at OTTMUSG00000008 "predicted gene, OTTMUSG00000008305 /// RNA 1616 1907 1325 1417138_s_at Polr2e polymerase (RNA) II (DNA directed) polypeptide E 1615 2061 1168 1448708_at Med1 mediator complex subunit 1 1614 1331 1897 1437850_a_at Cnbp cellular nucleic acid binding protein 1604 1581 1626 1448705_at Zbtb22 zinc finger and BTB domain containing 22 1601 1612 1589 1447861_x_at Meis2 Meis homeobox 2 1600 444 2755 1452901_at Creb1 cAMP responsive element binding protein 1 1600 1669 1530 1416331_a_at Nfe2l1 "nuclear factor, erythroid derived 2,-like 1" 1587 1758 1416 1424949_at Huwe1 "HECT, UBA and WWE domain containing 1" 1581 1371 1792 1437447_s_at Ercc1 "excision repair cross-complementing rodent repair 1581 1509 1653 1425617_at Dhx9 DEAH (Asp-Glu-Ala-His) box polypeptide 9 1580 1860 1300 1452193_a_at Wasl Wiskott-Aldrich syndrome-like (human) 1573 1536 1610 1419165_at Zfp260 zinc finger protein 260 1569 1406 1733 1435900_at Zbtb43 zinc finger and BTB domain containing 43 1565 1438 1691
159 1436802_at Ilf3 interleukin enhancer binding factor 3 1564 1501 1628 1448860_at Rem2 rad and gem related GTP binding protein 2 1562 1392 1733 1424205_at Smarca5 "SWI/SNF related, matrix associated, actin dependent 1561 1470 1651 1453848_s_at Zbed3 "zinc finger, BED domain containing 3" 1556 1573 1540 1457568_at Hnrnpd heterogeneous nuclear ribonucleoprotein D 1552 1344 1760 1423477_at LOC100044533 /// similar to Zic protein /// zinc finger protein of the 1544 793 2295 1429633_at Lcor ligand dependent nuclear receptor corepressor 1538 1706 1370 1448893_at Ncor2 nuclear receptor co-repressor 2 1538 1173 1903 1420772_a_at Tsc22d3 "TSC22 domain family, member 3" 1528 1662 1394 1431415_a_at Tbpl1 TATA box binding protein-like 1 1528 1646 1409 1427167_at Armcx4 "armadillo repeat containing, X-linked 4" 1524 1356 1692 1437163_x_at Gtf2h4 "general transcription factor II H, polypeptide 4" 1515 1686 1344 1420441_at Cenpc1 centromere protein C1 1513 1257 1768 1436483_at Myt1l myelin transcription factor 1-like 1512 1554 1469 1437353_at Setd1b SET domain containing 1B 1512 1336 1687 1427185_at Mef2a myocyte enhancer factor 2A 1509 1187 1831 1442039_at Tox thymocyte selection-associated high mobility group box 1505 1389 1621 1438420_at Rbm39 RNA binding motif protein 39 1501 1674 1327 1450376_at Mxi1 Max interacting protein 1 1494 1360 1628 1415746_at Cic capicua homolog (Drosophila) 1490 1490 1490 1426437_s_at Hdac3 histone deacetylase 3 1489 1588 1390 1422094_a_at Zfp329 zinc finger protein 329 1488 1181 1795 1428232_at Cpsf6 cleavage and polyadenylation specific factor 6 1483 1315 1651 1427384_at Chd6 chromodomain helicase DNA binding protein 6 1482 1249 1714 1449648_s_at Rpo1-1 RNA polymerase 1-1 1481 1452 1511 1423241_a_at Tfdp1 transcription factor Dp 1 1475 1400 1550 1452274_at Zfand3 "zinc finger, AN1-type domain 3" 1449 1574 1324 1433811_at Mllt6 "myeloid/lymphoid or mixed-lineage leukemia (trithorax 1444 1555 1332
160 1434005_at Rbms1 "RNA binding motif, single stranded interacting protein 1444 977 1911 1416184_s_at Hmga1 /// Hmga1- "high mobility group AT-hook 1 /// high mobility group 1434 1291 1577 1452648_at Tbrg1 transforming growth factor beta regulated gene 1 1429 1513 1346 1435768_at Arid4b AT rich interactive domain 4B (RBP1-like) 1429 1214 1644 1448101_s_at Trim27 tripartite motif-containing 27 1423 1308 1538 1428890_at Fem1c fem-1 homolog c (C.elegans) 1421 1236 1607 1437217_at Ankrd6 ankyrin repeat domain 6 1421 1552 1289 1460303_at Nr3c1 "nuclear receptor subfamily 3, group C, member 1" 1420 678 2163 1423534_at Pdcd2 programmed cell death 2 1414 1526 1303 1460398_at Phf8 PHD finger protein 8 1408 1391 1424 1416428_at Thap11 THAP domain containing 11 1406 1404 1408 1434633_at Crebbp CREB binding protein 1397 1296 1498 1433508_at Klf6 Kruppel-like factor 6 1394 856 1931 1456626_a_at 1110005A23Rik /// "RIKEN cDNA 1110005A23 gene /// predicted gene, 1389 1582 1196 1419207_at Zfp37 zinc finger protein 37 1386 1266 1507 1420882_a_at Acd /// Nsd1 adrenocortical dysplasia /// nuclear receptor-binding SET- 1386 1373 1399 1436025_at Ccdc88a coiled coil domain containing 88A 1380 1228 1533 1455189_at Trim33 tripartite motif-containing 33 1370 1179 1561 1448026_at Chd7 chromodomain helicase DNA binding protein 7 1370 1136 1603 1424540_at Hipk1 homeodomain interacting protein kinase 1 1365 1159 1570 1422675_at Smarce1 "SWI/SNF related, matrix associated, actin dependent 1363 1389 1336 1450953_at Ciao1 cytosolic iron-sulfur protein assembly 1 homolog (S. 1361 1426 1296 1427236_a_at Mll5 myeloid/lymphoid or mixed-lineage leukemia 5 1361 1501 1220 1434283_at LOC100044968 similar to modulator recognition factor 2 1348 1069 1627 1444158_at Jarid1c "jumonji, AT rich interactive domain 1C (Rbp2 like)" 1346 1393 1299 1416988_at Msh2 mutS homolog 2 (E. coli) 1335 1392 1278 1455273_at ENSMUSG00000066 "predicted gene, ENSMUSG00000066798 /// zinc finger 1331 1390 1271 1422502_at Parp1 "poly (ADP-ribose) polymerase family, member 1" 1327 1651 1004
161 1460367_at Hbp1 high mobility group box transcription factor 1 1326 1361 1291 1420982_at Rbm39 RNA binding motif protein 39 1323 1386 1261 1428233_at Cpsf6 cleavage and polyadenylation specific factor 6 1323 1232 1415 1434128_a_at Zfp574 zinc finger protein 574 1323 1307 1339 1438192_s_at Baz2a "bromodomain adjacent to zinc finger domain, 2A" 1320 1116 1524 1434765_at Ep300 E1A binding protein p300 1320 1089 1551 1449563_at Cntn1 contactin 1 1319 1893 745 1428816_a_at Gata2 GATA binding protein 2 1317 1270 1363 1435000_at Gspt1 G1 to S phase transition 1 1316 1243 1389 1422503_s_at Parp1 "poly (ADP-ribose) polymerase family, member 1" 1314 1614 1014 1436537_at Zfp629 zinc finger protein 629 1313 1424 1203 1426827_at Ythdc1 YTH domain containing 1 1306 1032 1580 1451742_a_at Ugp2 UDP-glucose pyrophosphorylase 2 1306 1192 1420 1455394_at Pias4 protein inhibitor of activated STAT 4 1303 1702 905 1428725_at Pias2 protein inhibitor of activated STAT 2 1303 1194 1411 1434830_at Mxd1 MAX dimerization protein 1 1302 1296 1309 1454852_at Sp1 trans-acting transcription factor 1 1302 1133 1470 1420397_a_at Spen "SPEN homolog, transcriptional regulator (Drosophila)" 1298 1419 1177 1451558_at Fbxw7 "F-box and WD-40 domain protein 7, archipelago 1296 1014 1577 1452916_at Wbp7 WW domain binding protein 7 1290 1224 1355 1417010_at Zfp238 zinc finger protein 238 1288 1244 1332 1456712_at Lcorl ligand dependent nuclear receptor corepressor-like 1287 1347 1227 1417949_at Ilf2 interleukin enhancer binding factor 2 1286 1417 1155 1428669_at Bmyc brain expressed myelocytomatosis oncogene 1286 1501 1070 1416159_at Nr2f2 "nuclear receptor subfamily 2, group F, member 2" 1285 1933 637 1416638_at Sall2 sal-like 2 (Drosophila) 1283 1286 1279 1418044_at A630042L21Rik RIKEN cDNA A630042L21 gene 1280 1224 1336 1438705_at Cbfa2t3 "core-binding factor, runt domain, alpha subunit 2, 1280 1095 1464
162 1460246_at Mecp2 methyl CpG binding protein 2 1274 1227 1321 1417302_at Rcor2 REST corepressor 2 1271 1212 1331 1420011_s_at Xbp1 X-box binding protein 1 1271 1416 1127 1424863_a_at Hipk2 homeodomain interacting protein kinase 2 1267 1330 1204 1448446_at Deaf1 deformed epidermal autoregulatory factor 1 (Drosophila) 1266 1194 1337 1448224_at Tfam "transcription factor A, mitochondrial" 1265 1253 1278 1434753_at Nfrkb nuclear factor related to kappa B binding protein 1261 1218 1305 1434907_at Tbpl1 TATA box binding protein-like 1 1258 1304 1213 1437216_at Ccdc88a coiled coil domain containing 88A 1258 1040 1475 1448921_a_at Mrps9 mitochondrial ribosomal protein S9 1255 1216 1294 1422752_at Polr3k polymerase (RNA) III (DNA directed) polypeptide K 1253 1188 1319 1426776_at Wasl Wiskott-Aldrich syndrome-like (human) 1252 1047 1457 1454890_at Amot angiomotin 1252 1087 1416 1427143_at Jarid1b "jumonji, AT rich interactive domain 1B (Rbp2 like)" 1251 1575 927 1460560_at Bahcc1 BAH domain and coiled-coil containing 1 1250 1325 1175 1452540_a_at Hist1h2bb /// "histone cluster 1, H2bb /// histone cluster 1, H2bc /// 1249 1517 982 1435337_at Tshz3 teashirt zinc finger family member 3 1249 710 1787 1426297_at Tcfe2a transcription factor E2a 1244 1194 1294 1454944_at Hic2 hypermethylated in cancer 2 1240 1100 1380 1425484_at LOC100044677 /// similar to thymus high mobility group box protein TOX /// 1240 1237 1243 1418593_at Taf6 "TAF6 RNA polymerase II, TATA box binding protein (TBP)- 1239 1216 1262 1450307_x_at H2afy3 "H2A histone family, member Y3" 1239 1104 1373 1451332_at Zfp521 zinc finger protein 521 1235 1147 1323 1436036_at Whsc1 Wolf-Hirschhorn syndrome candidate 1 (human) 1233 1109 1358 1457651_x_at Rem2 rad and gem related GTP binding protein 2 1233 1166 1300 1434486_x_at Ugp2 UDP-glucose pyrophosphorylase 2 1231 1169 1293 1433703_s_at Bahd1 bromo adjacent homology domain containing 1 1228 1123 1334 1437598_at Zbtb20 zinc finger and BTB domain containing 20 1228 1326 1130
163 1433737_at LOC677213 /// similar to U2AF homology motif (UHM) kinase 1 /// U2AF 1228 974 1481 1423507_a_at Sirt2 "sirtuin 2 (silent mating type information regulation 2, 1226 1238 1214 1424238_at Sirt7 "sirtuin 7 (silent mating type information regulation 2, 1226 1198 1254 1418861_at Pias4 protein inhibitor of activated STAT 4 1225 1536 914 1421867_at Nr3c1 "nuclear receptor subfamily 3, group C, member 1" 1224 529 1919 1424642_at Thoc1 THO complex 1 1224 1108 1340 1417041_at Rpo1-1 RNA polymerase 1-1 1224 1434 1013 1430526_a_at Smarca2 "SWI/SNF related, matrix associated, actin dependent 1220 1242 1198 1434840_at Hrb HIV-1 Rev binding protein 1216 1050 1383 1451983_at Irx1 Iroquois related homeobox 1 (Drosophila) 1214 1729 698 1448835_at E2f6 E2F transcription factor 6 1203 980 1427 1419355_at Klf7 Kruppel-like factor 7 (ubiquitous) 1198 1354 1042 1415976_a_at Carhsp1 calcium regulated heat stable protein 1 1193 1615 771 1417968_a_at Mbd1 methyl-CpG binding domain protein 1 1193 1062 1323 1426727_s_at 100039405 /// "predicted gene, 100039405 /// similar to protein 1190 1176 1204 1455638_at Zfp319 zinc finger protein 319 1189 1066 1313 1426805_at Smarca4 "SWI/SNF related, matrix associated, actin dependent 1187 1636 738 1439269_x_at Mcm7 minichromosome maintenance deficient 7 (S. cerevisiae) 1182 1177 1186 1454920_at Uhrf2 "ubiquitin-like, containing PHD and RING finger domains 1181 1038 1325 1434035_at Dnajb6 /// "DnaJ (Hsp40) homolog, subfamily B, member 6 /// 1177 1134 1219 1426961_at Phf20 PHD finger protein 20 1172 1101 1243 1426998_at Zfand3 "zinc finger, AN1-type domain 3" 1169 1391 947 1455092_at Zfp207 zinc finger protein 207 1167 805 1529 1422505_at Chrac1 chromatin accessibility complex 1 1165 1291 1038 1427232_at Tshz1 teashirt zinc finger family member 1 1164 953 1375 1452069_a_at Thap7 THAP domain containing 7 1164 1124 1203 1425262_at Cebpg "CCAAT/enhancer binding protein (C/EBP), gamma" 1162 1045 1278 1423955_a_at Lass2 "LAG1 homolog, ceramide synthase 2" 1160 1250 1069
164 1428239_at Ankrd16 ankyrin repeat domain 16 1157 790 1524 1417526_at Pcbp3 poly(rC) binding protein 3 1157 1083 1230 1434487_at Mef2d myocyte enhancer factor 2D 1155 950 1360 1423545_a_at Zfp207 zinc finger protein 207 1150 1285 1015 1438458_a_at Sfpq splicing factor proline/glutamine rich (polypyrimidine 1149 1033 1265 1417503_at Rfc2 replication factor C (activator 1) 2 1146 1294 999 1430187_at Zfp60 zinc finger protein 60 1143 1129 1156 1416018_at Dr1 down-regulator of transcription 1 1141 1207 1075 1422753_a_at Polr3k polymerase (RNA) III (DNA directed) polypeptide K 1140 1310 970 1427258_at Trim24 tripartite motif-containing 24 1140 1006 1274 1418241_at Usf2 upstream transcription factor 2 1136 1148 1125 1452259_at Phf20 PHD finger protein 20 1133 1331 935 1437377_a_at Polrmt polymerase (RNA) mitochondrial (DNA directed) 1132 1066 1197 1456415_at Zfp451 zinc finger protein 451 1132 1087 1176 1436122_at Zfp667 zinc finger protein 667 1131 544 1717 1426923_at Hrb HIV-1 Rev binding protein 1131 1028 1233 1452208_at Prdm4 PR domain containing 4 1130 914 1347 1447877_x_at Dnmt1 DNA methyltransferase (cytosine-5) 1 1130 1059 1201 1457672_at Chd9 chromodomain helicase DNA binding protein 9 1127 933 1320 1427027_a_at Gtf3a general transcription factor III A 1125 1397 853 1434088_at Zkscan17 zinc finger with KRAB and SCAN domains 17 1123 1132 1113 1426890_a_at Rpap1 RNA polymerase II associated protein 1 1118 1077 1158 1435248_a_at Btaf1 "BTAF1 RNA polymerase II, B-TFIID transcription factor- 1113 944 1282 1431777_a_at Hmgn3 high mobility group nucleosomal binding domain 3 1109 1123 1095 1434002_at Foxn3 forkhead box N3 1105 944 1267 1423992_at Gatad2a GATA zinc finger domain containing 2A 1102 1169 1036 1426483_at Prkrir "protein-kinase, interferon-inducible double stranded 1101 1017 1185 1455655_a_at Tardbp TAR DNA binding protein 1100 1114 1085
165 1435862_at Son Son DNA binding protein 1098 1043 1152 1424641_a_at Thoc1 THO complex 1 1097 935 1260 1416641_at Lig1 "ligase I, DNA, ATP-dependent" 1096 1134 1058 1450938_at Pnn pinin 1094 820 1368 1417295_at Mta1 metastasis associated 1 1093 1099 1088 1429124_s_at Rexo1 "REX1, RNA exonuclease 1 homolog (S. cerevisiae)" 1093 1054 1133 1444615_x_at Runx1t1 "runt-related transcription factor 1; translocated to, 1 1092 843 1341 1456632_at Bcl11a B-cell CLL/lymphoma 11A (zinc finger protein) 1090 1348 831 1417037_at Orc6l "origin recognition complex, subunit 6-like (S. 1089 1142 1037 1418366_at Hist1h2ab /// "histone cluster 1, H2ab /// histone cluster 1, H2ac /// 1089 1486 692 1418500_at Nap1l3 nucleosome assembly protein 1-like 3 1088 1042 1133 1418255_s_at Srf serum response factor 1078 1059 1096 1433640_at Fubp1 far upstream element (FUSE) binding protein 1 1074 826 1322 1427283_at Mll1 myeloid/lymphoid or mixed-lineage leukemia 1 1073 1082 1064 1448584_at Rsrc1 arginine/serine-rich coiled-coil 1 1071 568 1575 1455060_at G3bp1 Ras-GTPase-activating protein SH3-domain binding 1071 967 1175 1418127_a_at Aifm1 "apoptosis-inducing factor, mitochondrion-associated 1" 1070 922 1218 1418007_at 1810007M14Rik RIKEN cDNA 1810007M14 gene 1070 819 1320 1455850_at 2310003H01Rik RIKEN cDNA 2310003H01 gene 1066 1193 940 1422581_at Pias1 protein inhibitor of activated STAT 1 1064 1046 1082 1431469_a_at Cxxc5 CXXC finger 5 1063 1290 836 1427090_at Zbed4 "zinc finger, BED domain containing 4" 1062 957 1168 1443260_at Meis1 Meis homeobox 1 1057 529 1586 1429942_at Gmeb1 glucocorticoid modulatory element binding protein 1 1057 932 1182 1457342_at Ikzf4 IKAROS family zinc finger 4 1056 993 1119 1418496_at Foxa1 /// forkhead box A1 /// similar to Hepatocyte nuclear factor 1054 1247 861 1417698_at Gtf2f1 "general transcription factor IIF, polypeptide 1" 1053 1003 1103 1428224_at Hnrpdl heterogeneous nuclear ribonucleoprotein D-like 1051 967 1135
166 1456477_at Ccnt1 cyclin T1 1050 1068 1031 1426690_a_at Srebf1 sterol regulatory element binding transcription factor 1 1048 869 1226 1428342_at Rcor3 REST corepressor 3 1047 859 1235 1460402_at Brpf1 "bromodomain and PHD finger containing, 1" 1042 1080 1003 1436081_a_at Zfp414 zinc finger protein 414 1041 1065 1016 1455300_at Tet2 tet oncogene family member 2 1037 798 1277 1426953_at Hmgb2l1 high mobility group box 2-like 1 1034 914 1154 1451182_s_at Ankrd54 ankyrin repeat domain 54 1034 1078 989 1429951_at Ssbp2 single-stranded DNA binding protein 2 1032 1077 987 1434178_at Mll3 myeloid/lymphoid or mixed-lineage leukemia 3 1032 1070 993 1455521_at Klf12 Kruppel-like factor 12 1030 908 1153 1454732_at Mtap1s microtubule-associated protein 1S 1029 1083 975 1423201_at Ncor1 nuclear receptor co-repressor 1 1027 1279 775 1419787_a_at Zfp628 zinc finger protein 628 1025 1201 850 1449148_a_at Phtf1 putative homeodomain transcription factor 1 1024 905 1143 1429193_at Ankib1 ankyrin repeat and IBR domain containing 1 1021 906 1135 1435434_at Braf Braf transforming gene 1019 727 1311 1449646_s_at Tigd5 tigger transposable element derived 5 1019 1131 907 1420865_at Zfp161 zinc finger protein 161 1019 994 1044 1434043_a_at Repin1 replication initiator 1 1017 989 1044 1437313_x_at Hmgb2 high mobility group box 2 1014 1003 1025 1428646_at LOC676870 /// Pbx1 region containing RIKEN cDNA 2310056B04 gene; pre B- 1014 1487 540 1420621_a_at App amyloid beta (A4) precursor protein 1009 1117 900 1416031_s_at Mcm7 minichromosome maintenance deficient 7 (S. cerevisiae) 1002 930 1075 1450983_at Akap8 A kinase (PRKA) anchor protein 8 998 771 1224 1437086_at Ascl1 achaete-scute complex homolog 1 (Drosophila) 996 647 1345 1448672_a_at Arfgap2 ADP-ribosylation factor GTPase activating protein 2 995 1139 851 1434336_s_at Rcor1 REST corepressor 1 994 765 1222
167 1449072_a_at N6amt2 N-6 adenine-specific DNA methyltransferase 2 (putative) 990 1170 810 1450522_a_at H1f0 "H1 histone family, member 0" 990 1224 756 1434355_at Zfp617 zinc finger protein 617 987 1067 908 1422742_at Hivep1 human immunodeficiency virus type I enhancer binding 986 852 1120 1455397_at Caskin1 CASK interacting protein 1 985 1001 969 1417985_at Nrarp Notch-regulated ankyrin repeat protein 979 951 1008 1428844_a_at Bclaf1 BCL2-associated transcription factor 1 979 850 1109 1427150_at Mll3 myeloid/lymphoid or mixed-lineage leukemia 3 978 1002 954 1435922_at Fbxl19 F-box and leucine-rich repeat protein 19 976 1150 801 1451676_at Drap1 /// Dr1 associated protein 1 (negative cofactor 2 alpha) /// 970 1170 770 1438443_at Zbtb20 zinc finger and BTB domain containing 20 970 1176 764 1437474_at Gatad2b GATA zinc finger domain containing 2B 967 955 979 1434284_at Bdp1 "B double prime 1, subunit of RNA polymerase III 962 785 1139 1424385_at 5830417I10Rik RIKEN cDNA 5830417I10 gene 961 892 1030 1452743_at Pole3 "polymerase (DNA directed), epsilon 3 (p17 subunit)" 960 969 951 1426111_x_at Irf3 interferon regulatory factor 3 959 962 956 1437525_a_at Polr3a polymerase (RNA) III (DNA directed) polypeptide A 955 956 954 1427099_at Maz MYC-associated zinc finger protein (purine-binding 955 976 935 1437994_x_at Mier2 "mesoderm induction early response 1, family member 954 937 970 1423310_at Tpbg trophoblast glycoprotein 949 945 954 1451485_at 3300001P08Rik RIKEN cDNA 3300001P08 gene 945 1364 527 1416574_at Tox4 TOX high mobility group box family member 4 944 997 891 1451833_a_at Setdb1 "SET domain, bifurcated 1" 943 817 1068 1452021_a_at Hes6 hairy and enhancer of split 6 (Drosophila) 943 1197 688 1438004_at Pols polymerase (DNA directed) sigma 942 858 1026 1459859_x_at Chrac1 chromatin accessibility complex 1 942 1051 833 1436084_at Scrt1 "scratch homolog 1, zinc finger protein (Drosophila)" 940 1007 872 1424052_at Thap4 THAP domain containing 4 939 969 908
168 1428248_at Nfx1 "nuclear transcription factor, X-box binding 1" 934 724 1144 1436232_a_at Gabpb1 "GA repeat binding protein, beta 1" 932 895 968 1447540_at Tigd3 tigger transposable element derived 3 927 927 928 1434080_at Aebp2 AE binding protein 2 924 815 1033 1434884_at Mtdh Metadherin 923 893 954 1425940_a_at Ssbp3 single-stranded DNA binding protein 3 921 948 894 1429152_at Zkscan1 zinc finger with KRAB and SCAN domains 1 918 854 981 1455312_at Phc3 polyhomeotic-like 3 (Drosophila) 917 782 1051 1418929_at Ift57 intraflagellar transport 57 homolog (Chlamydomonas) 916 721 1111 1426482_at Prkrir "protein-kinase, interferon-inducible double stranded 916 924 907 1425806_a_at Med21 mediator complex subunit 21 915 1021 810 1440091_at Meis2 Meis homeobox 2 914 199 1628 1434506_at 1700124K17Rik /// "RIKEN cDNA 1700124K17 gene /// AT rich interactive 911 727 1096 1419489_at AW049604 expressed sequence AW049604 908 1045 770 1437924_at Son Son DNA binding protein 908 749 1066 1437585_x_at Zfp161 zinc finger protein 161 905 753 1057 1425837_a_at Ccrn4l /// CCR4 carbon catabolite repression 4-like (S. cerevisiae) 905 839 972 1439845_at Hp1bp3 "heterochromatin protein 1, binding protein 3" 903 974 831 1447754_x_at Thap4 THAP domain containing 4 901 960 841 1433433_at Myst2 MYST histone acetyltransferase 2 897 923 871 1418582_at Cbfa2t3 "core-binding factor, runt domain, alpha subunit 2, 897 672 1121 1448957_at Rbpj recombination signal binding protein for immunoglobulin 896 918 875 1433655_at Rnf141 ring finger protein 141 895 842 947 1454631_at Gtf2a1 "general transcription factor II A, 1" 894 909 878 1454818_at Gmeb2 glucocorticoid modulatory element binding protein 2 889 812 966 1416251_at Mcm6 "minichromosome maintenance deficient 6 (MIS5 888 777 999 1422031_a_at Zfand6 "zinc finger, AN1-type domain 6" 887 1047 727 1453478_at Pou3f2 "POU domain, class 3, transcription factor 2" 887 913 861
169 1418039_at Rabl3 "RAB, member of RAS oncogene family-like 3" 881 867 895 1457285_at Zfp187 zinc finger protein 187 879 653 1105 1450889_at Hltf helicase-like transcription factor 875 778 971 1449823_at Dach2 dachshund 2 (Drosophila) 875 774 975 1417734_at Akap8l A kinase (PRKA) anchor protein 8-like 874 884 864 1455942_at Fbxl11 F-box and leucine-rich repeat protein 11 873 889 857 1416502_a_at Preb prolactin regulatory element binding 873 830 916 1428174_x_at Khsrp KH-type splicing regulatory protein 871 920 821 1420628_at LOC100045958 /// similar to hCG45299 /// purine rich element binding 868 896 841 1419267_at Nfyb nuclear transcription factor-Y beta 865 846 884 1450072_at Ash1l "ash1 (absent, small, or homeotic)-like (Drosophila)" 864 797 931 1416158_at Nr2f2 "nuclear receptor subfamily 2, group F, member 2" 863 1071 656 1436220_at Zfp287 zinc finger protein 287 863 725 1002 1436318_at Tardbp TAR DNA binding protein 863 744 982 1450746_at Keap1 kelch-like ECH-associated protein 1 863 1073 652 1449370_at Sox4 SRY-box containing gene 4 862 1277 447 1437716_x_at Kif22 kinesin family member 22 860 801 920 1456093_at Zfp536 zinc finger protein 536 860 716 1004 1434995_s_at Dedd death effector domain-containing 859 854 864 1456009_x_at Top3b topoisomerase (DNA) III beta 856 797 915 1448916_at LOC100047868 /// "similar to mafG /// v-maf musculoaponeurotic 855 865 845 1434938_at Rbm9 RNA binding motif protein 9 855 914 796 1438430_at Hbp1 high mobility group box transcription factor 1 853 756 950 1422485_at LOC100048076 /// similar to MAD homolog 4 (Drosophila) /// MAD 851 994 708 1455505_at Gatad2a GATA zinc finger domain containing 2A 851 763 939 1426979_at Mlxip MLX interacting protein 851 794 907 1418343_at Gtf2ird2 GTF2I repeat domain containing 2 849 882 815 1424353_at Lrpprc leucine-rich PPR-motif containing 848 763 934
170 1433641_at LOC100046891 /// similar to Smad5 /// MAD homolog 5 (Drosophila) 847 703 991 1439487_at Lig4 "ligase IV, DNA, ATP-dependent" 845 777 912 1430651_s_at Zfp191 zinc finger protein 191 843 791 896 1451459_at Ahctf1 AT hook containing transcription factor 1 842 768 915 1417328_at Ercc1 "excision repair cross-complementing rodent repair 842 950 734 1460228_at Usf2 upstream transcription factor 2 840 882 797 1426049_a_at Terf2ip "telomeric repeat binding factor 2, interacting protein" 836 722 949 1448379_at Pot1a protection of telomeres 1A 836 866 805 1437338_x_at Elp3 Elongation protein 3 homolog (S. cerevisiae) 835 835 836 1426564_at Zfp553 zinc finger protein 553 835 905 765 1452174_at Srebf2 sterol regulatory element binding factor 2 835 969 700 1418640_at Sirt1 "sirtuin 1 (silent mating type information regulation 2, 834 776 891 1436559_a_at Psmd10 "proteasome (prosome, macropain) 26S subunit, non- 832 956 708 1450664_at Gabpa "GA repeat binding protein, alpha" 831 689 973 1459838_s_at Btbd11 BTB (POZ) domain containing 11 830 734 925 1426349_s_at Tmpo thymopoietin 828 860 796 1454994_at Klhl20 kelch-like 20 (Drosophila) 827 718 935 1452221_a_at Cxxc1 CXXC finger 1 (PHD domain) 826 942 709 1418072_at Hist1h2bb /// "histone cluster 1, H2bb /// histone cluster 1, H2bc /// 824 793 854 1417892_a_at Sirt3 "sirtuin 3 (silent mating type information regulation 2, 824 911 737 1426438_at Ddx3y "DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked" 821 736 905 1451899_a_at Gtf2ird1 general transcription factor II I repeat domain-containing 819 942 696 1426726_at LOC677319 /// "similar to protein phosphatase 1, regulatory subunit 10 818 842 794 1460614_at Mier3 "mesoderm induction early response 1, family member 817 962 672 1434655_at Foxk1 forkhead box K1 817 687 946 1416347_at Men1 multiple endocrine neoplasia 1 816 778 855 1423324_at Pnn pinin 814 562 1066 1416030_a_at Mcm7 minichromosome maintenance deficient 7 (S. cerevisiae) 814 956 672
171 1417778_at Zfp35 zinc finger protein 35 812 842 783 1417155_at Mycn "v-myc myelocytomatosis viral related oncogene, 812 833 790 1434318_a_at Tcfe3 transcription factor E3 811 808 813 1448288_at Nfib nuclear factor I/B 811 833 788 1423508_at Myst4 MYST histone acetyltransferase monocytic leukemia 4 809 841 776 1453804_a_at Orc4l "origin recognition complex, subunit 4-like (S. 805 684 926 1424175_at Tef thyrotroph embryonic factor 801 801 802 1448785_at Runx1t1 "runt-related transcription factor 1; translocated to, 1 801 585 1016 1447854_s_at Hist2h2be "histone cluster 2, H2be" 801 851 750 1452560_a_at Nfya nuclear transcription factor-Y alpha 797 725 869 1422532_at Xpc "xeroderma pigmentosum, complementation group C" 797 757 836 1436925_at Foxn3 forkhead box N3 796 900 692 1438487_s_at Zzz3 "zinc finger, ZZ domain containing 3" 794 724 863 1423293_at Rpa1 replication protein A1 793 792 794 1426114_at Hnrnpab heterogeneous nuclear ribonucleoprotein A/B 791 1264 319 1416903_at Nucb1 nucleobindin 1 790 805 776 1460655_a_at Ubp1 upstream binding protein 1 788 654 921 1418514_at Mtf2 metal response element binding transcription factor 2 787 969 606 1452281_at Sos2 Son of sevenless homolog 2 (Drosophila) 786 738 834 1435651_a_at Smarcad1 "SWI/SNF-related, matrix-associated actin-dependent 784 960 609 1433743_at Dach1 dachshund 1 (Drosophila) 784 579 989 1449934_at LOC100045958 /// similar to hCG45299 /// purine rich element binding 783 703 863 1434332_at Zzz3 "zinc finger, ZZ domain containing 3" 781 724 838 1437237_x_at Zfp110 zinc finger protein 110 781 762 800 1418618_at En1 engrailed 1 780 1457 103 1427252_at Dmrtb1 "DMRT-like family B with proline-rich C-terminal, 1" 779 1194 364 1452711_at Spg3a spastic paraplegia 3A homolog (human) 778 811 746 1423998_at Gtf3c5 "general transcription factor IIIC, polypeptide 5" 776 857 694
172 1417742_a_at Dmap1 DNA methyltransferase 1-associated protein 1 775 927 623 1437241_at Klf11 Kruppel-like factor 11 775 774 776 1434515_at Ncoa1 nuclear receptor coactivator 1 774 540 1008 1434485_a_at Ugp2 UDP-glucose pyrophosphorylase 2 774 649 899 1435136_at Whsc1 Wolf-Hirschhorn syndrome candidate 1 (human) 774 680 868 1448794_s_at Dnajc2 "DnaJ (Hsp40) homolog, subfamily C, member 2" 770 999 541 1434398_at Nkrf NF-kappaB repressing factor 769 743 795 1422165_at Pou3f4 "POU domain, class 3, transcription factor 4" 769 1046 492 1423060_at Pa2g4 proliferation-associated 2G4 765 999 530 1452237_at Hrb HIV-1 Rev binding protein 763 654 872 1453312_at Iqwd1 IQ motif and WD repeats 1 763 789 737 1439008_at Zfp319 zinc finger protein 319 761 731 791 1417800_at Parp2 "poly (ADP-ribose) polymerase family, member 2" 760 598 922 1416598_at Glis2 GLIS family zinc finger 2 758 679 837 1417737_at Mrps31 mitochondrial ribosomal protein S31 757 718 796 1424261_at Zfp672 zinc finger protein 672 755 713 796 1452377_at Mll1 myeloid/lymphoid or mixed-lineage leukemia 1 753 786 719 1453023_at Ankhd1 /// Eif4ebp3 ankyrin repeat and KH domain containing 1 /// 749 631 866 1428467_at Tardbp TAR DNA binding protein 745 601 888 1435385_at Tshz2 teashirt zinc finger family member 2 744 502 986 1419067_a_at Rabgef1 RAB guanine nucleotide exchange factor (GEF) 1 743 717 769 1428679_s_at 0610010K14Rik RIKEN cDNA 0610010K14 gene 739 977 500 1439044_at Zfp354c zinc finger protein 354C 737 745 729 1422064_a_at Zbtb20 zinc finger and BTB domain containing 20 736 868 604 1426556_at Suhw4 suppressor of hairy wing homolog 4 (Drosophila) 734 655 812 1451197_s_at Gatad2a GATA zinc finger domain containing 2A 732 696 769 1452374_at Zfp322a zinc finger protein 322a 729 905 553 1436363_a_at Nfix nuclear factor I/X 728 861 595
173 1455003_at Thap1 "THAP domain containing, apoptosis associated protein 726 682 770 1429438_at Bcor BCL6 interacting corepressor 724 487 960 1416724_x_at Tcf4 transcription factor 4 722 756 687 1437921_x_at Zfp516 zinc finger protein 516 721 710 731 1434116_at Cbx2 chromobox homolog 2 (Drosophila Pc class) 718 702 733 1436059_at Rfx1 "regulatory factor X, 1 (influences HLA class II 717 573 861 1452690_at Khsrp KH-type splicing regulatory protein 717 685 749 1416935_at Trpv2 "transient receptor potential cation channel, subfamily V, 717 673 761 1429631_at Sirt6 "sirtuin 6 (silent mating type information regulation 2, 717 827 606 1460404_at 0610007P08Rik RIKEN cDNA 0610007P08 gene 716 648 784 1447703_x_at Zfp593 zinc finger protein 593 715 770 660 1435249_at Btaf1 "BTAF1 RNA polymerase II, B-TFIID transcription factor- 714 584 845 1429335_at Snapc1 "small nuclear RNA activating complex, polypeptide 1" 713 651 775 1460700_at Stat3 signal transducer and activator of transcription 3 712 577 848 1418387_at Mphosph8 M-phase phosphoprotein 8 711 616 805 1434044_at Repin1 replication initiator 1 709 724 694 1425585_at Med12 "mediator of RNA polymerase II transcription, subunit 12 708 570 846 1452955_at Gtf2h5 "general transcription factor IIH, polypeptide 5" 708 724 692 1418159_at Tcfcp2 transcription factor CP2 707 634 779 1452310_at Tada2l "transcriptional adaptor 2 (ADA2 homolog, yeast)-like" 704 639 769 1419536_a_at Rela v-rel reticuloendotheliosis viral oncogene homolog A 696 809 583 1426819_at Hipk3 homeodomain interacting protein kinase 3 696 584 808 1416214_at Mcm4 minichromosome maintenance deficient 4 homolog (S. 696 647 744 1418355_at Nucb2 nucleobindin 2 693 587 798 1434618_at Crebzf CREB/ATF bZIP transcription factor 693 501 884 1438274_at Ikzf4 IKAROS family zinc finger 4 691 598 783 1427983_at Zfp280c zinc finger protein 280c 690 629 752 1424751_at Abt1 activator of basal transcription 1 689 740 637
174 1435961_at Nat14 N-acetyltransferase 14 688 741 635 1433907_at Pknox2 Pbx/knotted 1 homeobox 2 688 864 511 1438852_x_at Mcm6 "minichromosome maintenance deficient 6 (MIS5 687 634 740 1434418_at Lass6 "LAG1 homolog, ceramide synthase 6" 684 593 774 1418275_a_at Elf2 E74-like factor 2 681 771 591 1420096_at Zscan21 Zinc finger and SCAN domain containing 21 681 787 574 1425927_a_at Atf5 activating transcription factor 5 681 670 691 1452751_at Ebf3 early B-cell factor 3 680 603 756 1429252_at 0610010K14Rik RIKEN cDNA 0610010K14 gene 678 919 437 1419685_at Upf1 UPF1 regulator of nonsense transcripts homolog (yeast) 676 626 726 1423398_at Taf12 "TAF12 RNA polymerase II, TATA box binding protein 676 725 626 1423700_at Rfc3 replication factor C (activator 1) 3 676 807 544 1429800_at 9130221H12Rik /// RIKEN cDNA 9130221H12 gene /// zinc finger protein 526 674 730 618 1435881_at Pcbp2 poly(rC) binding protein 2 672 685 659 1455034_at Nr4a2 "nuclear receptor subfamily 4, group A, member 2" 671 601 741 1437105_at Jarid1a "jumonji, AT rich interactive domain 1A (Rbp2 like)" 671 644 697 1416007_at Satb1 special AT-rich sequence binding protein 1 669 700 639 1442745_x_at Rbm39 RNA binding motif protein 39 669 700 638 1452261_at Shprh SNF2 histone linker PHD RING helicase 668 603 733 1425972_a_at Zfx zinc finger protein X-linked 668 609 726 1418386_at N6amt2 N-6 adenine-specific DNA methyltransferase 2 (putative) 667 831 503 1426744_at Srebf2 sterol regulatory element binding factor 2 665 710 621 1418517_at Irx3 Iroquois related homeobox 3 (Drosophila) 665 1029 300 1437542_at Ikzf2 IKAROS family zinc finger 2 664 575 753 1437198_at Lig3 "ligase III, DNA, ATP-dependent" 662 537 786 1434831_a_at Foxo3a forkhead box O3a 658 700 617 1429431_at Ikzf5 IKAROS family zinc finger 5 658 697 619 1434117_at Tceb3 "transcription elongation factor B (SIII), polypeptide 3" 658 648 667
175 1434564_at E2f3 E2F transcription factor 3 656 516 796 1454694_a_at Top2a topoisomerase (DNA) II alpha 654 634 674 1429776_a_at Dnajb6 "DnaJ (Hsp40) homolog, subfamily B, member 6" 652 839 465 1439316_at Rbm39 RNA binding motif protein 39 652 575 728 1438218_at Zbtb24 zinc finger and BTB domain containing 24 652 653 650 1423064_at Dnmt3a DNA methyltransferase 3A 650 544 757 1424224_at Asb8 ankyrin repeat and SOCS box-containing 8 649 752 546 1417173_at Crebl1 cAMP responsive element binding protein-like 1 648 672 623 1425483_at LOC100044677 /// similar to thymus high mobility group box protein TOX /// 645 663 626 1449261_at Pbx2 pre B-cell leukemia transcription factor 2 644 723 565 1430535_at Tsc22d2 "TSC22 domain family, member 2" 643 531 755 1435114_at Wdhd1 WD repeat and HMG-box DNA binding protein 1 643 587 699 1448875_at Zhx1 zinc fingers and homeoboxes 1 643 539 747 1425599_a_at Gatad1 GATA zinc finger domain containing 1 642 581 703 1429276_at Lba1 lupus brain antigen 1 641 577 705 1455778_at Zfp192 zinc finger protein 192 641 574 707 1426218_at Glcci1 glucocorticoid induced transcript 1 641 556 726 1418594_a_at LOC100044566 /// similar to Nuclear receptor coactivator 1 (NCoA-1) 640 494 787 1454834_at Nfib nuclear factor I/B 640 520 760 1439035_at Zfp322a zinc finger protein 322a 639 824 453 1436341_at Hmbox1 homeobox containing 1 638 530 747 1418008_at 1810007M14Rik RIKEN cDNA 1810007M14 gene 638 380 895 1449546_a_at Zfp617 zinc finger protein 617 637 693 581 1452168_x_at Gspt1 G1 to S phase transition 1 636 560 712 1429099_at Duxbl double homeobox B-like 636 602 669 1420985_at Ash1l "ash1 (absent, small, or homeotic)-like (Drosophila)" 634 686 582 1433999_at Slk STE20-like kinase (yeast) 631 471 792 1449115_at Mtf2 metal response element binding transcription factor 2 631 554 708
176 1421030_at Zfp64 zinc finger protein 64 631 663 599 1426428_at Thap7 THAP domain containing 7 630 689 571 1415999_at Hey1 hairy/enhancer-of-split related with YRPW motif 1 629 531 726 1416620_at Smarcal1 "Swi/SNF related matrix associated, actin dependent 628 636 621 1437061_at Mbd1 methyl-CpG binding domain protein 1 628 470 786 1455336_at Thap2 "THAP domain containing, apoptosis associated protein 626 617 636 1433911_at Smg6 "Smg-6 homolog, nonsense mediated mRNA decay factor 625 629 621 1423371_at Pole4 "polymerase (DNA-directed), epsilon 4 (p12 subunit)" 623 654 593 1416751_a_at Ddx20 DEAD (Asp-Glu-Ala-Asp) box polypeptide 20 623 595 651 1442148_at Psip1 PC4 and SFRS1 interacting protein 1 623 674 571 1436049_at Tox4 TOX high mobility group box family member 4 622 606 639 1426411_a_at C230082I21Rik /// RIKEN cDNA C230082I21 gene /// spermatid perinuclear 621 510 732 1428225_s_at Hnrpdl heterogeneous nuclear ribonucleoprotein D-like 619 413 824 1453169_a_at Gtf2h1 "general transcription factor II H, polypeptide 1" 618 638 598 1439754_at Sox12 SRY-box containing gene 12 617 587 648 1439089_at Zbtb41 zinc finger and BTB domain containing 41 homolog 617 592 642 1447448_s_at Klf6 Kruppel-like factor 6 617 364 869 1422155_at Hist2h3c2 "histone cluster 2, H3c2" 616 742 490 1448277_at Pold2 "polymerase (DNA directed), delta 2, regulatory subunit" 615 673 556 1436596_at H2afv "H2A histone family, member V" 614 681 547 1438075_at Fem1c fem-1 homolog c (C.elegans) 614 513 714 1426736_at Gspt1 G1 to S phase transition 1 612 560 664 1416864_at Surf6 surfeit gene 6 612 549 674 1436808_x_at Mcm5 "minichromosome maintenance deficient 5, cell division 611 668 555 1417591_at Ptges2 prostaglandin E synthase 2 610 662 558 1450042_at Arx /// aristaless related homeobox /// similar to Arx 608 354 862 1418894_s_at Pbx2 pre B-cell leukemia transcription factor 2 608 716 499 1419356_at Klf7 Kruppel-like factor 7 (ubiquitous) 607 734 479
177 1429304_at Ankrd10 ankyrin repeat domain 10 605 541 669 1426790_at Ssrp1 structure specific recognition protein 1 605 705 505 1428915_at Sirt5 sirtuin 5 (silent mating type information regulation 2 603 605 600 1460207_s_at E2f5 E2F transcription factor 5 603 469 736 1417440_at Arid1a AT rich interactive domain 1A (SWI-like) 602 579 624 1428365_a_at Lonp1 "lon peptidase 1, mitochondrial" 601 568 634 1440930_a_at Scrt2 "scratch homolog 2, zinc finger protein (Drosophila)" 600 427 773 1438090_x_at Ankrd54 ankyrin repeat domain 54 597 537 658 1433894_at Jazf1 JAZF zinc finger 1 596 473 718 1454086_a_at Lmo2 /// LIM domain only 2 /// similar to LIM domain only 2 596 761 430 1435397_at Zbtb44 zinc finger and BTB domain containing 44 592 561 624 1441727_s_at Zfp467 zinc finger protein 467 592 551 632 1454079_at 4933400F03Rik RIKEN cDNA 4933400F03 gene 592 619 564 1424089_a_at Tcf4 transcription factor 4 587 622 552 1437065_at Zbtb20 zinc finger and BTB domain containing 20 585 600 570 1426469_a_at Tbp TATA box binding protein 585 605 564 1438232_at Foxp2 forkhead box P2 584 635 532 1424872_at 2310001H12Rik RIKEN cDNA 2310001H12 gene 581 440 723 1450644_at Zfp36l1 "zinc finger protein 36, C3H type-like 1" 580 564 596 1453077_a_at Snapc3 "small nuclear RNA activating complex, polypeptide 3" 577 669 485 1452835_a_at Polrmt polymerase (RNA) mitochondrial (DNA directed) 576 570 582 1429634_at Zfp580 zinc finger protein 580 576 665 486 1459895_at Ppp4r1l "protein phosphatase 4, regulatory subunit 1-like" 575 490 660 1426582_at Atf2 /// activating transcription factor 2 /// similar to Cyclic AMP- 572 585 558 1422948_s_at Hist1h4a /// "histone cluster 1, H4a /// histone cluster 1, H4b /// 569 814 325 1418125_at Ino80 INO80 homolog (S. cerevisiae) 569 421 716 1434825_at Tnrc18 trinucleotide repeat containing 18 569 526 611 1424986_s_at Fbxw7 "F-box and WD-40 domain protein 7, archipelago 567 583 551
178 1437571_at Hic2 hypermethylated in cancer 2 567 597 538 1427208_at Zfp451 zinc finger protein 451 567 447 688 1434400_at Tgif2 TGFB-induced factor homeobox 2 567 575 558 1437909_at Srcap Snf2-related CREBBP activator protein 565 629 502 1418932_at LOC100046232 /// "similar to NFIL3/E4BP4 transcription factor /// nuclear 565 597 533 1417145_at Nfxl1 "nuclear transcription factor, X-box binding-like 1" 564 441 686 1439159_at Rere Arginine glutamic acid dipeptide (RE) repeats 562 520 605 1439493_at Zfp827 zinc finger protein 827 562 524 601 1434650_at Pogz pogo transposable element with ZNF domain 562 485 639 1435202_at Zfp574 zinc finger protein 574 561 485 638 1434883_at Mtdh Metadherin 559 513 604 1433705_at Zfp213 zinc finger protein 213 557 583 531 1423065_at Dnmt3a DNA methyltransferase 3A 556 542 570 1460725_at Xpa "xeroderma pigmentosum, complementation group A" 555 672 438 1437880_at Lbxcor1 ladybird homeobox 1 homolog (Drosophila) corepressor 555 260 850 1420012_at Xbp1 X-box binding protein 1 555 650 459 1427899_at Rnf6 ring finger protein (C3H2C3 type) 6 555 542 567 1434900_at Mkl1 MKL (megakaryoblastic leukemia)/myocardin-like 1 554 591 517 1452438_s_at LOC100046932 /// "similar to TAF4A RNA polymerase II, TATA box binding 554 415 692 1437667_a_at Bach2 BTB and CNC homology 2 553 563 542 1435044_at Ebf4 early B-cell factor 4 551 449 654 1416224_at Zbtb17 zinc finger and BTB domain containing 17 551 537 565 1448694_at Jun Jun oncogene 551 471 631 1424740_at Creb3 cAMP responsive element binding protein 3 551 696 406 1448535_at Elp4 elongation protein 4 homolog (S. cerevisiae) 551 650 451 1437722_x_at Pcbp3 Poly(rC) binding protein 3 549 597 501 1428916_s_at Sirt5 sirtuin 5 (silent mating type information regulation 2 549 589 508 1449813_at Zfp30 zinc finger protein 30 545 582 507
179 1455486_at Pias1 protein inhibitor of activated STAT 1 543 589 497 1451012_a_at Csda cold shock domain protein A 543 465 621 1428976_at Tmpo thymopoietin 543 520 566 1460648_at Nr2f6 "nuclear receptor subfamily 2, group F, member 6" 543 564 521 1438423_at Ssbp2 single-stranded DNA binding protein 2 541 605 478 1439107_a_at Mll5 myeloid/lymphoid or mixed-lineage leukemia 5 541 680 402 1439490_at Nr2c1 "nuclear receptor subfamily 2, group C, member 1" 541 488 593 1436071_at Ankrd26 ankyrin repeat domain 26 540 465 615 1436597_at Ankhd1 /// Eif4ebp3 ankyrin repeat and KH domain containing 1 /// 539 411 667 1429125_at Zbtb9 zinc finger and BTB domain containing 9 538 527 548 1436708_x_at Mcm4 minichromosome maintenance deficient 4 homolog (S. 538 520 555 1434149_at Tcf4 transcription factor 4 537 554 520 1452347_at Mef2a myocyte enhancer factor 2A 537 421 653 1426962_at Phf20 PHD finger protein 20 537 541 532 1437841_x_at Csdc2 "cold shock domain containing C2, RNA binding" 536 497 575 1455762_at C330002I19Rik RIKEN cDNA C330002I19 gene 536 442 630 1428026_at Tshz2 teashirt zinc finger family member 2 535 293 776 1425281_a_at Tsc22d3 "TSC22 domain family, member 3" 534 657 411 1455625_at ------534 499 568 1423311_s_at Tpbg trophoblast glycoprotein 534 563 504 1434786_at Ppp1r12b "protein phosphatase 1, regulatory (inhibitor) subunit 533 529 536 1455513_at Taf1 "TAF1 RNA polymerase II, TATA box binding protein (TBP)- 531 475 588 1450464_at E4f1 E4F transcription factor 1 531 442 619 1447432_s_at Zfp263 zinc finger protein 263 528 501 556 1428827_at Whsc1 Wolf-Hirschhorn syndrome candidate 1 (human) 528 529 526 1436284_s_at Zfp319 zinc finger protein 319 528 395 661 1449511_a_at Ssbp4 single stranded DNA binding protein 4 525 618 432 1418859_at Rfxap regulatory factor X-associated protein 525 570 479
180 1434882_at Mtdh Metadherin 525 484 565 1424506_at Zfp768 zinc finger protein 768 524 530 517 1418312_at Zfp276 zinc finger protein (C2H2 type) 276 523 437 609 1434832_at Foxo3a forkhead box O3a 523 515 530 1449389_at Tal1 T-cell acute lymphocytic leukemia 1 522 692 351 1416915_at Msh6 mutS homolog 6 (E. coli) 518 505 530 1444107_at C130039O16Rik RIKEN cDNA C130039O16 gene 517 463 572 1429719_at Foxp4 forkhead box P4 516 613 420 1423169_at Taf7 "TAF7 RNA polymerase II, TATA box binding protein (TBP)- 516 507 526 1452319_at Zfp82 zinc finger protein 82 516 471 561 1429194_at Tigd2 tigger transposable element derived 2 513 510 516 1450921_at Aptx aprataxin 512 545 479 1431804_a_at D130067C23Rik /// RIKEN cDNA D130067C23 gene /// trans-acting 511 519 503 1448412_a_at Tsc22d4 "TSC22 domain family, member 4" 508 504 512 1434849_at Tspyl2 TSPY-like 2 505 469 541 1454932_at Rcor1 REST corepressor 1 505 413 598 1451150_at Zfp410 zinc finger protein 410 505 442 568 1451592_at P42pop Myb protein P42POP 504 477 530 1438999_a_at Nfat5 nuclear factor of activated T-cells 5 503 363 643 1416353_at Nr1h2 "nuclear receptor subfamily 1, group H, member 2" 502 602 402 1426456_a_at Pias2 protein inhibitor of activated STAT 2 502 511 493 1416115_at Orc3l "origin recognition complex, subunit 3-like (S. 501 492 509 1457669_x_at Rfc2 replication factor C (activator 1) 2 500 540 461 1452282_at Med26 mediator complex subunit 26 500 519 481 1428773_s_at Bcor BCL6 interacting corepressor 499 367 630 1457635_s_at Nr3c1 "nuclear receptor subfamily 3, group C, member 1" 498 244 753 1425557_x_at Tsc22d3 "TSC22 domain family, member 3" 498 505 491 1442744_at Rbm39 RNA binding motif protein 39 497 532 462
181 1446148_x_at Rbm39 RNA binding motif protein 39 497 579 414 1451997_at Zfp426 zinc finger protein 426 496 473 519 1423372_at Pole4 "polymerase (DNA-directed), epsilon 4 (p12 subunit)" 494 579 408 1435474_at Taf5 "TAF5 RNA polymerase II, TATA box binding protein (TBP)- 492 515 469 1417080_a_at Ecsit ECSIT homolog (Drosophila) 491 512 470 1437470_at Pknox1 Pbx/knotted 1 homeobox 491 380 601 1434963_at Supt3h suppressor of Ty 3 homolog (S. cerevisiae) 489 532 446 1449068_at Zfp148 zinc finger protein 148 489 526 451 1417146_at 2410018C20Rik RIKEN cDNA 2410018C20 gene 488 505 470 1425383_a_at LOC676870 /// Pbx1 region containing RIKEN cDNA 2310056B04 gene; pre B- 487 660 314 1422695_at Ttyh1 tweety homolog 1 (Drosophila) 486 448 524 1455483_at Zfp148 zinc finger protein 148 485 486 483 1449126_at Zfp90 zinc finger protein 90 484 436 532 1420374_at Foxj2 forkhead box J2 484 440 527 1419454_x_at Pias2 protein inhibitor of activated STAT 2 483 410 556 1450250_at Otud7a OTU domain containing 7A 483 469 496 1435664_at Zfp397 zinc finger protein 397 481 400 562 1451522_s_at Lrch4 /// Sap25 "leucine-rich repeats and calponin homology (CH) 481 513 449 1418375_at Mbd6 methyl-CpG binding domain protein 6 481 470 491 1443466_s_at Polr3b polymerase (RNA) III (DNA directed) polypeptide B 481 402 559 1422833_at Foxa2 forkhead box A2 480 445 515 1437020_at Ep400 E1A binding protein p400 480 600 359 1437174_at Tfdp2 transcription factor Dp 2 480 524 435 1419313_at Ccnt1 /// cyclin T1 /// similar to cyclin T1 479 485 473 1446147_at Rbm39 RNA binding motif protein 39 478 603 353 1416268_at Ets2 "E26 avian leukemia oncogene 2, 3' domain" 478 438 518 1437784_at Runx1t1 "runt-related transcription factor 1; translocated to, 1 477 492 462 1417409_at Jun Jun oncogene 476 438 513
182 1434031_at Zfp692 zinc finger protein 692 473 314 632 1460557_at Supv3l1 "suppressor of var1, 3-like 1 (S. cerevisiae)" 471 422 520 1433454_at Abtb2 ankyrin repeat and BTB (POZ) domain containing 2 470 298 642 1419380_at Zfp423 zinc finger protein 423 469 485 452 1434682_at Zfp770 zinc finger protein 770 468 409 527 1418616_at Mafk "v-maf musculoaponeurotic fibrosarcoma oncogene 468 475 461 1424166_at LOC100046843 /// similar to mutS homolog 3 /// mutS homolog 3 (E. coli) 467 363 571 1423419_at Lig3 "ligase III, DNA, ATP-dependent" 466 454 478 1449542_at Pbx1 pre B-cell leukemia transcription factor 1 466 563 369 1435270_x_at N6amt2 N-6 adenine-specific DNA methyltransferase 2 (putative) 466 551 380 1436967_at Ankrd11 ankyrin repeat domain 11 464 373 555 1415829_at Lbr lamin B receptor 463 430 496 1435176_a_at Id2 inhibitor of DNA binding 2 462 492 432 1419602_at Hoxa2 homeo box A2 462 185 739 1424712_at Ahctf1 AT hook containing transcription factor 1 461 382 541 1418152_at Nsbp1 nucleosome binding protein 1 461 428 495 1451138_x_at Mier2 "mesoderm induction early response 1, family member 461 488 434 1452917_at Rfc5 replication factor C (activator 1) 5 461 546 375 1423984_a_at LOC100046899 /// similar to Myeloid ecotropic viral integration site-related 460 417 502 1415810_at Uhrf1 "ubiquitin-like, containing PHD and RING finger domains, 459 522 396 1437543_at Fubp1 far upstream element (FUSE) binding protein 1 457 417 497 1440971_x_at LOC100047782 /// similar to crooked legs CG14938-PB /// zinc finger 457 524 390 1451995_at Taf11 "TAF11 RNA polymerase II, TATA box binding protein 456 486 427 1439209_at Tcf12 Transcription factor 12 455 378 532 1423681_at 1300018I05Rik RIKEN cDNA 1300018I05 gene 454 459 450 1419716_a_at Pou2f1 "POU domain, class 2, transcription factor 1" 452 424 480 1450710_at Jarid2 "jumonji, AT rich interactive domain 2" 452 503 400 1427680_a_at Nfib nuclear factor I/B 451 373 529
183 1423336_at Orc4l "origin recognition complex, subunit 4-like (S. 451 307 594 1426891_at Rpap1 RNA polymerase II associated protein 1 449 512 386 1437507_at Gatad2b GATA zinc finger domain containing 2B 448 442 454 1448585_at Gtf2h4 "general transcription factor II H, polypeptide 4" 448 522 373 1434627_at Nrf1 Nuclear respiratory factor 1 446 386 505 1435070_at Aebp2 AE binding protein 2 445 432 458 1435444_at Atf6 activating transcription factor 6 440 408 473 1450842_a_at Cenpa centromere protein A 440 498 382 1416029_at Klf10 Kruppel-like factor 10 439 424 453 1450701_a_at Gtf2h2 "general transcription factor II H, polypeptide 2" 439 463 414 1419068_at Rabgef1 RAB guanine nucleotide exchange factor (GEF) 1 439 451 426 1454831_at Foxn2 forkhead box N2 439 380 497 1456010_x_at Hes5 hairy and enhancer of split 5 (Drosophila) 436 698 174 1434160_at Zfp592 zinc finger protein 592 436 469 403 1428521_at Thap3 "THAP domain containing, apoptosis associated protein 435 476 394 1439627_at Zic1 zinc finger protein of the cerebellum 1 433 129 736 1418200_at Zbtb48 zinc finger and BTB domain containing 48 432 399 466 1433755_at Mier1 mesoderm induction early response 1 homolog (Xenopus 432 376 488 1450935_at Ercc5 "excision repair cross-complementing rodent repair 432 338 525 1459896_at Pogk /// Tada1l "pogo transposable element with KRAB domain /// 430 470 390 1417781_at Lass4 "LAG1 homolog, ceramide synthase 4" 429 370 487 1455667_at Preb prolactin regulatory element binding 428 388 468 1435168_at Zfp710 zinc finger protein 710 427 460 394 1452241_at Topbp1 topoisomerase (DNA) II binding protein 1 426 337 515 1418478_at Lmo1 LIM domain only 1 426 449 403 1430650_at Zfp191 zinc finger protein 191 425 396 455 1457482_at Jarid1b "jumonji, AT rich interactive domain 1B (Rbp2 like)" 425 402 448 1417444_at E2f5 E2F transcription factor 5 425 340 509
184 1444779_s_at Zfp59 zinc finger protein 59 425 411 438 1435670_at Tcfap2b transcription factor AP-2 beta 424 410 438 1434054_at Mafg "v-maf musculoaponeurotic fibrosarcoma oncogene 424 419 429 1417363_at Zfp61 zinc finger protein 61 421 383 458 1449915_at Zfp202 zinc finger protein 202 420 384 456 1437066_at Zbtb20 zinc finger and BTB domain containing 20 418 604 233 1422150_at Hmx3 H6 homeo box 3 417 728 106 1437067_at Phtf2 putative homeodomain transcription factor 2 417 348 486 1435192_at Sox3 SRY-box containing gene 3 417 604 230 1418035_a_at Prim2 "DNA primase, p58 subunit" 417 415 418 1417782_at Lass4 "LAG1 homolog, ceramide synthase 4" 415 317 513 1418333_at Mtf1 metal response element binding transcription factor 1 415 386 443 1433810_x_at Ddx5 DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 415 410 420 1428830_at Atm ataxia telangiectasia mutated homolog (human) 414 396 431 1418518_at Furin furin (paired basic amino acid cleaving enzyme) 413 464 362 1454873_at Zfp775 zinc finger protein 775 412 412 412 1418107_at Tcea2 "transcription elongation factor A (SII), 2" 411 423 399 1435344_at Tfdp2 transcription factor Dp 2 411 369 453 1446550_at Gspt1 G1 to S phase transition 1 411 375 446 1419308_at Invs inversin 410 326 495 1434856_at Ankrd44 ankyrin repeat domain 44 410 383 437 1438161_s_at Rfc4 replication factor C (activator 1) 4 409 414 405 1427197_at Atr ataxia telangiectasia and Rad3 related 409 336 481 1456423_at Mbd5 methyl-CpG binding domain protein 5 406 351 462 1426237_at Sp2 Sp2 transcription factor 406 364 448 1455831_at Fus "fusion, derived from t(12;16) malignant liposarcoma 406 543 268 1434746_at Mga MAX gene associated 406 304 507 1429667_at Pou4f1 "POU domain, class 4, transcription factor 1" 405 289 521
185 1416586_at Zfp239 zinc finger protein 239 405 387 423 1437508_at Sp4 trans-acting transcription factor 4 402 448 356 1448497_at Ercc3 "excision repair cross-complementing rodent repair 402 319 485 1426922_s_at Hrb HIV-1 Rev binding protein 399 360 439 1448519_at Tead2 TEA domain family member 2 399 377 420 1415772_at Ncl nucleolin 399 345 452 1421033_a_at Tcerg1 transcription elongation regulator 1 (CA150) 398 371 425 1435953_at Btaf1 "BTAF1 RNA polymerase II, B-TFIID transcription factor- 398 359 437 1437236_a_at Zfp110 zinc finger protein 110 397 390 404 1418607_at Zkscan14 zinc finger with KRAB and SCAN domains 14 395 458 333 1424143_a_at Cdt1 chromatin licensing and DNA replication factor 1 395 406 384 1449041_a_at Trip6 thyroid hormone receptor interactor 6 395 368 422 1429585_s_at Mynn myoneurin 394 387 402 1450854_at Pa2g4 proliferation-associated 2G4 394 381 408 1418494_at Ebf2 early B-cell factor 2 394 462 326 1434453_at Polr3a polymerase (RNA) III (DNA directed) polypeptide A 394 374 414 1439047_s_at Recql RecQ protein-like 393 321 464 1443471_at Zbtb20 zinc finger and BTB domain containing 20 392 393 391 1417516_at Ddit3 DNA-damage inducible transcript 3 390 407 372 1421812_at Tapbp TAP binding protein 388 362 413 1421908_a_at Tcf12 transcription factor 12 387 378 396 1454863_at Ankrd11 ankyrin repeat domain 11 386 357 414 1440255_at LOC100045760 /// similar to MBD2-interacting zinc finger /// MBD2- 386 396 375 1444669_at Lrfn1 leucine rich repeat and fibronectin type III domain 384 342 427 1435329_at Fbxl11 F-box and leucine-rich repeat protein 11 384 329 438 1455303_at Rfxap regulatory factor X-associated protein 382 356 408 1418034_at Mrps9 mitochondrial ribosomal protein S9 382 361 403 1457473_at Chd1 chromodomain helicase DNA binding protein 1 380 297 463
186 1456520_at Zfp652 zinc finger protein 652 380 325 434 1422599_s_at Zfp143 zinc finger protein 143 378 347 408 1453256_at Polr3c polymerase (RNA) III (DNA directed) polypeptide C 377 355 399 1453734_at Atrx alpha thalassemia/mental retardation syndrome X-linked 376 293 459 1428415_at Rnf113a2 ring finger protein 113A2 376 349 402 1434960_at Taf9b "TAF9B RNA polymerase II, TATA box binding protein 375 319 431 1432538_a_at Rfc3 replication factor C (activator 1) 3 374 492 257 1455123_at St18 suppression of tumorigenicity 18 374 488 260 1423312_at Tpbg trophoblast glycoprotein 373 344 402 1417165_at Mbd2 methyl-CpG binding domain protein 2 373 306 439 1456215_at Tfam "transcription factor A, mitochondrial" 371 320 422 1418114_at Rbpj recombination signal binding protein for immunoglobulin 371 395 346 1450086_at Gmeb1 glucocorticoid modulatory element binding protein 1 371 374 367 1450816_at Polg2 "polymerase (DNA directed), gamma 2, accessory 368 377 359 1427970_at Zfp689 zinc finger protein 689 368 329 407 1417780_at Lass4 "LAG1 homolog, ceramide synthase 4" 368 301 434 1417296_at Atf1 /// activating transcription factor 1 /// similar to activating 366 333 399 1455110_at Gabpb2 "GA repeat binding protein, beta 2" 366 330 402 1435057_x_at Polr1e polymerase (RNA) I polypeptide E 365 352 378 1424942_a_at Myc myelocytomatosis oncogene 364 191 538 1418381_at Zfp148 zinc finger protein 148 363 336 391 1424602_s_at Xrcc4 X-ray repair complementing defective repair in Chinese 363 355 371 1418102_at Hes1 hairy and enhancer of split 1 (Drosophila) 362 288 436 1428687_at Zfp687 zinc finger protein 687 361 360 361 1448487_at Lrrfip1 leucine rich repeat (in FLII) interacting protein 1 360 271 449 1432543_a_at Klf13 Kruppel-like factor 13 360 444 275 1440108_at Foxp2 forkhead box P2 359 349 369 1434419_s_at Tardbp TAR DNA binding protein 358 377 338
187 1439025_at Zfp446 zinc finger protein 446 357 342 372 1422570_at Yy1 YY1 transcription factor 356 306 405 1443020_at Hmbox1 homeobox containing 1 354 287 421 1434904_at Hivep2 human immunodeficiency virus type I enhancer binding 354 281 427 1438495_at Top1 topoisomerase (DNA) I 354 360 347 1426422_at Cc2d1a coiled-coil and C2 domain containing 1A 353 336 371 1421889_a_at Aplp2 amyloid beta (A4) precursor-like protein 2 353 366 339 1435282_at Gm967 "gene model 967, (NCBI)" 353 401 304 1444436_at 9630030I15Rik /// RIKEN cDNA 9630030I15 gene /// heat shock factor 2 352 323 382 1423146_at Hes5 hairy and enhancer of split 5 (Drosophila) 352 501 203 1423103_at Rfx5 "regulatory factor X, 5 (influences HLA class II 352 245 460 1424789_at Zscan22 zinc finger and SCAN domain containing 22 352 321 383 1456055_x_at Pold1 "polymerase (DNA directed), delta 1, catalytic subunit" 352 363 341 1422551_at Zkscan3 zinc finger with KRAB and SCAN domains 3 351 370 332 1419976_s_at Nfatc3 "nuclear factor of activated T-cells, cytoplasmic, 351 289 413 1460620_at Zfp592 zinc finger protein 592 351 281 420 1425271_at Psmc3ip "proteasome (prosome, macropain) 26S subunit, ATPase 350 372 328 1427259_at Trim24 tripartite motif-containing 24 350 301 399 1452126_at Zfp160 zinc finger protein 160 350 306 394 1427317_at Kin antigenic determinant of rec-A protein 350 387 312 1442311_at ------349 298 400 1455611_at Pias1 protein inhibitor of activated STAT 1 349 327 370 1419266_at Nfyb nuclear transcription factor-Y beta 348 435 262 1422103_a_at Stat5b signal transducer and activator of transcription 5B 348 280 416 1437983_at Sall1 sal-like 1 (Drosophila) 347 298 396 1420866_at Zfp161 zinc finger protein 161 345 353 338 1452125_at Thrap3 thyroid hormone receptor associated protein 3 345 345 344 1421334_x_at Mynn myoneurin 343 276 409
188 1440187_at Taf3 "TAF3 RNA polymerase II, TATA box binding protein (TBP)- 342 355 328 1436888_at Nhlh2 nescient helix loop helix 2 340 370 310 1433556_at Centa1 "centaurin, alpha 1" 339 353 325 1460633_at Prpf19 PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. 338 404 271 1451576_at Prkdc "protein kinase, DNA activated, catalytic polypeptide" 337 262 412 1419874_x_at Zbtb16 zinc finger and BTB domain containing 16 336 273 400 1418245_a_at Rbm9 RNA binding motif protein 9 336 434 237 1426626_at Gtf2f2 "general transcription factor IIF, polypeptide 2" 335 379 291 1439074_a_at Son Son DNA binding protein 335 326 343 1451639_at Cebpg "CCAAT/enhancer binding protein (C/EBP), gamma" 334 397 271 1452534_a_at Hmgb2 high mobility group box 2 334 387 281 1418342_at Rfc1 replication factor C (activator 1) 1 334 286 381 1426587_a_at Stat3 signal transducer and activator of transcription 3 332 307 357 1448293_at Ebf1 early B-cell factor 1 332 378 286 1452238_at Hrb HIV-1 Rev binding protein 331 285 376 1455658_at Cggbp1 CGG triplet repeat binding protein 1 329 359 298 1457638_x_at Rfc2 replication factor C (activator 1) 2 327 406 249 1438816_at Ahctf1 AT hook containing transcription factor 1 327 350 303 1448007_at Baz2b "bromodomain adjacent to zinc finger domain, 2B" 326 417 234 1434880_at Etv6 ets variant gene 6 (TEL oncogene) 325 299 352 1449510_at Zfp467 zinc finger protein 467 325 250 401 1449913_at Zfp2 zinc finger protein 2 325 296 353 1440037_at Pbx1 pre B-cell leukemia transcription factor 1 323 440 205 1447496_s_at Fank1 fibronectin type 3 and ankyrin repeat domains 1 321 320 322 1457812_at Trp53bp1 transformation related protein 53 binding protein 1 320 256 384 1437495_at LOC100047187 /// "similar to zinc finger, X-linked, duplicated B /// 319 278 360 1419257_at Tcea1 transcription elongation factor A (SII) 1 319 339 298 1427702_at Zfp1 zinc finger protein 1 319 374 263
189 1419164_at Zfp260 zinc finger protein 260 319 284 353 1428522_at Ttf2 "transcription termination factor, RNA polymerase II" 317 291 343 1443583_at LOC100043911 Hypothetical protein LOC100043911 314 268 360 1418437_a_at Mlx MAX-like protein X 311 320 301 1439503_at Zfp28 zinc finger protein 28 310 273 347 1418605_at Nr2c1 "nuclear receptor subfamily 2, group C, member 1" 308 320 296 1460567_at Rfx7 "regulatory factor X, 7" 307 322 291 1427969_s_at Zfp654 zinc finger protein 654 306 285 328 1428727_at Cep192 centrosomal protein 192 306 272 341 1435236_at A630018P17Rik RIKEN cDNA A630018P17 gene 305 304 306 1426460_a_at Ugp2 UDP-glucose pyrophosphorylase 2 305 273 336 1421072_at Irx5 Iroquois related homeobox 5 (Drosophila) 304 440 169 1455173_at Gspt1 G1 to S phase transition 1 304 263 345 1450350_a_at Jdp2 Jun dimerization protein 2 304 290 317 1427730_a_at Zfp148 zinc finger protein 148 303 303 302 1455413_at Zfp11 zinc finger protein 11 302 265 339 1424903_at Jarid1d "jumonji, AT rich interactive domain 1D (Rbp2 like)" 302 221 382 1423389_at Smad7 MAD homolog 7 (Drosophila) 301 297 306 1457946_at Sebox SEBOX homeobox 301 305 297 1455095_at Hist2h2be "histone cluster 2, H2be" 300 309 291 190 Supplemental Table S3. Expressed Genes - Axon guidance/cell adhesion
Axon guidance signaling Affy ID Gene Symbol Gene Title Av R+C+ Av R+ Av C+ 1433770_at Dpysl2 dihydropyrimidinase-like 2 27944 28458 27431 1455138_x_at Cfl1 "cofilin 1, non-muscle" 24411 24243 24579 1418209_a_at Pfn2 profilin 2 20561 19811 21310 1434396_a_at EG433297 /// "predicted gene, EG433297 /// predicted gene, EG667952 /// 20410 20678 20142 1455168_a_at Gnb2l1 "guanine nucleotide binding protein (G protein), beta polypeptide 2 19662 22966 16358 1452649_at Rtn4 reticulon 4 18165 18097 18232 1450186_s_at Gnas "GNAS (guanine nucleotide binding protein, alpha stimulating) 16836 15923 17748 1423985_at Gng5 /// "guanine nucleotide binding protein (G protein), gamma 5 /// similar 16013 17111 14914 1435652_a_at Gnai2 "guanine nucleotide binding protein (G protein), alpha inhibiting 2" 14410 15767 13053 191 1428608_at Mylc2b "myosin light chain, regulatory B" 13086 13772 12400 1454696_at Gnb1 "guanine nucleotide binding protein (G protein), beta 1" 12691 11644 13737 1437148_at Arpc2 "actin related protein 2/3 complex, subunit 2" 11796 12503 11089 1440487_at Dcc deleted in colorectal carcinoma 9946 8483 11408 1434325_x_at Prkar1b "protein kinase, cAMP dependent regulatory, type I beta" 9653 9347 9958 1434968_a_at Actr3 ARP3 actin-related protein 3 homolog (yeast) 9139 8778 9500 1450623_at Gnb2 "guanine nucleotide binding protein (G protein), beta 2" 8727 11007 6448 1452032_at Prkar1a "protein kinase, cAMP dependent regulatory, type I, alpha" 8468 8418 8519 1450435_at L1cam L1 cell adhesion molecule 8124 6447 9801 1452915_at Prkar2a "protein kinase, cAMP dependent regulatory, type II alpha" 8012 8489 7534 1450070_s_at Pak1 p21 (CDKN1A)-activated kinase 1 7329 6948 7711 1435486_at Pak3 p21 (CDKN1A)-activated kinase 3 7187 7295 7079 1447720_x_at Prkaca "protein kinase, cAMP dependent, catalytic, alpha" 7112 7297 6926 1454958_at Gsk3b glycogen synthase kinase 3 beta 7089 6958 7220 1428156_at Gng2 "guanine nucleotide binding protein (G protein), gamma 2" 6980 6509 7451 1423332_at Sdcbp syndecan binding protein 6943 6649 7238 1417428_at Gng3 "guanine nucleotide binding protein (G protein), gamma 3" 6691 7113 6269 1448279_at Arpc3 "actin related protein 2/3 complex, subunit 3" 6013 7210 4816 1452587_at Actr2 ARP2 actin-related protein 2 homolog (yeast) 5940 5411 6469 1448129_at Arpc5 "actin related protein 2/3 complex, subunit 5" 5544 5793 5294 1447669_s_at Gng4 "guanine nucleotide binding protein (G protein), gamma 4" 5435 4118 6751 1428645_at Gnai3 "guanine nucleotide binding protein (G protein), alpha inhibiting 3" 5389 4853 5926 1418067_at Cfl2 "cofilin 2, muscle" 5044 5155 4934 1428473_at Ppp3cb "protein phosphatase 3, catalytic subunit, beta isoform" 4800 4582 5018 1429559_at Gnaq "guanine nucleotide binding protein, alpha q polypeptide" 4748 4626 4870 1454959_s_at Gnai1 "guanine nucleotide binding protein (G protein), alpha inhibiting 1" 4416 4163 4668 1435519_at LOC100048397 similar to GTP-binding protein (smg p21B) /// RAS related protein 1b 4415 4098 4731 1428103_at Adam10 a disintegrin and metallopeptidase domain 10 4351 4107 4595 1451086_s_at Rac1 RAS-related C3 botulinum substrate 1 4118 3302 4933 192 1416078_s_at Raf1 v-raf-leukemia viral oncogene 1 4114 4194 4033 1454974_at LOC672215 /// similar to Netrin-1 precursor /// netrin 1 4096 3111 5080 1424588_at Srgap3 SLIT-ROBO Rho GTPase activating protein 3 4052 3457 4646 1435349_at Nrp2 /// Pard3b neuropilin 2 /// par-3 partitioning defective 3 homolog B (C. elegans) 3992 6716 1267 1451225_at Ptpn11 "protein tyrosine phosphatase, non-receptor type 11" 3955 3674 4237 1460419_a_at Prkcb "protein kinase C, beta" 3924 3937 3910 1416657_at Akt1 /// thymoma viral proto-oncogene 1 /// similar to serine/threonine 3819 4100 3537 1434000_at Kras v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 3779 3444 4114 1456482_at Pik3r3 "phosphatidylinositol 3 kinase, regulatory subunit, polypeptide 3 3684 3574 3794 1423085_at Efnb3 ephrin B3 3639 4082 3196 1450649_at Gng10 "guanine nucleotide binding protein (G protein), gamma 10" 3634 3746 3521 1448248_at Crk v-crk sarcoma virus CT10 oncogene homolog (avian) 3592 3243 3941 1420554_a_at Rac3 RAS-related C3 botulinum substrate 3 3578 4585 2571 1452044_at Arpc5l "actin related protein 2/3 complex, subunit 5-like" 3303 3420 3186 1419169_at Mapk6 mitogen-activated protein kinase 6 3280 2566 3995 1453104_at Mapk1 mitogen-activated protein kinase 1 3242 2842 3643 1436869_at Shh sonic hedgehog 3240 2199 4281 1433591_at Ppp3r1 "protein phosphatase 3, regulatory subunit B, alpha isoform 3236 2928 3544 1423902_s_at Arhgef12 Rho guanine nucleotide exchange factor (GEF) 12 3157 3055 3258 1416079_a_at Arpc1a "actin related protein 2/3 complex, subunit 1A" 3144 3273 3015 1427060_at Mapk3 mitogen-activated protein kinase 3 3030 3145 2915 1439388_s_at Bcar1 breast cancer anti-estrogen resistance 1 2986 2784 3189 1426476_at Rasa1 RAS p21 protein activator 1 2923 2871 2974 1434254_at Gna11 "guanine nucleotide binding protein, alpha 11" 2837 2942 2732 1424139_at Rap1a RAS-related protein-1a 2836 2671 3001 1435879_at Akt3 thymoma viral proto-oncogene 3 2670 2520 2821 1449290_at Dpysl5 dihydropyrimidinase-like 5 2633 2597 2669 1415974_at Map2k2 mitogen-activated protein kinase kinase 2 2577 2830 2325 1424659_at Slit2 slit homolog 2 (Drosophila) 2554 2390 2718 193 1455188_at Ephb1 Eph receptor B1 2523 3455 1590 1420820_at 2900073G15Rik RIKEN cDNA 2900073G15 gene 2496 2624 2368 1437628_s_at Rhoa "ras homolog gene family, member A" 2471 2594 2347 1420611_at Prkacb "protein kinase, cAMP dependent, catalytic, beta" 2408 2257 2558 1426401_at Ppp3ca "protein phosphatase 3, catalytic subunit, alpha isoform" 2376 2155 2597 1448689_at Rras2 related RAS viral (r-ras) oncogene homolog 2 2362 2875 1849 1421152_a_at Gnao1 "guanine nucleotide binding protein, alpha O" 2331 1801 2860 1416683_at Plxnb2 plexin B2 2279 2472 2085 1435885_s_at Itsn1 intersectin 1 (SH3 domain protein 1A) 2271 2223 2320 1435254_at Plxnb1 plexin B1 2227 2223 2232 1456475_s_at Prkar2b "protein kinase, cAMP dependent regulatory, type II beta" 2201 2064 2338 1424482_at Arhgef7 Rho guanine nucleotide exchange factor (GEF7) 2171 2088 2253 1428853_at Ptch1 patched homolog 1 2135 2137 2133 1448765_at Fyn Fyn proto-oncogene 2075 2035 2114 1428623_at Plxna1 plexin A1 2022 2069 1976 1423220_at Eif4e eukaryotic translation initiation factor 4E 1941 1763 2119 1433749_at Gna13 "guanine nucleotide binding protein, alpha 13" 1915 1710 2120 1448023_at Kalrn "kalirin, RhoGEF kinase" 1893 2099 1686 1449018_at Pfn1 profilin 1 1890 2428 1351 1425296_a_at Rgs3 regulator of G-protein signaling 3 1840 2175 1506 1422407_s_at Hras1 Harvey rat sarcoma virus oncogene 1 1828 2347 1309 1444606_at Efna2 ephrin A2 1827 2035 1619 1426238_at Bmp1 bone morphogenetic protein 1 1810 1617 2002 1456135_s_at Pxn paxillin 1809 1808 1810 1423589_at Arpc4 "actin related protein 2/3 complex, subunit 4" 1803 2324 1282 1451898_a_at Sema6c "sema domain, transmembrane domain (TM), and cytoplasmic 1802 2034 1569 1434389_at Sos1 Son of sevenless homolog 1 (Drosophila) 1770 1578 1963 1423999_at Abl1 "c-abl oncogene 1, receptor tyrosine kinase" 1766 1482 2050 1420996_at Plxna3 plexin A3 1749 1427 2071 194 1425015_at Ephb2 Eph receptor B2 1719 1876 1562 1460326_at Pik3ca "phosphatidylinositol 3-kinase, catalytic, alpha polypeptide" 1671 1491 1851 1417627_a_at Limk1 "LIM-domain containing, protein kinase" 1656 1700 1613 1435268_at ------1652 1736 1567 1420809_a_at 1500003O03Rik RIKEN cDNA 1500003O03 gene /// similar to EF-hand Ca2+ binding 1634 1617 1651 1423059_at Ptk2 PTK2 protein tyrosine kinase 2 1632 1419 1846 1447946_at Adam23 a disintegrin and metallopeptidase domain 23 1616 1139 2094 1418508_a_at Grb2 growth factor receptor bound protein 2 1615 1474 1756 1433920_at Sema4c "sema domain, immunoglobulin domain (Ig), transmembrane 1611 1681 1542 1419470_at Gnb4 "guanine nucleotide binding protein (G protein), beta 4" 1579 1415 1743 1452193_a_at Wasl Wiskott-Aldrich syndrome-like (human) 1573 1536 1610 1439768_x_at Sema4f "sema domain, immunoglobulin domain (Ig), TM domain, and short 1540 1303 1777 1435286_at Epha5 Eph receptor A5 1535 1974 1097 1437386_at Lingo1 leucine rich repeat and Ig domain containing 1 1502 1427 1576 1450674_at Cdk5 cyclin-dependent kinase 5 1476 1788 1163 1458622_at Ntrk2 "neurotrophic tyrosine kinase, receptor, type 2" 1450 595 2304 1418402_at Adam19 /// a disintegrin and metallopeptidase domain 19 (meltrin beta) /// 1437 1130 1743 1454887_at Pak2 p21 (CDKN1A)-activated kinase 2 1409 1308 1511 1435771_at Plcb4 "phospholipase C, beta 4" 1361 1025 1697 1435293_at Adam22 a disintegrin and metallopeptidase domain 22 1341 1078 1604 1434406_at Srgap2 SLIT-ROBO Rho GTPase activating protein 2 1328 1059 1597 1427231_at Robo1 roundabout homolog 1 (Drosophila) 1322 1747 898 1448943_at Nrp1 neuropilin 1 1322 1380 1263 1450994_at Rock1 Rho-associated coiled-coil containing protein kinase 1 1315 1001 1628 1449202_at Sema4g "sema domain, immunoglobulin domain (Ig), transmembrane 1272 1210 1334 1416796_at LOC100044475 similar to SH2/SH3 adaptor protein /// non-catalytic region of 1238 1227 1249 1452060_a_at Limk2 LIM motif-containing protein kinase 2 1207 1120 1294 1422208_a_at Gnb5 "guanine nucleotide binding protein (G protein), beta 5" 1097 1203 990 1417690_at Prkag1 "protein kinase, AMP-activated, gamma 1 non-catalytic subunit" 1086 1256 916 195 1423213_at Plxnc1 plexin C1 1052 1094 1010 1418085_at Prkcz "protein kinase C, zeta" 1039 1038 1039 1418463_at Pik3r2 "phosphatidylinositol 3-kinase, regulatory subunit, polypeptide 2 1032 1101 963 1417410_s_at Prkci "protein kinase C, iota" 1010 871 1149 1436950_at Crkl v-crk sarcoma virus CT10 oncogene homolog (avian)-like 981 1162 800 1418534_at Fzd2 frizzled homolog 2 (Drosophila) 965 1009 921 1438934_x_at Sema4a "sema domain, immunoglobulin domain (Ig), transmembrane 936 915 958 1454708_at Ablim1 actin-binding LIM protein 1 936 713 1158 1436866_at Efna5 ephrin A5 900 763 1036 1450024_at Sufu suppressor of fused homolog (Drosophila) 899 841 958 1455426_at Epha3 Eph receptor A3 894 371 1417 1451550_at Ephb3 Eph receptor B3 891 834 948 1418286_a_at Efnb1 ephrin B1 884 986 781 1437393_at Prkca "protein kinase C, alpha" 868 763 973 1448710_at Cxcr4 chemokine (C-X-C motif) receptor 4 863 920 805 1453055_at Sema6d "sema domain, transmembrane domain (TM), and cytoplasmic 856 687 1025 1434926_at Arhgef11 Rho guanine nucleotide exchange factor (GEF) 11 853 805 901 1449730_s_at Fzd3 frizzled homolog 3 (Drosophila) 839 852 825 1429021_at Epha4 Eph receptor A4 836 1006 666 1459903_at Sema7a "sema domain, immunoglobulin domain (Ig), and GPI membrane 834 907 760 1424480_s_at Akt2 /// thymoma viral proto-oncogene 2 /// similar to serine/threonine 826 883 768 1454903_at Ngfr "nerve growth factor receptor (TNFR superfamily, member 16)" 817 931 702 1451097_at Vasp vasodilator-stimulated phosphoprotein 813 889 737 1440981_at Pak7 p21 (CDKN1A)-activated kinase 7 805 758 851 1427049_s_at Smo smoothened homolog (Drosophila) 803 695 911 1455917_at Ntrk3 "neurotrophic tyrosine kinase, receptor, type 3" 799 936 662 1455678_at Sema4b "sema domain, immunoglobulin domain (Ig), transmembrane 787 824 750 1452281_at Sos2 Son of sevenless homolog 2 (Drosophila) 786 738 834 1416351_at Map2k1 mitogen-activated protein kinase kinase 1 767 687 847 196 1425277_at Slit1 slit homolog 1 (Drosophila) 767 677 857 1419732_at Rtn4r reticulon 4 receptor 765 885 645 1428548_at Pak4 p21 (CDKN1A)-activated kinase 4 765 775 755 1453419_at Mras muscle and microspikes RAS 760 624 896 1416598_at Glis2 GLIS family zinc finger 2 758 679 837 1416094_at Adam9 a disintegrin and metallopeptidase domain 9 (meltrin gamma) 756 582 930 1423831_at Prkag2 "protein kinase, AMP-activated, gamma 2 non-catalytic subunit" 756 746 767 1455158_at Itga3 integrin alpha 3 721 781 661 1420824_at Sema4d "sema domain, immunoglobulin domain (Ig), transmembrane 706 524 889 1419639_at Efnb2 ephrin B2 693 633 753 1449522_at Unc5c unc-5 homolog C (C. elegans) 687 539 834 1421023_at Pik3c2a "phosphatidylinositol 3-kinase, C2 domain containing, alpha 668 547 788 1434013_at Ablim3 "actin binding LIM protein family, member 3" 638 721 555 1418060_a_at Mapk7 mitogen-activated protein kinase 7 635 606 664 1438682_at Pik3r1 "phosphatidylinositol 3-kinase, regulatory subunit, polypeptide 1 634 481 787 1451991_at Epha7 Eph receptor A7 631 669 593 1439957_at Gnal "guanine nucleotide binding protein, alpha stimulating, olfactory 625 515 735 1449187_at Pdgfa "platelet derived growth factor, alpha" 613 555 670 1421487_a_at Nck1 non-catalytic region of tyrosine kinase adaptor protein 1 561 506 615 1434733_at Stk36 "serine/threonine kinase 36 (fused homolog, Drosophila)" 553 484 622 1455037_at Plxna2 plexin A2 553 637 469 1438999_a_at Nfat5 nuclear factor of activated T-cells 5 503 363 643 1456439_x_at Mical1 "microtubule associated monoxygenase, calponin and LIM domain 494 451 537 1437284_at Fzd1 frizzled homolog 1 (Drosophila) 474 556 391 1422847_a_at Prkcd "protein kinase C, delta" 468 484 452 1421858_at Adam17 a disintegrin and metallopeptidase domain 17 458 343 573 1426918_at Itgb1 integrin beta 1 (fibronectin receptor beta) 439 402 477 1420508_at Sema3f "sema domain, immunoglobulin domain (Ig), short basic domain, 439 399 479 1455270_at Adam11 a disintegrin and metallopeptidase domain 11 422 484 360 197 1431170_at Efna3 /// ephrin A3 /// similar to Ephrin A3 416 396 435 1453281_at Pik3cd phosphatidylinositol 3-kinase catalytic delta polypeptide 408 369 448 1436791_at Wnt5a wingless-related MMTV integration site 5A 389 403 375 1440484_at Unc5d unc-5 homolog D (C. elegans) 376 381 370 1425580_a_at Pik3c3 "phosphoinositide-3-kinase, class 3" 360 313 408 1455200_at Pak6 p21 (CDKN1A)-activated kinase 6 356 392 319 1419976_s_at Nfatc3 "nuclear factor of activated T-cells, cytoplasmic, calcineurin- 351 289 413 1442823_at ------345 378 311 1451041_at Rock2 Rho-associated coiled-coil containing protein kinase 2 314 263 365
Cell adhesion
Chl1 Affy ID Gene Symbol Gene Title Av R+C+ Av R+ Av C+ 1435190_at Chl1 cell adhesion molecule with homology to L1CAM 8867 9592 8142 1417795_at Chl1 cell adhesion molecule with homology to L1CAM 953 1207 699 Integrin Affy ID Gene Symbol Gene Title Av R+C+ Av R+ Av C+ 1428103_at Adam10 a disintegrin and metallopeptidase domain 10 4351 4107 4595 1428187_at Cd47 "CD47 antigen (Rh-related antigen, integrin-associated signal 3629 2395 4864 1419554_at Cd47 "CD47 antigen (Rh-related antigen, integrin-associated signal 2314 1601 3028 1419041_at Itfg1 integrin alpha FG-GAP repeat containing 1 1853 1902 1803 1449507_a_at Cd47 "CD47 antigen (Rh-related antigen, integrin-associated signal 1845 1602 2088 1447946_at Adam23 a disintegrin and metallopeptidase domain 23 1616 1139 2094 1435637_at Itfg1 integrin alpha FG-GAP repeat containing 1 1542 1598 1486 1418402_at Adam19 /// a disintegrin and metallopeptidase domain 19 (meltrin beta) /// 1437 1130 1743 1449942_a_at Ilk integrin linked kinase 1433 1518 1348 1435293_at Adam22 a disintegrin and metallopeptidase domain 22 1341 1078 1604 198 1422852_at Cib2 calcium and integrin binding family member 2 906 1167 644 1452506_a_at Ilkap integrin-linked kinase-associated serine/threonine phosphatase 2C 873 1117 629 1452784_at Itgav integrin alpha V 761 556 967 1416094_at Adam9 a disintegrin and metallopeptidase domain 9 (meltrin gamma) 756 582 930 1455158_at Itga3 integrin alpha 3 721 781 661 1434387_at Itfg3 integrin alpha FG-GAP repeat containing 3 707 627 788 1448564_at Cib1 calcium and integrin binding 1 (calmyrin) 667 691 642 1422157_a_at Itgb1bp1 integrin beta 1 binding protein 1 597 686 507 1422445_at Itga6 integrin alpha 6 554 502 606 1418032_at Itfg2 integrin alpha FG-GAP repeat containing 2 534 417 651 1439827_at Adamts12 "a disintegrin-like and metallopeptidase (reprolysin type) with 504 218 791 1453784_at Ilkap integrin-linked kinase-associated serine/threonine phosphatase 2C 469 449 489 1443378_s_at Adam1a a disintegrin and metallopeptidase domain 1a 459 320 599 1421858_at Adam17 a disintegrin and metallopeptidase domain 17 458 343 573 1426918_at Itgb1 integrin beta 1 (fibronectin receptor beta) 439 402 477 1455270_at Adam11 a disintegrin and metallopeptidase domain 11 422 484 360 L1 Affy ID Gene Symbol Gene Title Av R+C+ Av R+ Av C+ 1450435_at L1cam L1 cell adhesion molecule 8124 6447 9801
Ncam Affy ID Gene Symbol Gene Title Av R+C+ Av R+ Av C+ 1426864_a_at Ncam1 neural cell adhesion molecule 1 16653 16184 17122 1426865_a_at Ncam1 neural cell adhesion molecule 1 2646 3899 1392 1439556_at Ncam1 neural cell adhesion molecule 1 1729 1396 2063
Nectin Affy ID Gene Symbol Gene Title Av R+C+ Av R+ Av C+ 199 1420484_a_at Vtn vitronectin 2725 1717 3733 1434329_s_at Adipor2 adiponectin receptor 2 2051 1910 2192 1455434_a_at Ktn1 kinectin 1 1994 1562 2425 1426903_at Fndc3a fibronectin type III domain containing 3a 1619 1417 1821 1435026_at Spock2 "sparc/osteonectin, cwcv and kazal-like domains proteoglycan 2" 1426 1336 1516 1433833_at Fndc3b fibronectin type III domain containing 3B 1329 1128 1529 1439017_x_at Adipor1 adiponectin receptor 1 1317 1198 1437 1429310_at Flrt3 fibronectin leucine rich transmembrane protein 3 1088 1698 479 1419672_at Spock1 "sparc/osteonectin, cwcv and kazal-like domains proteoglycan 1" 897 573 1221 1456767_at Lrfn3 leucine rich repeat and fibronectin type III domain containing 3 806 900 711 1451311_a_at Adipor1 adiponectin receptor 1 800 671 928 1426642_at Fn1 fibronectin 1 724 537 911 1449979_a_at Spock3 "sparc/osteonectin, cwcv and kazal-like domains proteoglycan 3" 674 864 484 1455098_a_at Vtn vitronectin 632 491 772 1453102_at Flrt3 /// fibronectin leucine rich transmembrane protein 3 /// similar to 623 902 344 1423331_a_at LOC100047693 similar to cell adhesion molecule nectin-3 beta /// poliovirus 537 500 573 1454700_at Lrfn4 leucine rich repeat and fibronectin type III domain containing 4 507 614 399 1421133_at LOC100047693 similar to cell adhesion molecule nectin-3 beta /// poliovirus 446 449 442 1426918_at Itgb1 integrin beta 1 (fibronectin receptor beta) 439 402 477 1460041_at Flrt1 fibronectin leucine rich transmembrane protein 1 419 342 496 1431226_a_at Fndc4 fibronectin type III domain containing 4 415 496 333 1444669_at Lrfn1 leucine rich repeat and fibronectin type III domain containing 1 384 342 427 1424312_at Adipor1 adiponectin receptor 1 354 374 333 1455096_at Flrt2 fibronectin leucine rich transmembrane protein 2 343 485 202 1447496_s_at Fank1 fibronectin type 3 and ankyrin repeat domains 1 321 320 322
Cadherin Affy ID Gene Symbol Gene Title Av R+C+ Av R+ Av C+ 1420811_a_at Ctnnb1 "catenin (cadherin associated protein), beta 1" 16110 16116 16103 200 1418815_at Cdh2 /// cadherin 2 /// similar to N-cadherin 8055 7675 8434 1447825_x_at Pcdh8 protocadherin 8 4920 3215 6625 1420798_s_at LOC100046214 "similar to protocadherin alpha 11 /// protocadherin alpha 1 /// 3912 4638 3185 1435336_at Celsr2 "cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo 3792 4030 3553 1448895_a_at Ctnna2 "catenin (cadherin associated protein), alpha 2" 2792 2772 2812 1423628_s_at Pcdhga1 /// "protocadherin gamma subfamily A, 1 /// protocadherin gamma 2756 3172 2340 1434115_at Cdh13 cadherin 13 2679 4418 939 1422592_at Ctnnd2 /// "catenin (cadherin associated protein), delta 2 /// similar to arm- 2592 2483 2701 1424767_at Cdh22 /// cadherin 22 /// similar to cadherin 22 2310 2361 2259 1450008_a_at Ctnnb1 "catenin (cadherin associated protein), beta 1" 2286 2393 2178 1425067_at Celsr3 "cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo 2254 2433 2075 1448149_at Ctnna1 "catenin (cadherin associated protein), alpha 1" 2251 2009 2493 1437807_x_at Ctnna1 "catenin (cadherin associated protein), alpha 1" 2113 1983 2244 1417051_at Pcdh8 protocadherin 8 2048 1374 2723 1455145_at Pcdh19 protocadherin 19 1964 3264 664 1456116_at Ctnnd2 /// "catenin (cadherin associated protein), delta 2 /// similar to arm- 1914 2212 1617 1449244_at Cdh2 /// cadherin 2 /// similar to N-cadherin 1827 1742 1912 1437360_at Pcdh19 protocadherin 19 1703 2723 684 1453070_at Pcdh17 protocadherin 17 1319 1592 1045 1429861_at Pcdh9 protocadherin 9 1313 1641 984 1442659_at Pcdh9 protocadherin 9 1038 1509 568 1422073_a_at Celsr2 "cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo 1038 1266 810 1424341_s_at LOC100046214 "similar to protocadherin alpha 11 /// protocadherin alpha 1 /// 925 971 879 1456397_at Cdh4 cadherin 4 825 502 1147 1450757_at Cdh11 cadherin 11 805 891 719 1437448_s_at Ctnnd1 "catenin (cadherin associated protein), delta 1" 770 675 864 1449422_at Cdh4 cadherin 4 747 816 679 1436920_at Pcdh17 protocadherin 17 588 831 345 1438134_at Pcdh10 protocadherin 10 553 605 502 201 1448933_at Pcdhb17 protocadherin beta 17 540 539 541 1425092_at Cdh10 cadherin 10 449 301 598 1449583_at Pcdhb20 protocadherin beta 20 429 417 441 1449527_at Pcdhb7 protocadherin beta 7 385 410 359 1422640_at Pcdhb9 protocadherin beta 9 341 361 321 1460538_at Cdh10 cadherin 10 322 293 352 1418925_at Celsr1 "cadherin, EGF LAG seven-pass G-type receptor 1 (flamingo 305 244 366 Supplemental Table S4. Expressed Genes - Ion channels.
Affy ID Gene Symbol Gene Title Av R+C+ Av R+ Av C+ 1436992_x_at Vdac1 voltage-dependent anion channel 1 11579 11331 11826 1416175_a_at Vdac3 voltage-dependent anion channel 3 10467 10984 9950 1437192_x_at Vdac1 voltage-dependent anion channel 1 9900 9394 10406 1433643_at Cacna2d1 "calcium channel, voltage-dependent, alpha2/delta subunit 1" 6855 6203 7507 1420295_x_at Clcn5 chloride channel 5 6302 6165 6440 1415990_at Vdac2 voltage-dependent anion channel 2 6272 6792 5752 1448656_at Cacnb3 "calcium channel, voltage-dependent, beta 3 subunit" 5190 5652 4728 1435722_at Gria4 /// "glutamate receptor, ionotropic, AMPA4 (alpha 4) /// hypothetical 3704 3978 3429 1415998_at Vdac1 voltage-dependent anion channel 1 3362 4050 2673 1438366_x_at Clcn3 chloride channel 3 3254 3353 3156 202 1451595_a_at Kcnq2 "potassium voltage-gated channel, subfamily Q, member 2" 3004 2915 3093 1435021_at Gabrb3 "gamma-aminobutyric acid (GABA-A) receptor, subunit beta 3" 2921 2211 3631 1438606_a_at Clic4 chloride intracellular channel 4 (mitochondrial) 2660 2805 2515 1455328_at Accn2 "amiloride-sensitive cation channel 2, neuronal" 2604 2351 2856 1450975_at Cacng4 "calcium channel, voltage-dependent, gamma subunit 4" 2557 2991 2124 1437947_x_at Vdac1 voltage-dependent anion channel 1 2517 2429 2604 1439204_at Scn3a "sodium channel, voltage-gated, type III, alpha" 2339 2036 2641 1455440_at Clcn6 chloride channel 6 1986 1545 2427 1418784_at Grik5 "glutamate receptor, ionotropic, kainate 5 (gamma 2)" 1898 1917 1878 1452625_at Kctd2 potassium channel tetramerisation domain containing 2 1779 1653 1905 1423936_at Kctd5 potassium channel tetramerisation domain containing 5 1754 1621 1887 1417810_a_at Kcnb1 /// "potassium voltage gated channel, Shab-related subfamily, member 1627 1169 2084 1416656_at Clic1 chloride intracellular channel 1 1614 1554 1674 1429400_at Clcn5 chloride channel 5 1445 1424 1465 1449544_a_at Kcnh2 /// "potassium voltage-gated channel, subfamily H (eag-related), 1443 1281 1605 1435720_at Kcnd3 "potassium voltage-gated channel, Shal-related family, member 3" 1433 1274 1591 1449471_at Kcnmb4 /// "potassium large conductance calcium-activated channel, subfamily 1414 1455 1372 1422710_a_at Cacna1h "calcium channel, voltage-dependent, T type, alpha 1H subunit" 1311 1166 1456 1420296_at Clcn5 Chloride channel 5 1288 1433 1143 1423393_at Clic4 chloride intracellular channel 4 (mitochondrial) 1280 1366 1193 1428203_at Gabrb2 "gamma-aminobutyric acid (GABA-A) receptor, subunit beta 2" 1217 837 1597 1416610_a_at Clcn3 chloride channel 3 1211 1281 1142 1440168_x_at Kctd7 potassium channel tetramerisation domain containing 7 1181 1264 1099 1441870_s_at Pkd2 polycystic kidney disease 2 1099 749 1449 1440210_at Cacng2 "calcium channel, voltage-dependent, gamma subunit 2" 996 984 1007 1436428_at Chrnb2 "cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal)" 923 950 895 1416799_at Trpm7 "transient receptor potential cation channel, subfamily M, member 917 789 1044 1459579_at Cacng8 "Calcium channel, voltage-dependent, gamma subunit 8" 912 877 947 1421970_a_at Gria2 "glutamate receptor, ionotropic, AMPA2 (alpha 2)" 906 662 1151 203 1454917_at Alg10b "asparagine-linked glycosylation 10 homolog B (yeast, alpha-1,2- 875 860 890 1419719_at Gabrb1 "gamma-aminobutyric acid (GABA-A) receptor, subunit beta 1" 859 1352 366 1423937_at Kctd5 potassium channel tetramerisation domain containing 5 853 997 709 1423392_at Clic4 chloride intracellular channel 4 (mitochondrial) 757 877 637 1418177_at Gabrg2 "gamma-aminobutyric acid (GABA-A) receptor, subunit gamma 2" 739 722 755 1457683_at Grik2 "glutamate receptor, ionotropic, kainate 2 (beta 2)" 731 641 821 1416935_at Trpv2 "transient receptor potential cation channel, subfamily V, member 717 673 761 1436912_at Cacnb4 "calcium channel, voltage-dependent, beta 4 subunit" 707 569 845 1428204_at Gabrb2 "gamma-aminobutyric acid (GABA-A) receptor, subunit beta 2" 670 626 714 1460210_at Pkd1 polycystic kidney disease 1 homolog 660 525 794 1449158_at Kcnk2 "potassium channel, subfamily K, member 2" 645 534 756 1423515_at Scn8a "sodium channel, voltage-gated, type VIII, alpha" 639 500 778 1434146_at Gria2 "glutamate receptor, ionotropic, AMPA2 (alpha 2)" 620 424 815 1451023_at Hcn3 "hyperpolarization-activated, cyclic nucleotide-gated K+ 3" 607 657 556 1437147_at Gabrg2 "gamma-aminobutyric acid (GABA-A) receptor, subunit gamma 2" 602 568 637 1452702_at Clcn7 chloride channel 7 600 489 711 1423365_at Cacna1g "calcium channel, voltage-dependent, T type, alpha 1G subunit" 573 341 805 1422835_at Kcnd2 "potassium voltage-gated channel, Shal-related family, member 2" 571 720 422 1417753_at Pkd2 polycystic kidney disease 2 553 426 680 1428205_x_at Gabrb2 "gamma-aminobutyric acid (GABA-A) receptor, subunit beta 2" 549 507 590 1428186_at Kctd6 potassium channel tetramerisation domain containing 6 492 465 519 1442810_x_at Scn9a "sodium channel, voltage-gated, type IX, alpha" 486 288 683 1416956_at Kcnab2 "potassium voltage-gated channel, shaker-related subfamily, beta 484 434 534 1435933_at Scn2a1 "sodium channel, voltage-gated, type II, alpha 1" 483 381 585 1437091_at Accn4 "amiloride-sensitive cation channel 4, pituitary" 481 379 583 1443855_at Kcnc1 "potassium voltage gated channel, Shaw-related subfamily, member 475 452 498 1457412_at Scn8a "sodium channel, voltage-gated, type VIII, alpha" 473 431 515 1459850_x_at Glrb "glycine receptor, beta subunit" 468 437 500 1440861_a_at Kcnc3 "potassium voltage gated channel, Shaw-related subfamily, member 447 447 448 204 1449248_at Clcn2 chloride channel 2 432 309 555 1431355_s_at Trpm7 "transient receptor potential cation channel, subfamily M, member 429 448 410 1435942_at Kcnq2 "potassium voltage-gated channel, subfamily Q, member 2" 429 480 378 1440397_at Cacna2d1 "calcium channel, voltage-dependent, alpha2/delta subunit 1" 426 455 397 1456944_at Kcnc1 "potassium voltage gated channel, Shaw-related subfamily, member 404 324 483 1435549_at Trpm4 "transient receptor potential cation channel, subfamily M, member 403 400 406 1448459_at Kcnip1 Kv channel-interacting protein 1 397 233 561 1437879_at Alg10b "asparagine-linked glycosylation 10 homolog B (yeast, alpha-1,2- 390 356 425 1436134_at Scn2b "sodium channel, voltage-gated, type II, beta" 386 391 381 1427974_s_at Cacna1d "calcium channel, voltage-dependent, L type, alpha 1D subunit" 381 229 532 1434098_at Glra2 "glycine receptor, alpha 2 subunit" 348 453 244 1457003_at Grin2b "glutamate receptor, ionotropic, NMDA2B (epsilon 2)" 346 204 488 1453098_at Gria2 "glutamate receptor, ionotropic, AMPA2 (alpha 2)" 344 324 363 1434930_at Tpcn1 two pore channel 1 331 263 398 1440681_at Chrna7 "cholinergic receptor, nicotinic, alpha polypeptide 7" 311 269 353 1440980_at Kcnh8 "potassium voltage-gated channel, subfamily H (eag-related), 306 295 317 Supplemental Table S5. Expressed Genes - Solute carriers.
Affy ID Gene Symbol Gene Title Av R+C+ Av R+ Av C+ 1443749_x_at Slc1a3 "solute carrier family 1 (glial high affinity glutamate transporter), member 3" 1032 460 1603 1456003_a_at Slc1a4 "solute carrier family 1 (glutamate/neutral amino acid transporter), member 4" 570 461 678 1452031_at Slc1a3 "solute carrier family 1 (glial high affinity glutamate transporter), member 3" 457 329 584 1434773_a_at Slc2a1 "solute carrier family 2 (facilitated glucose transporter), member 1" 1059 972 1145 1437052_s_at Slc2a3 "solute carrier family 2 (facilitated glucose transporter), member 3" 857 474 1239 1435387_at Slc2a13 "solute carrier family 2 (facilitated glucose transporter), member 13" 712 612 812 1426599_a_at Slc2a1 "solute carrier family 2 (facilitated glucose transporter), member 1" 492 439 545 1455898_x_at Slc2a3 "solute carrier family 2 (facilitated glucose transporter), member 3" 407 240 574 1425364_a_at Slc3a2 "solute carrier family 3 (activators of dibasic and neutral amino acid transport), 2556 2919 2192 1438673_at Slc4a7 "solute carrier family 4, sodium bicarbonate cotransporter, member 7" 2439 2278 2599 1418485_at Slc4a3 "solute carrier family 4 (anion exchanger), member 3" 947 888 1005 1437758_a_at Slc4a1ap "solute carrier family 4 (anion exchanger), member 1, adaptor protein" 499 506 492 205 1455876_at Slc4a7 "solute carrier family 4, sodium bicarbonate cotransporter, member 7" 410 465 355 1435484_at Slc5a3 "solute carrier family 5 (inositol transporters), member 3" 2913 2531 3294 1417150_at Slc6a4 "solute carrier family 6 (neurotransmitter transporter, serotonin), member 4" 11640 13939 9341 1417116_at Slc6a8 "solute carrier family 6 (neurotransmitter transporter, creatine), member 8" 1357 1171 1542 1452142_at Slc6a1 "solute carrier family 6 (neurotransmitter transporter, GABA), member 1" 2786 2254 3318 1426712_at Slc6a15 "solute carrier family 6 (neurotransmitter transporter), member 15" 1059 1467 650 1436137_at Slc6a17 "solute carrier family 6 (neurotransmitter transporter), member 17" 2598 3587 1608 1437149_at Slc6a6 "solute carrier family 6 (neurotransmitter transporter, taurine), member 6" 980 1076 884 1433467_at Slc7a6 "solute carrier family 7 (cationic amino acid transporter, y+ system), member 6" 1603 1493 1712 1454991_at Slc7a1 "solute carrier family 7 (cationic amino acid transporter, y+ system), member 1" 848 750 946 1460541_at Slc7a6 "solute carrier family 7 (cationic amino acid transporter, y+ system), member 6" 736 616 855 1426068_at Slc7a4 "solute carrier family 7 (cationic amino acid transporter, y+ system), member 4" 697 775 618 1418326_at LOC100047619 /// "similar to solute carrier family 7 (cationic amino acid transporter, y+ system), 599 401 796 1440303_at Slc7a6os "Solute carrier family 7, member 6 opposite strand" 462 385 539 1440201_at C130026L21Rik /// "RIKEN cDNA C130026L21 gene /// solute carrier family 8 (sodium/calcium 1388 1179 1596 1440962_at Slc8a3 "solute carrier family 8 (sodium/calcium exchanger), member 3" 486 462 510 1435008_at Slc9a6 "solute carrier family 9 (sodium/hydrogen exchanger), member 6" 5463 5474 5453 1435009_at Slc9a6 "solute carrier family 9 (sodium/hydrogen exchanger), member 6" 491 498 485 1417397_at Slc9a1 "solute carrier family 9 (sodium/hydrogen exchanger), member 1" 470 512 428 1433578_at EG545758 /// "predicted gene, EG545758 /// solute carrier family 10 (sodium/bile acid 5807 7143 4471 1451674_at Slc12a5 "solute carrier family 12, member 5" 3034 2791 3276 1417622_at Slc12a2 "solute carrier family 12, member 2" 1306 1054 1558 1418257_at Slc12a7 "solute carrier family 12, member 7" 752 648 856 1449878_a_at Slc12a6 "solute carrier family 12, member 6" 691 554 828 1418103_at Slc12a9 "solute carrier family 12 (potassium/chloride transporters), member 9" 674 709 640 1436989_s_at Slc12a6 "solute carrier family 12, member 6" 563 627 499 1448385_at Slc15a4 "solute carrier family 15, member 4" 652 636 668 1418445_at Slc16a2 "solute carrier family 16 (monocarboxylic acid transporters), member 2" 733 747 720 1418446_at Slc16a2 "solute carrier family 16 (monocarboxylic acid transporters), member 2" 320 375 265 1437079_at Slc18a2 "solute carrier family 18 (vesicular monoamine), member 2" 4204 6307 2102 1420138_at Slc19a1 "solute carrier family 19 (sodium/hydrogen exchanger), member 1" 737 703 771 1448132_at Slc19a1 "solute carrier family 19 (sodium/hydrogen exchanger), member 1" 429 416 441
206 1417902_at Slc19a2 "solute carrier family 19 (thiamine transporter), member 2" 358 342 373 1448568_a_at Slc20a1 "solute carrier family 20, member 1" 2331 1836 2826 1434235_at Slc20a2 "solute carrier family 20, member 2" 320 281 358 1420444_at Slc22a3 "solute carrier family 22 (organic cation transporter), member 3" 2951 5215 686 1448209_a_at Slc22a17 "solute carrier family 22 (organic cation transporter), member 17" 2945 3039 2851 1453004_at Slc22a23 "solute carrier family 22, member 23" 668 742 594 1450395_at Slc22a5 "solute carrier family 22 (organic cation transporter), member 5" 523 476 569 1417329_at Slc23a2 "solute carrier family 23 (nucleobase transporters), member 2" 715 593 837 1424308_at Slc24a3 "solute carrier family 24 (sodium/potassium/calcium exchanger), member 3" 646 518 773 1424562_a_at Slc25a4 "solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), 15658 15438 15877 1455069_x_at Slc25a4 "solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), 15614 15426 15802 1434897_a_at Slc25a4 "solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), 15200 15040 15360 1416300_a_at Slc25a3 "solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 3" 14555 15084 14026 1434801_x_at Slc25a5 "solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), 9359 10235 8483 1436874_x_at Slc25a5 "solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), 8541 9087 7996 1423772_x_at Slc25a5 "solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), 8059 8663 7456 1430542_a_at EG433923 /// "predicted gene, EG433923 /// predicted gene, EG667030 /// solute carrier family 5146 5426 4867 1419657_a_at Slc25a36 "solute carrier family 25, member 36" 4597 3710 5484 1439410_x_at Slc25a39 "solute carrier family 25, member 39" 4442 4496 4387 1428190_at Slc25a1 "solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1" 3947 4518 3375 1438546_x_at EG433326 /// "predicted gene, EG433326 /// predicted gene, EG433923 /// predicted gene, 2569 2710 2427 1418134_at Slc25a46 "solute carrier family 25, member 46" 2501 2240 2762 1456176_x_at Slc25a39 "solute carrier family 25, member 39" 2490 2716 2263 1426586_at Slc25a11 "solute carrier family 25 (mitochondrial carrier oxoglutarate carrier), member 11" 1798 2104 1491 1428440_at Slc25a12 "solute carrier family 25 (mitochondrial carrier, Aralar), member 12" 1751 1578 1924 1436440_at Slc25a12 "solute carrier family 25 (mitochondrial carrier, Aralar), member 12" 1507 1459 1555 1438360_x_at EG383528 /// "predicted gene, EG383528 /// predicted gene, EG433326 /// solute carrier family 1480 1613 1347 1417154_at Slc25a14 "solute carrier family 25 (mitochondrial carrier, brain), member 14" 1158 1090 1225 1452653_at Slc25a22 "solute carrier family 25 (mitochondrial carrier, glutamate), member 22" 1156 994 1318 1423108_at Slc25a20 "solute carrier family 25 (mitochondrial carnitine/acylcarnitine translocase), 1076 946 1205 1419045_at Slc25a23 "solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23" 962 849 1074 1438187_at Slc25a29 "solute carrier family 25 (mitochondrial carrier, palmitoylcarnitine transporter), 926 959 892 1424211_at Slc25a33 "solute carrier family 25, member 33" 895 946 844 EG433326 /// "predicted gene, EG433326 /// predicted gene, EG433923 /// predicted gene, 207 1438545_at 872 994 750 1448970_at Slc25a46 "solute carrier family 25, member 46" 870 816 923 1438922_x_at EG383528 /// "predicted gene, EG383528 /// predicted gene, EG433326 /// solute carrier family 830 862 798 1424776_a_at Slc25a28 "solute carrier family 25, member 28" 796 742 851 1452717_at Slc25a24 "solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 24" 731 572 890 1438188_x_at Slc25a29 "solute carrier family 25 (mitochondrial carrier, palmitoylcarnitine transporter), 696 593 799 1424912_at Slc25a17 "solute carrier family 25 (mitochondrial carrier, peroxisomal membrane protein), 594 607 581 1447783_x_at Slc25a39 "solute carrier family 25, member 39" 503 508 497 1438520_at Slc25a36 "solute carrier family 25, member 36" 493 377 610 1423109_s_at Slc25a20 "solute carrier family 25 (mitochondrial carnitine/acylcarnitine translocase), 428 436 420 1453111_a_at Slc25a39 "solute carrier family 25, member 39" 418 529 306 1433448_at Slc25a44 "solute carrier family 25, member 44" 412 432 392 1424316_at Slc25a19 "solute carrier family 25 (mitochondrial thiamine pyrophosphate carrier), member 401 390 411 1420967_at Slc25a15 "solute carrier family 25 (mitochondrial carrier ornithine transporter), member 15" 397 339 454 1455639_at Slc25a39 "Solute carrier family 25, member 39" 339 378 299 1440090_at Slc25a27 "Solute carrier family 25, member 27" 324 348 299 1424441_at Slc27a4 "solute carrier family 27 (fatty acid transporter), member 4" 2367 2332 2402 1441902_x_at LOC100048058 /// "similar to Solute carrier family 29 (nucleoside transporters), member 4 /// solute 6680 6866 6494 1424900_at LOC100048058 /// "similar to Solute carrier family 29 (nucleoside transporters), member 4 /// solute 1209 1159 1259
1455731_at Slc29a3 "solute carrier family 29 (nucleoside transporters), member 3" 732 782 682 1426668_at Slc30a9 "solute carrier family 30 (zinc transporter), member 9" 2254 1980 2527 1424241_at Slc30a6 "solute carrier family 30 (zinc transporter), member 6" 835 808 862 1422497_at Slc30a5 "solute carrier family 30 (zinc transporter), member 5" 711 663 759 1418843_at Slc30a4 "solute carrier family 30 (zinc transporter), member 4" 427 389 464 1450697_at Slc30a7 "solute carrier family 30 (zinc transporter), member 7" 389 351 426 1433750_at Slc31a1 "solute carrier family 31, member 1" 428 417 438 1422756_at Slc32a1 "solute carrier family 32 (GABA vesicular transporter), member 1" 462 304 620 1417538_at LOC100046775 /// "similar to CMP-sialic acid transporter /// solute carrier family 35 (CMP-sialic acid 917 815 1019 1448769_at Slc35b1 "solute carrier family 35, member B1" 2932 3133 2732 1436719_at Slc35f1 "solute carrier family 35, member F1" 2285 2630 1940 1428805_at Slc35e3 "solute carrier family 35, member E3" 1010 1079 940 1439433_a_at Slc35a2 "solute carrier family 35 (UDP-galactose transporter), member A2" 820 766 874 1456013_x_at Slc35a4 "solute carrier family 35, member A4" 760 708 813
208 1423927_at Slc35b2 "solute carrier family 35, member B2" 733 835 632 1448937_at Slc35b3 "solute carrier family 35, member B3" 649 548 750 1434103_at Slc35e1 "solute carrier family 35, member E1" 645 596 694 1457024_x_at Slc35a2 "solute carrier family 35 (UDP-galactose transporter), member A2" 564 523 605 1416110_at Slc35a4 "solute carrier family 35, member A4" 555 608 501 1429648_at Slc35a3 "solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), 530 448 612 1452059_at Slc35f5 "solute carrier family 35, member F5" 490 449 531 1436693_x_at Slc35e4 "solute carrier family 35, member E4" 475 462 488 1419971_s_at Slc35a5 "solute carrier family 35, member A5" 473 492 454 1434104_at Slc35e1 "solute carrier family 35, member E1" 397 437 357 1420054_s_at Slc35c2 "solute carrier family 35, member C2" 384 337 431 1416549_at Slc35b4 "solute carrier family 35, member B4" 355 324 386 1453915_a_at Slc37a3 "solute carrier family 37 (glycerol-3-phosphate transporter), member 3" 948 956 939 1417042_at Slc37a4 "solute carrier family 37 (glucose-6-phosphate transporter), member 4" 608 619 598 1424920_at Slc37a3 "solute carrier family 37 (glycerol-3-phosphate transporter), member 3" 437 420 453 1456241_a_at Slc38a10 "solute carrier family 38, member 10" 6627 6883 6370 1426722_at Slc38a2 "solute carrier family 38, member 2" 6537 5811 7263 1454764_s_at Slc38a1 "solute carrier family 38, member 1" 5372 4618 6127 1427294_a_at Slc38a10 "solute carrier family 38, member 10" 2571 2560 2581 1429593_at Slc38a2 "solute carrier family 38, member 2" 1689 1850 1528 1427295_at Slc38a10 "solute carrier family 38, member 10" 1210 1319 1100 1457266_at Slc38a6 "solute carrier family 38, member 6" 759 559 958 1455295_at Slc38a7 "solute carrier family 38, member 7" 571 541 600 1415903_at Slc38a1 "solute carrier family 38, member 1" 557 631 483 1456338_at Slc38a9 "solute carrier family 38, member 9" 414 402 426 1424674_at Slc39a6 "solute carrier family 39 (metal ion transporter), member 6" 6912 6186 7637 1433751_at Slc39a10 "solute carrier family 39 (zinc transporter), member 10" 3819 3690 3948 1416949_s_at Slc39a7 "solute carrier family 39 (zinc transporter), member 7" 1767 1799 1736 1417881_at Slc39a3 "solute carrier family 39 (zinc transporter), member 3" 926 896 955 1424905_a_at Slc39a11 "solute carrier family 39 (metal ion transporter), member 11" 689 591 787 1452765_at Slc39a9 "solute carrier family 39 (zinc transporter), member 9" 577 517 637 1427035_at Slc39a14 "solute carrier family 39 (zinc transporter), member 14" 327 290 365 1424424_at LOC635418 /// "similar to Zinc transporter ZIP1 (Zinc-iron regulated transporter-like) (Solute 1241 1391 1092
209 1425439_a_at Slc41a3 "solute carrier family 41, member 3" 484 477 490 1460565_at Slc41a1 "solute carrier family 41, member 1" 378 305 450 1438559_x_at Slc44a2 "solute carrier family 44, member 2" 2234 1721 2746 1428065_at Slc44a2 "solute carrier family 44, member 2" 468 356 579 1433645_at Slc44a1 "solute carrier family 44, member 1" 358 355 361 1436252_at Slc45a1 "solute carrier family 45, member 1" 866 868 863 1433559_at Slc45a4 "solute carrier family 45, member 4" 490 500 480 1441047_at Slc45a4 "solute carrier family 45, member 4" 330 343 317 1440874_at Slco5a1 "solute carrier organic anion transporter family, member 5A1" 2386 2092 2680 1418030_at Slco3a1 "solute carrier organic anion transporter family, member 3a1" 1367 1130 1603 1448918_at Slco3a1 "solute carrier organic anion transporter family, member 3a1" 1196 1090 1302 Supplemental Table S6. Expressed Genes - GPCRs.
Class A Affy ID Gene Symbol Gene Title Av R+C+ Av R+ Av C+ 1437308_s_at F2r coagulation factor II (thrombin) receptor 12444 10052 14837 1434172_at Cnr1 cannabinoid receptor 1 (brain) 3486 4060 2913 1450852_s_at F2r coagulation factor II (thrombin) receptor 2890 2213 3568 1437618_x_at Gpr85 G protein-coupled receptor 85 2820 3013 2628 1426204_a_at Oprl1 opioid receptor-like 1 1972 1951 1993 1457229_at Gpr173 G-protein coupled receptor 173 1883 1633 2133 1424897_at Gpr85 G protein-coupled receptor 85 1750 1911 1589 1432273_a_at Darc "Duffy blood group, chemokine receptor" 1736 1468 2003
210 1418611_at Gpr162 G protein-coupled receptor 162 1678 2055 1301 1433891_at Lgr4 leucine-rich repeat-containing G protein-coupled receptor 4 1573 1514 1631 1421756_a_at Gpr19 G protein-coupled receptor 19 1456 1469 1444 1424896_at Gpr85 G protein-coupled receptor 85 1262 1346 1178 1448710_at Cxcr4 chemokine (C-X-C motif) receptor 4 863 920 805 1438710_at Htr1a 5-hydroxytryptamine (serotonin) receptor 1A 679 508 850 1437347_at Ednrb endothelin receptor type B 659 464 854 1433600_at Adra2a "adrenergic receptor, alpha 2a" 624 633 616 1450486_a_at Oprl1 opioid receptor-like 1 516 580 452 1448807_at Hrh3 histamine receptor H3 495 568 421 1450344_a_at Ptger3 prostaglandin E receptor 3 (subtype EP3) 481 305 657 1441944_s_at Gpr135 G protein-coupled receptor 135 343 389 297 1454844_at Mchr1 Melanin-concentrating hormone receptor 1 329 454 204 1438568_at Mrgpre "MAS-related GPR, member E" 304 305 302 Class B Affy ID Gene Symbol Gene Title Av R+C+ Av R+ Av C+ 1428510_at Lphn1 latrophilin 1 4091 5653 6619 "cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo 1435336_at Celsr2 2528 4030 3553 homolog, Drosophila)" "cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo 1425067_at Celsr3 1503 2433 2075 homolog, Drosophila)" 1433485_x_at Gpr56 G protein-coupled receptor 56 1324 1750 2223 1452812_at Lphn1 latrophilin 1 1297 2195 1696 1435558_at Bai2 /// LOC100048816 brain-specific angiogenesis inhibitor 2 /// similar to Brain- 1206 2203 1415 1418688_at Calcr calcitonin receptor 1138 1312 2101 1454782_at Bai3 brain-specific angiogenesis inhibitor 3 1041 1530 1593
211 1421118_a_at Gpr56 G protein-coupled receptor 56 1009 1246 1781 1426782_at Gpr125 G protein-coupled receptor 125 930 1283 1507 1434111_at LOC100048050 /// Lphn2 similar to calcium-independent alpha-latrotoxin receptor 853 1222 1337 1429022_at Adcyap1r1 adenylate cyclase activating polypeptide 1 receptor 1 727 575 1605 "cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo 1422073_a_at Celsr2 692 1266 810 homolog, Drosophila)" 1425314_at Gpr98 G protein-coupled receptor 98 551 668 986 1455363_at Bai1 brain-specific angiogenesis inhibitor 1 435 647 658 1434112_at LOC100048050 /// Lphn2 similar to calcium-independent alpha-latrotoxin receptor 382 530 616 1460440_at Lphn3 latrophilin 3 322 504 462 1417092_at Pthr1 parathyroid hormone receptor 1 333 403 263 "cadherin, EGF LAG seven-pass G-type receptor 1 (flamingo 1418925_at Celsr1 305 244 366 homolog, Drosophila)" Class C Affy ID Gene Symbol Gene Title Av R+C+ Av R+ Av C+ 1455021_at Gabbr1 "gamma-aminobutyric acid (GABA-B) receptor, 1" 8603 9380 7827 1437188_at Gabbr1 "gamma-aminobutyric acid (GABA-B) receptor, 1" 1394 1355 1433
Frizzled Affy ID Gene Symbol Gene Title Av R+C+ Av R+ Av C+ 1418534_at Fzd2 frizzled homolog 2 (Drosophila) 965 1009 921 1449730_s_at Fzd3 frizzled homolog 3 (Drosophila) 839 852 825 1427049_s_at Smo smoothened homolog (Drosophila) 803 695 911 1437284_at Fzd1 frizzled homolog 1 (Drosophila) 474 556 391 1418533_s_at Fzd2 frizzled homolog 2 (Drosophila) 452 597 307 212 Supplemental Table S7. Expressed Genes - Kinases.
AGC Affy ID Gene Symbol Gene Title Av R+C+ Av R+ Av C+ 1416657_at LOC100047666 serine/threonine protein kinase 3819 4100 3537 1435879_at Akt3 thymoma viral proto-oncogene 3 2670 2520 2821 1449423_at Mast1 microtubule associated serine/threonine kinase 1 2352 2261 2443 1435260_at Akt3 thymoma viral proto-oncogene 3 2266 1909 2623 1417542_at Rps6ka2 "ribosomal protein S6 kinase, polypeptide 2" 2066 1990 2142 1435739_at Lats1 large tumor suppressor 2020 1999 2041 1429759_at Rps6ka6 ribosomal protein S6 kinase polypeptide 6 1569 1764 1375 1450994_at Rock1 Rho-associated coiled-coil containing protein kinase 1 1315 1001 1628 1424286_at Prkx "protein kinase, X-linked" 1207 1201 1213 1417324_at Mast2 microtubule associated serine/threonine kinase 2 1078 1036 1121 1424480_s_at LOC100048123 serine/threonine kinase 826 883 768 213 1423444_at Rock1 Rho-associated coiled-coil containing protein kinase 1 680 657 702 1435666_at Mast3 microtubule associated serine/threonine kinase 3 660 655 664 1416896_at Rps6ka1 ribosomal protein S6 kinase polypeptide 1 592 603 580 1451299_at Prkx "protein kinase, X-linked" 591 628 553 1416041_at Sgk1 serum/glucocorticoid regulated kinase 1 497 612 382 1429760_at Rps6ka6 ribosomal protein S6 kinase polypeptide 6 476 504 449 1439441_x_at Lats2 large tumor suppressor 2 454 442 467 1437295_at Pkn2 protein kinase N2 395 342 448 1423445_at Rock1 Rho-associated coiled-coil containing protein kinase 1 342 270 414 1451041_at Rock2 Rho-associated coiled-coil containing protein kinase 2 314 263 365
Atypical Affy ID Gene Symbol Gene Title Av R+C+ Av R+ Av C+ 1415747_s_at Riok3 RIO kinase 3 (yeast) 6416 5906 6926 1455564_at Bcr breakpoint cluster region 3340 3448 3231 1436960_at Brd3 bromodomain containing 3 3243 2906 3580 1450711_at Brd4 bromodomain containing 4 3136 2808 3464 1437210_a_at Brd2 bromodomain containing 2 2637 3181 2093 1460670_at Riok3 RIO kinase 3 (yeast) 2570 2260 2879 1416532_at Trrap transformation/transcription domain-associated protein 1848 1679 2018 1423502_at Brd2 bromodomain containing 2 1688 1971 1404 1428539_at 2610207I05Rik RIKEN cDNA 2610207I05 gene 1551 1121 1982 1449346_s_at Riok1 RIO kinase 1 (yeast) 992 920 1065 1423762_at Adck1 aarF domain containing kinase 1 907 923 891 1450902_at Brd3 bromodomain containing 3 883 1023 743 1460644_at Bckdk branched chain ketoacid dehydrogenase kinase 685 776 594 1422650_a_at Riok3 RIO kinase 3 (yeast) 623 690 555 1437829_s_at Eef2k eukaryotic elongation factor-2 kinase 614 616 611 1455513_at Taf1 associated factor" 531 475 588 1436753_at Adck5 aarF domain containing kinase 5 457 513 401 1419981_at Riok3 RIO kinase 3 (yeast) 431 467 395 1428830_at Atm ataxia telangiectasia mutated homolog (human) 414 396 431 1427197_at Atr ataxia telangiectasia and Rad3 related 409 336 481 214 1436684_a_at Riok2 RIO kinase 2 (yeast) 389 380 398 1449013_at Eef2k eukaryotic elongation factor-2 kinase 303 299 306
CamK Affy ID Gene Symbol Gene Title Av R+C+ Av R+ Av C+ 1436659_at Dclk1 doublecortin-like kinase 1 4317 4447 4187 1419834_x_at Mark1 MAP/microtubule affinity-regulating kinase 1 3607 3461 3753 1435940_at Dclk1 doublecortin-like kinase 1 2968 3010 2926 1449630_s_at Mark1 MAP/microtubule affinity-regulating kinase 1 2866 2745 2987 1437100_x_at Pim3 proviral integration site 3 2563 2652 2474 1423941_at LOC100045547 /// similar to Calcium/calmodulin-dependent protein 2416 2045 2788 1450863_a_at Dclk1 doublecortin-like kinase 1 2391 2457 2324 1422518_at Cask (MAGUK family) 2364 2607 2121 1431826_a_at Brsk2 BR serine/threonine kinase 2 2260 2236 2283 1417542_at Rps6ka2 "ribosomal protein S6 kinase, polypeptide 2" 2066 1990 2142 1454711_at Trio triple functional domain (PTPRF interacting) 1859 1670 2048 1424271_at Dclk1 doublecortin-like kinase 1 1722 2269 1175 1418316_a_at /// Mark3 MAP/microtubule affinity-regulating kinase 3 1650 1473 1827 1448864_at Snrk SNF related kinase 1600 1664 1536 1438684_at Nuak1 "NUAK family, SNF1-like kinase, 1" 1597 1730 1463 1429759_at Rps6ka6 ribosomal protein S6 kinase polypeptide 6 1569 1764 1375 1426915_at Dapk1 death associated protein kinase 1 1394 1403 1386 1453569_s_at Mark4 MAP/microtubule affinity-regulating kinase 4 1376 1323 1428 1425678_a_at Snrk SNF related kinase 1284 1291 1278 1451289_at Dclk1 doublecortin-like kinase 1 1193 1755 632 1455406_at Cask (MAGUK family) 1159 1209 1108 1428222_at Dclk2 doublecortin-like kinase 2 1131 1083 1179 1423942_a_at LOC100045547 /// similar to Calcium/calmodulin-dependent protein 1116 1172 1060 1441870_s_at Pkd2 polycystic kidney disease 2 1099 749 1449 1429049_at Nuak2 "NUAK family, SNF1-like kinase, 2" 1041 1260 822 1439892_at Brsk1 BR serine/threonine kinase 1 1024 1052 995 1428511_at Phkg2 "phosphorylase kinase, gamma 2 (testis)" 991 1084 897 1425968_s_at Speg SPEG complex locus 965 919 1012 215 1424633_at Camk1g calcium/calmodulin-dependent protein kinase I gamma 964 1099 829 1439552_at Trio triple functional domain (PTPRF interacting) 957 969 945 1433745_at Trio triple functional domain (PTPRF interacting) 932 1121 742 1418260_at Hunk hormonally upregulated Neu-associated kinase 856 775 936 1417016_at /// Mapkapk5 kinase 5 821 714 928 1425510_at Mark1 MAP/microtubule affinity-regulating kinase 1 796 778 813 1422519_at Cask (MAGUK family) 739 838 639 1448664_a_at Speg SPEG complex locus 721 644 798 1415952_at Mark2 MAP/microtubule affinity-regulating kinase 2 678 743 614 1435458_at Pim1 proviral integration site 1 669 731 608 1460210_at Pkd1 polycystic kidney disease 1 homolog 660 525 794 1457311_at Camk2a calcium/calmodulin-dependent protein kinase II alpha 630 488 771 1446190_at Dclk1 doublecortin-like kinase 1 608 574 641 1416896_at Rps6ka1 ribosomal protein S6 kinase polypeptide 1 592 603 580 1417753_at Pkd2 polycystic kidney disease 2 553 426 680 1429760_at Rps6ka6 ribosomal protein S6 kinase polypeptide 6 476 504 449 1426648_at Mapkapk2 MAP kinase-activated protein kinase 2 456 500 412 1427358_a_at Dapk1 death associated protein kinase 1 436 487 384 1448676_at Camk2b "calcium/calmodulin-dependent protein kinase II, beta" 401 465 337 1425511_at Mark1 MAP/microtubule affinity-regulating kinase 1 393 359 427 1423446_at Dapk3 death-associated protein kinase 3 369 478 260
CK1 Affy ID Gene Symbol Gene Title Av R+C+ Av R+ Av C+ 1428371_at Ttbk2 tau tubulin kinase 2 1519 1404 1634 1418121_at Vrk3 vaccinia related kinase 3 928 941 916 1443528_at Ttbk1 tau tubulin kinase 1 617 616 619 1428166_at Cdan1 /// Ttbk2 tau tubulin kinase 2" 353 310 396 1425006_a_at Vrk1 vaccinia related kinase 1 342 387 297
CMGC Affy ID Gene Symbol Gene Title Av R+C+ Av R+ Av C+ 1454958_at Gsk3b glycogen synthase kinase 3 beta 7089 6958 7220 216 1422441_x_at Cdk4 cyclin-dependent kinase 4 6862 7536 6189 1428433_at Hipk2 homeodomain interacting protein kinase 2 6561 6946 6177 1422439_a_at LOC640611 protein kinase 4 (Cyclin-dependent kinase 4) (PSK-J3) 5231 5558 4904 1435970_at /// Nlk similar to nemo-like kinase /// nemo like kinase 4030 4172 3887 1422440_at LOC640611 protein kinase 4 (Cyclin-dependent kinase 4) (PSK-J3) 3672 4315 3030 1426124_a_at Clk1 CDC-like kinase 1 2895 2297 3492 1456022_at Hipk2 homeodomain interacting protein kinase 2 2816 3305 2326 1435638_at Gsk3a glycogen synthase kinase 3 alpha 2715 2814 2615 1417269_at Cdk9 cyclin-dependent kinase 9 (CDC2-related kinase) 2555 2393 2717 1460389_at Cdk8 cyclin-dependent kinase 8 2548 2183 2912 1455107_at Srpk1 serine/arginine-rich protein specific kinase 1 2429 2152 2707 1455687_at Ick intestinal cell kinase 2144 2098 2189 1417135_at Srpk2 serine/arginine-rich protein specific kinase 2 2068 2542 1594 1428637_at LOC100044376 kinase 2 /// similar to Dual-specificity tyrosine-(Y)- 1762 1560 1963 1454042_a_at Srpk1 serine/arginine-rich protein specific kinase 1 1696 1558 1834 1450674_at Cdk5 cyclin-dependent kinase 5 1476 1788 1163 1434439_at Gsk3b glycogen synthase kinase 3 beta 1438 1236 1640 1423849_a_at Clk3 CDC-like kinase 3 1383 1443 1323 1424540_at Hipk1 homeodomain interacting protein kinase 1 1365 1159 1570 1416294_at Clk2 /// Scamp3 CDC-like kinase 2 /// secretory carrier membrane protein 3 1291 1331 1250 1424863_a_at Hipk2 homeodomain interacting protein kinase 2 1267 1330 1204 1417743_at Clk2 CDC-like kinase 2 1091 1038 1144 1417134_at Srpk2 serine/arginine-rich protein specific kinase 2 1016 837 1195 1433975_at Cdk10 cyclin-dependent kinase (CDC2-like) 10 960 943 977 1417136_s_at Srpk2 serine/arginine-rich protein specific kinase 2 866 1133 600 1451020_at Gsk3b glycogen synthase kinase 3 beta 804 924 685 1456467_s_at /// Nlk similar to nemo-like kinase /// nemo like kinase 785 799 771 1422886_a_at Clk4 CDC like kinase 4 726 574 879 1439949_at Gsk3b Glycogen synthase kinase 3 beta 676 705 648 1439931_at Gsk3b glycogen synthase kinase 3 beta 589 506 672 1428299_at Dyrk1a kinase 1a 547 489 605 1435299_at Cdk7 activating kinase) 469 456 482 1451741_a_at Cdk7 activating kinase) 433 422 444 217 1435746_at Srpk2 serine/arginine-rich protein specific kinase 2 419 353 484 1454243_at Ick intestinal cell kinase 413 434 391 1448310_at Ick intestinal cell kinase 302 359 246
Other Affy ID Gene Symbol Gene Title Av R+C+ Av R+ Av C+ 1433676_at Wnk1 WNK lysine deficient protein kinase 1 3955 3288 4622 1434935_at Aak1 AP2 associated kinase 1 2767 2317 3218 1455024_at /// Tlk1 similar to tousled-like kinase 1 /// tousled-like kinase 1 2522 2146 2899 1422773_at Myt1 myelin transcription factor 1 2377 2438 2317 1427005_at Plk2 polo-like kinase 2 (Drosophila) 2176 1909 2443 1453355_at Wnk2 WNK lysine deficient protein kinase 2 2015 1832 2197 1417847_at Ulk2 Unc-51 like kinase 2 (C. elegans) 1777 1660 1893 1426604_at Rnasel dependent)" 1682 1600 1764 1451148_at /// Pink1 induced putative kinase 1 1653 1758 1549 1448370_at Ulk1 Unc-51 like kinase 1 (C. elegans) 1564 1427 1701 1443924_at Wnk3 WNK lysine deficient protein kinase 3 1496 1438 1555 1436804_s_at Scyl1 SCY1-like 1 (S. cerevisiae) 1474 1479 1469 1460315_s_at Tbk1 TANK-binding kinase 1 1412 1142 1682 1441937_s_at /// Pink1 induced putative kinase 1 1392 1491 1292 1435038_s_at Aak1 AP2 associated kinase 1 1314 939 1689 1424544_at Nrbp2 nuclear receptor binding protein 2 1238 883 1593 1424094_at Nek9 NIMA (never in mitosis gene a)-related expressed kinase 9 1061 775 1348 1416816_at Nek7 NIMA (never in mitosis gene a)-related expressed kinase 7 996 974 1018 1417846_at Ulk2 Unc-51 like kinase 2 (C. elegans) 995 1002 987 1424474_a_at Camkk2 beta" 951 994 909 1455401_at Camkk2 beta" 934 897 971 1460352_s_at Pik3r4 polypeptide 4, p150" 861 784 939 1426002_a_at Cdc7 cell division cycle 7 (S. cerevisiae) 817 594 1040 1423864_at Nrbp1 nuclear receptor binding protein 1 758 806 710 1416944_a_at Tlk2 tousled-like kinase 2 (Arabidopsis) 758 704 811 1418947_at Nek3 NIMA (never in mitosis gene a)-related expressed kinase 3 757 645 870 1426703_at Gak cyclin G associated kinase 734 608 860 218 1434267_at Nek1 NIMA (never in mitosis gene a)-related expressed kinase 1 651 496 805 1452960_at Scyl3 SCY1-like 3 (S. cerevisiae) 467 398 536 1418954_at Camkk1 alpha" 465 417 513 1436313_at Scyl2 SCY1-like 2 (S. cerevisiae) 440 383 498 1452633_s_at Aak1 AP2 associated kinase 1 427 369 485 1448627_s_at Pbk PDZ binding kinase 382 415 350 1448474_at Nek7 NIMA (never in mitosis gene a)-related expressed kinase 7 373 437 309 1451051_a_at Scyl1 SCY1-like 1 (S. cerevisiae) 351 418 283 1449861_at Nek4 NIMA (never in mitosis gene a)-related expressed kinase 4 309 278 340
STE Affy ID Gene Symbol Gene Title Av R+C+ Av R+ Av C+ 1450070_s_at Pak1 p21 (CDKN1A)-activated kinase 1 7329 6948 7711 1435486_at Pak3 p21 (CDKN1A)-activated kinase 3 7187 7295 7079 1420980_at Pak1 p21 (CDKN1A)-activated kinase 1 3790 3618 3962 1415974_at Map2k2 mitogen-activated protein kinase kinase 2 2577 2830 2325 1417923_at Pak3 p21 (CDKN1A)-activated kinase 3 2067 2328 1805 1455256_at Tnik TRAF2 and NCK interacting kinase 1920 1757 2084 1451736_a_at Map2k7 mitogen-activated protein kinase kinase 7 1920 1829 2010 1455441_at Map3k7 mitogen-activated protein kinase kinase kinase 7 1443 1299 1587 1451982_at Map2k4 mitogen-activated protein kinase kinase 4 1429 1145 1713 1454887_at Pak2 p21 (CDKN1A)-activated kinase 2 1409 1308 1511 1437318_at Pak3 p21 (CDKN1A)-activated kinase 3 1336 1671 1000 1420979_at Pak1 p21 (CDKN1A)-activated kinase 1 1201 1170 1233 1459800_s_at Map3k4 mitogen-activated protein kinase kinase kinase 4 1073 1084 1062 1455941_s_at Map2k5 mitogen-activated protein kinase kinase 5 951 871 1032 1417854_at Map2k5 mitogen-activated protein kinase kinase 5 874 942 807 1416351_at Map2k1 mitogen-activated protein kinase kinase 1 767 687 847 1428548_at Pak4 p21 (CDKN1A)-activated kinase 4 765 775 755 1433999_at Slk STE20-like kinase (yeast) 631 471 792 1426850_a_at Map2k6 mitogen-activated protein kinase kinase 6 609 473 746 1447667_x_at Map3k4 mitogen-activated protein kinase kinase kinase 4 575 596 553 1455597_at Map3k2 mitogen-activated protein kinase kinase kinase 2 501 425 577 219 1436522_at Map3k3 mitogen-activated protein kinase kinase kinase 3 459 457 460 1455200_at Pak6 p21 (CDKN1A)-activated kinase 6 356 392 319 1434250_at Pak2 p21 (CDKN1A)-activated kinase 2 347 320 375 1419988_at Map3k7 mitogen-activated protein kinase kinase kinase 7 328 266 390
Tyrosine Kinase Affy ID Gene Symbol Gene Title Av R+C+ Av R+ Av C+ 1456226_x_at Ddr1 "discoidin domain receptor family, member 1" 6662 6817 6506 1452982_at Igf1r insulin-like growth factor I receptor 2952 2690 3214 1455188_at Ephb1 Eph receptor B1 2523 3455 1590 1448765_at Fyn Fyn proto-oncogene 2075 2035 2114 1415797_at Ddr1 "discoidin domain receptor family, member 1" 2000 2345 1655 1421260_a_at Srm spermidine synthase 1831 1933 1728 1423999_at Abl1 "c-abl oncogene 1, receptor tyrosine kinase" 1766 1482 2050 1425015_at Ephb2 Eph receptor B2 1719 1876 1562 1435286_at Epha5 Eph receptor A5 1535 1974 1097 1426388_s_at Ryk receptor-like tyrosine kinase 1517 1729 1304 1417558_at Fyn Fyn proto-oncogene 1484 1689 1279
1455495_at Abl2 (arg, Abelson-related gene)" 1424 1145 1704 1421066_at Jak2 Janus kinase 2 1361 1290 1433 1434446_at Insr insulin receptor 1255 1131 1379 1425016_at Ephb2 Eph receptor B2 1158 1320 997 1444690_at Epha5 Eph receptor A5 1158 1511 804 1435820_x_at Ddr1 "discoidin domain receptor family, member 1" 1118 1144 1092 1421841_at Fgfr3 fibroblast growth factor receptor 3 995 695 1295 1433803_at Jak1 Janus kinase 1 971 1051 890 1455426_at Epha3 Eph receptor A3 894 371 1417 1451550_at Ephb3 Eph receptor B3 891 834 948 1429021_at Epha4 Eph receptor A4 836 1006 666 1424050_s_at Fgfr1 fibroblast growth factor receptor 1 795 799 792 1428967_at Igf1r insulin-like growth factor I receptor 753 744 761 1426565_at Igf1r insulin-like growth factor I receptor 724 646 802 1451991_at Epha7 Eph receptor A7 631 669 593 220 1450918_s_at Src Rous sarcoma oncogene 621 631 611 1437920_at Epha5 Eph receptor A5 586 809 363 1423518_at Csk c-src tyrosine kinase 574 622 527 1455682_at Abl2 (arg, Abelson-related gene)" 480 475 485 1443485_at Epha7 Eph receptor A7 465 476 453 1460420_a_at Egfr epidermal growth factor receptor 435 473 398 1433805_at Jak1 Janus kinase 1 409 437 381 1452514_a_at Kit kit oncogene 408 230 586 1452108_at Igf1r insulin-like growth factor I receptor 366 328 404
Tyrosine Kinase-like Affy ID Gene Symbol Gene Title Av R+C+ Av R+ Av C+ 1434310_at Bmpr2 (serine/threonine kinase)" 6445 5760 7130 1420895_at Tgfbr1 "transforming growth factor, beta receptor I" 5959 5428 6490 1452587_at Actr2 ARP2 actin-related protein 2 homolog (yeast) 5940 5411 6469 1416078_s_at Raf1 v-raf-leukemia viral oncogene 1 4114 4194 4033 1425419_a_at Raf1 v-raf-leukemia viral oncogene 1 2479 2521 2437 1417627_a_at Limk1 "LIM-domain containing, protein kinase" 1656 1700 1613 1449942_a_at Ilk integrin linked kinase 1433 1518 1348 1452060_a_at Limk2 LIM motif-containing protein kinase 2 1207 1120 1294 1450662_at Tesk1 testis specific protein kinase 1 1163 1218 1109 1438120_x_at Irak1 interleukin-1 receptor-associated kinase 1 1100 913 1288 1425492_at Bmpr1a "bone morphogenetic protein receptor, type 1A" 1083 1010 1155 1435434_at Braf Braf transforming gene 1019 727 1311 1460649_at Irak1 interleukin-1 receptor-associated kinase 1 872 824 919 1418581_a_at Limk2 LIM motif-containing protein kinase 2 665 746 584 1428607_at Araf v-raf murine sarcoma 3611 viral oncogene homolog 480 419 541 1448668_a_at Irak1 interleukin-1 receptor-associated kinase 1 362 339 385 1435480_at ------303 244 362 221 Supplemental Table S8. Cluster I, R+C+ enriched.
Affy ID Fold Change Gene Symbol Gene Title 1417150_at 96.7 Slc6a4 solute carrier family 6 (neurotransmitter transporter, serotonin), member 4 1425886_at 88.0 Fev FEV (ETS oncogene family) 1435314_at 80.1 Tph2 tryptophan hydroxylase 2 1435750_at 79.6 Gchfr GTP cyclohydrolase I feedback regulator 1437079_at 41.4 Slc18a2 solute carrier family 18 (vesicular monoamine), member 2 1419011_at 40.6 Cryba2 crystallin, beta A2 1426215_at 26.3 Ddc dopa decarboxylase 1450708_at 25.3 Scg2 secretogranin II 1429692_s_at 25.1 Gch1 GTP cyclohydrolase 1 1420499_at 22.2 Gch1 GTP cyclohydrolase 1 1430105_at 19.9 1700042O10Rik RIKEN cDNA 1700042O10 gene 1433434_at 18.6 AW551984 expressed sequence AW551984 222 1418688_at 17.5 Calcr calcitonin receptor 1434354_at 17.0 Maob monoamine oxidase B 1460303_at 14.8 Nr3c1 nuclear receptor subfamily 3, group C, member 1 1421112_at 12.3 Nkx2-2 NK2 transcription factor related, locus 2 (Drosophila) 1427038_at 10.9 Penk1 preproenkephalin 1 1445546_at 10.8 AI844685 expressed sequence AI844685 1415885_at 10.5 Chgb chromogranin B 1448886_at 10.4 Gata3 GATA binding protein 3 1445247_at 9.9 C530044C16Rik RIKEN cDNA C530044C16 gene 1460578_at 9.6 Fgd5 FYVE, RhoGEF and PH domain containing 5 1428667_at 9.4 Maoa monoamine oxidase A 1421498_a_at 9.4 2010204K13Rik RIKEN cDNA 2010204K13 gene 1433578_at 8.9 EG545758 /// Slc10a4 predicted gene, EG545758 /// solute carrier family 10 (sodium/bile acid 1436004_at 8.7 Usp27x ubiquitin specific peptidase 27, X chromosome 1456108_x_at 8.5 Rnf112 ring finger protein 112 1440891_at 8.2 Gria4 glutamate receptor, ionotropic, AMPA4 (alpha 4) 1433435_at 7.1 AW551984 expressed sequence AW551984 1458230_at 7.1 ------1450344_a_at 7.0 Ptger3 prostaglandin E receptor 3 (subtype EP3) 1441330_at 6.9 Crb1 crumbs homolog 1 (Drosophila) 1436772_at 6.7 ------1424842_a_at 6.6 Arhgap24 Rho GTPase activating protein 24 1435722_at 6.2 Gria4 /// LOC100044208 glutamate receptor, ionotropic, AMPA4 (alpha 4) /// hypothetical protein 1455416_at 6.1 C130021I20Rik Riken cDNA C130021I20 gene 1420955_at 5.9 Vsnl1 visinin-like 1 1452981_at 5.8 Cntn1 contactin 1 1450333_a_at 5.7 Gata2 GATA binding protein 2 1441729_at 5.6 ------1456712_at 5.5 Lcorl ligand dependent nuclear receptor corepressor-like 1447707_s_at 5.4 Pde2a phosphodiesterase 2A, cGMP-stimulated 1421867_at 5.3 Nr3c1 nuclear receptor subfamily 3, group C, member 1 1460097_at 5.3 ------1428434_at 5.2 Zcchc12 zinc finger, CCHC domain containing 12 223 1447669_s_at 5.2 Gng4 guanine nucleotide binding protein (G protein), gamma 4 1449563_at 5.1 Cntn1 contactin 1 1435939_s_at 5.1 Hepacam2 HEPACAM family member 2 1417441_at 5.1 Dnajc12 DnaJ (Hsp40) homolog, subfamily C, member 12 1447946_at 4.9 Adam23 a disintegrin and metallopeptidase domain 23 1441625_at 4.9 Rimbp2 RIMS binding protein 2 1438710_at 4.8 Htr1a 5-hydroxytryptamine (serotonin) receptor 1A 1428599_at 4.8 Kndc1 kinase non-catalytic C-lobe domain (KIND) containing 1 1456783_at 4.7 Zdbf2 zinc finger, DBF-type containing 2 1434800_at 4.7 Sv2b synaptic vesicle glycoprotein 2 b 1418360_at 4.7 Rnf112 ring finger protein 112 1441055_at 4.4 Akap2 /// Palm2 /// RP23-334A5.2 A kinase (PRKA) anchor protein 2 /// paralemmin 2 /// Palm2-Akap2 protein 1455260_at 4.4 Lcorl ligand dependent nuclear receptor corepressor-like 1419200_at 4.3 Fxyd7 FXYD domain-containing ion transport regulator 7 1433884_at 4.3 Syt1 synaptotagmin I 1416762_at 4.3 S100a10 S100 calcium binding protein A10 (calpactin) 1433643_at 4.2 Cacna2d1 calcium channel, voltage-dependent, alpha2/delta subunit 1 1429702_at 4.1 2900072G11Rik RIKEN cDNA 2900072G11 gene 1456642_x_at 4.0 S100a10 S100 calcium binding protein A10 (calpactin) 1426622_a_at 4.0 Qpct glutaminyl-peptide cyclotransferase (glutaminyl cyclase) 1442077_at 4.0 2310076G05Rik RIKEN cDNA 2310076G05 gene 1433582_at 3.9 1190002N15Rik /// LOC100044725 RIKEN cDNA 1190002N15 gene /// hypothetical protein LOC100044725 1451046_at 3.9 LOC100047651 /// Zfpm1 similar to FOG /// zinc finger protein, multitype 1 1428816_a_at 3.9 Gata2 GATA binding protein 2 1452202_at 3.9 Pde2a phosphodiesterase 2A, cGMP-stimulated 1417398_at 3.8 Rras2 related RAS viral (r-ras) oncogene homolog 2 1452114_s_at 3.7 Igfbp5 insulin-like growth factor binding protein 5 1433919_at 3.7 Asb4 ankyrin repeat and SOCS box-containing 4 1452936_at 3.7 Crtac1 cartilage acidic protein 1 1428221_at 3.7 Klhdc8b kelch domain containing 8B 1448689_at 3.6 Rras2 related RAS viral (r-ras) oncogene homolog 2 1417411_at 3.6 Nap1l5 nucleosome assembly protein 1-like 5 1447933_at 3.5 Kif26a kinesin family member 26A 224 1427509_at 3.5 Baiap3 BAI1-associated protein 3 1438407_at 3.5 Dsel dermatan sulfate epimerase-like 1435387_at 3.5 Slc2a13 solute carrier family 2 (facilitated glucose transporter), member 13 1455161_at 3.5 AI504432 expressed sequence AI504432 1417943_at 3.5 Gng4 guanine nucleotide binding protein (G protein), gamma 4 1437466_at 3.4 Alcam activated leukocyte cell adhesion molecule 1456392_at 3.4 Negr1 neuronal growth regulator 1 1434594_at 3.4 Dnahc1 dynein, axonemal, heavy chain 1 1425111_at 3.4 Sorcs3 sortilin-related VPS10 domain containing receptor 3 1444693_at 3.4 ------1419237_at 3.3 Usp29 ubiquitin specific peptidase 29 1455074_at 3.2 Efcab1 EF hand calcium binding domain 1 1433924_at 3.2 ------1454715_at 3.2 Ralyl RALY RNA binding protein-like 1426606_at 3.2 Crtac1 cartilage acidic protein 1 1454728_s_at 3.2 Atp8a1 ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1 1433581_at 3.2 1190002N15Rik /// LOC100044725 RIKEN cDNA 1190002N15 gene /// hypothetical protein LOC100044725 1442676_at 3.2 Maoa monoamine oxidase A 1445234_at 3.1 C130030K03Rik RIKEN cDNA C130030K03 gene 1455642_a_at 3.1 Tspan17 tetraspanin 17 1450055_at 3.1 Vsnl1 visinin-like 1 1424529_s_at 3.1 Cgref1 cell growth regulator with EF hand domain 1 1429224_at 3.1 Pnma1 paraneoplastic antigen MA1 1433827_at 3.0 Atp8a1 ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1 1442039_at 3.0 Tox thymocyte selection-associated high mobility group box 1446571_at 3.0 ------1424594_at 3.0 Lgals7 /// Samd4 lectin, galactose binding, soluble 7 /// sterile alpha motif domain containing 4 1417356_at 2.9 Peg3 paternally expressed 3 1421017_at 2.9 Nrg3 neuregulin 3 1418030_at 2.9 Slco3a1 solute carrier organic anion transporter family, member 3a1 1423597_at 2.9 Atp8a1 ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1 1438452_at 2.9 Nebl nebulette 1456401_at 2.9 Cacnb2 calcium channel, voltage-dependent, beta 2 subunit 225 1416588_at 2.9 Ptprn protein tyrosine phosphatase, receptor type, N 1445539_at 2.8 ------1442557_at 2.8 ------1440397_at 2.8 Cacna2d1 calcium channel, voltage-dependent, alpha2/delta subunit 1 1437568_at 2.8 Mmp16 matrix metallopeptidase 16 1437171_x_at 2.8 Gsn gelsolin 1457683_at 2.7 Grik2 glutamate receptor, ionotropic, kainate 2 (beta 2) 1417988_at 2.7 Resp18 regulated endocrine-specific protein 18 1429443_at 2.7 Cpne4 copine IV 1425484_at 2.7 LOC100044677 /// Tox similar to thymus high mobility group box protein TOX /// thymocyte selection- 1429703_at 2.7 2900072G11Rik RIKEN cDNA 2900072G11 gene 1456312_x_at 2.6 Gsn gelsolin 1437332_at 2.6 ------1437341_x_at 2.6 Cnp 2',3'-cyclic nucleotide 3' phosphodiesterase 1434917_at 2.6 Cobl cordon-bleu 1436991_x_at 2.6 Gsn gelsolin 1449240_at 2.6 Gsbs G substrate 1458407_s_at 2.6 ------1448918_at 2.5 Slco3a1 solute carrier organic anion transporter family, member 3a1 1416968_a_at 2.5 Hsd3b7 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 1424683_at 2.5 1810015C04Rik RIKEN cDNA 1810015C04 gene 1435815_at 2.5 Ldoc1 leucine zipper, down-regulated in cancer 1 1442032_at 2.5 BC030500 cDNA sequence BC030500 1447300_at 2.5 AW551984 expressed sequence AW551984 1419186_a_at 2.5 St8sia4 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 1455686_at 2.4 ------1425110_at 2.4 Sorcs3 sortilin-related VPS10 domain containing receptor 3 1435767_at 2.4 Scn3b sodium channel, voltage-gated, type III, beta 1440838_at 2.4 ------1435404_at 2.4 Disp2 dispatched homolog 2 (Drosophila) 1455177_at 2.4 Ahi1 Abelson helper integration site 1 1417994_a_at 2.4 Accn1 amiloride-sensitive cation channel 1, neuronal (degenerin) 1459858_x_at 2.4 Crtac1 cartilage acidic protein 1 226 1435512_at 2.4 AI836003 expressed sequence AI836003 1426517_at 2.4 Gnaz guanine nucleotide binding protein, alpha z subunit 1447480_at 2.3 ------1433667_at 2.3 Lgi3 leucine-rich repeat LGI family, member 3 1424334_at 2.3 Tspan17 tetraspanin 17 1452142_at 2.3 Slc6a1 solute carrier family 6 (neurotransmitter transporter, GABA), member 1 1447788_s_at 2.3 Tspyl3 TSPY-like 3 1429166_s_at 2.3 Clmn calmin 1427964_at 2.3 Cmtm8 CKLF-like MARVEL transmembrane domain containing 8 1435374_at 2.3 ------1455291_s_at 2.3 Znrf2 zinc and ring finger 2 1459854_s_at 2.3 Dynlt3 dynein light chain Tctex-type 3 1452763_at 2.3 Nipa1 non imprinted in Prader-Willi/Angelman syndrome 1 homolog (human) 1416935_at 2.3 Trpv2 transient receptor potential cation channel, subfamily V, member 2 1426301_at 2.3 Alcam activated leukocyte cell adhesion molecule 1428635_at 2.3 Comtd1 catechol-O-methyltransferase domain containing 1 1441491_at 2.3 A330068G13Rik RIKEN cDNA A330068G13 gene 1432556_a_at 2.3 3100002J23Rik RIKEN cDNA 3100002J23 gene 1415812_at 2.3 Gsn gelsolin 1419470_at 2.3 Gnb4 guanine nucleotide binding protein (G protein), beta 4 1424356_a_at 2.3 Metrnl meteorin, glial cell differentiation regulator-like 1434580_at 2.2 Enpp4 ectonucleotide pyrophosphatase/phosphodiesterase 4 1433909_at 2.2 Syt17 synaptotagmin XVII 1442270_at 2.2 ------1417862_at 2.2 A830059I20Rik RIKEN cDNA A830059I20 gene 1454959_s_at 2.2 Gnai1 guanine nucleotide binding protein (G protein), alpha inhibiting 1 1449823_at 2.2 Dach2 dachshund 2 (Drosophila) 1423312_at 2.2 Tpbg trophoblast glycoprotein 1429167_at 2.2 Ccdc112 coiled-coil domain containing 112 1441087_at 2.2 2810011L19Rik RIKEN cDNA 2810011L19 gene 1439732_at 2.2 ------1425603_at 2.2 Tmem176a transmembrane protein 176A 1445297_at 2.2 Stxbp5l syntaxin binding protein 5-like 227 1436656_at 2.2 BC062109 cDNA sequence BC062109 1434960_at 2.2 Taf9b TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor 1418881_at 2.2 Necab2 N-terminal EF-hand calcium binding protein 2 1424767_at 2.2 Cdh22 /// LOC100046008 cadherin 22 /// similar to cadherin 22 1418980_a_at 2.1 Cnp 2',3'-cyclic nucleotide 3' phosphodiesterase 1456146_at 2.1 LOC100047530 similar to oxysterol-binding protein-like protein OSBPL10 1435060_at 2.1 Tmod2 tropomodulin 2 1438423_at 2.1 Ssbp2 single-stranded DNA binding protein 2 1451268_at 2.1 Tram1l1 translocation associated membrane protein 1-like 1 1443997_at 2.1 Gprin2 G protein regulated inducer of neurite outgrowth 2 1437390_x_at 2.1 Stx1a syntaxin 1A (brain) 1435221_at 2.1 Foxp1 forkhead box P1 1449929_at 2.1 Dynlt3 dynein light chain Tctex-type 3 1442272_at 2.1 ------1460028_at 2.1 Grip2 glutamate receptor interacting protein 2 1434537_at 2.1 Slco3a1 solute carrier organic anion transporter family, member 3a1 1460292_a_at 2.1 Smarca1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, 1434440_at 2.1 Gnai1 guanine nucleotide binding protein (G protein), alpha inhibiting 1 1441905_x_at 2.1 Snrpn /// Snurf small nuclear ribonucleoprotein N /// SNRPN upstream reading frame 1433826_at 2.1 Tspyl3 TSPY-like 3 1417901_a_at 2.1 Ica1 islet cell autoantigen 1 1433453_a_at 2.1 Abtb2 ankyrin repeat and BTB (POZ) domain containing 2 1423310_at 2.1 Tpbg trophoblast glycoprotein 1443941_at 2.1 Gm447 gene model 447, (NCBI) 1440132_s_at 2.0 Prkar1b protein kinase, cAMP dependent regulatory, type I beta 1431251_at 2.0 Lrrc3 leucine rich repeat containing 3 1416441_at 2.0 Pgcp plasma glutamate carboxypeptidase 1421178_at 2.0 Mgat4c mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, 1442024_at 2.0 ------1458406_at 2.0 ------1433942_at 2.0 Myo6 myosin VI 1449324_at 2.0 Ero1l ERO1-like (S. cerevisiae) 1441317_x_at 2.0 Jakmip1 janus kinase and microtubule interacting protein 1 228 1456283_at 2.0 Neto1 neuropilin (NRP) and tolloid (TLL)-like 1 1439031_at 2.0 Jph4 junctophilin 4 1428550_at 2.0 Ydjc YdjC homolog (bacterial) 1423104_at 2.0 Irs1 insulin receptor substrate 1 1448660_at 2.0 Arhgdig Rho GDP dissociation inhibitor (GDI) gamma 1440234_at 2.0 1810012P15Rik RIKEN cDNA 1810012P15 gene 1451679_at 2.0 6530401D17Rik RIKEN cDNA 6530401D17 gene 1435462_at 2.0 Plcxd2 phosphatidylinositol-specific phospholipase C, X domain containing 2 1455098_a_at 2.0 Vtn vitronectin 1442157_at 2.0 ------1449259_at 2.0 Rab3d RAB3D, member RAS oncogene family 1435044_at 2.0 Ebf4 early B-cell factor 4 1460576_at 2.0 Exoc6 exocyst complex component 6 1422481_at 2.0 Krt1 keratin 1 1434325_x_at 2.0 Prkar1b protein kinase, cAMP dependent regulatory, type I beta 1460419_a_at 2.0 Prkcb protein kinase C, beta 1424602_s_at 2.0 Xrcc4 X-ray repair complementing defective repair in Chinese hamster cells 4 1434013_at 2.0 Ablim3 actin binding LIM protein family, member 3 1436161_at 2.0 Pds5b PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae) 1448280_at 2.0 Syp synaptophysin 1417605_s_at 1.9 Camk1 calcium/calmodulin-dependent protein kinase I 1448340_at 1.9 Tmem30a transmembrane protein 30A 1451210_at 1.9 Ppap2c phosphatidic acid phosphatase type 2c 1439632_at 1.9 ------1433894_at 1.9 Jazf1 JAZF zinc finger 1 1433801_at 1.9 9930012K11Rik RIKEN cDNA 9930012K11 gene 1436489_x_at 1.9 C85492 expressed sequence C85492 1441969_at 1.9 Trim36 tripartite motif-containing 36 1433791_at 1.9 Rab9b RAB9B, member RAS oncogene family 1423311_s_at 1.9 Tpbg trophoblast glycoprotein 1436529_at 1.9 Gpr123 G protein-coupled receptor 123 1435687_at 1.9 Sv2b synaptic vesicle glycoprotein 2 b 1426300_at 1.9 Alcam activated leukocyte cell adhesion molecule 229 1434073_at 1.9 Gprasp2 G protein-coupled receptor associated sorting protein 2 1456857_at 1.9 1500011B03Rik RIKEN cDNA 1500011B03 gene 1439286_at 1.9 ------1429276_at 1.9 Lba1 lupus brain antigen 1 1456885_at 1.9 ------1425458_a_at 1.9 Grb10 growth factor receptor bound protein 10 1442809_at 1.9 Scn9a sodium channel, voltage-gated, type IX, alpha 1455324_at 1.9 Plcxd2 phosphatidylinositol-specific phospholipase C, X domain containing 2 1416753_at 1.9 Prkar1b protein kinase, cAMP dependent regulatory, type I beta 1418445_at 1.9 Slc16a2 solute carrier family 16 (monocarboxylic acid transporters), member 2 1435559_at 1.9 Myo6 myosin VI 1418773_at 1.9 Fads3 fatty acid desaturase 3 1418713_at 1.9 Pcbd1 pterin 4 alpha carbinolamine dehydratase/dimerization cofactor of hepatocyte 1441662_at 1.9 Cyp4x1 cytochrome P450, family 4, subfamily x, polypeptide 1 1437742_at 1.9 Rab21 RAB21, member RAS oncogene family 1460449_at 1.9 Anks1b ankyrin repeat and sterile alpha motif domain containing 1B 1426204_a_at 1.8 Oprl1 opioid receptor-like 1 1434027_at 1.8 Rcan3 regulator of calcineurin 3 1428333_at 1.8 2900062L11Rik /// 6530401D17Rik RIKEN cDNA 2900062L11 gene /// RIKEN cDNA 6530401D17 gene 1450941_at 1.8 Sdcbp syndecan binding protein 1451555_at 1.8 Nln neurolysin (metallopeptidase M3 family) 1416635_at 1.8 Smpdl3a sphingomyelin phosphodiesterase, acid-like 3A 1430066_at 1.8 4930589M24Rik RIKEN cDNA 4930589M24 gene 1433486_at 1.8 Clcn3 chloride channel 3 1460003_at 1.8 AI956758 expressed sequence AI956758 1419494_a_at 1.8 Tpd52 tumor protein D52 1434640_at 1.8 Nrsn2 neurensin 2 1434913_at 1.8 Hmgcll1 3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1 1418136_at 1.8 Tgfb1i1 transforming growth factor beta 1 induced transcript 1 1460483_at 1.8 2610034E01Rik RIKEN cDNA 2610034E01 gene 1417781_at 1.8 Lass4 LAG1 homolog, ceramide synthase 4 1428854_at 1.8 Tmed8 transmembrane emp24 domain containing 8 1427055_at 1.8 Them4 thioesterase superfamily member 4 230 1416600_a_at 1.8 Rcan1 regulator of calcineurin 1 1455906_at 1.8 6030446N20Rik RIKEN cDNA 6030446N20 gene 1416199_at 1.8 Kifc3 kinesin family member C3 1428082_at 1.8 Acsl5 acyl-CoA synthetase long-chain family member 5 1427539_a_at 1.8 Zwint ZW10 interactor 1437974_a_at 1.8 Hk1 hexokinase 1 1452050_at 1.8 Camk1d calcium/calmodulin-dependent protein kinase ID 1449968_s_at 1.8 Acot10 /// Acot9 acyl-CoA thioesterase 10 /// acyl-CoA thioesterase 9 1437853_x_at 1.8 Ndn necdin 1435745_at 1.7 5031439G07Rik RIKEN cDNA 5031439G07 gene 1428351_at 1.7 Ppm1m protein phosphatase 1M 1415758_at 1.7 Fryl furry homolog-like (Drosophila) 1428549_at 1.7 Ccdc3 coiled-coil domain containing 3 1416632_at 1.7 LOC677317 /// Me1 similar to NADP-dependent malic enzyme (NADP-ME) (Malic enzyme 1) /// malic 1418355_at 1.7 Nucb2 nucleobindin 2 1420798_s_at 1.7 LOC100046214 /// Pcdha1 /// similar to protocadherin alpha 11 /// protocadherin alpha 1 /// protocadherin 1442062_at 1.7 7120426M23Rik RIKEN cDNA 7120426M23 gene 1454741_s_at 1.7 Tmem164 transmembrane protein 164 1423909_at 1.7 Tmem176a transmembrane protein 176A 1452719_at 1.7 Zdhhc24 zinc finger, DHHC domain containing 24 1424341_s_at 1.7 LOC100046214 /// Pcdha1 /// similar to protocadherin alpha 11 /// protocadherin alpha 1 /// protocadherin 1433796_at 1.7 Endod1 endonuclease domain containing 1 1417782_at 1.7 Lass4 LAG1 homolog, ceramide synthase 4 1440029_at 1.7 St8sia3 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3 1455378_at 1.7 BC057371 cDNA sequence BC057371 1418004_a_at 1.7 Tmem176b transmembrane protein 176B 1455014_at 1.7 Hint3 histidine triad nucleotide binding protein 3 1455269_a_at 1.7 Coro1a coronin, actin binding protein 1A 1457423_at 1.7 LOC675405 /// Nalcn similar to voltage gated channel like 1 /// sodium leak channel, non-selective 1428323_at 1.7 Gpd2 glycerol phosphate dehydrogenase 2, mitochondrial 1437796_at 1.7 ------1435598_at 1.7 ------1460371_at 1.7 Hspa12b heat shock protein 12B 231 1433602_at 1.6 Gabra5 gamma-aminobutyric acid (GABA-A) receptor, subunit alpha 5 1455389_s_at 1.6 2310051F07Rik RIKEN cDNA 2310051F07 gene 1418349_at 1.6 Hbegf heparin-binding EGF-like growth factor 1459522_s_at 1.6 Gyg glycogenin 1428710_at 1.6 Rit1 Ras-like without CAAX 1 1456315_a_at 1.6 Ptpla protein tyrosine phosphatase-like (proline instead of catalytic arginine), member a 1417520_at 1.6 Nfe2l3 nuclear factor, erythroid derived 2, like 3 1434472_at 1.6 Dusp3 dual specificity phosphatase 3 (vaccinia virus phosphatase VH1-related) Supplemental Table S9. Cluster II, R+ enriched. Affy ID Fold Change Gene Symbol Gene Title 1425804_at 29.7 Hmx2 H6 homeo box 2 1420444_at 27.1 Slc22a3 solute carrier family 22 (organic cation transporter), member 3 1437339_s_at 8.9 Pcsk5 proprotein convertase subtilisin/kexin type 5 1449031_at 8.3 Cited1 Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal 1452065_at 7.9 Vstm2a V-set and transmembrane domain containing 2A 1456512_at 7.2 Pdzrn4 PDZ domain containing RING finger 4 1425083_at 6.8 Otor otoraplin 1451406_a_at 6.1 Pcsk5 proprotein convertase subtilisin/kexin type 5 1422052_at 5.7 Cdh8 cadherin 8 1450047_at 5.3 Hs6st2 heparan sulfate 6-O-sulfotransferase 2 1419719_at 5.1 Gabrb1 gamma-aminobutyric acid (GABA-A) receptor, subunit beta 1 232 1426621_a_at 4.9 Ppp2r2b protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta 1455365_at 4.8 Cdh8 cadherin 8 1436662_at 4.5 Sorcs1 VPS10 domain receptor protein SORCS 1 1436137_at 4.3 Slc6a17 solute carrier family 6 (neurotransmitter transporter), member 17 1440545_at 4.2 ENSMUSG00000075319 predicted gene, ENSMUSG00000075319 1440455_at 4.0 Camk2n1 calcium/calmodulin-dependent protein kinase II inhibitor 1 1452728_at 3.9 Kirrel3 kin of IRRE like 3 (Drosophila) 1422150_at 3.8 Hmx3 H6 homeo box 3 1431569_a_at 3.8 Lypd1 Ly6/Plaur domain containing 1 1426712_at 3.8 Slc6a15 solute carrier family 6 (neurotransmitter transporter), member 15 1423551_at 3.8 Cdh13 cadherin 13 1456778_at 3.7 ------1449979_a_at 3.6 Spock3 sparc/osteonectin, cwcv and kazal-like domains proteoglycan 3 1440425_at 3.6 ------1456609_at 3.6 Camk2n1 calcium/calmodulin-dependent protein kinase II inhibitor 1 1429390_at 3.5 Acpl2 acid phosphatase-like 2 1459214_at 3.4 ------1438729_at 3.4 Sox1 SRY-box containing gene 1 1447992_s_at 3.3 Pcsk2 proprotein convertase subtilisin/kexin type 2 1434115_at 3.3 Cdh13 cadherin 13 1440413_at 3.3 A830006F12Rik RIKEN cDNA A830006F12 gene 1455145_at 3.3 Pcdh19 protocadherin 19 1435095_at 3.1 C030009O12Rik RIKEN cDNA C030009O12 gene 1435349_at 3.0 Nrp2 /// Pard3b neuropilin 2 /// par-3 partitioning defective 3 homolog B (C. elegans) 1442887_at 2.9 AI853363 expressed sequence AI853363 1437360_at 2.8 Pcdh19 protocadherin 19 1454869_at 2.7 Wdr40b WD repeat domain 40B 1448312_at 2.6 Pcsk2 proprotein convertase subtilisin/kexin type 2 1457156_at 2.6 Trhde TRH-degrading enzyme 233 1448473_at 2.6 Bub3 budding uninhibited by benzimidazoles 3 homolog (S. cerevisiae) 1457446_at 2.6 Opcml opioid binding protein/cell adhesion molecule-like 1435612_at 2.6 Opcml opioid binding protein/cell adhesion molecule-like 1450440_at 2.5 Gfra1 glial cell line derived neurotrophic factor family receptor alpha 1 1437214_at 2.5 Lrrtm4 leucine rich repeat transmembrane neuronal 4 1457325_at 2.5 Kcns2 K+ voltage-gated channel, subfamily S, 2 1460038_at 2.5 LOC100045707 /// similar to long overlapping ORF; NH2 terminus uncertain /// POU 1439088_at 2.5 Pdzd8 PDZ domain containing 8 1456735_x_at 2.5 Acpl2 acid phosphatase-like 2 1457318_at 2.4 A330008L17Rik RIKEN cDNA A330008L17 gene 1434170_at 2.4 Wdr40b WD repeat domain 40B 1417143_at 2.4 Lpar1 lysophosphatidic acid receptor 1 1442865_at 2.3 Dgkk diacylglycerol kinase kappa 1417568_at 2.3 Ncald neurocalcin delta 1436244_a_at 2.3 Tle2 transducin-like enhancer of split 2, homolog of Drosophila E(spl) 1451986_s_at 2.2 Lrrk1 leucine-rich repeat kinase 1 1421990_at 2.2 Syt1 synaptotagmin I 1458394_at 2.2 Slc6a17 solute carrier family 6 (neurotransmitter transporter), member 17 1436475_at 2.2 Nr2f2 nuclear receptor subfamily 2, group F, member 2 1422777_at 2.2 C1ql1 complement component 1, q subcomponent-like 1 1423664_at 2.1 Qdpr quinoid dihydropteridine reductase 1433452_at 2.1 B630019K06Rik RIKEN cDNA B630019K06 gene 1428305_at 2.1 Pcsk2 proprotein convertase subtilisin/kexin type 2 1424763_at 2.1 1700027N10Rik RIKEN cDNA 1700027N10 gene 1433707_at 2.1 Gabra4 gamma-aminobutyric acid (GABA-A) receptor, subunit alpha 4 1452227_at 2.1 2310045A20Rik RIKEN cDNA 2310045A20 gene 1438441_at 2.1 Id4 Inhibitor of DNA binding 4 1416815_s_at 2.1 Bub3 budding uninhibited by benzimidazoles 3 homolog (S. cerevisiae) 1455298_at 2.1 ------234 1457808_at 2.0 LOC432842 hypothetical LOC432842 1417929_at 2.0 Slc7a8 solute carrier family 7 (cationic amino acid transporter, y+ system), 1435741_at 2.0 Pde8b phosphodiesterase 8B 1451537_at 2.0 Chi3l1 chitinase 3-like 1 1435286_at 2.0 Epha5 Eph receptor A5 1436754_at 2.0 Tmem179 transmembrane protein 179 1429391_at 2.0 Acpl2 acid phosphatase-like 2 1452203_at 1.9 Obfc2a oligonucleotide/oligosaccharide-binding fold containing 2A 1450466_at 1.9 Cdk5r2 cyclin-dependent kinase 5, regulatory subunit 2 (p39) 1430391_a_at 1.9 St8sia4 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 1439272_at 1.9 Lcorl /// LOC100046011 ligand dependent nuclear receptor corepressor-like /// hypothetical 1456954_at 1.9 Kcna6 potassium voltage-gated channel, shaker-related, subfamily, member 6 1449545_at 1.9 Fgf18 fibroblast growth factor 18 1446036_at 1.8 AU018728 expressed sequence AU018728 1446382_at 1.8 ------1417804_at 1.8 Rasgrp2 RAS, guanyl releasing protein 2 1436044_at 1.8 Scn7a sodium channel, voltage-gated, type VII, alpha 1454691_at 1.7 Nrxn1 neurexin I 1448647_at 1.7 Man2a1 mannosidase 2, alpha 1 1421654_a_at 1.7 Lmna lamin A 1453510_s_at 1.6 4930589M24Rik RIKEN cDNA 4930589M24 gene 1455288_at 1.5 1110036O03Rik RIKEN cDNA 1110036O03 gene 1452249_at 1.5 Prickle1 prickle like 1 (Drosophila) 1439322_at 1.5 ------1440270_at 1.4 Fgf12 fibroblast growth factor 12 235 Supplemental Table S10. Cluster III, R+R- enriched.
Affy ID Fold Change Gene Symbol Gene Title 1418868_at 18.3 En2 engrailed 2 1438009_at 11.1 Hist1h2ab /// Hist1h2ac histone cluster 1, H2ab /// histone cluster 1, H2ac /// histone cluster 1, 1437996_s_at 8.4 1500012D20Rik RIKEN cDNA 1500012D20 gene 1418618_at 7.2 En1 engrailed 1 1455471_at 6.6 1500012D20Rik RIKEN cDNA 1500012D20 gene 1418666_at 4.5 Ptx3 pentraxin related gene 1456127_at 4.5 Cnpy1 canopy 1 homolog (zebrafish) 1455620_at 3.6 EG628779 predicted gene, EG628779 1442558_at 3.4 ENSMUSG00000072792 predicted gene, ENSMUSG00000072792 1451888_a_at 3.0 Odz4 odd Oz/ten-m homolog 4 (Drosophila) 236 1447676_x_at 2.8 S100a16 S100 calcium binding protein A16 1425560_a_at 2.7 S100a16 S100 calcium binding protein A16 1454178_at 2.6 2610027F03Rik RIKEN cDNA 2610027F03 gene 1434458_at 2.5 Fst follistatin 1452968_at 2.4 Cthrc1 collagen triple helix repeat containing 1 1451983_at 2.2 Irx1 Iroquois related homeobox 1 (Drosophila) 1427252_at 2.1 Dmrtb1 DMRT-like family B with proline-rich C-terminal, 1 1439557_s_at 2.1 Ldb2 LIM domain binding 2 1435917_at 1.9 Ociad2 OCIA domain containing 2 1426298_at 1.9 Irx2 /// LOC100045612 Iroquois related homeobox 2 (Drosophila) /// similar to iroquois-class 1436449_at 1.8 ------1451479_a_at 1.8 Tmem53 transmembrane protein 53 1435297_at 1.8 Gjd2 gap junction protein, delta 2 1425530_a_at 1.7 Stx3 syntaxin 3 1418502_a_at 1.7 Oxr1 oxidation resistance 1 1424133_at 1.5 Tmem98 transmembrane protein 98 Supplemental Table S11. Cluster IV, C+ enriched.
Affy ID Fold Change Gene Symbol Gene Title 1441429_at 20.3 Irs4 insulin receptor substrate 4 1442724_at 15.6 Dlk1 delta-like 1 homolog (Drosophila) 1455436_at 13.0 Diras2 DIRAS family, GTP-binding RAS-like 2 1418589_a_at 11.9 Mlf1 myeloid leukemia factor 1 1457733_at 9.7 ------1457635_s_at 9.6 Nr3c1 nuclear receptor subfamily 3, group C, member 1 1424250_a_at 9.3 Arhgef3 Rho guanine nucleotide exchange factor (GEF) 3 1438540_at 8.8 Col25a1 collagen, type XXV, alpha 1 1460482_at 7.7 3110047P20Rik RIKEN cDNA 3110047P20 gene 1449939_s_at 7.4 Dlk1 delta-like 1 homolog (Drosophila) 1445268_at 6.1 ------237 1418756_at 5.6 Trh thyrotropin releasing hormone 1456096_at 5.5 6430573F11Rik RIKEN cDNA 6430573F11 gene 1437868_at 5.3 BC023892 cDNA sequence BC023892 1441258_at 5.2 AF529169 cDNA sequence AF529169 1433787_at 5.2 Nell1 NEL-like 1 (chicken) 1423836_at 5.1 Zfp503 zinc finger protein 503 1448125_at 5.0 Rit2 Ras-like without CAAX 2 1427122_at 4.9 Copg2as2 coatomer protein complex, subunit gamma 2, antisense 2 1439827_at 4.9 Adamts12 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 12 1428765_at 4.7 Meg3 maternally expressed 3 1417217_at 4.6 Magel2 melanoma antigen, family L, 2 1435513_at 4.4 Htr2c 5-hydroxytryptamine (serotonin) receptor 2C 1449465_at 4.4 Reln reelin 1427123_s_at 4.2 Copg2as2 coatomer protein complex, subunit gamma 2, antisense 2 1429256_at 4.1 Meg3 maternally expressed 3 1452183_a_at 4.1 Meg3 maternally expressed 3 1442257_at 4.0 ------1416778_at 4.0 Sdpr serum deprivation response 1443179_at 3.9 ------1438989_s_at 3.9 B130021B11Rik RIKEN cDNA B130021B11 gene 1455883_a_at 3.8 Lrrtm1 leucine rich repeat transmembrane neuronal 1 1457105_at 3.8 Pkd2l1 polycystic kidney disease 2-like 1 1435337_at 3.7 Tshz3 teashirt zinc finger family member 3 1447260_at 3.7 667782 /// predicted gene, 667782 /// predicted gene, EG667977 /// predicted gene, 1447448_s_at 3.7 Klf6 Kruppel-like factor 6 1453334_at 3.7 B230216N24Rik RIKEN cDNA B230216N24 gene 1427157_at 3.7 Ccdc85a coiled-coil domain containing 85A 1439990_at 3.5 ------1416069_at 3.4 Pfkp phosphofructokinase, platelet 1450958_at 3.4 Tm4sf1 transmembrane 4 superfamily member 1 1420484_a_at 3.3 Vtn vitronectin 238 1442810_x_at 3.3 Scn9a sodium channel, voltage-gated, type IX, alpha 1436359_at 3.3 Ret ret proto-oncogene 1458974_at 3.3 ------1447100_s_at 3.2 5730508B09Rik RIKEN cDNA 5730508B09 gene 1431094_at 3.2 1110006E14Rik RIKEN cDNA 1110006E14 gene 1423835_at 3.2 Zfp503 zinc finger protein 503 1452654_at 3.2 Zdhhc2 zinc finger, DHHC domain containing 2 1417288_at 3.1 Plekha2 pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2 1450042_at 3.1 Arx /// aristaless related homeobox /// similar to Arx homeoprotein 1442800_x_at 3.1 A830059I20Rik RIKEN cDNA A830059I20 gene 1435162_at 3.0 Prkg2 protein kinase, cGMP-dependent, type II 1433508_at 3.0 Klf6 Kruppel-like factor 6 1439604_at 3.0 Adamts16 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 16 1427320_at 3.0 Copg2as2 coatomer protein complex, subunit gamma 2, antisense 2 1440557_at 3.0 Ipw Imprinted gene in the Prader-Willi syndrome region 1434292_at 3.0 A930034L06Rik RIKEN cDNA A930034L06 gene 1433607_at 3.0 Cbln4 cerebellin 4 precursor protein 1440935_at 2.9 ------1424525_at 2.8 Grp gastrin releasing peptide 1417788_at 2.8 Sncg synuclein, gamma 1440431_at 2.8 ------1429678_at 2.8 5730508B09Rik RIKEN cDNA 5730508B09 gene 1440156_s_at 2.7 ------1428187_at 2.7 Cd47 CD47 antigen (Rh-related antigen, integrin-associated signal transducer) 1436057_at 2.7 Meg3 maternally expressed 3 1458135_at 2.6 ------1438057_at 2.6 ------1439380_x_at 2.6 Meg3 maternally expressed 3 1433965_at 2.6 Atp8a1 ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1 1434759_at 2.6 Lrrtm3 leucine rich repeat transmembrane neuronal 3 1433551_at 2.6 AI427515 expressed sequence AI427515 239 1445703_at 2.5 Ptchd1 patched domain containing 1 1427019_at 2.5 Ptprz1 protein tyrosine phosphatase, receptor type Z, polypeptide 1 1452284_at 2.5 Ptprz1 protein tyrosine phosphatase, receptor type Z, polypeptide 1 1419517_at 2.5 Cnih3 cornichon homolog 3 (Drosophila) 1436869_at 2.4 Shh sonic hedgehog 1457038_at 2.4 Frem2 Fras1 related extracellular matrix protein 2 1419392_at 2.4 Pclo piccolo (presynaptic cytomatrix protein) 1424415_s_at 2.4 Spon1 spondin 1, (f-spondin) extracellular matrix protein 1458015_at 2.4 Megf11 multiple EGF-like-domains 11 1435424_x_at 2.4 ------1420925_at 2.4 Tub tubby candidate gene 1434386_at 2.4 Atp2c1 /// ATPase, Ca++-sequestering /// hypothetical protein LOC100045884 1419493_a_at 2.4 Tpd52 tumor protein D52 1436122_at 2.4 Zfp667 zinc finger protein 667 1423561_at 2.4 Nell2 NEL-like 2 (chicken) 1419554_at 2.4 Cd47 CD47 antigen (Rh-related antigen, integrin-associated signal transducer) 1458492_x_at 2.4 Hnt neurotrimin 1433868_at 2.4 Btbd3 BTB (POZ) domain containing 3 1438045_at 2.4 Eea1 early endosome antigen 1 1451342_at 2.3 Spon1 spondin 1, (f-spondin) extracellular matrix protein 1455608_at 2.3 Sclt1 sodium channel and clathrin linker 1 1420824_at 2.3 Sema4d sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic 1436931_at 2.3 Rfx4 regulatory factor X, 4 (influences HLA class II expression) 1435744_at 2.3 6720401G13Rik RIKEN cDNA 6720401G13 gene 1448250_at 2.3 9030425E11Rik RIKEN cDNA 9030425E11 gene 1428799_at 2.3 Lca5 Leber congenital amaurosis 5 (human) 1439311_at 2.3 B830012L14Rik RIKEN cDNA B830012L14 gene 1438624_x_at 2.3 Hs3st2 heparan sulfate (glucosamine) 3-O-sulfotransferase 2 1441165_s_at 2.3 Clstn2 calsyntenin 2 1460166_at 2.3 Rit2 Ras-like without CAAX 2 1434760_at 2.2 Lrrtm3 leucine rich repeat transmembrane neuronal 3 240 1419706_a_at 2.2 Akap12 A kinase (PRKA) anchor protein (gravin) 12 1435895_at 2.2 Lsamp limbic system-associated membrane protein 1433997_at 2.2 2410127E18Rik RIKEN cDNA 2410127E18 gene 1459723_at 2.2 Zdhhc22 zinc finger, DHHC-type containing 22 1459900_at 2.2 C79468 expressed sequence C79468 1429060_at 2.2 Malat1 metastasis associated lung adenocarcinoma transcript 1 (non-coding RNA) 1447738_s_at 2.2 Ankrd13d ankyrin repeat domain 13 family, member D 1456681_at 2.1 Ptchd1 patched domain containing 1 1449229_a_at 2.1 Cdkl2 cyclin-dependent kinase-like 2 (CDC2-related kinase) 1437738_at 2.1 Atp2c1 /// ATPase, Ca++-sequestering /// hypothetical protein LOC100045884 1455746_at 2.1 Kif13a kinesin family member 13A 1452123_s_at 2.1 Frmd4b FERM domain containing 4B 1417676_a_at 2.1 Ptpro protein tyrosine phosphatase, receptor type, O 1419017_at 2.1 Corin corin 1428771_at 2.1 2410127E18Rik RIKEN cDNA 2410127E18 gene 1435021_at 2.1 Gabrb3 gamma-aminobutyric acid (GABA-A) receptor, subunit beta 3 1442068_at 2.1 ------1424544_at 2.1 Nrbp2 nuclear receptor binding protein 2 1435910_at 2.1 Fads3 fatty acid desaturase 3 1435315_s_at 2.1 2900034E22Rik RIKEN cDNA 2900034E22 gene 1434642_at 2.1 Hsd17b11 hydroxysteroid (17-beta) dehydrogenase 11 1457311_at 2.1 Camk2a calcium/calmodulin-dependent protein kinase II alpha 1459958_at 2.1 Rsrc1 arginine/serine-rich coiled-coil 1 1437696_at 2.1 BC049807 cDNA sequence BC049807 1454708_at 2.1 Ablim1 actin-binding LIM protein 1 1459702_at 2.0 ------1424942_a_at 2.0 Myc myelocytomatosis oncogene 1435460_at 2.0 Prkg2 protein kinase, cGMP-dependent, type II 1417672_at 2.0 Slc4a10 solute carrier family 4, sodium bicarbonate cotransporter-like, member 10 1436427_at 2.0 Prpf4b PRP4 pre-mRNA processing factor 4 homolog B (yeast) 1437855_at 2.0 Mtap4 microtubule-associated protein 4 241 1455234_at 2.0 B3galt1 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1 1458737_at 2.0 C77097 expressed sequence C77097 1434016_at 2.0 Znrf2 zinc and ring finger 2 1442143_at 2.0 Ano4 anoctamin 4 1435952_at 2.0 ------1449141_at 2.0 Fblim1 filamin binding LIM protein 1 1455696_a_at 2.0 Prpf4b PRP4 pre-mRNA processing factor 4 homolog B (yeast) 1457317_at 2.0 ------1456684_at 2.0 Tmem74 transmembrane protein 74 1429041_at 2.0 6820431F20Rik RIKEN cDNA 6820431F20 gene 1434218_at 2.0 C330019G07Rik RIKEN cDNA C330019G07 gene 1444488_at 2.0 ------1456483_at 2.0 Zfp9 zinc finger protein 9 1439265_at 2.0 ------1442613_at 2.0 ------1434017_at 2.0 Znrf2 zinc and ring finger 2 1435618_at 2.0 Pnma2 paraneoplastic antigen MA2 1455258_at 2.0 Kcnc2 potassium voltage gated channel, Shaw-related subfamily, member 2 1426594_at 2.0 Frmd4b FERM domain containing 4B 1440056_at 2.0 ------1418497_at 1.9 Fgf13 fibroblast growth factor 13 1428146_s_at 1.9 Acaa2 acetyl-Coenzyme A acyltransferase 2 (mitochondrial 3-oxoacyl-Coenzyme A thiolase) 1434657_at 1.9 Gls glutaminase 1452952_at 1.9 9030418K01Rik RIKEN cDNA 9030418K01 gene 1422743_at 1.9 Phka1 phosphorylase kinase alpha 1 1455249_at 1.9 ------1455444_at 1.9 Gabra2 gamma-aminobutyric acid (GABA-A) receptor, subunit alpha 2 1416985_at 1.9 Sirpa signal-regulatory protein alpha 1428196_a_at 1.9 1200015F23Rik RIKEN cDNA 1200015F23 gene 1439971_at 1.9 6330439K17Rik RIKEN cDNA 6330439K17 gene 1450435_at 1.9 L1cam L1 cell adhesion molecule 242 1435796_at 1.9 Wscd2 WSC domain containing 2 1439768_x_at 1.9 Sema4f sema domain, immunoglobulin domain (Ig), TM domain, and short cytoplasmic domain 1444384_at 1.9 ------1443018_at 1.9 ------1435567_at 1.9 Phka1 phosphorylase kinase alpha 1 1439093_at 1.9 ------1440896_at 1.9 ------1449770_x_at 1.9 Tmem191c transmembrane protein 191C 1430175_at 1.9 4930588G05Rik RIKEN cDNA 4930588G05 gene 1456072_at 1.9 Ppp1r9a protein phosphatase 1, regulatory (inhibitor) subunit 9A 1440219_at 1.9 ------1447537_at 1.9 1500032P08Rik RIKEN cDNA 1500032P08 gene 1430030_at 1.9 5330426P16Rik RIKEN cDNA 5330426P16 gene 1423365_at 1.9 Cacna1g calcium channel, voltage-dependent, T type, alpha 1G subunit 1460608_at 1.9 Cacna1b calcium channel, voltage-dependent, N type, alpha 1B subunit 1417757_at 1.9 Unc13b unc-13 homolog B (C. elegans) 1429028_at 1.9 Dock11 dedicator of cytokinesis 11 1459321_at 1.9 ------1437041_at 1.9 Sfrs18 splicing factor, arginine/serine-rich 18 1436202_at 1.9 Malat1 metastasis associated lung adenocarcinoma transcript 1 (non-coding RNA) 1442924_at 1.9 ------1434572_at 1.9 Hdac9 histone deacetylase 9 1436602_x_at 1.9 Cacna1b calcium channel, voltage-dependent, N type, alpha 1B subunit 1436177_at 1.9 Plekha2 pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2 1460359_at 1.9 Armcx3 /// armadillo repeat containing, X-linked 3 /// hypothetical protein LOC100044266 1426716_at 1.9 Tdrd7 tudor domain containing 7 1445275_at 1.9 C130092O11Rik RIKEN cDNA C130092O11 gene 1458578_at 1.9 ------1441629_at 1.8 ------1431300_at 1.8 Sgip1 SH3-domain GRB2-like (endophilin) interacting protein 1 1449106_at 1.8 Gpx3 glutathione peroxidase 3 243 1455631_at 1.8 H13 histocompatibility 13 1420191_s_at 1.8 Tmem191c transmembrane protein 191C 1440201_at 1.8 C130026L21Rik RIKEN cDNA C130026L21 gene /// solute carrier family 8 (sodium/calcium exchanger), member 1438076_at 1.8 Rpl30 ribosomal protein L30 1429106_at 1.8 4921509J17Rik RIKEN cDNA 4921509J17 gene 1451388_a_at 1.8 Atp11b ATPase, class VI, type 11B 1455092_at 1.8 Zfp207 zinc finger protein 207 1418008_at 1.8 1810007M14Rik RIKEN cDNA 1810007M14 gene 1440361_at 1.8 OTTMUSG00000 predicted gene, OTTMUSG00000006514 1455636_at 1.8 Lsamp limbic system-associated membrane protein 1434958_at 1.8 Sacs sacsin 1448835_at 1.8 E2f6 E2F transcription factor 6 1421201_a_at 1.8 Tro trophinin 1436463_at 1.8 ------1436871_at 1.8 Sfrs7 splicing factor, arginine/serine-rich 7 1454974_at 1.8 LOC672215 /// similar to Netrin-1 precursor /// netrin 1 1415911_at 1.8 Impact imprinted and ancient 1436944_x_at 1.8 4933439C20Rik RIKEN cDNA 4933439C20 gene /// phosphatidylserine decarboxylase pseudogene /// 1452353_at 1.8 Gpr155 G protein-coupled receptor 155 1455904_at 1.8 Gas5 growth arrest specific 5 1427974_s_at 1.8 Cacna1d calcium channel, voltage-dependent, L type, alpha 1D subunit 1429504_at 1.8 Rnpc3 RNA-binding region (RNP1, RRM) containing 3 1419091_a_at 1.8 Anxa2 annexin A2 1435357_at 1.8 D4Wsu53e DNA segment, Chr 4, Wayne State University 53, expressed 1439090_at 1.8 Tbc1d23 TBC1 domain family, member 23 1428852_at 1.8 Dock3 dedicator of cyto-kinesis 3 1436033_at 1.8 BC031353 cDNA sequence BC031353 1449507_a_at 1.8 Cd47 CD47 antigen (Rh-related antigen, integrin-associated signal transducer) 1428385_at 1.8 8-Mar membrane-associated ring finger (C3HC4) 8 1433830_at 1.8 Hnrnpa2b1 heterogeneous nuclear ribonucleoprotein A2/B1 1439556_at 1.8 Ncam1 neural cell adhesion molecule 1 244 1421425_a_at 1.8 Rcan2 regulator of calcineurin 2 1426803_at 1.8 Rbm26 RNA binding motif protein 26 1429965_at 1.8 Lonrf2 LON peptidase N-terminal domain and ring finger 2 1451526_at 1.7 Arhgap12 Rho GTPase activating protein 12 1433514_at 1.7 Etnk1 ethanolamine kinase 1 1440955_at 1.7 Crim2 cysteine rich BMP regulator 2 (chordin like) 1454982_at 1.7 Arfgef2 ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited) 1435038_s_at 1.7 Aak1 AP2 associated kinase 1 1447900_x_at 1.7 Entpd4 /// ectonucleoside triphosphate diphosphohydrolase 4 /// similar to ectonucleoside triphosphate 1457305_at 1.7 Btrc beta-transducin repeat containing protein 1446138_at 1.7 ------1424437_s_at 1.7 Abcg4 ATP-binding cassette, sub-family G (WHITE), member 4 1434273_at 1.7 Fam174b family with sequence similarity 174, member B 1447725_at 1.7 C030034E14Rik RIKEN cDNA C030034E14 gene 1438975_x_at 1.6 Zdhhc14 zinc finger, DHHC domain containing 14 1450994_at 1.6 Rock1 Rho-associated coiled-coil containing protein kinase 1 1456388_at 1.6 Atp11a ATPase, class VI, type 11A 1437614_x_at 1.6 Zdhhc14 zinc finger, DHHC domain containing 14 1429982_at 1.6 4933426K21Rik RIKEN cDNA 4933426K21 gene 1420150_at 1.6 Spsb1 splA/ryanodine receptor domain and SOCS box containing 1 1438619_x_at 1.6 Zdhhc14 zinc finger, DHHC domain containing 14 1434975_x_at 1.6 4933439C20Rik RIKEN cDNA 4933439C20 gene 1428749_at 1.6 Dmxl2 Dmx-like 2 1455250_at 1.6 Sh3bp4 SH3-domain binding protein 4 1418402_at 1.6 Adam19 /// a disintegrin and metallopeptidase domain 19 (meltrin beta) /// similar to metalloprotease- 1457027_at 1.6 Dhtkd1 dehydrogenase E1 and transketolase domain containing 1 1433596_at 1.6 Dnajc6 DnaJ (Hsp40) homolog, subfamily C, member 6 1441687_at 1.6 Wnt4 wingless-related MMTV integration site 4 1436087_at 1.6 Dpp10 /// dipeptidylpeptidase 10 /// similar to Dipeptidylpeptidase 10 1455489_at 1.6 Lrrtm2 leucine rich repeat transmembrane neuronal 2 1440892_at 1.5 ------245 1416503_at 1.5 Lxn latexin 1416816_at 1.5 Nek7 NIMA (never in mitosis gene a)-related expressed kinase 7 1433600_at 1.4 Adra2a adrenergic receptor, alpha 2a 1418496_at 1.4 Foxa1 /// forkhead box A1 /// similar to Hepatocyte nuclear factor 3-alpha (HNF-3A) (Forkhead box 1437217_at 1.3 Ankrd6 ankyrin repeat domain 6 1432195_s_at 1.7 Ccnl2 cyclin L2 1460580_at 1.7 Pcnx pecanex homolog (Drosophila) 1433998_at 1.7 4933427D14Rik RIKEN cDNA 4933427D14 gene 1439725_at 1.7 Ptprt protein tyrosine phosphatase, receptor type, T 1446860_at 1.7 ------1459857_at 1.7 Usp32 ubiquitin specific peptidase 32 1440522_at 1.7 ENSMUSG000000 predicted gene, ENSMUSG00000073019 1436405_at 1.7 Dock4 dedicator of cytokinesis 4 1434670_at 1.7 Kif5a kinesin family member 5A 1438999_a_at 1.7 Nfat5 nuclear factor of activated T-cells 5 1419898_s_at 1.7 Zc3h7a zinc finger CCCH type containing 7 A 1434051_s_at 1.7 Hspa12a heat shock protein 12A 1457832_at 1.7 ------1436324_at 1.7 Stard9 START domain containing 9 1418073_at 1.7 Acot9 acyl-CoA thioesterase 9 1459223_at 1.7 B930095G15Rik RIKEN cDNA B930095G15 gene 1455377_at 1.7 Ttll7 tubulin tyrosine ligase-like family, member 7 1435641_at 1.7 Mgat4a mannoside acetylglucosaminyltransferase 4, isoenzyme A 1444005_at 1.7 ------1429722_at 1.7 Zbtb4 zinc finger and BTB domain containing 4 1435050_at 1.7 D10Bwg1379e DNA segment, Chr 10, Brigham & Women's Genetics 1379 expressed 1455698_at 1.7 Sec62 SEC62 homolog (S. cerevisiae) 1441989_at 1.7 Bnip2 BCL2/adenovirus E1B interacting protein 2 1435829_at 1.7 Zmat1 zinc finger, matrin type 1 1416828_at 1.7 Snap25 synaptosomal-associated protein 25 1439779_at 1.7 ------246 1453583_at 1.7 Zzef1 zinc finger, ZZ-type with EF hand domain 1 1431202_at 1.7 Herc3 hect domain and RLD 3 1454989_at 1.7 Cspp1 centrosome and spindle pole associated protein 1 1431114_at 1.7 Dock4 dedicator of cytokinesis 4 1435311_s_at 1.7 ------1432750_at 1.7 Zfp711 zinc finger protein 711 1418007_at 1.7 1810007M14Rik RIKEN cDNA 1810007M14 gene 1424632_a_at 1.7 Rev3l REV3-like, catalytic subunit of DNA polymerase zeta RAD54 like (S. cerevisiae) 1458942_at 1.7 C230037E05Rik RIKEN cDNA C230037E05 gene 1450782_at 1.7 Wnt4 wingless-related MMTV integration site 4 Supplemental Table S12. Expressed Imprinted Genes.
Affy ID Gene Symbol Gene Title Av R+C+ Av R+ Av C+ 1455792_x_at Ndn necdin 34466 33866 35066 1437853_x_at Ndn necdin 33098 31707 34489 1435383_x_at Ndn necdin 27232 26625 27838 1415923_at Ndn necdin 24319 24236 24402 1435382_at Ndn necdin 23681 23685 23677 1436936_s_at Xist inactive X specific transcripts 18729 19304 18154 1439380_x_at Meg3 maternally expressed 3 17327 8200 26454 1450186_s_at Gnas "GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus" 16836 15923 17748 1425458_a_at Grb10 growth factor receptor bound protein 10 13471 12780 14162 1452905_at Meg3 maternally expressed 3 13349 7636 19061 1449939_s_at Dlk1 delta-like 1 homolog (Drosophila) 10858 3183 18534 1426215_at Ddc dopa decarboxylase 10760 15044 6475 247 1452183_a_at Meg3 maternally expressed 3 9470 2794 16146 1423506_a_at Nnat neuronatin 9328 13414 5241 1448476_at Nap1l4 nucleosome assembly protein 1-like 4 8416 8010 8822 1415895_at Snrpn /// Snurf small nuclear ribonucleoprotein N /// SNRPN upstream reading frame 8089 7973 8205 1417411_at Nap1l5 nucleosome assembly protein 1-like 5 7691 8737 6645 1417649_at Cdkn1c cyclin-dependent kinase inhibitor 1C (P57) 6640 8412 4867 1415896_x_at Snrpn /// Snurf small nuclear ribonucleoprotein N /// SNRPN upstream reading frame 6553 6999 6106 1435716_x_at Snrpn /// Snurf small nuclear ribonucleoprotein N /// SNRPN upstream reading frame 6119 6341 5897 1417217_at Magel2 "melanoma antigen, family L, 2" 4760 2321 7199 1442724_at Dlk1 delta-like 1 homolog (Drosophila) 4132 710 7554 1416330_at Cd81 CD81 antigen 4061 4327 3794 1424122_s_at Commd1 COMM domain containing 1 3993 4978 3009 1416680_at Ube3a ubiquitin protein ligase E3A 3705 3521 3888 1452906_at Meg3 maternally expressed 3 3490 1760 5219 1423294_at Mest mesoderm specific transcript 3133 2136 4130 1426758_s_at Meg3 maternally expressed 3 3095 1039 5151 1436713_s_at Meg3 maternally expressed 3 2989 1351 4628 1420444_at Slc22a3 "solute carrier family 22 (organic cation transporter), member 3" 2951 5215 686 1435021_at Gabrb3 "gamma-aminobutyric acid (GABA-A) receptor, subunit beta 3" 2921 2211 3631 1429256_at Meg3 maternally expressed 3 2697 1036 4357 1433919_at Asb4 ankyrin repeat and SOCS box-containing 4 2692 1702 3682 1428235_at Sdhd "succinate dehydrogenase complex, subunit D, integral membrane protein" 2096 2220 1973 1428764_at Meg3 maternally expressed 3 2032 1040 3023 1448619_at Dhcr7 7-dehydrocholesterol reductase 1862 1570 2154 1426208_x_at Plagl1 pleiomorphic adenoma gene-like 1 1791 1347 2234 1418688_at Calcr calcitonin receptor 1707 1312 2101 1455883_a_at Lrrtm1 leucine rich repeat transmembrane neuronal 1 1645 782 2508 1451058_at Mcts2 malignant T cell amplified sequence 2 1473 1658 1289 1424121_at Commd1 COMM domain containing 1 1436 1589 1283 1417355_at Peg3 paternally expressed 3 1397 1576 1219 1448194_a_at H19 H19 fetal liver mRNA 1317 1237 1397 1428765_at Meg3 maternally expressed 3 1232 474 1989 1419237_at Usp29 ubiquitin specific peptidase 29 1145 862 1427 248 1427661_a_at Tssc4 tumor-suppressing subchromosomal transferable fragment 4 960 1079 841 1415911_at Impact imprinted and ancient 923 632 1214 1421063_s_at LOC100044139 /// similar to SNRPN upstream reading frame protein /// small nuclear 854 1124 583 1418160_at Mkrn3 "makorin, ring finger protein, 3" 847 947 748 1448761_a_at Copg2 "coatomer protein complex, subunit gamma 2" 847 874 820 1417356_at Peg3 paternally expressed 3 843 821 866 1424111_at Igf2r insulin-like growth factor 2 receptor 824 874 775 1420688_a_at Sgce "sarcoglycan, epsilon" 809 599 1018 1441905_x_at Snrpn /// Snurf small nuclear ribonucleoprotein N /// SNRPN upstream reading frame 764 711 816 1436057_at Meg3 maternally expressed 3 760 415 1105 1457781_at Kcnq1ot1 KCNQ1 overlapping transcript 1 600 475 725 1423422_at Asb4 ankyrin repeat and SOCS box-containing 4 514 388 640 1437489_x_at Sdhd "succinate dehydrogenase complex, subunit D, integral membrane protein" 490 475 504 1440097_at Mirg miRNA containing gene 454 298 610 1416681_at Ube3a ubiquitin protein ligase E3A 442 409 475 1420357_s_at LOC100044094 /// hypothetical protein LOC100044094 /// hypothetical protein LOC100044314 /// 441 345 536 1458161_at Kcnq1ot1 KCNQ1 overlapping transcript 1 437 363 512 1418035_a_at Prim2 "DNA primase, p58 subunit" 417 415 418 SupplementalTable S13. Cluster V, C+ C- enriched.
Affy ID Fold Change Gene Symbol Gene Title 1418415_at 68.0 Hoxb5 homeo box B5 1456229_at 46.0 Hoxb3 homeo box B3 1448926_at 39.7 Hoxa5 homeo box A5 1422870_at 33.8 Hoxc4 homeo box C4 1437664_at 23.1 Hoxd3 homeo box D3 1427433_s_at 19.7 Hoxa3 homeo box A3 1439885_at 17.6 Hoxc5 homeo box C5 1451660_a_at 16.9 Hoxb6 homeo box B6 1460379_at 12.5 Hoxb4 homeo box B4
249 1435673_at 10.9 AI448005 expressed sequence AI448005 1457011_at 10.1 ------1455913_x_at 9.8 Ttr transthyretin 1454608_x_at 8.8 Ttr transthyretin 1449397_at 8.4 Hoxb2 homeo box B2 1427354_at 8.1 Hoxa4 homeo box A4 1416783_at 7.7 Tac1 tachykinin 1 1449368_at 7.6 Dcn decorin 1421537_at 7.2 Hoxd3 homeo box D3 1438042_at 6.9 Shox2 short stature homeobox 2 1459737_s_at 6.9 Ttr transthyretin 1419602_at 6.9 Hoxa2 homeo box A2 1447886_at 5.7 0610040B09Rik RIKEN cDNA 0610040B09 gene 1427605_at 5.5 Hoxb3 homeo box B3 1460465_at 5.4 A930038C07Rik RIKEN cDNA A930038C07 gene 1416561_at 4.9 Gad1 glutamic acid decarboxylase 1 1425828_at 4.9 LOC100045487 /// similar to homeodomain transcription factor /// NK6 homeobox 1 1453003_at 4.9 Sorl1 sortilin-related receptor, LDLR class A repeats-containing 1443803_x_at 4.7 Hoxa5 homeo box A5 1452421_at 4.2 Hoxa3 homeo box A3 1452493_s_at 4.2 Hoxb7 /// Hoxb8 homeo box B7 /// homeo box B8 1441070_at 3.9 ------1439915_at 3.9 ------1435043_at 3.9 Plcb1 phospholipase C, beta 1 1451580_a_at 3.6 Ttr transthyretin 1440177_at 3.5 9630027E11 /// hypothetical protein 9630027E11 /// glutamate receptor, ionotropic, kainate 3 1457358_at 3.5 ------1451461_a_at 3.4 Aldoc aldolase C, fructose-bisphosphate
250 1435385_at 3.4 Tshz2 teashirt zinc finger family member 2 1428026_at 3.2 Tshz2 teashirt zinc finger family member 2 1436948_a_at 3.1 6430550H21Rik RIKEN cDNA 6430550H21 gene 1417129_a_at 3.1 Meis2 Meis homeobox 2 1460623_at 3.0 Skap2 src family associated phosphoprotein 2 1418895_at 2.9 Skap2 src family associated phosphoprotein 2 1451129_at 2.8 Calb2 calbindin 2 1436461_at 2.7 ------1416114_at 2.7 Sparcl1 SPARC-like 1 (mast9, hevin) 1457632_s_at 2.6 Meis2 Meis homeobox 2 1450992_a_at 2.6 Meis1 Meis homeobox 1 1455426_at 2.6 Epha3 Eph receptor A3 1456301_at 2.6 Hoxc5 homeo box C5 1440975_at 2.6 Mxra7 matrix-remodelling associated 7 1430596_s_at 2.6 Vgll3 vestigial like 3 (Drosophila) 1429918_at 2.6 Arhgap20 Rho GTPase activating protein 20 1460101_at 2.5 ------1437558_at 2.5 B130021B11Rik RIKEN cDNA B130021B11 gene 1431398_at 2.5 5730446D14Rik RIKEN cDNA 5730446D14 gene 1441732_at 2.5 ------1453593_at 2.5 Vgll3 vestigial like 3 (Drosophila) 1460056_at 2.4 1700109F18Rik RIKEN cDNA 1700109F18 gene 1447861_x_at 2.4 Meis2 Meis homeobox 2 1451277_at 2.4 Zadh2 zinc binding alcohol dehydrogenase, domain containing 2 1451761_at 2.4 Hoxb4 homeo box B4 1437782_at 2.4 Cntnap2 contactin associated protein-like 2 1455845_at 2.4 Wscd1 WSC domain containing 1 1436026_at 2.3 Zfp703 zinc finger protein 703
251 1427256_at 2.3 Vcan versican 1452878_at 2.3 Prkce protein kinase C, epsilon 1439174_at 2.3 ------1429175_at 2.3 Tmem178 transmembrane protein 178 1458622_at 2.2 Ntrk2 neurotrophic tyrosine kinase, receptor, type 2 1454720_at 2.2 Apba3 /// Hs3st5 amyloid beta (A4) precursor protein-binding, family A, member 3 /// heparan sulfate 1416805_at 2.2 1110032E23Rik RIKEN cDNA 1110032E23 gene 1455299_at 2.2 Vgll3 vestigial like 3 (Drosophila) 1417937_at 2.2 Dact1 dapper homolog 1, antagonist of beta-catenin (xenopus) 1444734_at 2.1 A330001L22Rik RIKEN cDNA A330001L22 gene 1441223_at 2.1 4-Mar membrane-associated ring finger (C3HC4) 4 1433885_at 2.0 Iqgap2 IQ motif containing GTPase activating protein 2 1444543_at 2.0 ------1457966_at 2.0 ------1425452_s_at 2.0 Fam84a /// Ptprj family with sequence similarity 84, member A /// protein tyrosine phosphatase, 1459886_at 1.9 ------1418588_at 1.9 Nrsn1 neurensin 1 1433776_at 1.9 Lhfp lipoma HMGIC fusion partner 1447509_at 1.9 ------1417122_at 1.9 Vav3 vav 3 oncogene 1437405_a_at 1.9 Igfbp4 insulin-like growth factor binding protein 4 1423278_at 1.9 Ptprk protein tyrosine phosphatase, receptor type, K 1424547_at 1.9 Car10 carbonic anhydrase 10 1435453_at 1.9 A930011O12Rik RIKEN cDNA A930011O12 gene 1450209_at 1.8 Hoxd3 /// Hoxd4 homeo box D3 /// homeo box D4 1448600_s_at 1.8 Vav3 vav 3 oncogene 1420416_at 1.8 LOC100044161 /// hypothetical protein LOC100044161 /// sema domain, immunoglobulin domain (Ig), 1433992_at 1.8 Shroom2 shroom family member 2
252 1460214_at 1.8 Pcp4 Purkinje cell protein 4 1435771_at 1.8 Plcb4 phospholipase C, beta 4 1443075_at 1.8 ------1429022_at 1.8 Adcyap1r1 adenylate cyclase activating polypeptide 1 receptor 1 1423756_s_at 1.8 Igfbp4 insulin-like growth factor binding protein 4 1419672_at 1.7 Spock1 sparc/osteonectin, cwcv and kazal-like domains proteoglycan 1 1455325_at 1.7 ------1460693_a_at 1.7 Col9a3 collagen, type IX, alpha 3 1425514_at 1.7 Pik3r1 phosphatidylinositol 3-kinase, regulatory subunit, polypeptide 1 (p85 alpha) 1448584_at 1.7 Rsrc1 arginine/serine-rich coiled-coil 1 1458470_at 1.7 ------1418505_at 1.7 Nudt4 nudix (nucleoside diphosphate linked moiety X)-type motif 4 1421917_at 1.7 Pdgfra platelet derived growth factor receptor, alpha polypeptide 1455450_at 1.7 Ptpn3 protein tyrosine phosphatase, non-receptor type 3 1455898_x_at 1.7 Slc2a3 solute carrier family 2 (facilitated glucose transporter), member 3 1434515_at 1.7 Ncoa1 nuclear receptor coactivator 1 1437052_s_at 1.7 Slc2a3 solute carrier family 2 (facilitated glucose transporter), member 3 1421841_at 1.6 Fgfr3 fibroblast growth factor receptor 3 1420401_a_at 1.6 AB182283 /// cDNA sequence AB182283 /// similar to receptor activity modifying protein 3 /// 1434818_at 1.6 9330159K06 hypothetical protein 9330159K06 1429514_at 1.6 Ppap2b phosphatidic acid phosphatase type 2B 1433691_at 1.6 Ppp1r3c protein phosphatase 1, regulatory (inhibitor) subunit 3C 1435578_s_at 1.6 Dab1 disabled homolog 1 (Drosophila) 1434384_at 1.6 Nrip1 nuclear receptor interacting protein 1 1439422_a_at 1.6 C1qdc2 C1q domain containing 2 1420573_at 1.6 Hoxd1 homeo box D1 1417600_at 1.6 Slc15a2 solute carrier family 15 (H+/peptide transporter), member 2 1421694_a_at 1.6 Vcan versican
253 1427308_at 1.6 Dab1 disabled homolog 1 (Drosophila) 1429809_at 1.6 Tmtc2 transmembrane and tetratricopeptide repeat containing 2 1439412_at 1.5 ------1433906_at 1.5 Rlbp1l1 retinaldehyde binding protein 1-like 1 1423757_x_at 1.5 Igfbp4 insulin-like growth factor binding protein 4 1450832_at 1.5 Hoxc5 homeo box C5 1418690_at 1.5 Ptprz1 protein tyrosine phosphatase, receptor type Z, polypeptide 1 1418966_a_at 1.5 Dcbld1 discoidin, CUB and LCCL domain containing 1 1429019_s_at 1.5 Pon2 paraoxonase 2 1435577_at 1.5 Dab1 disabled homolog 1 (Drosophila) 1417318_at 1.5 Dbc1 deleted in bladder cancer 1 (human) 1449169_at 1.5 Has2 hyaluronan synthase 2 1437643_at 1.5 Cenpj centromere protein J 1433768_at 1.4 Palld palladin, cytoskeletal associated protein 1437086_at 1.4 Ascl1 achaete-scute complex homolog 1 (Drosophila) 1433939_at 1.4 Aff3 AF4/FMR2 family, member 3 1449236_at 1.4 Dll3 delta-like 3 (Drosophila) 1419204_at 1.4 Dll1 delta-like 1 (Drosophila) 1456397_at 1.3 Cdh4 cadherin 4 1428429_at 1.3 Rgmb RGM domain family, member B 1450686_at 1.2 Pon2 paraoxonase 2 1433587_at 1.2 Rgmb RGM domain family, member B 1418157_at 1.2 LOC100046044 /// similar to COUP-TFI /// nuclear receptor subfamily 2, group F, member 1 1435963_at 1.2 Sema5b sema domain, seven thrombospondin repeats (type 1 and type 1-like), 1436570_at 1.1 ------254 Supplemental Table S14 - Expressed disease-associated genes (Ingenuity Pathway Analysis). Anxiety Affy ID Gene Symbol Gene Title Av R+C+ Av R+ Av C+ 1417150_at Slc6a4 solute carrier family 6 (neurotransmitter transporter, serotonin), 11640 13940 9341 1454675_at Thra thyroid hormone receptor alpha 7873 7665 8081 1450070_s_at Pak1 p21 (CDKN1A)-activated kinase 1 7330 6948 7711 1428667_at Maoa monoamine oxidase A 4717 4638 4797 1418545_at Wasf1 WASP family 1 4346 3840 4853 1419248_at Rgs2 regulator of G-protein signaling 2 4298 4333 4263 1417386_at Npepps aminopeptidase puromycin sensitive 3845 3619 4072 1420980_at Pak1 p21 (CDKN1A)-activated kinase 1 3790 3618 3962 1416837_at Bax BCL2-associated X protein 3771 4590 2952
255 1416394_at Bag1 BCL2-associated athanogene 1 3473 3596 3350 1435021_at Gabrb3 gamma-aminobutyric acid (GABA-A) receptor, subunit beta 3 2921 2211 3632 1452142_at Slc6a1 solute carrier family 6 (neurotransmitter transporter, GABA), member 2786 2254 3318 1417385_at Npepps aminopeptidase puromycin sensitive 2495 3096 1895 1447830_s_at Rgs2 regulator of G-protein signaling 2 2425 2434 2416 1428755_at Creb1 cAMP responsive element binding protein 1 2339 2251 2428 1452901_at Creb1 cAMP responsive element binding protein 1 1600 1669 1530 1419247_at Rgs2 regulator of G-protein signaling 2 1268 1899 637 1428203_at Gabrb2 gamma-aminobutyric acid (GABA-A) receptor, subunit beta 2 1217 837 1597 1420979_at Pak1 p21 (CDKN1A)-activated kinase 1 1202 1170 1233 1419719_at Gabrb1 gamma-aminobutyric acid (GABA-A) receptor, subunit beta 1 859 1352 365 1423369_at Fmr1 fragile X mental retardation syndrome 1 homolog 826 783 870
1418177_at Gabrg2 gamma-aminobutyric acid (GABA-A) receptor, subunit gamma 2 739 723 755 1415806_at Plat plasminogen activator, tissue 728 663 792 1438710_at Htr1a 5-hydroxytryptamine (serotonin) receptor 1A 679 507 850 1428204_at Gabrb2 gamma-aminobutyric acid (GABA-A) receptor, subunit beta 2 670 626 714 1433600_at Adra2a adrenergic receptor, alpha 2a 624 633 616
1437147_at Gabrg2 gamma-aminobutyric acid (GABA-A) receptor, subunit gamma 2 602 568 637 1428205_x_at Gabrb2 gamma-aminobutyric acid (GABA-A) receptor, subunit beta 2 549 507 590 1435775_at Clock circadian locomoter output cycles kaput 504 435 572
1422756_at Slc32a1 solute carrier family 32 (GABA vesicular transporter), member 1 462 304 620 1418660_at Clock circadian locomoter output cycles kaput 445 339 551 1437968_at Grin1 glutamate receptor, ionotropic, NMDA1 (zeta 1) 408 448 369 1457003_at Grin2b glutamate receptor, ionotropic, NMDA2B (epsilon 2) 346 204 488 1441778_at Adcyap1 Adenylate cyclase activating polypeptide 1 336 417 255
256 1442676_at Maoa monoamine oxidase A 334 377 292 1456667_at Htt huntingtin 328 303 353 1425969_a_at Htt huntingtin 315 310 319 Supplemental Table S14 - Expressed disease-associated genes (Ingenuity Pathway Analysis). Bipolar Affy ID Gene Symbol Gene Title Av R+ C+ Av R+ Av C+ 1416970_a_at Cox7a2 cytochrome c oxidase, subunit VIIa 2 33018 35342 30693 1433770_at Dpysl2 dihydropyrimidinase-like 2 27945 28458 27431 1415970_at Cox6c cytochrome c oxidase, subunit VIc 26536 27528 25544 1454661_at Atp5g3 ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c 26249 27415 25082 1416971_at Cox7a2 cytochrome c oxidase, subunit VIIa 2 19547 21648 17446 1415933_a_at Cox5a cytochrome c oxidase, subunit Va 19186 19929 18443 1448153_at Cox5a cytochrome c oxidase, subunit Va 17475 18056 16895 1450186_s_at Gnas GNAS (guanine nucleotide binding protein, alpha stimulating) 16836 15923 17748 1426864_a_at Ncam1 neural cell adhesion molecule 1 16653 16184 17123 1424562_a_at Slc25a4 solute carrier family 25 (mitochondrial carrier, adenine nucleotide 15658 15438 15877 257 1455069_x_at Slc25a4 solute carrier family 25 (mitochondrial carrier, adenine nucleotide 15614 15426 15802 1434897_a_at Slc25a4 solute carrier family 25 (mitochondrial carrier, adenine nucleotide 15200 15040 15360 1416143_at Atp5j /// ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F 13111 13755 12467 1452692_a_at Ndufv2 NADH dehydrogenase (ubiquinone) flavoprotein 2 12017 12628 11407 1417150_at Slc6a4 solute carrier family 6 (neurotransmitter transporter, serotonin), 11640 13940 9341 1436992_x_at Vdac1 voltage-dependent anion channel 1 11579 11331 11827 1416058_s_at Atp5c1 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma 10984 12305 9663 1426215_at Ddc dopa decarboxylase 10760 15045 6475 1438159_x_at Ndufv2 NADH dehydrogenase (ubiquinone) flavoprotein 2 10711 11271 10150 1416064_a_at Hspa5 heat shock protein 5 10556 9076 12035 1416004_at Ywhah tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation 10175 10132 10219 1439267_x_at Cox5a cytochrome c oxidase, subunit Va 10165 10703 9627 1437192_x_at Vdac1 voltage-dependent anion channel 1 9900 9394 10406 1434579_x_at Ndufs8 NADH dehydrogenase (ubiquinone) Fe-S protein 8 9250 10545 7955 1434491_a_at Cox6c cytochrome c oxidase, subunit VIc 9195 9413 8977 1430326_s_at Uqcrq ubiquinol-cytochrome c reductase, complex III subunit VII 9061 10476 7646 1455283_x_at Ndufs8 NADH dehydrogenase (ubiquinone) Fe-S protein 8 8937 9955 7919 1428179_at Ndufv2 NADH dehydrogenase (ubiquinone) flavoprotein 2 8682 9901 7464 1456193_x_at Gpx4 glutathione peroxidase 4 8656 10854 6458 1452032_at Prkar1a protein kinase, cAMP dependent regulatory, type I, alpha 8468 8418 8519 1447919_x_at Ndufab1 NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1 8312 8699 7925 1416189_a_at Sec61a1 Sec61 alpha 1 subunit (S. cerevisiae) 7518 7037 7998 1427965_at Ssbp1 single-stranded DNA binding protein 1 7400 7642 7157 1449465_at Reln reelin 7145 2550 11739 1454958_at Gsk3b glycogen synthase kinase 3 beta 7089 6958 7220 1437223_s_at Xbp1 X-box binding protein 1 6742 7282 6202 1428159_s_at Ndufab1 NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1 6638 7416 5859 1451695_a_at Gpx4 glutathione peroxidase 4 6570 9079 4061 1415990_at Vdac2 voltage-dependent anion channel 2 6272 6793 5752 258 1435767_at Scn3b sodium channel, voltage-gated, type III, beta 5998 5491 6505 1428631_a_at Uqcrc2 ubiquinol cytochrome c reductase core protein 2 5612 6284 4941 1449059_a_at Oxct1 3-oxoacid CoA transferase 1 5327 4977 5678 1438993_a_at Atp6v1d ATPase, H+ transporting, lysosomal V1 subunit D 5195 5405 4985 1423907_a_at Ndufs8 NADH dehydrogenase (ubiquinone) Fe-S protein 8 4911 5691 4131 1420886_a_at Xbp1 X-box binding protein 1 4820 5747 3893 1428667_at Maoa monoamine oxidase A 4717 4638 4797 1426255_at Nefl neurofilament, light polypeptide 4710 3760 5659 1424313_a_at Ndufs7 NADH dehydrogenase (ubiquinone) Fe-S protein 7 4494 4795 4192 1435757_a_at Uqcrc2 ubiquinol cytochrome c reductase core protein 2 4218 4688 3748 1435314_at Tph2 tryptophan hydroxylase 2 4202 6211 2193 1416951_a_at Atp6v1d ATPase, H+ transporting, lysosomal V1 subunit D 4189 4333 4046 1454961_at Synj1 synaptojanin 1 4075 3890 4261 1417771_a_at Psmc6 proteasome (prosome, macropain) 26S subunit, ATPase, 6 4008 3648 4368 1460419_a_at Prkcb protein kinase C, beta 3923 3937 3910 1448799_s_at Mrps12 mitochondrial ribosomal protein S12 3900 4846 2954 1416657_at Akt1 /// thymoma viral proto-oncogene 1 /// similar to serine/threonine 3818 4100 3537 1451312_at Ndufs7 NADH dehydrogenase (ubiquinone) Fe-S protein 7 3739 4622 2855 1416952_at Atp6v1d ATPase, H+ transporting, lysosomal V1 subunit D 3571 3727 3415 1434148_at Tcf4 transcription factor 4 3468 3523 3412 1415998_at Vdac1 voltage-dependent anion channel 1 3362 4050 2673 1420499_at Gch1 GTP cyclohydrolase 1 3316 4249 2382 1422508_at Atp6v1a ATPase, H+ transporting, lysosomal V1 subunit A 3288 3398 3178 1435003_at Pi4ka phosphatidylinositol 4-kinase, catalytic, alpha polypeptide 3182 3202 3163 1436931_at Rfx4 regulatory factor X, 4 (influences HLA class II expression) 3030 1999 4060 1451595_a_at Kcnq2 potassium voltage-gated channel, subfamily Q, member 2 3004 2915 3093 1431086_s_at Pcmt1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 2976 2838 3115 1435021_at Gabrb3 gamma-aminobutyric acid (GABA-A) receptor, subunit beta 3 2921 2211 3632 1422946_a_at Dnmt1 DNA methyltransferase (cytosine-5) 1 2915 2545 3285 259 1435122_x_at Dnmt1 DNA methyltransferase (cytosine-5) 1 2802 2725 2880 1416665_at Coq7 demethyl-Q 7 2778 2863 2693 1416723_at Tcf4 transcription factor 4 2770 2832 2709 1428160_at Ndufab1 NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1 2714 3657 1772 1426865_a_at Ncam1 neural cell adhesion molecule 1 2646 3899 1393 1429692_s_at Gch1 GTP cyclohydrolase 1 2555 2748 2363 1452616_s_at Ssbp1 single-stranded DNA binding protein 1 2517 2656 2378 1437947_x_at Vdac1 voltage-dependent anion channel 1 2517 2430 2604 1415889_a_at Hsp90b1 heat shock protein 90, beta (Grp94), member 1 2507 1967 3047 1435149_at Plcg1 phospholipase C, gamma 1 2491 2175 2807 1447500_at Cux2 cut-like homeobox 2 2365 2219 2510 1427464_s_at Hspa5 heat shock protein 5 2340 2113 2566 1439204_at Scn3a sodium channel, voltage-gated, type III, alpha 2339 2036 2641 1424069_at Napg N-ethylmaleimide sensitive fusion protein attachment protein gamma 2287 1884 2689 1428140_at Oxct1 3-oxoacid CoA transferase 1 2270 2118 2421 1423908_at Ndufs8 NADH dehydrogenase (ubiquinone) Fe-S protein 8 2237 2893 1581 1434213_x_at Ndufs8 NADH dehydrogenase (ubiquinone) Fe-S protein 8 2212 2763 1661 1434887_at Freq frequenin homolog (Drosophila) 2200 2441 1958 1422464_at Mrpl3 mitochondrial ribosomal protein L3 2193 2259 2127 1417770_s_at Psmc6 proteasome (prosome, macropain) 26S subunit, ATPase, 6 2117 2137 2097 1448242_at Sec61a1 Sec61 alpha 1 subunit (S. cerevisiae) 2036 2170 1901 1439556_at Ncam1 neural cell adhesion molecule 1 1729 1396 2063 1434087_at Mthfr 5,10-methylenetetrahydrofolate reductase 1677 1326 2027 1431085_a_at Pcmt1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1618 1753 1483 1447824_x_at Hspa5 heat shock protein 5 1576 1627 1526 1422665_a_at Pcmt1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1556 1440 1672 1455746_at Kif13a kinesin family member 13A 1539 1047 2030 1417683_at Diablo diablo homolog (Drosophila) 1505 1627 1384 1418844_at Alg9 asparagine-linked glycosylation 9 homolog (yeast, alpha 1,2 1469 1443 1495 260 1434439_at Gsk3b glycogen synthase kinase 3 beta 1438 1236 1640 1425550_a_at Prkar1a protein kinase, cAMP dependent regulatory, type I, alpha 1430 1677 1183 1436333_a_at Synj1 synaptojanin 1 1422 1548 1297 1460303_at Nr3c1 nuclear receptor subfamily 3, group C, member 1 1420 678 2163 1450634_at Atp6v1a ATPase, H+ transporting, lysosomal V1 subunit A 1380 1600 1160 1456604_a_at Pcmt1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1356 1445 1266 1426517_at Gnaz guanine nucleotide binding protein, alpha z subunit 1333 1330 1336 1451742_a_at Ugp2 UDP-glucose pyrophosphorylase 2 1306 1192 1420 1419580_at Dlg4 discs, large homolog 4 (Drosophila) 1305 1639 970 1449404_at Pip4k2a phosphatidylinositol-5-phosphate 4-kinase, type II, alpha 1297 983 1611 1420011_s_at Xbp1 X-box binding protein 1 1271 1416 1127 1436750_a_at Oxct1 3-oxoacid CoA transferase 1 1247 1211 1283 1455311_at Dgcr8 DiGeorge syndrome critical region gene 8 1237 1143 1332 1434486_x_at Ugp2 UDP-glucose pyrophosphorylase 2 1231 1169 1292 1421867_at Nr3c1 nuclear receptor subfamily 3, group C, member 1 1224 530 1919 1428203_at Gabrb2 gamma-aminobutyric acid (GABA-A) receptor, subunit beta 2 1217 837 1597 1426269_at Vamp7 vesicle-associated membrane protein 7 1183 1114 1253 1416561_at Gad1 glutamic acid decarboxylase 1 1154 184 2125 1417480_at Fbxo9 f-box protein 9 1140 1058 1222 1447877_x_at Dnmt1 DNA methyltransferase (cytosine-5) 1 1130 1059 1201 1434821_at Brd1 /// bromodomain containing 1 /// similar to bromodomain containing 1 1117 1026 1208 1443749_x_at Slc1a3 solute carrier family 1 (glial high affinity glutamate transporter), 1031 460 1603 1416918_at Dlg3 discs, large homolog 3 (Drosophila) 1007 856 1159 1455804_x_at Oxct1 3-oxoacid CoA transferase 1 1001 974 1027 1453065_at Aldh5a1 aldhehyde dehydrogenase family 5, subfamily A1 966 860 1072 1435439_at Dgcr8 DiGeorge syndrome critical region gene 8 929 788 1069 1451484_a_at Syn1 synapsin I 897 824 971 1436334_at Synj1 synaptojanin 1 885 931 840 1437393_at Prkca protein kinase C, alpha 868 763 973 261 1419719_at Gabrb1 gamma-aminobutyric acid (GABA-A) receptor, subunit beta 1 859 1352 365 1458276_x_at Cit citron 825 905 744 1451020_at Gsk3b glycogen synthase kinase 3 beta 804 923 685 1434986_a_at Sec61a1 Sec61 alpha 1 subunit (S. cerevisiae) 785 709 862 1434485_a_at Ugp2 UDP-glucose pyrophosphorylase 2 774 650 899 1415916_a_at Mthfd1 methylenetetrahydrofolate dehydrogenase (NADP+ dependent), 740 718 761 1418177_at Gabrg2 gamma-aminobutyric acid (GABA-A) receptor, subunit gamma 2 739 723 755 1418586_at Adcy9 adenylate cyclase 9 738 664 812 1416724_x_at Tcf4 transcription factor 4 722 756 687 1437485_at Nos1ap nitric oxide synthase 1 (neuronal) adaptor protein 710 700 719 1449878_a_at Slc12a6 solute carrier family 12, member 6 691 554 828 1417227_at Mccc1 methylcrotonoyl-Coenzyme A carboxylase 1 (alpha) 686 625 747 1438710_at Htr1a 5-hydroxytryptamine (serotonin) receptor 1A 679 507 850 1439949_at Gsk3b Glycogen synthase kinase 3 beta 676 705 647 1428204_at Gabrb2 gamma-aminobutyric acid (GABA-A) receptor, subunit beta 2 670 626 714 1438477_a_at Mcee methylmalonyl CoA epimerase 669 705 632 1417954_at Sst somatostatin 665 730 601 1423515_at Scn8a sodium channel, voltage-gated, type VIII, alpha 639 500 778 1419811_at Adcy9 adenylate cyclase 9 625 514 736 1433600_at Adra2a adrenergic receptor, alpha 2a 624 633 616 1433855_at Abat 4-aminobutyrate aminotransferase 615 565 665 1434450_s_at Adrbk2 adrenergic receptor kinase, beta 2 614 501 728 1437147_at Gabrg2 gamma-aminobutyric acid (GABA-A) receptor, subunit gamma 2 602 568 637 1439931_at Gsk3b glycogen synthase kinase 3 beta 589 506 672 1424089_a_at Tcf4 transcription factor 4 587 622 552 1456003_a_at Slc1a4 solute carrier family 1 (glutamate/neutral amino acid transporter), 569 461 678 1436989_s_at Slc12a6 solute carrier family 12, member 6 563 627 498 1423478_at Prkcb protein kinase C, beta 562 513 611 1436269_s_at Htra2 HtrA serine peptidase 2 556 454 657 262 1420012_at Xbp1 X-box binding protein 1 554 650 459 1428205_x_at Gabrb2 gamma-aminobutyric acid (GABA-A) receptor, subunit beta 2 549 507 590 1419279_at Pip4k2a phosphatidylinositol-5-phosphate 4-kinase, type II, alpha 545 461 630 1457299_at Grm4 glutamate receptor, metabotropic 4 541 418 665 1434149_at Tcf4 transcription factor 4 537 554 520 1452007_at Vamp7 vesicle-associated membrane protein 7 515 552 478 1426118_a_at Tomm40 translocase of outer mitochondrial membrane 40 homolog (yeast) 507 629 386 1455987_at Sec61a1 Sec61 alpha 1 subunit (S. cerevisiae) 507 439 575 1435775_at Clock circadian locomoter output cycles kaput 504 435 572 1457635_s_at Nr3c1 nuclear receptor subfamily 3, group C, member 1 498 244 753 1442810_x_at Scn9a sodium channel, voltage-gated, type IX, alpha 486 288 683 1460495_s_at Htra2 HtrA serine peptidase 2 479 454 505 1457412_at Scn8a sodium channel, voltage-gated, type VIII, alpha 473 431 515 1448411_at Wfs1 Wolfram syndrome 1 homolog (human) 471 430 513 1452031_at Slc1a3 solute carrier family 1 (glial high affinity glutamate transporter), 457 329 584 1418660_at Clock circadian locomoter output cycles kaput 445 339 551 1435942_at Kcnq2 potassium voltage-gated channel, subfamily Q, member 2 429 480 378 1435511_at Syn2 synapsin II 423 436 409 1455609_at Cit citron 420 340 501 1437968_at Grin1 glutamate receptor, ionotropic, NMDA1 (zeta 1) 408 448 369 1436134_at Scn2b sodium channel, voltage-gated, type II, beta 386 391 381 1423447_at Clpx caseinolytic peptidase X (E.coli) 381 340 423 1424070_at Napg N-ethylmaleimide sensitive fusion protein attachment protein gamma 379 375 382 1422463_a_at Mrpl3 mitochondrial ribosomal protein L3 372 405 339 1425580_a_at Pik3c3 phosphoinositide-3-kinase, class 3 360 313 408 1457003_at Grin2b glutamate receptor, ionotropic, NMDA2B (epsilon 2) 346 204 488 1442676_at Maoa monoamine oxidase A 334 377 292 1417857_at Mmaa methylmalonic aciduria (cobalamin deficiency) type A 333 394 271 1428460_at Syn2 synapsin II 329 370 288 263 1454844_at Mchr1 Melanin-concentrating hormone receptor 1 328 453 204 1449620_s_at Adcy9 adenylate cyclase 9 325 298 353 1440681_at Chrna7 cholinergic receptor, nicotinic, alpha polypeptide 7 311 269 354 1426460_a_at Ugp2 UDP-glucose pyrophosphorylase 2 305 273 336 Supplemental Table S14 - Expressed disease-associated genes (Ingenuity Pathway Analysis). Pervasive developmental disorder Affy ID Gene Symbol Gene Title Av R+C+ Av R+ Av C+ 1435767_at Scn3b "sodium channel, voltage-gated, type III, beta" 5998 5491 6505 1454691_at Nrxn1 neurexin I 5118 6211 4024 1438930_s_at Mecp2 methyl CpG binding protein 2 4017 3791 4243 1435021_at Gabrb3 "gamma-aminobutyric acid (GABA-A) receptor, subunit beta 3" 2921 2211 3632 1454722_at Pten phosphatase and tensin homolog 2599 2244 2954 1439204_at Scn3a "sodium channel, voltage-gated, type III, alpha" 2339 2036 2641 1422710_a_at Cacna1h "calcium channel, voltage-dependent, T type, alpha 1H subunit" 1311 1166 1456 1460246_at Mecp2 methyl CpG binding protein 2 1274 1227 1321 1428240_at Nrxn1 neurexin I 1232 1602 862 1428203_at Gabrb2 "gamma-aminobutyric acid (GABA-A) receptor, subunit beta 2" 1217 837 1597 1443749_x_at Slc1a3 "solute carrier family 1 (glial high affinity glutamate transporter), 1031 460 1603
264 1422798_at Cntnap2 contactin associated protein-like 2 983 850 1117 1453065_at Aldh5a1 "aldhehyde dehydrogenase family 5, subfamily A1" 966 860 1072 1419719_at Gabrb1 "gamma-aminobutyric acid (GABA-A) receptor, subunit beta 1" 859 1352 365 1418177_at Gabrg2 "gamma-aminobutyric acid (GABA-A) receptor, subunit gamma 2" 739 723 755 1438710_at Htr1a 5-hydroxytryptamine (serotonin) receptor 1A 679 507 850 1428204_at Gabrb2 "gamma-aminobutyric acid (GABA-A) receptor, subunit beta 2" 670 626 714 1423515_at Scn8a "sodium channel, voltage-gated, type VIII, alpha" 639 500 778 1433600_at Adra2a "adrenergic receptor, alpha 2a" 624 633 616 1433855_at Abat 4-aminobutyrate aminotransferase 615 565 665 1437147_at Gabrg2 "gamma-aminobutyric acid (GABA-A) receptor, subunit gamma 2" 602 568 637 1456003_a_at Slc1a4 "solute carrier family 1 (glutamate/neutral amino acid transporter), 569 461 678 1428205_x_at Gabrb2 "gamma-aminobutyric acid (GABA-A) receptor, subunit beta 2" 549 507 590 1455728_at Pten phosphatase and tensin homolog 488 424 552 1442810_x_at Scn9a "sodium channel, voltage-gated, type IX, alpha" 486 288 683 1457412_at Scn8a "sodium channel, voltage-gated, type VIII, alpha" 473 431 515 1452031_at Slc1a3 "solute carrier family 1 (glial high affinity glutamate transporter), 457 329 584 1450655_at Pten phosphatase and tensin homolog 455 450 459 1436134_at Scn2b "sodium channel, voltage-gated, type II, beta" 386 391 381 Supplemental Table S14 - Expressed disease-associated genes (Ingenuity Pathway Analysis). Schizophrenia Affy ID Gene Symbol Gene Title Av R+C+ Av R+ Av C+ 1418884_x_at Tuba1a tubulin 36800 38312 35287 1455792_x_at Ndn necdin 34466 33866 35066 1415885_at Chgb chromogranin B 34007 32519 35495 1437853_x_at Ndn necdin 33099 31708 34490 1433770_at Dpysl2 dihydropyrimidinase-like 2 27945 28458 27431 1435383_x_at Ndn necdin 27232 26626 27838 1415923_at Ndn necdin 24320 24236 24403 1435382_at Ndn necdin 23682 23686 23678 1429761_at Rtn1 reticulon 1 23631 25854 21408 1427347_s_at Tubb2a tubulin 23316 24266 22366 265 1423281_at Stmn2 stathmin-like 2 21367 23845 18889 1418209_a_at Pfn2 profilin 2 20561 19811 21311 1452649_at Rtn4 reticulon 4 18165 18097 18232 1423280_at Stmn2 stathmin-like 2 18152 17879 18425 1450708_at Scg2 secretogranin II 17764 18990 16537 1416313_at Mllt11 myeloid/lymphoid or mixed-lineage leukemia 16879 16983 16776 1450186_s_at Gnas GNAS (guanine nucleotide binding protein 16836 15923 17748 1426864_a_at Ncam1 neural cell adhesion molecule 1 16653 16184 17123 1417005_at Klc1 kinesin light chain 1 14041 13015 15066 1415978_at Tubb3 tubulin 13814 16644 10984 1436993_x_at Pfn2 profilin 2 13704 13901 13508 1418210_at Pfn2 profilin 2 13613 13195 14032 1417606_a_at Calr calreticulin 13027 11789 14264 1452692_a_at Ndufv2 NADH dehydrogenase (ubiquinone) flavoprotein 2 12017 12628 11407 1427442_a_at App amyloid beta (A4) precursor protein 12000 11613 12386 1435543_at Apc adenomatosis polyposis coli 11941 11351 12532 solute carrier family 6 (neurotransmitter transporter, serotonin), 1417150_at Slc6a4 member 4 11640 13940 9341 1436992_x_at Vdac1 voltage-dependent anion channel 1 11579 11331 11827 1438159_x_at Ndufv2 NADH dehydrogenase (ubiquinone) flavoprotein 2 10711 11271 10150 1450779_at Fabp7 fatty acid binding protein 7 10437 8919 11955 tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation 1416004_at Ywhah protein 10175 10132 10219 1437192_x_at Vdac1 voltage-dependent anion channel 1 9900 9394 10406 1435190_at Chl1 cell adhesion molecule with homology to L1CAM 8867 9592 8143 1428179_at Ndufv2 NADH dehydrogenase (ubiquinone) flavoprotein 2 8682 9901 7464 1455021_at Gabbr1 gamma-aminobutyric acid (GABA-B) receptor 8604 9380 7827 1423537_at Gap43 growth associated protein 43 8097 9519 6674 OTTMUSG0000 266 1455871_s_at 0012893 /// predicted gene 7734 8013 7455 1420377_at St8sia2 ST8 alpha-N-acetyl-neuraminide alpha-2 7724 6481 8966 1454674_at Fez1 fasciculation and elongation protein zeta 1 (zygin I) 7534 7825 7243 1449465_at Reln reelin 7145 2550 11739 1415687_a_at Psap prosaposin 7107 7618 6596 1454958_at Gsk3b glycogen synthase kinase 3 beta 7089 6958 7220 1423489_at LOC100047565 similar to monocyte to macrophage differentiation-associated 6923 6930 6917 1437223_s_at Xbp1 X-box binding protein 1 6742 7282 6202 1456226_x_at Ddr1 discoidin domain receptor family 6662 6818 6506 1448172_at Mdh1 malate dehydrogenase 1 6324 6857 5792 1456170_x_at Calr calreticulin 6316 5299 7333 1452894_at Elavl4 ELAV (embryonic lethal 6078 5926 6230 1421425_a_at Rcan2 regulator of calcineurin 2 6026 4364 7687 1433806_x_at Calr calreticulin 5648 4589 6707 1436834_x_at Mdh1 malate dehydrogenase 1 5571 5957 5185 1417285_a_at Ndufa5 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 5448 5771 5125 1449059_a_at Oxct1 3-oxoacid CoA transferase 1 5327 4977 5678 1417094_at Acot7 acyl-CoA thioesterase 7 5325 6057 4593 1454691_at Nrxn1 neurexin I 5118 6211 4024 1415814_at Atp6v1b2 ATPase 4900 4605 5195 1420886_a_at Xbp1 X-box binding protein 1 4820 5747 3893 1455177_at Ahi1 Abelson helper integration site 1 4748 4462 5034 1428667_at Maoa monoamine oxidase A 4717 4638 4797 1426255_at Nefl neurofilament 4710 3760 5659 1454925_x_at Mdh1 malate dehydrogenase 1 4616 4695 4537 1450258_a_at Elavl4 ELAV (embryonic lethal 4490 4578 4402 1448610_a_at Sod2 superoxide dismutase 2 4425 4417 4433 1425784_a_at Olfm1 olfactomedin 1 4383 3506 5260 1417343_at Fxyd6 FXYD domain-containing ion transport regulator 6 4279 5077 3481 267 1437079_at Slc18a2 solute carrier family 18 (vesicular monoamine) 4205 6307 2102 1417286_at Ndufa5 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 4200 4539 3862 1428741_at Elavl4 ELAV (embryonic lethal 3945 4326 3565 1460419_a_at Prkcb protein kinase C 3923 3937 3910 1416657_at Akt1 /// thymoma viral proto-oncogene 1 3818 4100 3537 1425993_a_at Hsph1 heat shock 105kDa/110kDa protein 1 3759 3243 4276 1435722_at Gria4 /// glutamate receptor 3704 3978 3430 1434172_at Cnr1 cannabinoid receptor 1 (brain) 3486 4060 2913 1423221_at Tubb4 tubulin 3367 3823 2911 1415998_at Vdac1 voltage-dependent anion channel 1 3362 4050 2673 1437390_x_at Stx1a syntaxin 1A (brain) 3312 3000 3624 1435003_at Pi4ka phosphatidylinositol 4-kinase 3182 3202 3163 1424169_at OTTMUSG0000 predicted gene 3176 3747 2606 1423150_at Scg5 secretogranin V 3170 3481 2858 1415821_at Nptn neuroplastin 3157 2868 3446 1422520_at Nefm neurofilament 3124 2450 3799 1451674_at Slc12a5 solute carrier family 12 3033 2791 3276 1435021_at Gabrb3 gamma-aminobutyric acid (GABA-A) receptor 2921 2211 3632 1422946_a_at Dnmt1 DNA methyltransferase (cytosine-5) 1 2915 2545 3285 1439015_at Gfra1 glial cell line derived neurotrophic factor family receptor alpha 1 2901 4945 858 1452152_at Clint1 clathrin interactor 1 2812 2634 2991 1435122_x_at Dnmt1 DNA methyltransferase (cytosine-5) 1 2802 2725 2880 1437341_x_at Cnp 2' 2651 2546 2755 1423488_at Mmd monocyte to macrophage differentiation-associated 2650 2955 2344 1426865_a_at Ncam1 neural cell adhesion molecule 1 2646 3899 1393 1426946_at Ipo5 importin 5 2589 2331 2848 1437947_x_at Vdac1 voltage-dependent anion channel 1 2517 2430 2604 1437224_at Rtn4 reticulon 4 2500 3255 1745 1423561_at Nell2 NEL-like 2 (chicken) 2470 1448 3491 268 1448812_at Hpcal1 hippocalcin-like 1 2308 2583 2034 1428140_at Oxct1 3-oxoacid CoA transferase 1 2270 2118 2421 1417193_at Sod2 superoxide dismutase 2 2255 2369 2142 1460214_at Pcp4 Purkinje cell protein 4 2244 1952 2535 1456475_s_at Prkar2b protein kinase 2201 2064 2338 1434887_at Freq frequenin homolog (Drosophila) 2200 2441 1958 1451071_a_at Atp1a1 ATPase 2180 1752 2608 1416828_at Snap25 synaptosomal-associated protein 25 2178 1756 2600 1455796_x_at Olfm1 olfactomedin 1 2151 1642 2660 1417983_a_at Ube2v2 ubiquitin-conjugating enzyme E2 variant 2 2132 2085 2179 1416990_at Rxrb retinoid X receptor beta 2107 2112 2102 1450053_at Kif2a Kinesin family member 2A 2042 1710 2374 1415797_at Ddr1 discoidin domain receptor family 2000 2345 1655 1434745_at Ccnd2 cyclin D2 1994 2874 1115 1421116_a_at Rtn4 reticulon 4 1947 2304 1590 1436908_at Pcm1 pericentriolar material 1 1848 1350 2347 1421813_a_at Psap prosaposin 1845 2438 1252 1428813_a_at Caly calcyon neuron-specific vesicular protein 1815 2256 1374 1455672_s_at Cplx2 complexin 2 1777 1921 1633 1439556_at Ncam1 neural cell adhesion molecule 1 1729 1396 2063 1435645_at LOC676546 /// similar to monocyte to macrophage differentiation-associated 1690 1601 1779 1434087_at Mthfr 5 1677 1326 2027 1448443_at Serpini1 serine (or cysteine) peptidase inhibitor 1672 1424 1919 1454976_at Sod2 superoxide dismutase 2 1619 1470 1767 1448864_at Snrk SNF related kinase 1600 1664 1536 1440177_at 9630027E11 /// hypothetical protein 9630027E11 /// glutamate receptor 1598 467 2728 1420956_at Apc adenomatosis polyposis coli 1581 1414 1747 1428168_at Mpzl1 myelin protein zero-like 1 1568 1731 1405 1428167_a_at Mpzl1 myelin protein zero-like 1 1554 1608 1500 269 1417144_at Tubg1 tubulin 1528 1609 1446 1416122_at Ccnd2 cyclin D2 1497 2398 596 1429047_at Rtf1 Rtf1 1452 1436 1468 1458622_at Ntrk2 neurotrophic tyrosine kinase 1450 595 2305 1450386_at Kpna3 karyopherin (importin) alpha 3 1441 1302 1580 1434439_at Gsk3b glycogen synthase kinase 3 beta 1438 1236 1640 1427838_at Tubb2a tubulin 1433 1899 966 1460303_at Nr3c1 nuclear receptor subfamily 3 1420 678 2163 1448736_a_at Hprt1 hypoxanthine guanine phosphoribosyl transferase 1 1411 1365 1457 1437188_at Gabbr1 gamma-aminobutyric acid (GABA-B) receptor 1394 1355 1433 1419580_at Dlg4 discs 1305 1639 970 1449404_at Pip4k2a phosphatidylinositol-5-phosphate 4-kinase 1297 983 1611 1425678_a_at Snrk SNF related kinase 1284 1291 1278 1420011_s_at Xbp1 X-box binding protein 1 1271 1416 1127 1436750_a_at Oxct1 3-oxoacid CoA transferase 1 1247 1211 1283 1428240_at Nrxn1 neurexin I 1232 1602 862 1433737_at LOC677213 /// similar to U2AF homology motif (UHM) kinase 1 1228 974 1481 1421867_at Nr3c1 nuclear receptor subfamily 3 1224 530 1919 1430526_a_at Smarca2 SWI/SNF related 1220 1242 1198 1428203_at Gabrb2 gamma-aminobutyric acid (GABA-A) receptor 1217 837 1597 1418087_at Ufd1l ubiquitin fusion degradation 1 like 1215 1210 1220 1435284_at Rtn4 reticulon 4 1174 1125 1222 1416561_at Gad1 glutamic acid decarboxylase 1 1154 184 2125 1434045_at Cdkn1b cyclin-dependent kinase inhibitor 1B 1139 1366 911 1447877_x_at Dnmt1 DNA methyltransferase (cytosine-5) 1 1130 1059 1201 1438664_at Prkar2b protein kinase 1122 1163 1081 1435820_x_at Ddr1 discoidin domain receptor family 1118 1144 1092 1434821_at Brd1 bromodomain containing 1 1117 1026 1208 1423653_at Atp1a1 ATPase 1103 1172 1033 270 1450052_at Kif2a kinesin family member 2A 1089 864 1315 1426562_a_at Olfm1 olfactomedin 1 1073 1084 1063 1420621_a_at App amyloid beta (A4) precursor protein 1009 1117 900 1416918_at Dlg3 discs 1007 856 1159 1455804_x_at Oxct1 3-oxoacid CoA transferase 1 1001 974 1027 1416702_at Serpini1 serine (or cysteine) peptidase inhibitor 996 872 1121 1437363_at Homer1 homer homolog 1 (Drosophila) 994 828 1159 1420838_at Ntrk2 neurotrophic tyrosine kinase 988 634 1343 1422798_at Cntnap2 contactin associated protein-like 2 983 850 1117 1417795_at Chl1 cell adhesion molecule with homology to L1CAM 953 1207 699 1417456_at Gnpat glyceronephosphate O-acyltransferase 930 995 865 1420981_a_at Lmo4 LIM domain only 4 902 1227 577 1418524_at Pcm1 pericentriolar material 1 898 693 1103 1455956_x_at Ccnd2 cyclin D2 887 1419 356 1453063_at Cltb clathrin 878 973 783 1427044_a_at Amph amphiphysin 867 840 895 1419719_at Gabrb1 gamma-aminobutyric acid (GABA-A) receptor 859 1352 365 1449730_s_at Fzd3 frizzled homolog 3 (Drosophila) 839 852 826 1440891_at Gria4 glutamate receptor 829 1013 644 1448125_at Rit2 Ras-like without CAAX 2 820 299 1341 1451020_at Gsk3b glycogen synthase kinase 3 beta 804 923 685 1424050_s_at Fgfr1 fibroblast growth factor receptor 1 795 799 791 1433888_at Atp2b2 ATPase 782 675 890 1419732_at Rtn4r reticulon 4 receptor 765 885 645 1415916_a_at Mthfd1 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 740 718 761 1418177_at Gabrg2 gamma-aminobutyric acid (GABA-A) receptor 739 723 755 1456312_x_at Gsn gelsolin 738 655 821 1451476_at Zdhhc8 zinc finger 732 682 782 1448435_at Med15 mediator complex subunit 15 732 703 761 271 1457683_at Grik2 glutamate receptor 730 640 820 1435971_at Rims3 regulating synaptic membrane exocytosis 3 728 623 833 1418031_at Myo9b myosin IXb 713 497 929 1437485_at Nos1ap nitric oxide synthase 1 (neuronal) adaptor protein 710 700 719 1425585_at Med12 mediator of RNA polymerase II transcription 708 570 846 1448188_at Ucp2 uncoupling protein 2 (mitochondrial 707 718 696 1419883_s_at Atp6v1b2 ATPase 705 796 613 1438710_at Htr1a 5-hydroxytryptamine (serotonin) receptor 1A 679 507 850 1416587_a_at Xrcc1 X-ray repair complementing defective repair in Chinese hamster cells 678 612 745 1439949_at Gsk3b Glycogen synthase kinase 3 beta 676 705 647 1416402_at Abcb10 ATP-binding cassette 675 588 761 1428204_at Gabrb2 gamma-aminobutyric acid (GABA-A) receptor 670 626 714 1417954_at Sst somatostatin 665 730 601 1416491_at Numbl numb-like 639 714 563 1426945_at Ipo5 importin 5 634 638 629 1450970_at Got1 glutamate oxaloacetate transaminase 1 634 716 551 1433600_at Adra2a adrenergic receptor 624 633 616 1428881_at Klc1 kinesin light chain 1 /// similar to Kinesin light chain 1 620 629 612 1437147_at Gabrg2 gamma-aminobutyric acid (GABA-A) receptor 602 568 637 1453421_at Srr serine racemase 597 538 655 1439931_at Gsk3b glycogen synthase kinase 3 beta 589 506 672 1438232_at Foxp2 forkhead box P2 584 635 532 1432367_a_at Ufd1l ubiquitin fusion degradation 1 like 583 638 528 1423478_at Prkcb protein kinase C 562 513 611 1456354_at Chrna4 cholinergic receptor 561 631 492 1419384_at Pick1 protein interacting with C kinase 1 560 521 599 1420012_at Xbp1 X-box binding protein 1 554 650 459 1455037_at Plxna2 plexin A2 553 637 469 1448366_at Stx1a syntaxin 1A (brain) 551 567 534 272 1415996_at Txnip thioredoxin interacting protein 549 567 531 1428205_x_at Gabrb2 gamma-aminobutyric acid (GABA-A) receptor 549 507 590 1453286_at Plxna2 plexin A2 547 684 411 1419279_at Pip4k2a phosphatidylinositol-5-phosphate 4-kinase 545 461 630 1417373_a_at Tuba4a tubulin 542 554 530 1457299_at Grm4 glutamate receptor 541 418 665 1460740_at Cltb /// clathrin 537 516 557 1436930_x_at EG623818 /// predicted gene 537 555 519 1455959_s_at Gclc Glutamate-cysteine ligase 535 527 542 1418980_a_at Cnp 2',3'-cyclic nucleotide 3' phosphodiesterase 528 536 521 1423566_a_at Hsph1 heat shock 105kDa/110kDa protein 1 519 481 557 1452141_a_at Sepp1 selenoprotein P 518 453 584 1434665_at Aga aspartylglucosaminidase 515 475 556 1452232_at Galnt7 UDP-N-acetyl-alpha-D-galactosamine 510 421 600 1439662_at Homer1 homer homolog 1 (Drosophila) 505 502 508 1435775_at Clock circadian locomoter output cycles kaput 504 435 572 1457635_s_at Nr3c1 nuclear receptor subfamily 3 498 244 753 1437171_x_at Gsn gelsolin 480 443 517 1436991_x_at Gsn gelsolin 474 406 542 1459850_x_at Glrb glycine receptor 468 437 500 1415793_at Pnpo pyridoxine 5'-phosphate oxidase 468 476 459 1455045_at Srr serine racemase 465 405 526 1418660_at Clock circadian locomoter output cycles kaput 445 339 551 1415812_at Gsn gelsolin 442 441 443 1429131_at Ube2v2 ubiquitin-conjugating enzyme E2 variant 2 438 423 453 1450659_at Rgs7 regulator of G protein signaling 7 437 408 466 1460420_a_at Egfr epidermal growth factor receptor 435 473 398 1435511_at Syn2 synapsin II 423 436 409 1433787_at Nell1 NEL-like 1 (chicken) 419 93 745 273 1423356_at Snap29 synaptosomal-associated protein 29 409 431 387 1437968_at Grin1 glutamate receptor 408 448 369 1417984_at Ube2v2 ubiquitin-conjugating enzyme E2 variant 2 398 313 483 1421828_at Kpna3 karyopherin (importin) alpha 3 392 400 385 1421017_at Nrg3 neuregulin 3 390 431 349 1425580_a_at Pik3c3 phosphoinositide-3-kinase 360 313 408 1440108_at Foxp2 forkhead box P2 359 349 370 1459741_x_at Ucp2 uncoupling protein 2 (mitochondrial 356 286 427 1439650_at Rtn4 reticulon 4 351 414 287 1457003_at Grin2b glutamate receptor 346 204 488 1449146_at Notch4 Notch gene homolog 4 (Drosophila) 336 407 265 1442676_at Maoa monoamine oxidase A 334 377 292 1428573_at Chn2 chimerin (chimaerin) 2 332 381 283 1435305_at Ntrk2 neurotrophic tyrosine kinase 331 259 403 1428460_at Syn2 synapsin II 329 370 288 1454844_at Mchr1 Melanin-concentrating hormone receptor 1 328 453 204 1440090_at Slc25a27 Solute carrier family 25 323 348 299 1434877_at Nptx1 neuronal pentraxin 1 317 428 206 1436551_at Fgfr1 fibroblast growth factor receptor 1 316 308 324 1440681_at Chrna7 cholinergic receptor 311 269 354 1430640_a_at Prkar2b protein kinase 306 363 248 274 Supplemental Table S14 - Expressed disease-associated genes (Ingenuity Pathway Analysis).
Sudden infant death syndrome Affy ID Gene Symbol Gene Title Av R+C+ Av R+ Av C+ 1415908_at Tspyl1 "testis-specific protein, Y-encoded-like 1" 1974 2039 1909
Unipolar depression Affy ID Gene Symbol Gene Title Av R+C+ Av R+ Av C+ 1417150_at Slc6a4 solute carrier family 6 (neurotransmitter 11640 13940 9341 1452032_at Prkar1a protein kinase, cAMP dependent regulatory, 8468 8418 8519 1447707_s_at Pde2a phosphodiesterase 2A, cGMP-stimulated 6328 5806 6850 275 1428667_at Maoa monoamine oxidase A 4717 4638 4797 1435314_at Tph2 tryptophan hydroxylase 2 4202 6211 2193 1435722_at Gria4 /// glutamate receptor, ionotropic, AMPA4 (alpha 3704 3978 3430 1435021_at Gabrb3 gamma-aminobutyric acid (GABA-A) receptor, 2921 2211 3632 1416125_at Fkbp5 FK506 binding protein 5 1457 1326 1588 1425550_a_at Prkar1a protein kinase, cAMP dependent regulatory, 1430 1677 1183 1460303_at Nr3c1 nuclear receptor subfamily 3, group C, member 1420 678 2163 1421867_at Nr3c1 nuclear receptor subfamily 3, group C, member 1224 530 1919 1428203_at Gabrb2 gamma-aminobutyric acid (GABA-A) receptor, 1217 837 1597 1416918_at Dlg3 discs, large homolog 3 (Drosophila) 1007 856 1159 1436428_at Chrnb2 cholinergic receptor, nicotinic, beta 923 950 896 1452202_at Pde2a phosphodiesterase 2A, cGMP-stimulated 917 964 870 1421970_a_at Gria2 glutamate receptor, ionotropic, AMPA2 (alpha 906 662 1151 1419719_at Gabrb1 gamma-aminobutyric acid (GABA-A) receptor, 859 1352 365 1440891_at Gria4 glutamate receptor, ionotropic, AMPA4 (alpha 829 1013 644 1418177_at Gabrg2 gamma-aminobutyric acid (GABA-A) receptor, 739 723 755 1425585_at Med12 mediator of RNA polymerase II transcription, 708 570 846 1438710_at Htr1a 5-hydroxytryptamine (serotonin) receptor 1A 679 507 850 1428204_at Gabrb2 gamma-aminobutyric acid (GABA-A) receptor, 670 626 714 1433600_at Adra2a adrenergic receptor, alpha 2a 624 633 616 1434146_at Gria2 glutamate receptor, ionotropic, AMPA2 (alpha 620 424 815 1449403_at Pde9a phosphodiesterase 9A 619 511 727 1447708_x_at Pde2a phosphodiesterase 2A, cGMP-stimulated 607 626 588 1437147_at Gabrg2 gamma-aminobutyric acid (GABA-A) receptor, 602 568 637 1456354_at Chrna4 cholinergic receptor, nicotinic, alpha 561 631 492 276 1428205_x_at Gabrb2 gamma-aminobutyric acid (GABA-A) receptor, 549 507 590 1439618_at Pde10a phosphodiesterase 10A 537 494 581 1457635_s_at Nr3c1 nuclear receptor subfamily 3, group C, member 498 244 753 1448411_at Wfs1 Wolfram syndrome 1 homolog (human) 471 430 513 1437968_at Grin1 glutamate receptor, ionotropic, NMDA1 (zeta 408 448 369 1457003_at Grin2b glutamate receptor, ionotropic, NMDA2B 346 204 488 1453098_at Gria2 glutamate receptor, ionotropic, AMPA2 (alpha 344 324 363 1442676_at Maoa monoamine oxidase A 334 377 292 1440681_at Chrna7 cholinergic receptor, nicotinic, alpha 311 269 354 LITERATURE CITED
Adham N, Bard JA, Zgombick JM, Durkin MM, Kucharewicz S, Weinshank RL, Branchek TA (1997) Cloning and characterization of the guinea pig 5-HT1F receptor subtype: a comparison of the pharmacological profile to the human species homolog. Neuropharmacology 36(4-5): 569-576
Aitken AR, Tork I (1988) Early development of serotonin-containing neurons and pathways as seen in wholemount preparations of the fetal rat brain. J Comp Neurol 274(1): 32-47
Albert PR, Lembo P, Storring JM, Charest A, Saucier C (1996) The 5-HT1A receptor: signaling, desensitization, and gene transcription. Neuropsychopharmacology 14(1): 19-25
Albrecht U, Sutcliffe JS, Cattanach BM, Beechey CV, Armstrong D, Eichele G, Beaudet AL (1997) Imprinted expression of the murine Angelman syndrome gene, Ube3a, in hippocampal and Purkinje neurons. Nat Genet 17(1): 75-78
Alenina N, Kikic D, Todiras M, Mosienko V, Qadri F, Plehm R, Boye P, Vilianovitch L, Sohr R, Tenner K, Hortnagl H, Bader M (2009) Growth retardation and altered autonomic control in mice lacking brain serotonin. Proc Natl Acad Sci U S A
Allen ND, Logan K, Lally G, Drage DJ, Norris ML, Keverne EB (1995) Distribution of parthenogenetic cells in the mouse brain and their influence on brain development and behavior. Proc Natl Acad Sci U S A 92(23): 10782-10786
Ansorge MS, Hen R, Gingrich JA (2007) Neurodevelopmental origins of depressive disorders. Curr Opin Pharmacol 7(1): 8-17
Antal M, Petko M, Polgar E, Heizmann CW, Storm-Mathisen J (1996) Direct evidence of an extensive GABAergic innervation of the spinal dorsal horn by fibres descending from the rostral ventromedial medulla. Neuroscience 73(2): 509-518
Arking DE, Cutler DJ, Brune CW, Teslovich TM, West K, Ikeda M, Rea A, Guy M, Lin S, Cook EH, Chakravarti A (2008) A common genetic variant in the neurexin superfamily member CNTNAP2 increases familial risk of autism. Am J Hum Genet 82(1): 160-164
Arvidsson U, Cullheim S, Ulfhake B, Bennett GW, Fone KC, Cuello AC, Verhofstad AA, Visser TJ, Hokfelt T (1990a) 5-Hydroxytryptamine, substance P, and thyrotropin-releasing hormone in the adult cat spinal cord segment L7: immunohistochemical and chemical studies. Synapse 6(3): 237-270
277 Arvidsson U, Cullheim S, Ulfhake B, Luppi PH, Kitahama K, Jouvet M, Hokfelt T (1994) Quantitative and qualitative aspects on the distribution of 5-HT and its coexistence with substance P and TRH in cat ventral medullary neurons. J Chem Neuroanat 7(1-2): 3-12
Arvidsson U, Schalling M, Cullheim S, Ulfhake B, Terenius L, Verhofstad A, Hokfelt T (1990b) Evidence for coexistence between calcitonin gene-related peptide and serotonin in the bulbospinal pathway in the monkey. Brain Res 532(1-2): 47-57
Azmitia EC, Whitaker-Azmitia PM (1991) Awakening the sleeping giant: anatomy and plasticity of the brain serotonergic system. J Clin Psychiatry 52 Suppl: 4-16
Barker PA, Salehi A (2002) The MAGE proteins: emerging roles in cell cycle progression, apoptosis, and neurogenetic disease. J Neurosci Res 67(6): 705- 712
Barlow DP, Stoger R, Herrmann BG, Saito K, Schweifer N (1991) The mouse insulin-like growth factor type-2 receptor is imprinted and closely linked to the Tme locus. Nature 349(6304): 84-87
Barnes NM, Sharp T (1999) A review of central 5-HT receptors and their function. Neuropharmacology 38(8): 1083-1152
Barone P, Millet S, Moret C, Prudhomme N, Fillion G (1993) Quantitative autoradiography of 5-HT1E binding sites in rodent brains: effect of lesion of serotonergic neurones. Eur J Pharmacol 249(2): 221-230
Bartolomei MS, Zemel S, Tilghman SM (1991) Parental imprinting of the mouse H19 gene. Nature 351(6322): 153-155
Barton SC, Surani MA, Norris ML (1984) Role of paternal and maternal genomes in mouse development. Nature 311(5984): 374-376
Baxter G, Kennett G, Blaney F, Blackburn T (1995) 5-HT2 receptor subtypes: a family re-united? Trends Pharmacol Sci 16(3): 105-110
Beck SG, Pan YZ, Akanwa AC, Kirby LG (2004) Median and dorsal raphe neurons are not electrophysiologically identical. J Neurophysiol 91(2): 994-1005
Belin MF, Nanopoulos D, Didier M, Aguera M, Steinbusch H, Verhofstad A, Maitre M, Pujol JF (1983) Immunohistochemical evidence for the presence of gamma-aminobutyric acid and serotonin in one nerve cell. A study on the raphe nuclei of the rat using antibodies to glutamate decarboxylase and serotonin. Brain Res 275(2): 329-339
278 Bell C, Abrams J, Nutt D (2001) Tryptophan depletion and its implications for psychiatry. Br J Psychiatry 178: 399-405
Benjamini Y, Hochberg Y (1995) Controlling the false discovery rate: a practical and powerful approach to multiple testing. Journal of the Royal Statistical Society 57(1): 289-300
Bethea CL, Reddy AP, Pedersen D, Tokuyama Y (2009) Expression profile of differentiating serotonin neurons derived from rhesus embryonic stem cells and comparison to adult serotonin neurons. Gene Expr Patterns 9(2): 94-108
Bischof JM, Stewart CL, Wevrick R (2007) Inactivation of the mouse Magel2 gene results in growth abnormalities similar to Prader-Willi syndrome. Hum Mol Genet 16(22): 2713-2719
Blier P, de Montigny C (1987) Modification of 5-HT neuron properties by sustained administration of the 5-HT1A agonist gepirone: electrophysiological studies in the rat brain. Synapse 1(5): 470-480
Bockaert J, Claeysen S, Compan V, Dumuis A (2004) 5-HT4 receptors. Curr Drug Targets CNS Neurol Disord 3(1): 39-51
Bost F, Diarra-Mehrpour M, Martin JP (1998) Inter-alpha-trypsin inhibitor proteoglycan family--a group of proteins binding and stabilizing the extracellular matrix. Eur J Biochem 252(3): 339-346
Bregman BS (1987) Development of serotonin immunoreactivity in the rat spinal cord and its plasticity after neonatal spinal cord lesions. Brain Res 431(2): 245- 263
Briscoe J, Ericson J (1999) The specification of neuronal identity by graded Sonic Hedgehog signalling. Semin Cell Dev Biol 10(3): 353-362
Briscoe J, Pierani A, Jessell TM, Ericson J (2000) A homeodomain protein code specifies progenitor cell identity and neuronal fate in the ventral neural tube. Cell 101(4): 435-445
Briscoe J, Sussel L, Serup P, Hartigan-O'Connor D, Jessell TM, Rubenstein JL, Ericson J (1999) Homeobox gene Nkx2.2 and specification of neuronal identity by graded Sonic hedgehog signalling. Nature 398(6728): 622-627
Bruinvels AT, Palacios JM, Hoyer D (1993) Autoradiographic characterisation and localisation of 5-HT1D compared to 5-HT1B binding sites in rat brain. Naunyn Schmiedebergs Arch Pharmacol 347(6): 569-582
279 Bruning G, Liangos O (1997) Transient expression of the serotonin transporter in the developing mouse thalamocortical system. Acta Histochem 99(1): 117-121
Cahoy JD, Emery B, Kaushal A, Foo LC, Zamanian JL, Christopherson KS, Xing Y, Lubischer JL, Krieg PA, Krupenko SA, Thompson WJ, Barres BA (2008) A transcriptome database for astrocytes, neurons, and oligodendrocytes: a new resource for understanding brain development and function. J Neurosci 28(1): 264-278
Cai H, Reed RR (1999) Cloning and characterization of neuropilin-1-interacting protein: a PSD-95/Dlg/ZO-1 domain-containing protein that interacts with the cytoplasmic domain of neuropilin-1. J Neurosci 19(15): 6519-6527
Carson MJ, Thomas EA, Danielson PE, Sutcliffe JG (1996) The 5HT5A serotonin receptor is expressed predominantly by astrocytes in which it inhibits cAMP accumulation: a mechanism for neuronal suppression of reactive astrocytes. Glia 17(4): 317-326
Castellani V, Chedotal A, Schachner M, Faivre-Sarrailh C, Rougon G (2000) Analysis of the L1-deficient mouse phenotype reveals cross-talk between Sema3A and L1 signaling pathways in axonal guidance. Neuron 27(2): 237-249
Champagne FA, Curley JP, Swaney WT, Hasen NS, Keverne EB (2009) Paternal influence on female behavior: the role of Peg3 in exploration, olfaction, and neuroendocrine regulation of maternal behavior of female mice. Behav Neurosci 123(3): 469-480
Chan-Palay V, Jonsson G, Palay SL (1978) Serotonin and substance P coexist i, neurons of the rat's central nervous system. Proc Natl Acad Sci U S A 75(3): 1582-1586
Chen H, Chedotal A, He Z, Goodman CS, Tessier-Lavigne M (1997) Neuropilin- 2, a novel member of the neuropilin family, is a high affinity receptor for the semaphorins Sema E and Sema IV but not Sema III. Neuron 19(3): 547-559
Chen H, He Z, Bagri A, Tessier-Lavigne M (1998) Semaphorin-neuropilin interactions underlying sympathetic axon responses to class III semaphorins. Neuron 21(6): 1283-1290
Cho G, Bhat SS, Gao J, Collins JS, Rogers RC, Simensen RJ, Schwartz CE, Golden JA, Srivastava AK (2008a) Evidence that SIZN1 is a candidate X-linked mental retardation gene. Am J Med Genet A 146A(20): 2644-2650
Cho G, Lim Y, Zand D, Golden JA (2008b) Sizn1 is a novel protein that functions as a transcriptional coactivator of bone morphogenic protein signaling. Mol Cell Biol 28(5): 1565-1572
280
Claeysen S, Sebben M, Becamel C, Bockaert J, Dumuis A (1999) Novel brain- specific 5-HT4 receptor splice variants show marked constitutive activity: role of the C-terminal intracellular domain. Mol Pharmacol 55(5): 910-920
Claeysen S, Sebben M, Journot L, Bockaert J, Dumuis A (1996) Cloning, expression and pharmacology of the mouse 5-HT(4L) receptor. FEBS Lett 398(1): 19-25
Collier DA, Stober G, Li T, Heils A, Catalano M, Di Bella D, Arranz MJ, Murray RM, Vallada HP, Bengel D, Muller CR, Roberts GW, Smeraldi E, Kirov G, Sham P, Lesch KP (1996) A novel functional polymorphism within the promoter of the serotonin transporter gene: possible role in susceptibility to affective disorders. Mol Psychiatry 1(6): 453-460
Commons KG (2009) Locally collateralizing glutamate neurons in the dorsal raphe nucleus responsive to substance P contain vesicular glutamate transporter 3 (VGLUT3). J Chem Neuroanat 38(4): 273-281
Condron BG (1999) Serotonergic neurons transiently require a midline-derived FGF signal. Neuron 24(3): 531-540
Couch JA, Chen J, Rieff HI, Uri EM, Condron BG (2004) robo2 and robo3 interact with eagle to regulate serotonergic neuron differentiation. Development 131(5): 997-1006
Craven SE, Lim KC, Ye W, Engel JD, de Sauvage F, Rosenthal A (2004) Gata2 specifies serotonergic neurons downstream of sonic hedgehog. Development 131(5): 1165-1173
Cryan JF, Leonard BE (2000) 5-HT1A and beyond: the role of serotonin and its receptors in depression and the antidepressant response. Hum Psychopharmacol 15(2): 113-135
Dahlstrom A, Fuxe K (1964) Localization of monoamines in the lower brain stem. Experientia 20(7): 398-399
Dasen JS, Tice BC, Brenner-Morton S, Jessell TM (2005) A Hox regulatory network establishes motor neuron pool identity and target-muscle connectivity. Cell 123(3): 477-491
Day HE, Greenwood BN, Hammack SE, Watkins LR, Fleshner M, Maier SF, Campeau S (2004) Differential expression of 5HT-1A, alpha 1b adrenergic, CRF- R1, and CRF-R2 receptor mRNA in serotonergic, gamma-aminobutyric acidergic, and catecholaminergic cells of the rat dorsal raphe nucleus. J Comp Neurol 474(3): 364-378
281
DeChiara TM, Robertson EJ, Efstratiadis A (1991) Parental imprinting of the mouse insulin-like growth factor II gene. Cell 64(4): 849-859
Ding S, Luo JH, Yuan XB (2007) Semaphorin-3F attracts the growth cone of cerebellar granule cells through cGMP signaling pathway. Biochem Biophys Res Commun 356(4): 857-863
Ding YQ, Marklund U, Yuan W, Yin J, Wegman L, Ericson J, Deneris E, Johnson RL, Chen ZF (2003) Lmx1b is essential for the development of serotonergic neurons. Nat Neurosci 6(9): 933-938
Doyle JP, Dougherty JD, Heiman M, Schmidt EF, Stevens TR, Ma G, Bupp S, Shrestha P, Shah RD, Doughty ML, Gong S, Greengard P, Heintz N (2008) Application of a translational profiling approach for the comparative analysis of CNS cell types. Cell 135(4): 749-762
Duncan MJ, Jennes L, Jefferson JB, Brownfield MS (2000) Localization of serotonin(5A) receptors in discrete regions of the circadian timing system in the Syrian hamster. Brain Res 869(1-2): 178-185
Duxon MS, Flanigan TP, Reavley AC, Baxter GS, Blackburn TP, Fone KC (1997) Evidence for expression of the 5-hydroxytryptamine-2B receptor protein in the rat central nervous system. Neuroscience 76(2): 323-329
Eisen MB, Spellman PT, Brown PO, Botstein D (1998) Cluster analysis and display of genome-wide expression patterns. Proc Natl Acad Sci U S A 95(25): 14863-14868
Erickson JT, Shafer G, Rossetti MD, Wilson CG, Deneris ES (2007) Arrest of 5HT neuron differentiation delays respiratory maturation and impairs neonatal homeostatic responses to environmental challenges. Respir Physiol Neurobiol 159(1): 85-101
Erspamer V, Asero B (1952) Identification of enteramine, the specific hormone of the enterochromaffin cell system, as 5-hydroxytryptamine. Nature 169(4306): 800-801
Esterle TM, Sanders-Bush E (1992) Serotonin agonists increase transferrin levels via activation of 5-HT1C receptors in choroid plexus epithelium. J Neurosci 12(12): 4775-4782
Falk J, Bechara A, Fiore R, Nawabi H, Zhou H, Hoyo-Becerra C, Bozon M, Rougon G, Grumet M, Puschel AW, Sanes JR, Castellani V (2005) Dual functional activity of semaphorin 3B is required for positioning the anterior commissure. Neuron 48(1): 63-75
282
Falkson G, van Zyl AJ (1989) A phase I study of a new 5HT3-receptor antagonist, BRL43694A, an agent for the prevention of chemotherapy-induced nausea and vomiting. Cancer Chemother Pharmacol 24(3): 193-196
Feiner L, Koppel AM, Kobayashi H, Raper JA (1997) Secreted chick semaphorins bind recombinant neuropilin with similar affinities but bind different subsets of neurons in situ. Neuron 19(3): 539-545
Fischer A, Schumacher N, Maier M, Sendtner M, Gessler M (2004) The Notch target genes Hey1 and Hey2 are required for embryonic vascular development. Genes Dev 18(8): 901-911
Foguet M, Hoyer D, Pardo LA, Parekh A, Kluxen FW, Kalkman HO, Stuhmer W, Lubbert H (1992) Cloning and functional characterization of the rat stomach fundus serotonin receptor. EMBO J 11(9): 3481-3487
Fuh G, Garcia KC, de Vos AM (2000) The interaction of neuropilin-1 with vascular endothelial growth factor and its receptor flt-1. J Biol Chem 275(35): 26690-26695
Gaddum JH, Picarelli ZP (1957) Two kinds of tryptamine receptor. Br J Pharmacol Chemother 12(3): 323-328
Gargaglioni LH, Bicego KC, Branco LG (2008) Brain monoaminergic neurons and ventilatory control in vertebrates. Respir Physiol Neurobiol
Gerald C, Adham N, Kao HT, Olsen MA, Laz TM, Schechter LE, Bard JA, Vaysse PJ, Hartig PR, Branchek TA, et al. (1995) The 5-HT4 receptor: molecular cloning and pharmacological characterization of two splice variants. EMBO J 14(12): 2806-2815
Gras C, Herzog E, Bellenchi GC, Bernard V, Ravassard P, Pohl M, Gasnier B, Giros B, El Mestikawy S (2002) A third vesicular glutamate transporter expressed by cholinergic and serotoninergic neurons. J Neurosci 22(13): 5442-5451
Gudermann T, Levy FO, Birnbaumer M, Birnbaumer L, Kaumann AJ (1993) Human S31 serotonin receptor clone encodes a 5-hydroxytryptamine1E-like serotonin receptor. Mol Pharmacol 43(3): 412-418
Hawthorne AL, Wylie, C.J., Landmesser, L.T., Deneris, E.S., and Silver, J. (In press) Serotonergic neurons migrate radially through the neuroepithelium by dynamin-mediated somal translocation. Journal of Neuroscience
283 Hendricks T, Francis N, Fyodorov D, Deneris E (1999a) The ETS Domain Factor Pet-1 is an Early and Precise Marker of Central 5-HT Neurons and Interacts with a Conserved Element in Serotonergic Genes. J Neurosci 19: 10348-10356.
Hendricks T, Francis N, Fyodorov D, Deneris ES (1999b) The ETS domain factor Pet-1 is an early and precise marker of central serotonin neurons and interacts with a conserved element in serotonergic genes. J Neurosci 19(23): 10348- 10356
Hendricks TJ, Fyodorov DV, Wegman LJ, Lelutiu NB, Pehek EA, Yamamoto B, Silver J, Weeber EJ, Sweatt JD, Deneris ES (2003) Pet-1 ETS gene plays a critical role in 5-HT neuron development and is required for normal anxiety-like and aggressive behavior. Neuron 37(2): 233-247
Hillion J, Catelon J, Raid M, Hamon M, De Vitry F (1994) Neuronal localization of 5-HT1A receptor mRNA and protein in rat embryonic brain stem cultures. Brain Res Dev Brain Res 79(2): 195-202
Hodges MR, Tattersall GJ, Harris MB, McEvoy SD, Richerson DN, Deneris ES, Johnson RL, Chen ZF, Richerson GB (2008) Defects in breathing and thermoregulation in mice with near-complete absence of central serotonin neurons. J Neurosci 28(10): 2495-2505
Hokfelt T, Arvidsson U, Cullheim S, Millhorn D, Nicholas AP, Pieribone V, Seroogy K, Ulfhake B (2000) Multiple messengers in descending serotonin neurons: localization and functional implications. J Chem Neuroanat 18(1-2): 75- 86
Hokfelt T, Ljungdahl A, Steinbusch H, Verhofstad A, Nilsson G, Brodin E, Pernow B, Goldstein M (1978) Immunohistochemical evidence of substance P-like immunoreactivity in some 5-hydroxytryptamine-containing neurons in the rat central nervous system. Neuroscience 3(6): 517-538
Holmes A (2008) Genetic variation in cortico-amygdala serotonin function and risk for stress-related disease. Neurosci Biobehav Rev
Holmes A, Lit Q, Murphy DL, Gold E, Crawley JN (2003) Abnormal anxiety- related behavior in serotonin transporter null mutant mice: the influence of genetic background. Genes Brain Behav 2(6): 365-380
Horsthemke B, Wagstaff J (2008) Mechanisms of imprinting of the Prader- Willi/Angelman region. Am J Med Genet A 146A(16): 2041-2052
Hoyer D, Clarke DE, Fozard JR, Hartig PR, Martin GR, Mylecharane EJ, Saxena PR, Humphrey PP (1994) International Union of Pharmacology classification of receptors for 5-hydroxytryptamine (Serotonin). Pharmacol Rev 46(2): 157-203
284
Isles AR, Wilkinson LS (2000) Imprinted genes, cognition and behaviour. Trends Cogn Sci 4(8): 309-318
Jacob J, Ferri AL, Milton C, Prin F, Pla P, Lin W, Gavalas A, Ang SL, Briscoe J (2007) Transcriptional repression coordinates the temporal switch from motor to serotonergic neurogenesis. Nat Neurosci 10(11): 1433-1439
Jacobs BL, Azmitia EC (1992) Structure and function of the brain serotonin system. Physiol Rev 72(1): 165-229
Jacobs BL, Wise WD, Taylor KM (1974) Differential behavioral and neurochemical effects following lesions of the dorsal or median raphe nuclei in rats. Brain Res 79(3): 353-361
Jensen P, Farago AF, Awatramani RB, Scott MM, Deneris ES, Dymecki SM (2008) Redefining the serotonergic system by genetic lineage. Nat Neurosci 11(4): 417-419
Joh TH (ed) (1997) Tryptophan hyrdoxylase: molecular biology and regulation, 117-129pp
Johansson O, Hokfelt T, Pernow B, Jeffcoate SL, White N, Steinbusch HW, Verhofstad AA, Emson PC, Spindel E (1981) Immunohistochemical support for three putative transmitters in one neuron: coexistence of 5-hydroxytryptamine, substance P- and thyrotropin releasing hormone-like immunoreactivity in medullary neurons projecting to the spinal cord. Neuroscience 6(10): 1857-1881
Johnson RG, Jr. (1988) Accumulation of biological amines into chromaffin granules: a model for hormone and neurotransmitter transport. Physiol Rev 68(1): 232-307
Joyner AL (1996) Engrailed, Wnt and Pax genes regulate midbrain--hindbrain development. Trends Genet 12(1): 15-20
Kantor DB, Chivatakarn O, Peer KL, Oster SF, Inatani M, Hansen MJ, Flanagan JG, Yamaguchi Y, Sretavan DW, Giger RJ, Kolodkin AL (2004) Semaphorin 5A is a bifunctional axon guidance cue regulated by heparan and chondroitin sulfate proteoglycans. Neuron 44(6): 961-975
Kelly RB (1991) Secretory granule and synaptic vesicle formation. Curr Opin Cell Biol 3(4): 654-660
Kennett GA, Ainsworth K, Trail B, Blackburn TP (1997) BW 723C86, a 5-HT2B receptor agonist, causes hyperphagia and reduced grooming in rats. Neuropharmacology 36(2): 233-239
285
Kennett GA, Bright F, Trail B, Baxter GS, Blackburn TP (1996) Effects of the 5- HT2B receptor agonist, BW 723C86, on three rat models of anxiety. Br J Pharmacol 117(7): 1443-1448
Keverne EB, Fundele R, Narasimha M, Barton SC, Surani MA (1996) Genomic imprinting and the differential roles of parental genomes in brain development. Brain Res Dev Brain Res 92(1): 91-100
Kim E, Sheng M (2004) PDZ domain proteins of synapses. Nat Rev Neurosci 5(10): 771-781
Kim HG, Kishikawa S, Higgins AW, Seong IS, Donovan DJ, Shen Y, Lally E, Weiss LA, Najm J, Kutsche K, Descartes M, Holt L, Braddock S, Troxell R, Kaplan L, Volkmar F, Klin A, Tsatsanis K, Harris DJ, Noens I, Pauls DL, Daly MJ, MacDonald ME, Morton CC, Quade BJ, Gusella JF (2008) Disruption of neurexin 1 associated with autism spectrum disorder. Am J Hum Genet 82(1): 199-207
Kimura T, Arakawa Y, Inoue S, Fukushima Y, Kondo I, Koyama K, Hosoi T, Orimo A, Muramatsu M, Nakamura Y, Abe T, Inazawa J (1997) The brain finger protein gene (ZNF179), a member of the RING finger family, maps within the Smith-Magenis syndrome region at 17p11.2. Am J Med Genet 69(3): 320-324
Kirstein CL, Spear LP (1988) 5-HT1A, 5-HT1B and 5-HT2 receptor agonists induce differential behavioral responses in neonatal rat pups. Eur J Pharmacol 150(3): 339-345
Kocsis B, Varga V, Dahan L, Sik A (2006) Serotonergic neuron diversity: identification of raphe neurons with discharges time-locked to the hippocampal theta rhythm. Proc Natl Acad Sci U S A 103(4): 1059-1064
Kohen R, Metcalf MA, Khan N, Druck T, Huebner K, Lachowicz JE, Meltzer HY, Sibley DR, Roth BL, Hamblin MW (1996) Cloning, characterization, and chromosomal localization of a human 5-HT6 serotonin receptor. J Neurochem 66(1): 47-56
Kolodkin AL, Levengood DV, Rowe EG, Tai YT, Giger RJ, Ginty DD (1997) Neuropilin is a semaphorin III receptor. Cell 90(4): 753-762
Kosofsky BE, Molliver ME (1987) The serotoninergic innervation of cerebral cortex: different classes of axon terminals arise from dorsal and median raphe nuclei. Synapse 1(2): 153-168
Lacoste B, Riad M, Descarries L (2006) Immunocytochemical evidence for the existence of substance P receptor (NK1) in serotonin neurons of rat and mouse dorsal raphe nucleus. Eur J Neurosci 23(11): 2947-2958
286
Le Francois B, Czesak M, Steubl D, Albert PR (2008) Transcriptional regulation at a HTR1A polymorphism associated with mental illness. Neuropharmacology 55(6): 977-985
Lee S, Walker CL, Karten B, Kuny SL, Tennese AA, O'Neill MA, Wevrick R (2005) Essential role for the Prader-Willi syndrome protein necdin in axonal outgrowth. Hum Mol Genet 14(5): 627-637
Leonardo ED, Hen R (2006) Genetics of Affective and Anxiety Disorders. Annu Rev Psychol: 117-137
Lerch-Haner JK, Frierson D, Crawford LK, Beck SG, Deneris ES (2008a) Serotonergic transcriptional programming determines maternal behavior and offspring survival. Nat Neurosci
Lerch-Haner JK, Frierson D, Crawford LK, Beck SG, Deneris ES (2008b) Serotonergic transcriptional programming determines maternal behavior and offspring survival. Nat Neurosci 11: 1001-1003.
Lesch KP, Bengel D, Heils A, Sabol SZ, Greenberg BD, Petri S, Benjamin J, Muller CR, Hamer DH, Murphy DL (1996) Association of anxiety-related traits with a polymorphism in the serotonin transporter gene regulatory region. Science 274(5292): 1527-1531
Levinson DF (2006) The genetics of depression: a review. Biol Psychiatry 60(2): 84-92
Lillesaar C, Tannhauser B, Stigloher C, Kremmer E, Bally-Cuif L (2007) The serotonergic phenotype is acquired by converging genetic mechanisms within the zebrafish central nervous system. Dev Dyn 236(4): 1072-1084
Lira A, Zhou M, Castanon N, Ansorge MS, Gordon JA, Francis JH, Bradley- Moore M, Lira J, Underwood MD, Arango V, Kung HF, Hofer MA, Hen R, Gingrich JA (2003) Altered depression-related behaviors and functional changes in the dorsal raphe nucleus of serotonin transporter-deficient mice. Biol Psychiatry 54(10): 960-971
Louvi A, Artavanis-Tsakonas S (2006) Notch signalling in vertebrate neural development. Nat Rev Neurosci 7(2): 93-102
Lucki I (1998) The spectrum of behaviors influenced by serotonin. Biol Psychiatry 44(3): 151-162
287 Lui C, Maejima, T., Wyler, S. Casadeus, G. Herlitze, S., Deneris, E. (Manuscript in submission) Pet-1-Dependent Transcription Is Required into Adulthood for Serotonin System Maturation and Emotional Behavior.
Lumsden A, Krumlauf R (1996) Patterning the vertebrate neuraxis. Science 274(5290): 1109-1115
Manji SS, Sorensen BS, Klockars T, Lam T, Hutchison W, Dahl HH (2006) Molecular characterization and expression of maternally expressed gene 3 (Meg3/Gtl2) RNA in the mouse inner ear. J Neurosci Res 83(2): 181-190
Maricq AV, Peterson AS, Brake AJ, Myers RM, Julius D (1991) Primary structure and functional expression of the 5HT3 receptor, a serotonin-gated ion channel. Science 254(5030): 432-437
Maroteaux L, Saudou F, Amlaiky N, Boschert U, Plassat JL, Hen R (1992) Mouse 5HT1B serotonin receptor: cloning, functional expression, and localization in motor control centers. Proc Natl Acad Sci U S A 89(7): 3020-3024
Mason P (2001) Contributions of the medullary raphe and ventromedial reticular region to pain modulation and other homeostatic functions. Annu Rev Neurosci 24: 737-777
Matthes H, Boschert U, Amlaiky N, Grailhe R, Plassat JL, Muscatelli F, Mattei MG, Hen R (1993) Mouse 5-hydroxytryptamine5A and 5-hydroxytryptamine5B receptors define a new family of serotonin receptors: cloning, functional expression, and chromosomal localization. Mol Pharmacol 43(3): 313-319
McAllister G, Charlesworth A, Snodin C, Beer MS, Noble AJ, Middlemiss DN, Iversen LL, Whiting P (1992) Molecular cloning of a serotonin receptor from human brain (5HT1E): a fifth 5HT1-like subtype. Proc Natl Acad Sci U S A 89(12): 5517-5521
McGinnis W, Krumlauf R (1992) Homeobox genes and axial patterning. Cell 68(2): 283-302
McGinnis W, Levine MS, Hafen E, Kuroiwa A, Gehring WJ (1984) A conserved DNA sequence in homoeotic genes of the Drosophila Antennapedia and bithorax complexes. Nature 308(5958): 428-433
McGrath J, Solter D (1984) Completion of mouse embryogenesis requires both the maternal and paternal genomes. Cell 37(1): 179-183
Melander T, Hokfelt T, Rokaeus A, Cuello AC, Oertel WH, Verhofstad A, Goldstein M (1986) Coexistence of galanin-like immunoreactivity with
288 catecholamines, 5-hydroxytryptamine, GABA and neuropeptides in the rat CNS. J Neurosci 6(12): 3640-3654
Mercer RE, Kwolek EM, Bischof JM, van Eede M, Henkelman RM, Wevrick R (2009) Regionally reduced brain volume, altered serotonin neurochemistry, and abnormal behavior in mice null for the circadian rhythm output gene Magel2. Am J Med Genet B Neuropsychiatr Genet
Mercer RE, Wevrick R (2009) Loss of magel2, a candidate gene for features of Prader-Willi syndrome, impairs reproductive function in mice. PLoS ONE 4(1): e4291
Middlemiss DN, Hutson PH (1990) The 5-HT1B receptors. Ann N Y Acad Sci 600: 132-147; discussion 347-148
Millhorn DE, Hokfelt T, Seroogy K, Oertel W, Verhofstad AA, Wu JY (1987) Immunohistochemical evidence for colocalization of gamma-aminobutyric acid and serotonin in neurons of the ventral medulla oblongata projecting to the spinal cord. Brain Res 410(1): 179-185
Molliver ME (1987) Serotonergic neuronal systems: what their anatomic organization tells us about function. J Clin Psychopharmacol 7(6 Suppl): 3S-23S
Monsma FJ, Jr., Shen Y, Ward RP, Hamblin MW, Sibley DR (1993) Cloning and expression of a novel serotonin receptor with high affinity for tricyclic psychotropic drugs. Mol Pharmacol 43(3): 320-327
Moon YS, Smas CM, Lee K, Villena JA, Kim KH, Yun EJ, Sul HS (2002) Mice lacking paternally expressed Pref-1/Dlk1 display growth retardation and accelerated adiposity. Mol Cell Biol 22(15): 5585-5592
Moore T, Haig D (1991) Genomic imprinting in mammalian development: a parental tug-of-war. Trends Genet 7(2): 45-49
Morairty SR, Hedley L, Flores J, Martin R, Kilduff TS (2008) Selective 5HT2A and 5HT6 receptor antagonists promote sleep in rats. Sleep 31(1): 34-44
Moroz LL, Edwards JR, Puthanveettil SV, Kohn AB, Ha T, Heyland A, Knudsen B, Sahni A, Yu F, Liu L, Jezzini S, Lovell P, Iannucculli W, Chen M, Nguyen T, Sheng H, Shaw R, Kalachikov S, Panchin YV, Farmerie W, Russo JJ, Ju J, Kandel ER (2006) Neuronal transcriptome of aplysia: neuronal compartments and circuitry. Cell 127(7): 1453-1467
Muhlfriedel S, Kirsch F, Gruss P, Chowdhury K, Stoykova A (2007) Novel genes differentially expressed in cortical regions during late neurogenesis. Eur J Neurosci 26(1): 33-50
289
Nakamura F, Tanaka M, Takahashi T, Kalb RG, Strittmatter SM (1998) Neuropilin-1 extracellular domains mediate semaphorin D/III-induced growth cone collapse. Neuron 21(5): 1093-1100
Narita Y, Rijli FM (2009) Hox genes in neural patterning and circuit formation in the mouse hindbrain. Curr Top Dev Biol 88: 139-167
Naughton M, Mulrooney JB, Leonard BE (2000) A review of the role of serotonin receptors in psychiatric disorders. Hum Psychopharmacol 15(6): 397-415
Ng L, Bernard A, Lau C, Overly CC, Dong HW, Kuan C, Pathak S, Sunkin SM, Dang C, Bohland JW, Bokil H, Mitra PP, Puelles L, Hohmann J, Anderson DJ, Lein ES, Jones AR, Hawrylycz M (2009) An anatomic gene expression atlas of the adult mouse brain. Nat Neurosci 12(3): 356-362
Nixon GM, Brouillette RT (2002) Sleep and breathing in Prader-Willi syndrome. Pediatr Pulmonol 34(3): 209-217
O'Neill MJ (2005) The influence of non-coding RNAs on allele-specific gene expression in mammals. Hum Mol Genet 14 Spec No 1: R113-120
Pasterkamp RJ, Giger RJ (2009) Semaphorin function in neural plasticity and disease. Curr Opin Neurobiol 19(3): 263-274
Pasterkamp RJ, Kolodkin AL (2003) Semaphorin junction: making tracks toward neural connectivity. Curr Opin Neurobiol 13(1): 79-89
Pasterkamp RJ, Peschon JJ, Spriggs MK, Kolodkin AL (2003) Semaphorin 7A promotes axon outgrowth through integrins and MAPKs. Nature 424(6947): 398- 405
Pattyn A, Simplicio N, van Doorninck JH, Goridis C, Guillemot F, Brunet JF (2004) Ascl1/Mash1 is required for the development of central serotonergic neurons. Nat Neurosci 7(6): 589-595
Pattyn A, Vallstedt A, Dias JM, Samad OA, Krumlauf R, Rijli FM, Brunet JF, Ericson J (2003) Coordinated temporal and spatial control of motor neuron and serotonergic neuron generation from a common pool of CNS progenitors. Genes Dev 17(6): 729-737
Pazos A, Probst A, Palacios JM (1987) Serotonin receptors in the human brain-- IV. Autoradiographic mapping of serotonin-2 receptors. Neuroscience 21(1): 123- 139
290 Pearson JC, Lemons D, McGinnis W (2005) Modulating Hox gene functions during animal body patterning. Nat Rev Genet 6(12): 893-904
Peter D, Finn, J.P., Merickel, A. Liu, Y, and Edwards, R.H. (1997) Molecular analysis of serotonin packaging into secretory vesicles. , Vol. 129.
Plassat JL, Boschert U, Amlaiky N, Hen R (1992) The mouse 5HT5 receptor reveals a remarkable heterogeneity within the 5HT1D receptor family. EMBO J 11(13): 4779-4786
Potocki L, Bi W, Treadwell-Deering D, Carvalho CM, Eifert A, Friedman EM, Glaze D, Krull K, Lee JA, Lewis RA, Mendoza-Londono R, Robbins-Furman P, Shaw C, Shi X, Weissenberger G, Withers M, Yatsenko SA, Zackai EH, Stankiewicz P, Lupski JR (2007) Characterization of Potocki-Lupski syndrome (dup(17)(p11.2p11.2)) and delineation of a dosage-sensitive critical interval that can convey an autism phenotype. Am J Hum Genet 80(4): 633-649
Prasad HC, Zhu CB, McCauley JL, Samuvel DJ, Ramamoorthy S, Shelton RC, Hewlett WA, Sutcliffe JS, Blakely RD (2005) Human serotonin transporter variants display altered sensitivity to protein kinase G and p38 mitogen-activated protein kinase. Proc Natl Acad Sci U S A 102(32): 11545-11550
Rajaofetra N, Sandillon F, Geffard M, Privat A (1989) Pre- and post-natal ontogeny of serotonergic projections to the rat spinal cord. J Neurosci Res 22(3): 305-321
Raper JA (2000) Semaphorins and their receptors in vertebrates and invertebrates. Curr Opin Neurobiol 10(1): 88-94
Rapport MM, Green AA, Page IH (1948) Serum vasoconstrictor, serotonin; chemical inactivation. J Biol Chem 176(3): 1237-1241
Reik W, Walter J (2001) Genomic imprinting: parental influence on the genome. Nat Rev Genet 2(1): 21-32
Reimers M, Carey VJ (2006) Bioconductor: an open source framework for bioinformatics and computational biology. Methods Enzymol 411: 119-134
Ren J, Lee S, Pagliardini S, Gerard M, Stewart CL, Greer JJ, Wevrick R (2003) Absence of Ndn, encoding the Prader-Willi syndrome-deleted gene necdin, results in congenital deficiency of central respiratory drive in neonatal mice. J Neurosci 23(5): 1569-1573
Renzi MJ, Feiner L, Koppel AM, Raper JA (1999) A dominant negative receptor for specific secreted semaphorins is generated by deleting an extracellular domain from neuropilin-1. J Neurosci 19(18): 7870-7880
291
Rocha SF, Lopes SS, Gossler A, Henrique D (2009) Dll1 and Dll4 function sequentially in the retina and pV2 domain of the spinal cord to regulate neurogenesis and create cell diversity. Dev Biol 328(1): 54-65
Rohm B, Ottemeyer A, Lohrum M, Puschel AW (2000) Plexin/neuropilin complexes mediate repulsion by the axonal guidance signal semaphorin 3A. Mech Dev 93(1-2): 95-104
Rougeulle C, Glatt H, Lalande M (1997) The Angelman syndrome candidate gene, UBE3A/E6-AP, is imprinted in brain. Nat Genet 17(1): 14-15
Rousso DL, Gaber ZB, Wellik D, Morrisey EE, Novitch BG (2008) Coordinated actions of the forkhead protein Foxp1 and Hox proteins in the columnar organization of spinal motor neurons. Neuron 59(2): 226-240
Ruat M, Traiffort E, Arrang JM, Tardivel-Lacombe J, Diaz J, Leurs R, Schwartz JC (1993a) A novel rat serotonin (5-HT6) receptor: molecular cloning, localization and stimulation of cAMP accumulation. Biochem Biophys Res Commun 193(1): 268-276
Ruat M, Traiffort E, Leurs R, Tardivel-Lacombe J, Diaz J, Arrang JM, Schwartz JC (1993b) Molecular cloning, characterization, and localization of a high-affinity serotonin receptor (5-HT7) activating cAMP formation. Proc Natl Acad Sci U S A 90(18): 8547-8551
Schuster-Gossler K, Bilinski P, Sado T, Ferguson-Smith A, Gossler A (1998) The mouse Gtl2 gene is differentially expressed during embryonic development, encodes multiple alternatively spliced transcripts, and may act as an RNA. Dev Dyn 212(2): 214-228
Scott MM, Krueger KC, Deneris ES (2005a) A differentially autoregulated Pet-1 enhancer region is a critical target of the transcriptional cascade that governs serotonin neuron development. J Neurosci 25(10): 2628-2636
Scott MM, Wylie CJ, Lerch JK, Murphy R, Lobur K, Herlitze S, Jiang W, Conlon RA, Strowbridge BW, Deneris ES (2005b) A genetic approach to access serotonin neurons for in vivo and in vitro studies. Proceedings of the National Academy of Sciences of the United States of America 102(45): 16472-16477
Scott MM, Wylie CW, Lerch JK, Murphy R, Lobur K, Herlitze S, Jiang W, Conlon RA, Strowbridge B, Deneris ES (2005c) A genetic approach to access serotonin neurons for in vivo and in vitro studies. . Proc Natl Acad Sci, USA 102: 16472- 16477.
292 Scott MP, Weiner AJ (1984) Structural relationships among genes that control development: sequence homology between the Antennapedia, Ultrabithorax, and fushi tarazu loci of Drosophila. Proc Natl Acad Sci U S A 81(13): 4115-4119
Seki N, Hattori A, Muramatsu M, Saito T (1999) cDNA cloning of a human brain finger protein, BFP/ZNF179, a member of the RING finger protein family. DNA Res 6(5): 353-356
Shaltiel G, Shamir A, Agam G, Belmaker RH (2005) Only tryptophan hydroxylase (TPH)-2 is relevant to the CNS. Am J Med Genet B Neuropsychiatr Genet 136(1): 106
Shih JC (2004) Cloning, after cloning, knock-out mice, and physiological functions of MAO A and B. Neurotoxicology 25(1-2): 21-30
Simon HH, Scholz C, O'Leary DD (2005) Engrailed genes control developmental fate of serotonergic and noradrenergic neurons in mid- and hindbrain in a gene dose-dependent manner. Mol Cell Neurosci 28(1): 96-105
Simon HH, Thuret S, Alberi L (2004) Midbrain dopaminergic neurons: control of their cell fate by the engrailed transcription factors. Cell Tissue Res 318(1): 53-61
Skagerberg G, Bjorklund A (1985) Topographic principles in the spinal projections of serotonergic and non-serotonergic brainstem neurons in the rat. Neuroscience 15(2): 445-480
Smyth GK (2005) Limma: Linear models for microarray data. . Bioinformatics and Computational Biology Solutions using R and Bioconductor, R. Gentleman, V. Carey, S. Dudoit, R. Irizarry, W. Huber (eds.), Springer, New York.: 397-420
Sodhi MS, Sanders-Bush E (2004) Serotonin and brain development. Int Rev Neurobiol 59: 111-174
Staner L, Kempenaers C, Simonnet MP, Fransolet L, Mendlewicz J (1992) 5-HT2 receptor antagonism and slow-wave sleep in major depression. Acta Psychiatr Scand 86(2): 133-137
Strader CD, Fong TM, Tota MR, Underwood D, Dixon RA (1994) Structure and function of G protein-coupled receptors. Annu Rev Biochem 63: 101-132
Sudhof TC, Jahn R (1991) Proteins of synaptic vesicles involved in exocytosis and membrane recycling. Neuron 6(5): 665-677
Sugino K, Hempel CM, Miller MN, Hattox AM, Shapiro P, Wu C, Huang ZJ, Nelson SB (2006) Molecular taxonomy of major neuronal classes in the adult mouse forebrain. Nat Neurosci 9(1): 99-107
293
Tamagnone L, Artigiani S, Chen H, He Z, Ming GI, Song H, Chedotal A, Winberg ML, Goodman CS, Poo M, Tessier-Lavigne M, Comoglio PM (1999) Plexins are a large family of receptors for transmembrane, secreted, and GPI-anchored semaphorins in vertebrates. Cell 99(1): 71-80
Tamagnone L, Comoglio PM (2000) Signalling by semaphorin receptors: cell guidance and beyond. Trends Cell Biol 10(9): 377-383
Tamagnone L, Comoglio PM (2004) To move or not to move? Semaphorin signalling in cell migration. EMBO Rep 5(4): 356-361
Tanaka H, Amamiya S, Miura N, Araki A, Ohinata J, Fujieda K (2006) Postnatal development of brainstem serotonin-containing neurons projecting to lumbar spinal cord in rats. Brain Dev 28(9): 586-591
Thureson-Klein A (1983) Exocytosis from large and small dense cored vesicles in noradrenergic nerve terminals. Neuroscience 10(2): 245-259
Tork I (1990) Anatomy of the serotonergic system. Ann N Y Acad Sci 600: 9-34; discussion 34-35
Tran TS, Kolodkin AL, Bharadwaj R (2007) Semaphorin regulation of cellular morphology. Annu Rev Cell Dev Biol 23: 263-292
Tuckwell D (1999) Evolution of von Willebrand factor A (VWA) domains. Biochem Soc Trans 27(6): 835-840
Tumpel S, Wiedemann LM, Krumlauf R (2009) Hox genes and segmentation of the vertebrate hindbrain. Curr Top Dev Biol 88: 103-137
Twarog BM, Page IH (1953) Serotonin content of some mammalian tissues and urine and a method for its determination. Am J Physiol 175(1): 157-161
Uesugi K, Oinuma I, Katoh H, Negishi M (2009) Different requirement for Rnd GTPases of R-Ras GAP activity of Plexin-C1 and Plexin-D1. J Biol Chem 284(11): 6743-6751
van Doorninck JH, van Der Wees J, Karis A, Goedknegt E, Engel JD, Coesmans M, Rutteman M, Grosveld F, De Zeeuw CI (1999) GATA-3 is involved in the development of serotonergic neurons in the caudal raphe nuclei. J Neurosci 19(12): RC12
Varga V, Losonczy A, Zemelman BV, Borhegyi Z, Nyiri G, Domonkos A, Hangya B, Holderith N, Magee JC, Freund TF (2009) Fast synaptic subcortical control of hippocampal circuits. Science 326(5951): 449-453
294
Vastrik I, Eickholt BJ, Walsh FS, Ridley A, Doherty P (1999) Sema3A-induced growth-cone collapse is mediated by Rac1 amino acids 17-32. Curr Biol 9(18): 991-998
Wallace JA, Lauder JM (1983) Development of the serotonergic system in the rat embryo: an immunocytochemical study. Brain Res Bull 10(4): 459-479
Walther DJ, Peter JU, Bashammakh S, Hortnagl H, Voits M, Fink H, Bader M (2003) Synthesis of serotonin by a second tryptophan hydroxylase isoform. Science 299(5603): 76
Walz A, Rodriguez I, Mombaerts P (2002) Aberrant sensory innervation of the olfactory bulb in neuropilin-2 mutant mice. J Neurosci 22(10): 4025-4035
Wang K, Zhang H, Ma D, Bucan M, Glessner JT, Abrahams BS, Salyakina D, Imielinski M, Bradfield JP, Sleiman PM, Kim CE, Hou C, Frackelton E, Chiavacci R, Takahashi N, Sakurai T, Rappaport E, Lajonchere CM, Munson J, Estes A, Korvatska O, Piven J, Sonnenblick LI, Alvarez Retuerto AI, Herman EI, Dong H, Hutman T, Sigman M, Ozonoff S, Klin A, Owley T, Sweeney JA, Brune CW, Cantor RM, Bernier R, Gilbert JR, Cuccaro ML, McMahon WM, Miller J, State MW, Wassink TH, Coon H, Levy SE, Schultz RT, Nurnberger JI, Haines JL, Sutcliffe JS, Cook EH, Minshew NJ, Buxbaum JD, Dawson G, Grant SF, Geschwind DH, Pericak-Vance MA, Schellenberg GD, Hakonarson H (2009) Common genetic variants on 5p14.1 associate with autism spectrum disorders. Nature 459(7246): 528-533
Wang L, Zhang B, Wolfinger RD, Chen X (2008) An integrated approach for the analysis of biological pathways using mixed models. PLoS Genet 4(7): e1000115
Wang W, Grimmer JF, Van De Water TR, Lufkin T (2004a) Hmx2 and Hmx3 homeobox genes direct development of the murine inner ear and hypothalamus and can be functionally replaced by Drosophila Hmx. Dev Cell 7(3): 439-453
Wang Y, Joh K, Masuko S, Yatsuki H, Soejima H, Nabetani A, Beechey CV, Okinami S, Mukai T (2004b) The mouse Murr1 gene is imprinted in the adult brain, presumably due to transcriptional interference by the antisense-oriented U2af1-rs1 gene. Mol Cell Biol 24(1): 270-279
Wessendorf MW, Elde R (1987) The coexistence of serotonin- and substance P- like immunoreactivity in the spinal cord of the rat as shown by immunofluorescent double labeling. J Neurosci 7(8): 2352-2363
Wilkinson LS, Davies W, Isles AR (2007) Genomic imprinting effects on brain development and function. Nat Rev Neurosci 8(11): 832-843
295 Ye W, Shimamura K, Rubenstein JL, Hynes MA, Rosenthal A (1998a) FGF and Shh signals control dopaminergic and serotonergic cell fate in the anterior neural plate. Cell 93(5): 755-766
Ye W, Shimamura K, Rubenstein JLR, Hynes MA, Rosenthal A (1998b) FGF and Shh signals control dopaminergic and serotonergic cell fate in the anterior neural plate. Cell 93: 755-766.
Zanella S, Watrin F, Mebarek S, Marly F, Roussel M, Gire C, Diene G, Tauber M, Muscatelli F, Hilaire G (2008) Necdin plays a role in the serotonergic modulation of the mouse respiratory network: implication for Prader-Willi syndrome. J Neurosci 28(7): 1745-1755
Zgombick JM, Schechter LE, Macchi M, Hartig PR, Branchek TA, Weinshank RL (1992) Human gene S31 encodes the pharmacologically defined serotonin 5- hydroxytryptamine1E receptor. Mol Pharmacol 42(2): 180-185
Zhang X, Beaulieu JM, Sotnikova TD, Gainetdinov RR, Caron MG (2004) Tryptophan hydroxylase-2 controls brain serotonin synthesis. Science 305(5681): 217
Zhao ZQ, Chiechio S, Sun YG, Zhang KH, Zhao CS, Scott M, Johnson RL, Deneris ES, Renner KJ, Gereau RWt, Chen ZF (2007) Mice lacking central serotonergic neurons show enhanced inflammatory pain and an impaired analgesic response to antidepressant drugs. J Neurosci 27(22): 6045-6053
Zhu L, Bergmeier W, Wu J, Jiang H, Stalker TJ, Cieslak M, Fan R, Boumsell L, Kumanogoh A, Kikutani H, Tamagnone L, Wagner DD, Milla ME, Brass LF (2007) Regulated surface expression and shedding support a dual role for semaphorin 4D in platelet responses to vascular injury. Proc Natl Acad Sci U S A 104(5): 1621-1626
Zou Y, Stoeckli E, Chen H, Tessier-Lavigne M (2000) Squeezing axons out of the gray matter: a role for slit and semaphorin proteins from midline and ventral spinal cord. Cell 102(3): 363-375
296