Metabolism BMJ Open Diab Res Care: first published as 10.1136/bmjdrc-2020-002104 on 20 April 2021. Downloaded from Open access Original research Central administration of sodium-­ glucose cotransporter-2 inhibitors increases food intake involving adenosine monophosphate-­activated protein kinase phosphorylation in the lateral hypothalamus in healthy rats

Kenji Takeda ‍ ‍ , Hiraku Ono ‍ ‍ , Ko Ishikawa ‍ ‍ , Tomohiro Ohno, Jin Kumagai, Hidetoshi Ochiai, Ai Matumoto, Hidetaka Yokoh, Yoshiro Maezawa ‍ ‍ , Koutaro Yokote

To cite: Takeda K, Ono H, ABSTRACT Ishikawa K, et al. Central Introduction Sodium glucose cotransporter-2 (SGLT2) Significance of this study administration of sodium-­ inhibitors are widely used for diabetes treatment. Although glucose cotransporter-2 SGLT2 inhibitors have been clinically observed to increase What is already known about this subject? inhibitors increases food food intake, roles or even the presence of SGLT2 in the ►► Intracerebroventricular administration of phlorizin, intake involving adenosine central nervous system (CNS) has not been established. We a non-­specific sodium glucose cotransporter (SGLT) monophosphate-activated­ inhibitor, increases food intake in rats. protein kinase phosphorylation aimed to elucidate potential functions of SGLT2 in the CNS, ►► Systemic clinical use of SGLT2 inhibitors in humans in the lateral hypothalamus and the effects of CNS-targeted­ SGLT2 inhibitors on food increases food intake. in healthy rats. BMJ intake. Open Diab Res Care Research design and methods We administered three What are the new findings? 2021;9:e002104. doi:10.1136/ kinds of SGLT2 inhibitors, tofogliflozin, dapagliflozin, and ►► Administration of SGLT2 inhibitors within the central bmjdrc-2020-002104 empagliflozin, into the lateral ventricle (LV) in rats and evaluated nervous system (CNS) increases food intake in rats. their effects on food intake. We also evaluated the effects of ►► Systemic administration of liraglutide suppresses tofogliflozin administration in the third (3V) and fourth ventricle ► Supplemental material is the effect of intracerebroventricular administrated ► (4V). Intraperitoneal administration of liraglutide, a glucagon-­ published online only. To view tofogliflozin on food intake. like peptide-1 (GLP-1) receptor agonist known to suppress food http://drc.bmj.com/ please visit the journal online ►► Inhibition of SGLT2 within the CNS enhances AMPK intake, was combined with central tofogliflozin to elucidate (http://dx.​ ​doi.org/​ ​10.1136/​ ​ phosphorylation in the lateral hypothalamic area. bmjdrc-2020-​ ​002104). whether GLP-1 signaling antagonizes the effect of central SGLT2 inhibitors on food intake. To elucidate potential molecular How might these results change the focus of mechanisms mediating changes in feeding, hypothalamic research or clinical practice? Received 31 December 2020 areas associated with food intake regulation were harvested ► SGLT2 in the CNS is suggested to be involved in reg- Revised 3 March 2021 ► and analyzed after intracerebroventricular administration (ICV) ulating food intake. Accepted 21 March 2021 on September 30, 2021 by guest. Protected copyright. of tofogliflozin. ►► SGLT2 inhibitors with low penetration of the blood Results Bolus ICV injection of tofogliflozin induced a robust brain barrier could be used to treat diabetes with increase in food intake starting at 1.5 hours postinjection, and less compensatory food intake. lasting for 5 days. No effect was observed when the same dose of tofogliflozin was administered intraperitoneally. ICV © Author(s) (or their dapagliflozin and empagliflozin significantly enhanced food employer(s)) 2021. Re-­use intake, although the strength of these effects varied among INTRODUCTION permitted under CC BY-­NC. No drugs. Food intake was most markedly enhanced when Glucose, the main source of energy in commercial re-­use. See rights tofogliflozin was infused into the LV. Fewer or no effects the brain, is a large polar molecule that and permissions. Published were observed with infusion into the 3V or 4V, respectively. by BMJ. cannot pass through the lipid bilayer of cell Systemic administration of liraglutide suppressed the effect membranes by simple diffusion. Hence, cells Department of Endocrinology, of ICV tofogliflozin on food intake. ICV tofogliflozin increased 1 Hematology, and Gerontology, have glucose transporters to take up glucose. phosphorylation of AMPK and c-­fos expression in the lateral Chiba University Graduate Three families of solute carriers have been hypothalamus. School of Medicine, Chiba, identified as glucose transporters: GLUTs Japan Conclusions SGLT2 inhibitors in the CNS increase food intake. SGLT2 activity in the CNS may regulate food intake (glucose transporters), SGLTs (sodium-­ Correspondence to through AMPK phosphorylation in the lateral hypothalamic glucose cotransporters), and SWEETs (sugars 2 Dr Hiraku Ono; area. will eventually be exported transporters). hono@​ ​chiba-u.​ ​jp GLUTs transport glucose across the plasma

BMJ Open Diab Res Care 2021;9:e002104. doi:10.1136/bmjdrc-2020-002104 1 BMJ Open Diab Res Care: first published as 10.1136/bmjdrc-2020-002104 on 20 April 2021. Downloaded from Metabolism membrane via facilitated diffusion, while SGLTs use air-­conditioned animal quarters with lights on between the sodium concentration gradient generated by the 06:00 and 18:00 hours. Food and water were available ad sodium-­potassium ATPase as a source of potential energy libitum throughout the study. After 7 days of adaptation to symport glucose in concert with sodium ions.3 Six to their home cages, rats were anaesthetized with isoflu- SGLT proteins have been identified in humans. SGLT1/ rane (Mylan, Pennsylvania, USA). A 23-gauge­ stainless SLC5A1 and SGLT2/SLC5A2 are expressed in the kidney steel cannula (P1 Technologies, Virginia, USA) was stably and play an important role in reabsorption of glucose implanted into the ventricle using a stereotaxic apparatus. from raw urine.2 SGLT2 inhibitors contribute to reducing Right lateral ventricle (LV) coordinates were 0.8 mm blood glucose levels by inhibiting reabsorption of glucose posterior, 1.4 mm right lateral, and 4.3 mm ventral to the from raw urine. Although urinary glucose elimination bregma. Third ventricle (3V) coordinates were 3.0 mm results in both calorie loss and weight loss, the actual posterior and 9.7 mm ventral to the bregma, and fourth weight loss observed with clinical use is reportedly smaller ventricle (4V) coordinates were 12.0 mm posterior and than the expected weight loss due to glucose discharge.4 9.0 mm ventral to the bregma, in accordance with the The appetite-­stimulating effects of SGLT2 inhibitors in atlas.22 The cannula was secured to the skull with three clinical use are of concern, but the mechanism by which stainless steel screws and dental cement. The implanted these inhibitors stimulate food intake via the central cannula was temporarily plugged with a 33-gauge­ stainless nervous system (CNS) is not yet fully understood.4 dummy cannula. After surgery, the animals were allowed SGLT2/SLC5A2 is reportedly expressed specifically on 5 days to recover. Correct positioning of the cannula brush border membranes of proximal tubular epithelial cells was verified by ICV infusion of angiotensin II (100 ng, in the kidney.5–7 At the mRNA level, conflicting reports exist Sigma-­Aldrich, Missouri, USA) to confirm a dipsogenic regarding its expression in the CNS.5 7–9 Thus, the presence response. All experiments were performed more than of SGLT2/SLC5A2 in the CNS is controversial. Based on a week after the surgery. After the experiments, 3 µL of western blotting results, SGLT2/SLC5A2 protein is present black ink was injected into the cannula of each animal, in human brain tissue after trauma.10 Furthermore, SGLT2/ and cannula placement was confirmed by spreading of SLC5A2 has been detected in choroid plexus epithelial cells the dye throughout the cerebral ventricular system. and ependymal cells in normal human and mouse tissues by immunostaining.11 Another recent report showed that Materials SGLT2/SLC5A2 is present in the forebrains and brain stems 2-DG­ (20 µmol, Merck KGaA, Darmstadt, DE, Germany), of mice.12 One study suggests that glucose uptake occurs via phlorizin (0.52 µmol, Merck KGaA), tofogliflozin (0.52 SGLT2/SLC5A2 in the rat brain.13 To date, expression of µmol, Advanced ChemBlocks, California, USA), empagli- SGLT2/SLC5A2 in the rat brain has not been unequivocally flozin (0.52 µmol, ChemScene, New Jersey, USA), and proven, and its function in the CNS thus remains uncertain.11 dapagliflozin (0.52 or 4.16 µmol, Carbosynth, Berks, Phlorizin, which inhibits both SGLT1/SLC5A1 and UK) were dissolved in vehicle, consisting of 25% DMSO SGLT2/SCL5A2, increased food intake in rats when admin- (dimethyl sulfoxide) in 75% normal saline, and then istered into the cerebral ventricle.14–17 2-­deoxy-­D-­glucose administered ICV to the rats. DMSO (25%) was required http://drc.bmj.com/ (2-DG)­ is a non-metabolizable­ glucose analogue18 which, to dissolve each solute. The glucagon-like­ peptide-1 when taken into cells, antagonizes normal intracellular (GLP-1) receptor agonist, liraglutide (20 µg, Adipogen, glucose metabolism,19 but stimulates food intake when California, USA) was dissolved in vehicle, consisting of injected into the cerebral ventricles of rats.15 20 Impaired 200 µL of saline containing 2% DMSO, and injected glucose metabolism in the brain stimulates food intake.15 intraperitoneally. For quantitative PCR, total RNA Considering that clinical use of SGLT2 inhibitors is known was prepared from tissue using an RNeasy Plus Mini to induce food intake,4 CNS-expressed­ SGLT2/SLC5A2 may Kit (Qiagen, Hilden, DE, Germany). Complementary on September 30, 2021 by guest. Protected copyright. play a role in regulating food intake. There remains a possi- DNA was prepared using a PrimeScript RT Reagent kit bility that prescribed SGLT2 inhibitors can cross the blood (Takara, Shiga, Japan). TaqMan probes for c-­fos, agouti-­ brain barrier (BBB) and act in brain regions that govern related protein (AgRP), neuropeptide Y (NPY), and pro-­ appetite and satiety.8 21 opiomelanocortin (POMC) were obtained from Thermo If SGLT2/SLC5A2 is present in the CNS in rats as well Fisher Scientific (Rn02396759_m, Rn01431703_g1, as in humans and mice, then intracerebroventricular Rn00561681_m1, and Rn00595020_m1, respectively; administration (ICV) infusion of an SGLT2 inhibitor, like MA, USA) and were used with TaqMan Fast Advanced phlorizin, might increase food intake. In this study, we Master Mix (Applied Biosystems, California, USA). 18s aimed to elucidate whether SGLT2/SLC5A2 in the CNS primers (18S-­f: ​CGGACAGGATTGACAGATTG, 18S-­r: ​ plays a role in stimulating food intake. CAAATCGCTCCACCAACTAA) were purchased from Applied Biosystems and used with Fast SYBR Green Master Mix in a CFX Connect Real-­Time PCR Detection RESEARCH DESIGN AND METHODS System (Bio-Rad,­ California, USA). For western blotting, Animals and surgical treatment frozen tissues were sonicated in lysis buffer containing a Male Sprague-Dawley­ rats (CLEA Japan, Tokyo, phosphatase inhibitor cocktail (F. Hoffmann-La­ Roche, Japan) weighing 250–350 g were housed separately in Basel, CH, Switzerland) as previously described.23 c-­fos

2 BMJ Open Diab Res Care 2021;9:e002104. doi:10.1136/bmjdrc-2020-002104 BMJ Open Diab Res Care: first published as 10.1136/bmjdrc-2020-002104 on 20 April 2021. Downloaded from Metabolism antibody (sc-271243, 1:100) was purchased from Santa using the F-­test but were not significantly different after Cruz Biotechnology (California, USA). Phospho-AMPK­ α logarithmic transformation. In these analyses, ANOVA (Thr172) antibody (#2531 1:1000), AMPKα (#2532 and multiple comparisons were performed using loga- 1:1000) antibody, β−tubulin (9F3) rabbit mAb (#2128 rithmically transformed values. Unless otherwise noted, 1:1000), HRP-­linked anti-­mouse IgG (#7072 1: 5000), data are presented as the mean±SD. A significant differ- and HRP-linked­ anti-rabbit­ IgG (#7074 1:1000) were ence was defined as p<0.05. from Cell Signaling Technology (MA, USA). Blocking was performed with 0.5% bovine serum albumin or 1% RESULTS skim milk. Western Lightning Plus-ECL­ was obtained Administration of tofogliflozin into the LV increased food from Perkin Elmer (Massachusetts, USA). intake ICV infusion To investigate whether CNS administration of SGLT2 Experiments were begun between 09:00 and 12:00 hours. inhibitors affects food intake, we administered 0.52 ICV infusion was performed for 3 min using a motor-­ μmol/3 µL of tofogliflozin, 0.52 μmol/3 µL of phlorizin, driven infusion pump with a delivery rate set to 1 µL/ 20 μmol/3 µL of 2-DG,­ or 3 µL of vehicle into the LV min. The rats were awake during the ICV procedure. via stably implanted cannula. We chose the same molar Starting 2 days before the day of drug administration, amount of 0.52 μmol SGLT2 inhibitors as was used in and for up to 6 days thereafter, food intake, water intake, a previous report in which phlorizin increased food 17 and body weight were measured daily. Cumulative food intake. We decided that 20 μmol of 2-­DG (in accord intake, water intake, and body weight were measured at with a previous report) would be sufficient to increase 15 0, 1.5, 3, 6, and 24 hours after completion of infusion. food intake. Tofogliflozin induced a significant increase Spilled food was accounted for in each measurement. in food intake at 1.5, 3, 6, and 24 hours after bolus admin- istration, compared with vehicle (figure 1A). In a prelim- Administration of tofogliflozin and liraglutide inary experiment using another cohort of rats, the food The time and method of administration were the same as intake at 24 hours did not reach statistical significance those applied for ICV infusion. Tofogliflozin was adminis- (p=0.10; data not shown). Consistent with previous tered only once, while liraglutide was administered daily at reports, increased food intake was also observed with 09:00 hours during the observation period. The measure- ICV infusions of phlorizin and 2-­DG. Increased food ment method was the same as that used for ICV infusion. intake was only observed during the first 1.5 hours after ICV phlorizin administration (figure 1A). Tofogliflozin Quantitative PCR and western blotting tended to yield stronger effects on food intake than 2-DG­ More than a week after the surgery, tofogliflozin, 2-DG,­ or and phlorizin. Tofogliflozin also induced a significant vehicle was infused as described above. Animals were decap- increase in water intake 1.5, 3, 6, and 24 hours after bolus itated 1.5 hours after drug administration. Brain tissues were administration, compared with vehicle (figure 1B). In frozen in liquid nitrogen and stored at −80°C. Each brain accordance with the increased food intake, rats adminis- was cut into serial 2.5 mm sections for micro-punch­ dissec- tered tofogliflozin gained significantly more body weight http://drc.bmj.com/ tion of the paraventricular nucleus (PVH, 0.0 to −2.5 mm), than those administered vehicle alone. The difference the arcuate nucleus (ARC, −2.5 to −5.0 mm), the lateral in weight gain was approximately equal to the sum of hypothalamus (LH, −2.5 to −5.0 mm), and the ventromedial the increased food and water intake (figure 1C). With hypothalamic nucleus (VMH, −2.5 to −5.0 mm) spanning phlorizin and 2-DG,­ the increase in food intake disap- indicated neuroanatomical intervals relative to the anterior peared after 24 hours. Increased food and water intake 22 commissure. Tissue samples were procured with a biopsy with tofogliflozin administration persisted for 5 days. on September 30, 2021 by guest. Protected copyright. punch (diameter: 1 mm, Integra Life Science, New Jersey, (figure 1D,E). Weight gain with tofogliflozin did not USA). For western blotting, after tissue sonication, protein persist beyond the day after administration. concentrations in lysis buffer were measured and normal- ized. Proteins were blotted with the indicated antibodies. Systemic administration of tofogliflozin did not change food Band intensities from western blots were measured and intake quantified using ImageJ software. To confirm that the effects of ICV tofogliflozin on food intake are exerted directly on the CNS and not via systemic Data analysis effects after leakage out of the brain, we administered the All statistical analyses were performed using GraphPad same molar amount of tofogliflozin intraperitoneally, and Prism 8 (V.8.4.3). Data for each drug treatment protocol observed no significant effects on food or water intake, or were evaluated by one-way­ analysis of variance (ANOVA) body weight in response to systemic tofogliflozin administra- for each phenotype. Where indicated, further compar- tion (online supplemental figure 1). isons between individual groups and the vehicle group were performed using Dunnett’s multiple comparison ICV administration of other SGLT2 inhibitors also increased test. Data obtained for multiple days were analyzed by food intake two-way­ or three-­way repeated measures ANOVA. In some To examine whether the effects on food intake induced analyses, variances among groups differed significantly by ICV tofogliflozin are compound-­specific or common

BMJ Open Diab Res Care 2021;9:e002104. doi:10.1136/bmjdrc-2020-002104 3 BMJ Open Diab Res Care: first published as 10.1136/bmjdrc-2020-002104 on 20 April 2021. Downloaded from Metabolism

Figure 1 Effects of ICV tofogliflozin on food intake, water intake and body weight. 0.52 µmol/3 µL of tofogliflozin, 0.52 http://drc.bmj.com/ µmol/3 µL of phlorizin, 20 µmol/3 µL of 2-­DG, or vehicle was infused into the LV of rats, and food and water intake and body weight gain were measured at 1.5, 3, 6, and 24 hours after completion of infusion, and from 2 days before, to 6 days after ICV infusion. (A) Cumulative food intake after ICV administration. (B) Cumulative water intake after ICV administration. (C) Body weight change relative to weight at time of drug administration. (D) Daily food intake from 2 days before, to 6 days after administration. (E) Daily water intake from 2 days before to 6 days after administration. (A–C) Data are presented as the mean±SD. (D,E) Data are presented as the mean±SEM. Significance relative to vehicle control: *p<0.05, **p<0.01. V: vehicle, P: phlorizin, 2-DG:­ 2-­deoxy-­D-­glucose, T: tofogliflozin A–E (V, P, 2-­DG, T) n=18, 9, 10, and 7, respectively. ICV, on September 30, 2021 by guest. Protected copyright. intracerebroventricular administration; LV, lateral ventricle. to SGLT2 inhibitors, two other SGLT2 inhibitors, dapagli- 6 hours, and water intake at 6 and 24 hours (figure 2C,D). flozin and empagliflozin, were administered into the LV There was no significant change in body weight. Food using the same protocol. As shown in figure 2A, dapagli- and water intake were significantly elevated by high-­dose flozin significantly increased food intake at 6 hours. ICV dapagliflozin for 5 days (figure 2E,F). empagliflozin significantly enhanced food intake at 1.5 hours (figure 2B). Water intake and body weight did The hyperphagic effect induced by ICV tofogliflozin was the not change significantly over the course of the experi- strongest in the LV, followed by the 3V ment in response to either of these drugs. To investigate where in the brain SGLT2 inhibitors acts to To determine whether higher doses of SGLT2 inhib- enhance feeding, tofogliflozin was administered into the itors would induce more robust effects on food intake, 3V and 4V. Administration of 0.52 μmol tofogliflozin into 4.16 μmol (eightfold higher concentration than in the the 3V increased food intake at 1.5 and 3 hours (figure 3A). previous experiment) dapagliflozin was administered A trend toward increased food intake was still present at into the LV. Compared with vehicle, high-dose­ dapagli- 6 hours, although it did not reach statistical significance. flozin significantly increased food intake at 1.5, 3, and Regardless of the increase in food intake, no significant

4 BMJ Open Diab Res Care 2021;9:e002104. doi:10.1136/bmjdrc-2020-002104 BMJ Open Diab Res Care: first published as 10.1136/bmjdrc-2020-002104 on 20 April 2021. Downloaded from Metabolism http://drc.bmj.com/ on September 30, 2021 by guest. Protected copyright.

Figure 2 Effects of ICV infusion of dapagliflozin and empagliflozin on food intake and water intake. 0.52 µmol or 4.16 µmol (high-­dose)/3 µL of dapagliflozin, 0.52 µmol/3 µL of empagliflozin or 3 µL of vehicle was infused into the LV of rats, and food and water intake were measured at 0, 1.5, 3, 6, and 24 hours after ICV infusion. (A) Cumulative food intake after ICV 0.52 µmol dapagliflozin administration. (B) Cumulative food intake after ICV 0.52 µmol empagliflozin administration. (C) Cumulative food intake. (D) Cumulative water intake after high-dose­ dapagliflozin administration. (E) Daily food and (F) water intake from 2 days before to 6 days after high-­dose dapagliflozin administration. (A–D) Data are presented as the mean±SD. (E,F) Data are presented as the mean±SEM. Significance relative to vehicle control: *p<0.05, **p<0.01. V: vehicle, D: dapagliflozin, E: empagliflozin, HD: high-­dose dapagliflozin A (V, D): n=13 and 13, respectively. B (V, E): n=14 and 14, respectively. C–F (V, HD) n=7 and 8, respectively. ICV, intracerebroventricular administration; LV, lateral ventricle.

BMJ Open Diab Res Care 2021;9:e002104. doi:10.1136/bmjdrc-2020-002104 5 BMJ Open Diab Res Care: first published as 10.1136/bmjdrc-2020-002104 on 20 April 2021. Downloaded from Metabolism http://drc.bmj.com/ on September 30, 2021 by guest. Protected copyright. Figure 3 Effects of ICV infusion of tofogliflozin into 3V or 4V on food intake and body weight. 0.52 µmol/3 µL of tofogliflozin or vehicle was infused into the 3V or 4V of rats, and food intake and body weight gain were measured at 1.5, 3, 6, and 24 hours after completion of infusion, and from 2 days before to 6 days after. (A) Cumulative food intake after ICV administration into the 3V. (B) Body weight change relative to the time of drug administration into the 3V. (C) Cumulative food intake after ICV administration into the 4V. (D) Body weight change relative to the time of drug administration into the 4V. Data are presented as the mean±SD. Significance relative to vehicle control: *p<0.05, **p<0.01. V: vehicle, T: tofogliflozin A–D (V, T): n=9 and 9, respectively. ICV, intracerebroventricular administration; 3V, third ventricle; 4V, fourth ventricle. change in body weight was observed (figure 3B). Admin- effect) on food intake was observed with administration istration of tofogliflozin into the 4V increased neither into the 4V. food nor water intake (figure 3C). Rather, food and water intake tended to decrease. Moreover, a significant Systemic administration of liraglutide attenuated the decrease in body weight was observed with 4V infusion hyperphagic effect of ICV tofogliflozin of tofogliflozin (figure 3D). Taken together, these results Liraglutide is a GLP-1 receptor agonist that can increase indicate that the hyperphagic effect is strongest in the LV, satiety.24 To determine whether systemic administration followed by 3V, while no effect (or a mildly suppressive of a GLP-1 receptor agonist can block the hyperphagic

6 BMJ Open Diab Res Care 2021;9:e002104. doi:10.1136/bmjdrc-2020-002104 BMJ Open Diab Res Care: first published as 10.1136/bmjdrc-2020-002104 on 20 April 2021. Downloaded from Metabolism

Figure 4 Effects of systemic liraglutide administration with ICV tofogliflozin on food intake. 0.52 µmol/3 µL of tofogliflozin or vehicle was infused into the LV of rats, and 20 µg of liraglutide was intraperitoneally injected daily from day 0 to day 6. Food intake was measured at 1.5, 3, 6, and 24 hours after ICV infusion, and from 2 days before to 6 days after. (A) Cumulative food intake after ICV administration. (B) Body weight changes throughout time after ICV administration. (C) Daily food intake from 2 days before to 6 days after administration. (D) Changes in body weight after drug administration. (A,B) Data are presented as the mean±SD. Significance relative to vehicle control: *p<0.05, **p<0.01. (C,D) Data are presented as the mean±SEM. Significance between IP vehicle vs IP liraglutide: ***p<0.001. Significance of interaction between IP liraglutide vs ICV tofogliflozin †p<0.05. V, vehicle; T, tofogliflozin; L, liraglutide ICV-V+IP­ V, ICV-­V+IP L, ICV-­T+IP V, ICV-­T+IP-­L: n=13, 13, 12, and 12, respectively. ICV, intracerebroventricular administration; LV, lateral ventricle. http://drc.bmj.com/ effect of ICV SGLT2 inhibitors, we intraperitoneally showed a significant increase in c-­fos expression in the injected 20 μmol of liraglutide once a day into the rats LH, and a trend toward increased expression in the PVH treated with bolus ICV tofogliflozin. Consistent with (figure 5B). AMPK phosphorylation was examined in the previous experiments, the group receiving ICV tofogli- LH (the feeding center), VMH (the satiety center), ARC,

flozin with intraperitoneal vehicle showed increased food and PVH. There was a significant increase in AMPK phos- on September 30, 2021 by guest. Protected copyright. intake compared with the ICV vehicle group (figure 4A). phorylation in the LH, and a trend toward decreased No significant changes in body weight were observed AMPK phosphorylation in the VMH (figure 5C). No (figure 4B). Intraperitoneal injection of liraglutide significant changes in AMPK phosphorylation levels were significantly suppressed the hyperphagic effect of ICV observed in the ARC and PVH (figure 5C). Moreover, tofogliflozin at 3 and 6 hours after treatment (figure 4A). NPY and AgRP levels showed a decreasing trend with In a three-way­ repeated measures ANOVA, IP liraglutide tofogliflozin, whereas in those of POMC did not signifi- independently and significantly suppressed food intake cantly change (figure 5D). for 5 days, with significant interaction between IP lira- glutide and ICV tofogliflozin (figure 4C). No significant differences in body weight were observed (figure 4D). DISCUSSION We found that bolus administration of tofogliflozin to the Changes in molecular signals in hypothalamic nuclei ICV increases food intake for 5 days, whereas intraperito- We conducted qPCR of c-fos­ expression in the hypothal- neal injection does not. Thus, we consider the effects of amus at 1.5 hours after ICV administration of tofogli- ICV infusion attributable to direct actions within the CNS flozin. We found that c-fos,­ a marker of neural activity, rather than due to leakage into the bloodstream. All three was significantly upregulated in the ARC and tended to SGLT2 inhibitors induced hyperphagia when adminis- be increased in the PVH (figure 5A). Western blotting tered to the CNS. In addition, dapagliflozin showed a

BMJ Open Diab Res Care 2021;9:e002104. doi:10.1136/bmjdrc-2020-002104 7 BMJ Open Diab Res Care: first published as 10.1136/bmjdrc-2020-002104 on 20 April 2021. Downloaded from Metabolism

Figure 5 ICV of tofogliflozin altered c-­fos expression and AMPK phosphorylation. At 1.5 hours after ICV infusion of 0.52 µmol/3 µL of tofogliflozin or vehicle into the V,L tissue samples were collected. (A) Expression of c-fos­ in the ARC and the PVH was assessed by RT-­PCR and normalized to the expression of 18 s ribosomal RNA. (B) c-­fos and β-tubulin expression were evaluated by immunoblotting. The results are shown as representative bands. All bands were quantified by densitometry. Band intensities of c-­fos were normalized to β-tubulin. (C) Expression levels of total AMPK and AMPK phosphorylated at Thr172 were evaluated by immunoblotting. Results are shown as representative bands, and band are quantified by densitometry. Band intensities of phospho-­AMPK were normalized to those of AMPK. (D) Expression of NPY, AgRP, and POMC in the ARC http://drc.bmj.com/ was assessed by RT-­PCR and normalized to the expression of 18s ribosomal RNA. Data are presented as the mean±SD. Significance relative to vehicle control: *p<0.05, **p<0.01. V: vehicle, 2-­DG: 2-deoxy-­ D-­ glucose,­ T: tofogliflozin A: (T, 2-DG,­ (V) n=4, 5, and 4, respectively. B and C: (V, T): n=3 and 5, respectively. D: (V, T) n=4 and 4, respectively. AgRP, agouti-­related protein; ARC, arcuate nucleus; ICV, intracerebroventricular administration; LH, lateral hypothalamus; LV, lateral ventricle; NPY, neuropeptide Y; POMC, pro-­opiomelanocortin; PVH, paraventricular nucleus; VMH, ventromedial hypothalamic. on September 30, 2021 by guest. Protected copyright. dose-­dependent effect on food intake. The effect of ICV subjects was calculated to have increased by ~350 kcal/ tofogliflozin was the strongest in the LV, while less or day.30 To our knowledge, no research has focused on no effects in the 3V or 4V, respectively. ICV infusion of whether this hyperphagic effect is exerted via the CNS. SGLT2 inhibitors activated AMPK in the LH, and upreg- Our observations in the present study raise the possibility ulated c-­fos in the ARC and LH. The hyperphagic effect that the clinically observed hyperphagic effects associated of tofogliflozin was blocked by systemic administration of with SGLT2 inhibitors are, at least partially, exerted via liraglutide. the CNS. If true, this would imply that reduced transfer In several previous reports, oral administration of of SGLT2 inhibitors to the CNS would result in more SGLT2 inhibitors was credited with increasing food intake effective weight loss. in rats.25–29 In rats with diet-­induced obesity, chronic In the present study, tofogliflozin induced a greater dapagliflozin administration caused compensatory food increase in food intake than did 2-DG­ or phlorizin. intake and more than three times the weight loss in Several studies have reported that ICV phlorizin increases rats with paired food consumption.29 In a human study, food intake.14–17 One showed that 0.26 μmol ICV phlo- a dissociation between expected and actual weight loss rizin induced a stronger hyperphagic effect than 0.13 of approximately 8 kg was observed.4 In another study, μmol, while the effects of 0.26 μmol and 0.52 μmol were steady state energy intake in the canagliflozin-­treated similar.17 Based on this report, we compared 0.52 μmol

8 BMJ Open Diab Res Care 2021;9:e002104. doi:10.1136/bmjdrc-2020-002104 BMJ Open Diab Res Care: first published as 10.1136/bmjdrc-2020-002104 on 20 April 2021. Downloaded from Metabolism of phlorizin with the same molar amount of tofogliflozin in the hypothalamus, amygdala, periaqueductal gray, and and found that the latter had a stronger effect on food the nucleus of the solitary tract by immunohistochemical intake. Two other previous studies demonstrated that analysis.12 Another report showed that SGLT2/SLC5A2 is approximately 20 μmol ICV 2-­DG induced a significant present in ependymal cells and choroid plexus epithelial hyperphagic effect.15 31 We thus employed 20 μmol 2-DG,­ cells.11 Thus, there is still no consensus regarding which a dose considered sufficient to increase food intake. This CNS locations express SGLT2/SLC5A2. GLUTs are the amount of 2-­DG tended to induce a hyperphagic effect primary transporter of glucose uptake in the CNS, and in the present study, but its effect was smaller than that of the contribution of SGLTs is low.38 Although differing in tofogliflozin. Therefore, tofogliflozin was more effective selectivity, tofogliflozin and phlorizin caused completely in increasing food intake than phlorizin and 2-­DG. These different effects when administered 4V-­ICV, despite being observations suggest that higher SGLT2/SLC5A2 selec- SGLT inhibitors. These results suggest that the tofogli- tivity contributes to enhanced food intake, supporting flozin target exists mainly in the forebrain, suggesting the presence of SGLT2/SLC5A2 in the rat CNS. The that SGLT2/SLC5A2, as a target of tofogliflozin, is function of SGLT2/SLC5A2 itself might be associated present in the forebrain. This assumption is consistent with food intake. with the sites previously suggested to harbor SGLT2/ The hyperphagic effect seems to be common to SGLT2 SLC5A2.12 Another possibility is that spinal fluid flows inhibitors, because all three SGLT2 inhibitors we used from the LV to the lower ventricles, and the SGLT2 inhib- significantly increased food intake. There was, however, itor thereby reaches more SGLT2-­expressing ependymal a difference in the degree of hyperphagia among groups cells expressed around the cerebral ventricle, which may given the same molar amount of each drug. SGLT2/ explain why the effect is stronger in the upper ventricles. SLC5A2 selectivity differs among these drugs,32 possibly In the present study, ICV administration of tofogliflozin contributing to this difference. SGLT1/SLC5A1 and increased c-­fos expression and tended to suppress AgRP SGLT3/SLC5A4 are present in the rat hypothalamus as and NPY, without significant changes in POMC in the glucose sensors.33 In humans, tofogliflozin is known to be ARC. c-fos­ belongs to the Fos family,39 and various stimuli less selective for SGLT3 versus SGLT2 than the other two are known to selectively induce its expression.40 41 Oral SGLT2 inhibitors.32 Taken together with reports showing administration of SGLT2 inhibitors has been reported that SGLT3/SLC5A4 functions as a glucose sensor in the to enhance c-­fos expression in the PVH, ARC, and LH, CNS,34 additional effects on SGLT3/SLC5A4 may explain consistent with our observations.12 AMPK is known to the stronger effects of tofogliflozin. Mice and rats have be the main sensor of cellular energy status, and coor- two isoforms of SGLT3/SLC5A4, unlike humans who dinates metabolism at the whole-­body level.42 In the have only one isoform.35 It is thus difficult to extrapo- hypothalamus, regulation of AMPK phosphorylation is a late findings from rats to humans.35 In addition, selec- mechanism for detecting nutritional changes.33 43 Early tivity of SGLT2 inhibitors for SGLT2/SLC5A2 compared researchers referred to the LH and VMH as feeding and with SGLT1/SLC5A1 is reportedly lower in rats than in satiety centers, respectively.44 More recently, the LH has humans.36 Therefore, if the hyperphagic effect of SGLT2 been suggested to be a core node within a distributed http://drc.bmj.com/ inhibitors is SGLT2/SLC5A2-specific,­ it might be stronger feeding network that integrates different feeding drives in humans. Another possible reason is that differences and motivates behaviour.45 The present study showed in the excretion of SGLT2 inhibitors from the CNS may that ICV infusion of tofogliflozin activated AMPK in the contribute to changes in hyperphagia. However, to the LH, consistent with a previous report that showed that best of our knowledge, no studies have reported the systemic hypoglycemia could induce AMPK phosphoryla- rate or mechanism of SGLT2 inhibitors excretion in the tion in the LH.46 These observations suggest that SGLT2/ CNS. Future experiments using ICV-­radiolabelled SGLT2 SLC5A2 in the CNS directly or indirectly regulates feeding on September 30, 2021 by guest. Protected copyright. inhibitors may clarify why ICV tofogliflozin had the stron- via AMPK phosphorylation in the LH. It was reported gest effect on food intake. that the ARC projects to the LH,47 which may play an We attempted to identify brain regions responsible for important role in feeding.48 Taken together, it is possible the hyperphagic effect induced by SGLT2 inhibitors. ICV that tofogliflozin acts on the LH to enhance feeding, tofogliflozin infusion into the 3V caused a milder increase which in turn may induce compensatory suppression of in food intake than that into the LV. ICV tofogliflozin AgRP and NPY expression. Systemic administration of into the 4V produced no significant hyperphagic effect. exendin-4, a GLP-1 receptor agonist, has been reported Conversely, body weight tended to be reduced by 4V-­ICV to decrease AMPK phosphorylation in the LH.49 In the administration. These results are in contrast to those of present study, systemic injection of liraglutide blocked previous studies using phlorizin and 5-thioglucose.­ 16 17 37 ICV infused tofogliflozin-mediated­ hyperphagia. One ICV phlorizin in both the LV and 4V reportedly induced possible mechanism involves inhibition by GLP-1 of a similar hyperphagic effect.17 In another report, ICV ICV administered SGLT2 inhibitor driven AMPK phos- infusion of 5-thioglucose­ into both the LV and the 4V phorylation in the LH. Our findings may further clarify increased food intake, and this effect was abolished only the role of the LH in food intake. Further studies using in the LV after obstruction of the cerebral aqueduct.37 ICV-­administrated AMPK inhibitors (ie, SBI-0206965) According to one report, SGLT2/SLC5A2 was detected or allosteric activators (ie, A-769662, MK-8722, or

BMJ Open Diab Res Care 2021;9:e002104. doi:10.1136/bmjdrc-2020-002104 9 BMJ Open Diab Res Care: first published as 10.1136/bmjdrc-2020-002104 on 20 April 2021. Downloaded from Metabolism

PF-06409577) with tofogliflozin are necessary to further peer-­reviewed. Any opinions or recommendations discussed are solely those demonstrate that SGLT2 inhibitors enhance feeding via of the author(s) and are not endorsed by BMJ. BMJ disclaims all liability and responsibility arising from any reliance placed on the content. Where the content AMPK phosphorylation in the LH. The combination of includes any translated material, BMJ does not warrant the accuracy and reliability SGLT2 inhibitors and GLP-1 receptor agonists report- of the translations (including but not limited to local regulations, clinical guidelines, edly results in greater weight loss than the use of a single terminology, drug names and drug dosages), and is not responsible for any error agent in humans.50 Our results may provide a basic and/or omissions arising from translation and adaptation or otherwise. research perspective impetus for investigating the useful- Open access This is an open access article distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-­NC 4.0) license, which ness of combining SGLT2 inhibitors and GLP-1 receptor permits others to distribute, remix, adapt, build upon this work non-commercially­ , agonists. and license their derivative works on different terms, provided the original work is The present study has several limitations. We did not properly cited, appropriate credit is given, any changes made indicated, and the prove that SGLT2/SLC5A2 regulates food intake. To use is non-commercial.­ See: http://creativecommons.​ ​org/licenses/​ ​by-nc/​ ​4.0/.​ determine the function of SGLT2/SLC5A2 in the brain, ORCID iDs it is necessary to conduct experiments using knockout Kenji Takeda http://orcid.​ ​org/0000-​ ​0001-8323-​ ​2488 models. However, administering an SGLT2 inhibitor into Hiraku Ono http://orcid.​ ​org/0000-​ ​0002-3550-​ ​9339 Ko Ishikawa http://orcid.​ ​org/0000-​ ​0001-5788-​ ​2217 the LV dramatically enhanced food intake, suggesting Yoshiro Maezawa http://orcid.​ ​org/0000-​ ​0001-5567-​ ​9901 that the SGLT2 inhibitor acts directly in the CNS to induce hyperphagia. Another limitation is the dose of REFERENCES SGLT2 inhibitor administered to the CNS in this experi- 1 Mueckler M, Thorens B. The SLC2 (GLUT) family of membrane ment, which would be higher than that of clinical use. To transporters. Mol Aspects Med 2013;34:121–38. 2 Deng D, Yan N. Glut, SGLT, and sweet: structural and mechanistic our knowledge, it is not known how much of the orally investigations of the glucose transporters. Protein Sci administered SGLT2 inhibitors could be transferred to 2016;25:546–58. 3 Navale AM, Paranjape AN. Glucose transporters: physiological and the CNS. Thus, in addition to the acute and chronic pathological roles. Biophys Rev 2016;8:5–9. effects on the CNS, as shown in this study, chronic energy 4 Ferrannini G, Hach T, Crowe S, et al. Energy balance after sodium-­ glucose cotransporter 2 inhibition. Diabetes Care 2015;38:1730–5. loss via the excretion of urinary glucose could also induce 5 Chen J, Williams S, Ho S, et al. Quantitative PCR tissue expression compensatory food intake. profiling of the human SGLT2 gene and related family members. Diabetes Ther 2010;1:57–92. In summary, our study suggests that direct ICV admin- 6 Vallon V, Platt KA, Cunard R, et al. Sglt2 mediates glucose istration of an SGLT2 inhibitor into the CNS increases reabsorption in the early proximal tubule. J Am Soc Nephrol food intake via phosphorylation of AMPK in the LH. 2011;22:104–12. 7 Vrhovac I, Balen Eror D, Klessen D, et al. Localizations of Na+-D-­ While the physiological function of SGLT2 in the CNS glucose cotransporters SGLT1 and SGLT2 in human kidney and of has not been confirmed, our results support the theory SGLT1 in human small intestine, liver, lung, and heart. Pflugers Arch - Eur J Physiol 2015;467:1881–98. that CNS SGLT2/SLC5A2 plays a regulatory role in food 8 Wright EM, Loo DDF, Hirayama BA. Biology of human sodium intake. This result may explain the increased food intake glucose transporters. Physiol Rev 2011;91:733–94. 9 Zhou L, Cryan EV, D'Andrea MR, et al. Human cardiomyocytes observed with the use of SGLT2 inhibitors in clinical prac- express high level of Na+/glucose cotransporter 1 (SGLT1). J Cell tice. If we can develop SGLT2 inhibitors with lower or Biochem 2003;90:339–46.

10 Oerter S, Förster C, Bohnert M. Validation of sodium/glucose http://drc.bmj.com/ absent BBB penetration, diabetic treatment with reduced cotransporter proteins in human brain as a potential marker for compensatory food intake might become possible. temporal narrowing of the trauma formation. Int J Legal Med 2019;133:1107–14. Acknowledgements We would like to thank Dr Bierta Barfod and Editage (​www.​ 11 Chiba Y, Sugiyama Y, Nishi N, et al. Sodium/glucose cotransporter 2 is expressed in choroid plexus epithelial cells and ependymal cells in editage.​jp) for English language editing. HOn is the guarantor of this work and, as human and mouse brains. Neuropathology 2020;40:482–91. such, had full access to all of the data in the study and takes responsibility for the 12 Nguyen T, Wen S, Gong M, et al. Dapagliflozin activates neurons integrity of the data and the accuracy of the data analysis. in the central nervous system and regulates cardiovascular on September 30, 2021 by guest. Protected copyright. Contributors KT, HOn, and KY designed the study. KT and HOn wrote the study activity by inhibiting SGLT-2 in mice. Diabetes Metab Syndr Obes 2020;13:2781–99. protocol, performed the study, and wrote the manuscript. KT, HOc, AM, TO, JK, HY, 13 Yu AS, Hirayama BA, Timbol G, et al. Functional expression of and HOn contributed reagents/materials/analysis tools. All authors critically edited SGLTs in rat brain. Am J Physiol Cell Physiol 2010;299:C1277–84. the manuscript and approved the final version. 14 Glick Z, Mayer J. Hyperphagia caused by cerebral ventricular Funding This work was supported by the grants JSPS KAKENHI 15K09398 and infusion of phloridzin. Nature 1968;219:1374. 15 Tsujii S, Bray GA. Effects of glucose, 2-­deoxyglucose, phlorizin, 18K08502 to HOn as well as 20H00524 to KY and by the Project for Elucidating and insulin on food intake of lean and fatty rats. Am J Physiol and Controlling Mechanisms of Aging and Longevity of AMED 17gm5010002h0001, 1990;258:E476–81. 18gm5010002h0002, 19gm5010002h0003, and 20gm5010002h0004 to KY. 16 Flynn FW, Grill HJ. Fourth ventricular phlorizin dissociates feeding Competing interests None declared. from hyperglycemia in rats. Brain Res 1985;341:331–6. 17 Li A-­J, Wang Q, Dinh TT, et al. Stimulation of feeding by three Patient consent for publication Not required. different glucose-­sensing mechanisms requires hindbrain catecholamine neurons. Am J Physiol Regul Integr Comp Physiol Ethics approval All experimental procedures were performed in accordance with 2014;306:R257–64. specified guidelines and regulations for the care and use of laboratory animals. The 18 Gonzàlez JA, Reimann F, Burdakov D. Dissociation between sensing Chiba University Institutional Animal Care and Use Committee approved all animal and metabolism of glucose in sugar sensing neurones. J Physiol procedures. 2009;587:41–8. 19 Pénicaud L, Thompson DA. Effects of systemic or Provenance and peer review Not commissioned; externally peer reviewed. intracerebroventricular naloxone injection on basal and 2-­deoxy-D-­ ­ Data availability statement Data are available on reasonable request. glucose-induced­ ingestive behavior. Life Sci 1984;35:2297–302. 20 Smith GP, Epstein AN. Increased feeding in response to Supplemental material This content has been supplied by the author(s). It has decreased glucose utilization in the rat and monkey. Am J Physiol not been vetted by BMJ Publishing Group Limited (BMJ) and may not have been 1969;217:1083–7.

10 BMJ Open Diab Res Care 2021;9:e002104. doi:10.1136/bmjdrc-2020-002104 BMJ Open Diab Res Care: first published as 10.1136/bmjdrc-2020-002104 on 20 April 2021. Downloaded from Metabolism

21 Ferrannini E, Co-transporters­ S-­G. Sodium-­Glucose co-­transporters 36 Grempler R, Thomas L, Eckhardt M, et al. Empagliflozin, a novel and their inhibition: clinical physiology. Cell Metab 2017;26:27–38. selective sodium glucose cotransporter-2 (SGLT-2) inhibitor: 22 Ann S, Pellegrino PLJ, Cushman AJ. A stereotaxic atlas of the rat characterisation and comparison with other SGLT-2 inhibitors. brain. second edition. PLENUM PUBLISHING CORPORATION, Diabetes Obes Metab 2012;14:83–90. 1979. 37 Ritter RC, Slusser PG, Stone S. Glucoreceptors controlling 23 Sumita T, Ono H, Suzuki T, et al. Mediobasal hypothalamic PTEN feeding and blood glucose: location in the hindbrain. Science modulates hepatic insulin resistance independently of food intake in 1981;213:451–2. rats. Am J Physiol Endocrinol Metab 2014;307:E47–60. 38 Sala-Rabanal­ M, Hirayama BA, Ghezzi C, et al. Revisiting the 24 Trujillo JM, Nuffer W, Ellis SL. GLP-1 receptor agonists: a review physiological roles of SGLTs and GLUTs using positron emission of head-to-­ head­ clinical studies. Ther Adv Endocrinol Metab tomography in mice. J Physiol 2016;594:4425–38. 2015;6:19–28. 39 Milde-Langosch­ K. The Fos family of transcription factors and their 25 Suzuki M, Takeda M, Kito A, et al. Tofogliflozin, a sodium/glucose role in tumourigenesis. Eur J Cancer 2005;41:2449–61. cotransporter 2 inhibitor, attenuates body weight gain and fat 40 Sagar SM, Sharp FR, Curran T. Expression of c-­fos protein in brain: accumulation in diabetic and obese animal models. Nutr Diabetes metabolic mapping at the cellular level. Science 1988;240:1328–31. 2014;4:e125. 41 Morgan JI, Curran T. Stimulus-­transcription coupling in neurons: role 26 Iuchi H, Sakamoto M, Matsutani D, et al. Time-­dependent effects of cellular immediate-­early genes. Trends Neurosci 1989;12:459–62. of ipragliflozin on behaviour and energy homeostasis in normal and 42 Garcia D, Shaw RJ. Ampk: mechanisms of cellular energy sensing type 2 diabetic rats: continuous glucose telemetry analysis. Sci Rep and restoration of metabolic balance. Mol Cell 2017;66:789–800. 2017;7:11906. 43 Minokoshi Y, Alquier T, Furukawa N, et al. Amp-­Kinase regulates 27 Kojima N, Williams JM, Takahashi T, et al. Effects of a new SGLT2 food intake by responding to hormonal and nutrient signals in the inhibitor, luseogliflozin, on diabetic nephropathy in T2DN rats. J hypothalamus. Nature 2004;428:569–74. Pharmacol Exp Ther 2013;345:464–72. 44 Anand BK, Brobeck JR. Hypothalamic control of food intake in rats 28 Vickers SP, Cheetham SC, Headland KR, et al. Combination of the and cats. Yale J Biol Med 1951;24:123–40. sodium-­glucose cotransporter-2 inhibitor empagliflozin with orlistat 45 Petrovich GD. Lateral hypothalamus as a Motivation-­Cognition or sibutramine further improves the body-­weight reduction and interface in the control of feeding behavior. Front Syst Neurosci glucose homeostasis of obese rats fed a cafeteria diet. Diabetes 2018;12:14. Metab Syndr Obes 2014;7:265–75. 46 Alhamami HN, Uddin MM, Mahmood ASMH, et al. Lateral 29 Devenny JJ, Godonis HE, Harvey SJ, et al. Weight loss induced but not medial hypothalamic AMPK activation occurs at the by chronic dapagliflozin treatment is attenuated by compensatory hypoglycemic nadir in Insulin-­injected male rats: impact of caudal hyperphagia in diet-­induced obese (DIO) rats. Obesity dorsomedial hindbrain catecholamine signaling. Neuroscience 2012;20:1645–52. 2018;379:103–14. 30 Polidori D, Sanghvi A, Seeley RJ, et al. How strongly does appetite 47 Elias CF, Aschkenasi C, Lee C, et al. Leptin differentially regulates counter weight loss? quantification of the feedback control of human NPY and POMC neurons projecting to the lateral hypothalamic area. energy intake. Obesity 2016;24:2289–95. Neuron 1999;23:775–86. 31 Miselis RR, Epstein AN. Feeding induced by intracerebroventricular 48 Elias CF, Saper CB, Maratos-­Flier E, et al. Chemically defined 2-­deoxy-­D-­glucose in the rat. Am J Physiol 1975;229:1438–47. projections linking the mediobasal hypothalamus and the lateral 32 Suzuki M, Honda K, Fukazawa M, et al. Tofogliflozin, a potent and hypothalamic area. J Comp Neurol 1998;402:442–59. highly specific sodium/glucose cotransporter 2 inhibitor, improves 49 Hurtado-­Carneiro V, Sanz C, Roncero I, et al. Glucagon-­Like peptide glycemic control in diabetic rats and mice. J Pharmacol Exp Ther 1 (GLP-1) can reverse AMP-activated­ protein kinase (AMPK) and S6 2012;341:692–701. kinase (p70S6K) activities induced by fluctuations in glucose levels 33 Mountjoy PD, Rutter GA. Glucose sensing by hypothalamic in hypothalamic areas involved in feeding behaviour. Mol Neurobiol neurones and pancreatic islet cells: AMPle evidence for common 2012;45:348–61. mechanisms? Exp Physiol 2007;92:311–9. 50 Frías JP, Guja C, Hardy E, et al. Exenatide once Weekly plus 34 Díez-Sampedr­ o A, Hirayama BA, Osswald C, et al. A glucose dapagliflozin once daily versus exenatide or dapagliflozin alone in sensor hiding in a family of transporters. Proc Natl Acad Sci U S A patients with type 2 diabetes inadequately controlled with metformin 2003;100:11753–8. monotherapy (DURATION-8): a 28 week, multicentre, double-blind,­ 35 Soták M, Marks J, Unwin RJ. Putative tissue location and function of phase 3, randomised controlled trial. Lancet Diabetes Endocrinol the SLC5 family member SGLT3. Exp Physiol 2017;102:5–13. 2016;4:1004–16. http://drc.bmj.com/ on September 30, 2021 by guest. Protected copyright.

BMJ Open Diab Res Care 2021;9:e002104. doi:10.1136/bmjdrc-2020-002104 11