Anabolic Steroid Associated to Physical Training Induces Deleterious Cardiac Effects

Home , Nandrolone, Nandrolone decanoate, Spironolactone

EVERTON CRIVOI DO CARMO1, TIAGO FERNANDES1, DANIEL KOIKE2, NATHAN DANIEL DA SILVA JR.1, KATT COELHO MATTOS1, KALEIZU TEODORO ROSA3, DIEGO BARRETTI1, STE´ PHANO FREITAS SOARES MELO1, ROGE´ RIO B. WICHI2, MARIA CLAUDIA COSTA IRIGOYEN3, and EDILAMAR MENEZES DE OLIVEIRA1 1School of Physical Education and Sport, University of Saõ Paulo, Saõ Paulo, SP, BRAZIL; 2Human Movement Laboratory, Sao Judas Tadeu University, Saõ Paulo, SP, BRAZIL; and 3Hypertension Unit, Heart Institute, Medical School, University of Saõ Paulo, Saõ Paulo, SP, BRAZIL

ABSTRACT DO CARMO, E. C., T. FERNANDES, D. KOIKE, N. D. DA SILVA JR., K. C. MATTOS, K. T. ROSA, D. BARRETTI, S. F. S. MELO, R. B. WICHI, M. C. C. IRIGOYEN, and E. M. DE OLIVEIRA. Anabolic Steroid Associated to Physical Training Induces Deleterious Cardiac Effects. Med. Sci. Sports Exerc., Vol. 43, No. 10, pp. 1836–1848, 2011. Purpose: Cardiac aldosterone might be involved in the deleterious effects of nandrolone decanoate (ND) on the heart. Therefore, we investigated the involvement of cardiac aldosterone, by the pharmacological block of AT1 or mineralocorticoid receptors, on cardiac hypertrophy and fibrosis. Methods: Male Wistar rats were randomized into eight groups (n = 14 per group): Control (C), nandrolone decanoate (ND), trained (T), trained ND (TND), ND + losartan (ND + L), trained ND + losartan (TND + L), ND + spironolactone (ND + S), and trained ND + spironolactone (TND + S). ND (10 mgIkgj1Iwkj1) was administered during 10 wk of swimming training (five times per week). Losartan (20 mgIkgj1Idj1) and spironolactone (10 mgIkgj1Idj1) were administered in drinking water. Results: Cardiac hypertrophy was increased 10% by using ND and 17% by ND plus training (P G 0.05). In both groups, there was an increase in the collagen volumetric fraction (CVF) and cardiac collagen type III expression (P G 0.05). The ND treatment increased left ventricle–angiotensin-converting BASIC SCIENCES enzyme I activity, AT1 receptor expression, aldosterone synthase (CYP11B2), and 11-A hydroxysteroid dehydrogenase 2 (11A-HSD2) gene expression and inflammatory markers, TGFA and osteopontin. Both losartan and spironolactone inhibited the increase of CVF and collagen type III. In addition, both treatments inhibited the increase in left ventricle–angiotensin-converting enzyme I activity, CYP11B2, 11A-HSD2, TGFA, and osteopontin induced by the ND treatment. Conclusions: We believe this is the first study to show the effects of ND on cardiac aldosterone. Our results suggest that these effects may be associated to TGFA and osteopontin. Thus, we conclude that the cardiac aldosterone has an important role on the deleterious effects on the heart induced by ND. Key Words: ANABOLIC STEROID, ANGIOTENSIN II, ALDOSTERONE, CARDIAC HYPERTROPHY, CARDIAC COLLAGEN

nabolic steroids induce adverse effects on the car- angiotensin system. These findings were reinforced by the diovascular system, including myocardial structural fact that AT1 receptor antagonist prevented these effects Achanges and cardiac hypertrophy (15). Exercise induce by ND (27). training associated with anabolic steroid induces maladaptive The renin–angiotensin system, via angiotensin II, plays an remodeling and further deterioration in cardiac performance important role in regulating cardiac growth and in remod- and causes loss of the beneficial effects in left ventricle (LV) eling of the cardiac extracellular matrix (40). However, the function induced by exercising (27). However, the mecha- angiotensin II effects on cardiac tissue have been associated nisms of these processes are poorly understood. with aldosterone actions (16). As the tissue angiotensin II, Our previous findings indicate that the combination of aldosterone synthesis is also detected in extra adrenal sites as physical training and nandrolone decanoate (ND) causes an cardiovascular tissue (33), being that the aldosterone syn- increase in the heart collagen concentration and cardiac hy- thase gene (CYP11B2) is a key enzyme in this process pertrophy associated with activation of the cardiac renin– (33,37). An increase in CYP11B2 was associated with cardiovascular disorders, such as heart failure and myocardial infarction (37). The mineralocorticoid receptor and 11-A Address for correspondence: Edilamar Menezes de Oliveira, Ph.D., Labo- hydroxysteroid dehydrogenase 2 (11A-HSD2), which con- ratory of Biochemistry, School of Physical Education and Sport, University of Sa˜o Paulo, Av. Professor Mello Moraes, 65-Butanta˜,Sa˜o Paulo, SP, fers mineralocorticoid receptors selectivity to aldosterone 05508-900, Brazil; E-mail: [email protected]. target tissue, have also been detected in the heart (12). The Submitted for publication October 2010. increase in 11A-HSD2 seems to have deleterious effects on Accepted for publication February 2011. the heart, suggesting that the aldosterone has an important 0195-9131/11/4310-1836/0 role in the cardiovascular system (24).

MEDICINE & SCIENCE IN SPORTS & EXERCISEÒ The production of aldosterone in the myocardium may Copyright Ó 2011 by the American College of Sports Medicine stimulate the extracellular matrix due to the increase in car- DOI: 10.1249/MSS.0b013e318217e8b6 diac fibrosis and the remodeling (26), leading to increased

1836

Copyright © 2011 by the American College of Sports Medicine. Unauthorized reproduction of this article is prohibited. myocardial stiffness and dysfunction, regardless of hemo- peutic dosage (23). All the treatments began on the same day dynamic factors (5,26). These effects may be mediated by as the exercise training and continued thereafter. inflammatory factors as TGFA and osteopontin that have a Food and water were provided ad libitum. Room tem- functional role in fibrosis and cardiac hypertrophy (31,28). perature was kept at 23-C T 1-C. A 12:12-h light–dark cycle On the basis of our previous study, the cardiac renin– was maintained throughout the experiment. The rats were angiotensin system might be importantly involved in ND’s identified and weighed weekly. effects on cardiac hypertrophy and fibrosis when associated with physical training (27). However, the aldosterone effects Training Protocol are unknown. Therefore, our hypothesis was that the cardiac The swimming training was performed as described pre- aldosterone might be involved in deleterious effects induced viously (14). The swimming training was performed during by ND treatment alone or associated with physical training. j the dark cycle of the rat and consisted of 5 dIwk 1 of For this purpose, initially, we evaluated the effects of ND swimming sessions of 60 min in duration for 10 wk in a treatment alone or associated with physical training on ac- swimming system with water at 30-C–32-C. Exercise du- tivation of the cardiac aldosterone synthesis, inflammatory ration and workload were increased gradually until the rats markers, and left ventricular geometry and function in vivo, were able to swim for 60 min wearing caudal dumbbells by M-mode echocardiography in rats. In the next step, we weighing 5% of their body weight. Thereafter, duration and evaluated whether the pharmacological block of AT1 or workload were constant. Sedentary groups were placed in SCIENCES BASIC mineralocorticoid receptors prevent the cardiac deleterious the swimming apparatus for 10 min, twice a week with no effects induced by ND and ND associated with physical workload for the control of their being in the water. This training. protocol is defined as a low-intensity long training period, effective for the promotion of cardiovascular adaptations and increase in muscle oxidative capacity (14). METHODS Experimental Groups Measurements and Procedures Male Wistar rats (8–12 wk old, weighing 180–250 g; Hemodynamic measurements. BP. It was deter- n = 112) were used. All protocols were in accordance with mined noninvasively using a computerized tail–cuff system. the policy statement of the American College of Sports Rats were acclimatized to the apparatus during daily ses- Medicine with experimental animals and were approved by sions for 6 d, 1 wk before starting the experimental period. the Ethics Committee of the School of Physical Education The BP was determined before beginning the experimen- and Sports of the University of Sa˜o Paulo. The rats were tal protocol and was measured weekly until the end of divided randomly into eight groups, each with 14 rats: the training to identify possible changes on BP that could control (C), nandrolone decanoate (ND), trained (T), trained interfere with the results. For BP recording, a rubber cuff was ND (TND), ND + losartan (ND + L), ND + spironolactone placed on the tail proximally and connected to a sphyg- (ND + S), trained ND + losartan (TND + L), and trained momanometer to gradually inflate and deflate the cuff from ND + spironolactone (TND + S). Each group was subdivided 0 to 250/300 mm Hg. In the most distal portion of the tail, a into two groups: one for biochemical and molecular studies pneumatic transducer was attached to detect signs of passage and the other for hemodynamic and histological studies. of the pulse wave of BP in the artery and recorded on the The AT1 receptor antagonist, losartan (Cozaar Ò; Merck system AT/CODAS (DataQ Instruments, Inc., Akron, OH) Sharp, Whitehouse Station, NJ) and the mineralocorticoid with sampling frequency of 1000 Hz. The BP was recorded at receptors antagonist, spironolactone (AldactoneÒ; Pfizer the time when the pressure on the tail became slightly less S.R.L., New York, NY), were administered in the animals’ than the value of intra-arterial pressure, allowing the detection water at doses of 20 and 10 mgIkgj1Idj1, respectively. Be- of the pulse pressure. For each animal, five measures of BP cause spironolactone is insoluble in water, it was first dis- were taken, and the first and last steps were discarded to solved in ethanol at 25 mgImLj1 and added to drinking calculate the arithmetic mean of the remaining values. water. The other groups received a vehicle (1% ethanol in Echocardiography. It was assessed in accordance with drinking water) as described previously (16). The doses are the recommendations of the American Society of Echocar- described in the literature as sufficient to block the actions of diography (29). Transthoracic echocardiography was per- angiotensin II and aldosterone, respectively, without interfer- formed after the experimental period using Sequoia 512 ing with the blood pressure (BP) of normotensive rats equipment (ACUSON Corporation, Mountain View, CA) with (5,11,27). The rats were treated with ND (Decadurabolin; a 10- to 14-MHz multifrequency linear transducer placed on Organon, Roseland, NJ) administered subcutaneously twice a the animals shaved chest (lateral recumbence). Rats were week, in a dose of 5 mgIkgj1 per injection. This is a supra- anesthetized with a mixture of xylazine (10 mgIkgj1)and physiologic dose and comparable to that frequently used by ketamine (90 mgIkgj1). All measurements were performed athletes in doping processes (700 mgIwkj1 or approximately by the same observer based on the average of three consecu- 10 mgIkgj1Iwkj1). This dose of ND is 100 times the thera- tive cardiac cycles. Wall thickness and LV dimensions were

DELETERIOUS HEART EFFECTS BY NANDROLONE DECANOATE Medicine & Science in Sports & Exercised 1837

Copyright © 2011 by the American College of Sports Medicine. Unauthorized reproduction of this article is prohibited. obtained from a short-axis view at the level of the papillary Molecular and Biochemical Analysis muscles. Two-dimensionally guided pulse Doppler recordings Angiotensin-converting enzyme I activity. LV– of LV transmitral flow were obtained from the apical four- Angiotensin-converting enzyme I (ACE) activity in rat tissue chamber view. The systolic function was determined by short- extracts were determined using Abz-FRK(Dnp)P-OH deriva- eningfraction(SFj ((LVd j LVs)/(LVdÂ100), where LVd tives as substrates by continuously measuring the fluorescence is LV end-diastolic diameter and LVs is the LV end-systolic according to Alves et al. (1). Tissue samples were quickly diameter). The ejection fraction (EF) was calculated accord- harvested, homogenized in Tris–HCl buffer, pH 7.0, con- ing to the Teichholz formula (V =[7.0/2.4+d] D3, where taining 50 mM NaCl, and centrifuged at 1000g for 10 min. V =volumeandD = the echocardiographically measured The assays were performed at 37-Cin0.1MTris–HClbuffer, internal dimension) (34). The diastolic function was deter- pH 7.0, containing 50 mM NaCl and 10 KMZnCl.The mined at peak velocity of E wave, peak velocity of A wave, 2 hydrolysis rate of the intramolecularly quenched fluorogenic E/A ratio, and isovolumetric relaxation time (IVRT, was substrate Abz-YRK-(Dnp)p (10 mM) incubated with aliquots taken as the time from aortic valve closure to the onset of of tissue homogenate for 30 min at 37-C was assessed to mitral flow). obtain ACE enzymatic activity. Florescence increments along Tissue samples. At the end of the experimental period, the time were read at 420-nm emission/320-nm excitation. animals were killed by decapitation. The heart was removed Cardiac ACE activity was expressed as arbitrary fluorescence from the thoracic cavity and dissected to separate the LV. units (UF) per milligram of protein. The protein content was The LV of one group was weighed and stored at j80-C for determined by the Bradford method (4). biochemical and molecular analysis, and the LV of the other Cardiac protein expression. Quantification of AT1 group, for histological analysis. receptor was performed by Western blot analysis. The fro- Morphological and morphometric analysis. Cardiac zen ventricles were thawed and minced into small pieces and hypertrophy was determined by ratio of LV weight to animal homogenized in cell lysis buffer containing 100 mM Tris– body weight and cardiomyocytes diameter. HCl, 50 mM NaCl, 10 mM EDTA, 1% Triton X-100, and a Ratio of LV weight to animal body weight. LV solution containing a mixture of protease inhibitors (potas-

BASIC SCIENCES hypertrophy was calculated by LV weight (LVW, mg) normalized by BW (g) of the animals (LVW/BW, mgIgj1). sium EDTA (25 mmol), o-phenanthroline (0.44 mmol), Cardiomyocytes diameter. For morphometric analy- pepstatin A (0.12 mmol), and 4-(chloromercuribenzoic acid) ses, the hearts were stopped at diastole by perfusing with (1 mmol)) to prevent the in vitro production and degrada- 14 mM KCl. After that, the LV was fixed at 6% formalde- tion of angiotensin peptides. Insoluble heart tissues were - hyde and embedded in paraffin, cut into 5-Km sections at removed by centrifugation at 3000g at 4 C and 10 min. the level of the papillary muscle, and subsequently stained Samples were loaded and subjected to SDS–PAGE at 10% with hematoxylin and eosin for the visualization of cellu- of polyacrylamide gels. After electrophoresis, proteins were lar structures. Two randomly selected sections from each electrotransferred to the nitrocellulose membrane (Amersham animal were visualized by light microscopy using an oil Biosciences, Piscataway, NJ). Equal loading of samples K immersion objective with a calibrated magnification (Â400). (60 g) and even transfer efficiency were monitored with Cardiomyocytes with visible nuclei and intact cellular the use of 0.5% of Ponceau S staining of the blot membrane. membranes were chosen for diameter determination. The The blot membrane was then incubated in a blocking buffer width of individually isolated cardiomyocytes displayed on (5% of nonfat dry milk, 10 mM Tris–HCl, pH 7.6, 150 mM a viewing screen was manually traced across the middle of NaCl, and 0.1% of Tween 20) for 2 h at room temperature the nuclei, with a digitizing pad, and determined by a com- and then probed with a polyclonal antibody directed against puter-assisted image analysis system (Quantimet 520; AT1 (1:1000; Santa Cruz Biotechnology, Santa Cruz, CA) Cambridge Instruments, Woburn, MA). For each animal, at room temperature. The binding of the primary antibody È20 visual fields were analyzed. Results were expressed as was detected with the use of peroxidase-conjugated secondary micrometers. antibodies (1:2000), and improved chemiluminescence re- Myocardial interstitial collagen volumetric frac- agents (Amersham Biosciences)wereusedtovisualizetheau- tion. This was determined using direct and polarized light of toradiogram that was later exposed to a photographic film. The the Picrosirius red prepared tissues, as reported previously film was developed, and the bands were analyzed using Scion (7). In short, 20 fields were selected from sections placed in a Image software (Scion based on National Institutes of Health projection microscope (Â200), and interstitial collagen was Image). >-Tubulin expression levels were used to normalize determined by a computer-assisted image analysis system the results. Results were expressed as arbitrary units (AU). (Quantimet 520; Cambridge Instruments). Collagen volu- Cardiac gene expression. The gene expression of metric fraction (CVF) was calculated as the sum of all con- collagen type I (sense GAGAGCATGACCGATGGA and nective tissue areas divided by the sum of all muscle areas in antisense GAGGTTGCCAGTCTGTTGG), collagen type all fields. Perivascular and patch cardiac (reparative fibrosis) III (sense AAGGTCCACGAGGTGACAA and antisense were specifically excluded from this determination. Results AGGGCCTGGACTACCAACT), mineralocorticoid recep- were expressed as micrometers per area. tors (MR) (sense GCTTTGATGGTAGCTGCG and antisense

1838 Official Journal of the American College of Sports Medicine http://www.acsm-msse.org

Copyright © 2011 by the American College of Sports Medicine. Unauthorized reproduction of this article is prohibited. TGAGCACCAATCCGGTAG), transforming growth factor molecular weight marker used was the DNA ladder of 100 bp A (TGFA) (sense GGCGGTGCTCGCTTTGTA and anti- (Gibco-BRL). sense GCGGGTGACTTCTTTGGC), osteopontin (sense GTC The bands were visualized by the effect of ultraviolet CTTCACTGCCAGCACAC and antisense GAACTCGCC radiation in a darkroom equipped with a transluminator and TGACTGTCGAT), CYP11B2 (aldosterone synthase gene) images acquired by the program Chemilmager 5500 (Alpha (sense GGATGTCCAGCAAAGTCTC and antisense ATTAG Innotech, San Leandro, CA). The intensity of the bands TGCTGCCACAATGC) (36), and 11A-hydroxysteroid dehy- obtained was analyzed using the analysis program Scion drogenase 2 (11A-HSD2) (sense CCGGTTGTGACACTGG Image densitometry, provided free by National Institutes of TTTTG and antisense GGGGTATGGCATGTCTCCTG) (13) Health online. were determined by reverse transcription–polymerase chain reaction (PCR). Statistical Analysis Because of the very high similarity of sequence between CYP11B2 (aldosterone synthase) and CYP11B1, we chose Results are represented as means T SD. Statistical analysis to use a primer previously described in the literature as being was performed using the software BASIC STATISTIC, by specific for the aldosterone synthase (CYP11B2) (36). The two-way ANOVA. Statistical analysis was performed in glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (sense three stages. Our first aim was to confirm the cardiac hyper- ATGGGTGTGAACCACGAGAA and antisense CGAGTA trophy and fibrosis induced by ND and to observe the AI SCIENCES BASIC CTGGTGTCAGGTA) gene level was used to normalize the cardiac aldosterone synthesis in these groups. Thereafter, we results. Results were expressed as AU. compared the control groups (C and T) with the ND-treated Frozen tissue samples (150–200 mg) were homogenized groups (ND and TND). In a second step, we tested the in a guanidinium thiocyanate solution (4 M), and RNA was hypothesis that the AT1 block has an important role on the isolated according to the method described previously (6). cardiac effects induced by ND and cardiac aldosterone. We Samples were quantified spectrophotometrically at 260 nm compared the groups treated with steroids (ND and TND) and checked for integrity by EtBr-agarose gel electrophoresis. with the groups treated with ND plus losartan (ND + L and RNA were primed with 0.5 KgIKLj1 oligo(dT) (12–18 bp) TND + L). In a third step, we tested the hypothesis that (Invitrogen Life Technologies, Strathclyde, UK) to generate the mineralocorticoid block might be involved in cardiac the first strand of DNA. Reverse transcription was performed effects induced by ND and cardiac aldosterone. Thereafter, we using SuperScript II Reverse Transcriptase (Invitrogen Life compared animals treated with ND (ND and TND) in rela- Technologies). tion to groups treated with ND and spironolactone (ND + S Amplification of cDNA segments was carried out under and TND + S). The analysis of BP before and after the the following conditions: 5–7 KL of the reaction product of experimental treatment was performed using ANOVA for reverse transcription (cDNA), 2.5 KLof10Â reaction buffer repeated measures. If the F test was significant, we applied a post hoc Duncan to multiple comparisons. Correlation anal- (20 mM Tris–HCl (pH 8.4), 50 mM KCl), 0.75 KLofMgCl2 50 mM, 2 KL of the mixture of 2.5 mM dNTP, 0.5 KLof ysis was performed using the Pearson correlation coefficient each primer (12.5 KM), and 0.25 KL of Taq Platinum DNA (r). P G 0.05 was accepted as statistically significant. polymerase (Gibco) (2.5 U of enzyme) and sterile H2Oto complete 25 KL. The PCR were performed in the MJ Re- RESULTS search thermal cycler MiniCycler, following the conditions specified for each pair of primers. To analyze the formation of Hemodynamic measurements. The data referring to PCR products, aliquots of 10 KL of the reaction products BP and cardiac function are summarized in Table 1. We can were subjected to electrophoresis on agarose gel at 3%. The observe that the ND did not increase the BP compared with

TABLE 1. Blood pressure and ventricular function. BP (mm Hg) Systolic Function Diastolic Function Groups Before After LVEF (%) LVFS (%) PEWV (mIsj1) PAWV (mIsj1) E/A Ratio IVRT (mIsj1) C 120.8 T 9.2 124.8 T 5.7 81.05 T 4.38 44.30 T 3.44 0.61 T 0.07 0.43 T 0.08 1.53 T 0.08 25.2 T 1.7 ND 126.5 T 11.2 126.8 T 8.1 79.03 T 5.17 42.39 T 4.09 0.56 T 0.06 0.40 T 0.05 1.34 T 0.12 24.2 T 2.5 ND + L 120.4 T 4.4 124.5 T 4.3 80.92 T 5.01 44.21 T 4.42 0.58 T 0.05 0.38 T 0.06 1.40 T 0.19 25.7 T 0.9 ND + S 127.9 T 7.7 125.5 T 1.9 79.71 T 5.33 41.67 T 5.67 0.63 T 0.05 0.48 T 0.05 1.38 T 0.23 27.5 T 1.9 T 120.0 T 10.8 126.8 T 6.7 78.55 T 2.95 40.23 T 2.74 0.62 T 0.06 0.40 T 0.09 1.68 T 0.23 30.6 T 2.8 TND 128.0 T 8.03 124.4 T 4.3 79.02 T 3.76 40.77 T 3.78 0.42 T 0.10a 0.38 T 0.04 1.07 T 0.25a 23.5 T 2.3 TND + L 125.5 T 8.2 126.4 T 2.3 82.12 T 2.74 42.08 T 2.76 0.59 T 0.07b 0.40 T 0.09 1.39 T 0.12b 28.3 T 1.15 TND + S 125.6 T 3.9 128.1 T 9.6 78.66 T 3.03 40.42 T 3.71 0.57 T 0.07b 0.42 T 0.05 1.46 T 0.14b 26.7 T 1 Values are mean T SD. a P G 0.05, significant difference versus C. b P G 0.05, significant difference versus TND. C, control; IVRT, isovolumetric relaxation time; LVEF, left ventricular ejection fraction; LVFS, left ventricular fraction shortening; ND + L, nandrolone decanoate + losartan; ND + S, nandrolone decanoate + spironolactone; ND, nandrolone decanoate; PAWV, peak velocity wave A; PEWV, peak velocity wave E; T, trained; TND + L, trained nandrolone decanoate + losartan; TND + S, trained nandrolone decanoate + spironolactone; TND, trained nandrolone decanoate.

DELETERIOUS HEART EFFECTS BY NANDROLONE DECANOATE Medicine & Science in Sports & Exercised 1839

Copyright © 2011 by the American College of Sports Medicine. Unauthorized reproduction of this article is prohibited. control groups. We can also observe that none of the treatment used, losartan or spironolactone, altered the BP compared with the ND groups. Regarding ventricular function, we observed that the ND treatment did not modify the ventricular function in the sedentary group. However, the peak velocity of E wave and E/A ratio was lower when ND treatment was combined with swimming training, suggesting diastolic dysfunction in this group. When the TND group was treated with losartan (TND + L), the reduction in the peak velocity of E wave and E/A ratio was prevented. Similar results were also observed when the TND group was treated with spironolactone (TND + S). These results showed that both treatments were efficient in reverting the ND plus swimming training effects on diastolic function. Cardiac effects of ND. Our first objective was to confirm ND’s effects on cardiac tissue and to analyze if cardiac aldosterone may be involved in this process. Cardiac hypertrophy was observed in the ND, T, and TND groups when compared with C (2.3 T 0.10, 2.2 T 0.10, and 2.4 T 0.12 mgIgj1, respectively, vs 2.07 T 0.09 mgIgj1, P G 0.05) (Fig. 1A). Cardiac hypertrophy was exacerbated in TND compared with the ND and T groups (P G 0.05). The cardiomyocytes diameter was also significantly increased in T T

BASIC SCIENCES the ND, T, and TND groups (10.86 0.20, 11.39 0.46, and 11.55 T 0.33 Km, respectively, P G 0.05) compared with the C group (10.28 T 0.14 Km) (Fig. 1B). Also, they were increased in T and TND groups compared with the ND group (P G 0.05). CVF was significantly increased in ND and TND when compared with the C and T groups (2.32 T 0.28 and 2.0 T 0.11 vs 1.17 T 0.17 and 1.33 T 0.2 Km per area, respectively, P G 0.001) (Fig. 1C). Figure 1D shows the relative gene expression of collagen. The gene expression of collagen type III was significantly increased in the ND and TND groups when compared with the C and T groups (1.32 T 0.32 FIGURE 1—Nandrolone decanoate and nandrolone decanoate associ- and 1.26 T 0.05 vs 0.73 T 0.17 and 0.88 T 0.12 AU, ate to swimming training on cardiac hypertrophy (A), cardiomyocytes respectively, P G 0.05). The relative gene expression of diameter (B), CVF (C), and cardiac collagen expression (cardiac type I (white bar) and type III (black bar)) (D). Control (C, n = 7), nandrolone collagen type I was not significantly different among the decanoate (ND, n = 7), trained (T, n = 7), trained ND (TND, n = 7). The four groups. CH was evaluated by the ratio of left ventricular weight (LVW) to To evaluate ND’s effects on renin-angiotensin system and animal body weight (BW) (LVW/BW). Representative blots of collagen type I and III expression are above D. Data are presented as mean T cardiac aldosterone syntheses, we analyzed the LV-ACE SD. †P G 0.05 versus C. #P G 0.05 versus T. ‡P G 0.05 versus ND. activity, the AT1 receptor protein expression, and the mineralocorticoid receptors, aldosterone synthase (CYP11B2) and 11A-HSD2 gene expressions. increased in the ND (1.23 T 0.2 and 1.24 T 0.22) and TND The LV-ACE activity was increased in the ND and TND groups (1.47 T 0.27 and 1.49 T 0.28) when compared with groups compared with the C and T groups (2083 T 161 and the C (0.85 T 0.07 and 0.88 T 0.08) and T groups (0.87 T 0.15 1879 T 75 vs 1445 T 115 and 1377 T 44 UF per milligram, and 0.56 T 0.13), respectively (P G 0.05; Fig. 2C). Also, respectively, P G 0.001) (Fig. 2A). The AT1 receptor protein the relative gene expression of 11A-HSD2 was signifi- expression was also increased in the ND and TND groups cantly decreased in the T group compared with the C group compared with the C and T groups (1.02 T 0.2 and 1.15 T (P G 0.05). The CYP11B2 expression was positively cor- 0.16 vs 0.66 T 0.12 and 0.76 T 0.06, respectively, P G 0.05) related to the increase in collagen type III expression (Fig. 2B). (r2 = 0.7046, P G 0.05) (Fig. 2D). The mineralocorticoid receptors were not increased in the Figure 3A shows the TGFA and osteopontin gene ex- ND group (data not shown). However, the relative gene pression. The expression of these genes was significantly expressions of CYP11B2 and 11A-HSD2 were significantly increased in the ND (1089.21 T 169 and 1381.60 T 147,

1840 Official Journal of the American College of Sports Medicine http://www.acsm-msse.org

FIGURE 2—ND effects and ND associate to swimming training on LV-ACE activity (A), AT1 receptor expression (B), and aldosterone synthase (CYP11B2, white bar) and 11A hydroxysteroid dehydrogenase (11A-HSD2, black bar) gene expression (C). Control (C, n = 7), nandrolone decanoate (ND, n = 7), trained (T, n = 7), and trained ND (TND, n = 7). Representative blots of CYP11B2 and 11A-HSD2 are above C. Targeted bands were normalized to cardiac GAPDH. A representative blot of AT1 expression is above B. Targeted bands were normalized to >-tubulin. Data are presented as mean T SD. †P G 0.05 versus C. #P G 0.05 versus T. Correlation between CYP11B2 and collagen type III mRNA expression (r2 = 0.70, P G 0.05; D). respectively) and TND groups (1244.02 T 113 and 1674.34 T when compared with the ND and TND groups (0.90 T 0.1 326, respectively) when compared with the C (839.27 T 122 and 0.96 T 0.14 vs 1.32 T 0.32 and 1.26 T 0.05 AU, re- and 777.68 T 32, respectively) and T groups (858.29 T 101 spectively, P G 0.05). Moreover, the relative gene expression and 1067.103 T 247, respectively) (P G 0.05). Moreover, of collagen type I was decreased by losartan (Fig. 2E) the osteopontin gene expression was exacerbated in the TND treatment in the TND + L group (0.86 T 0.12 AU) compared group compared with the ND group (P G 0.01). CYP11B2 with the TND group (1.12 T 0.12 AU, P G 0.05). expression was positively correlated with the increase of The LV-ACE activity increase was prevented by the losar- TGFA (r2 =0.8912,P G 0.05) (Fig. 3B) and osteopontin tan treatment in both groups (ND + L = 1682.3 T 140 UF (r2 = 0.8596, P G 0.05) (Fig. 3C). In addition, we observed a per milligram and TND + L = 1495.4 T 187 UF per milli- positive correlation between TGFA and collagen type III gram vs ND = 2083 T 161 UF per milligram and TND = expression (r2 = 0.7927, P G 0.05) (Fig. 3D) and between 1879 T 75 UF per milligram, P G 0.05) (Fig. 4E). On the osteopontin and collagen type III expression (r2 =0.6364, other hand, the AT1 receptor increase was not prevented P G 0.05) (Fig. 3E). by the losartan treatment (ND + L = 0.95 T 0.24 AU and Cardiac effects of ND and pharmacological block TND + L = 1.02 T 0.07 AU vs ND = 1.02 T 0.2 AU and of AT1 receptor. Cardiac hypertrophy was inhibited by TND = 1.15 T 0.16 AU; data not shown). losartan treatment in ND + L and TND + L compared with The relative gene expression of the CYP11B2 and 11A- ND and TND groups (2.04 T 0.16 and 2.13 T 0.12 vs 2.3 T HSD2 increases was prevented by the losartan treatment 0.10 and 2.4 T 0.12, P G 0.05, respectively) (Fig. 4A). Car- (Fig. 4F) in the ND + L (0.83 T 0.17 and 0.97 T 0.25) and diomyocytes diameter was also prevented by the losartan TND + L groups (0.99 T 0.14 and 0.90 T 0.19) when com- (Fig. 4B) treatment in the ND + L and TND + L groups pared with the TND group (1.47 T 0.27 and 1.49 T 0.28, (10.62 T 0.32 and 11 T 0.11 Km) when compared with the respectively, P G 0.05) but not when compared with the TND group (11.55 T 0.33 Km). ND group. CVF increase was prevented by the losartan treatment The relative gene expression of the TGFA and osteopon- (Fig. 4C) in the ND + L and TND + L groups (1.49 T 0.11 tin (Fig. 4G) increases was prevented by the losartan treat- and 1.2 T 0.17 Km per area) compared with ND and TND ment in the ND + L (981.12 T 148 and 899.31 T 131) and groups (2.32 T 0.28 and 2.0 T 0.11 Km per area, P G 0.05). TND + L groups (907.92 T 83 and 996.14 T 107), when Similar results were observed in relation to relative gene compared with the ND (1089.21 T 169 and 1381.60 T 147 expression of collagen type III. The increase in the ex- respectively, P G 0.05) and TND groups (1244.02 T 113 and pression of collagen type III was prevented by the losartan 1674.34 T 326, P G 0.05), except when compared with the (Fig. 4D) treatment in the ND + L and TND + L groups ND group to the TGFA gene.

DELETERIOUS HEART EFFECTS BY NANDROLONE DECANOATE Medicine & Science in Sports & Exercised 1841

FIGURE 3—Nandrolone decanoate effects and nandrolone decanoate associate to swimming training on inflammatory factors TGFA (white bar) and osteopontin (black bar) gene expression (A). Control (C, n = 7), nandrolone decanoate (ND, n = 7), trained (T, n = 7), and trained ND (TND, n = 7). Representative blots of TGFA and osteopontin are above A. Targeted bands were normalized to cardiac GAPDH. Data are presented as mean T SD. †P G 0.05 versus C. #P G 0.05 versus T. ‡P G 0.05 versus ND. Correlation between CYP11B2 and TGFA mRNA expression (r2 = 0.89, P G 0.05; B) and osteopontin mRNA expression (r2 = 0.86, P G 0.05; C). Correlation between TGFA (r2 = 0.79, P G 0.05; D) and osteopontin (r2 = 0.64, P G 0.05; E) and collagen type III mRNA expression mRNA expression.

Cardiac effects of ND and pharmacological block induced by ND was prevented by the spironolactone treat- of mineralocorticoid receptor. Unlike the results ob- ment in the ND + S and TND + S groups (1.01 T 0.07 and served with losartan treatment, cardiac hypertrophy was not 0.85 T 0.08 AU) compared with the ND and TND groups prevented by the spironolactone treatment in the ND + S and (1.32 T 0.32 and 1.26 T 0.05 AU, P G 0.05) (Fig. 5D). TND+Sgroups(2.17+0.09and2.3+0.14mgIgj1) compared Moreover, the relative gene expression of collagen type I with the ND group (2.3 T 0.10 and 2.4 T 0.12) (Fig. 5A). was decreased by the spironolactone treatment in the ND + S Similar cardiac hypertrophy and cardiomyocytes diameter in- and TND + S groups (0.87 T 0.09 and 0.88 T 0.05 AU) when creases were also not prevented by the spironolactone treatment compared with the ND and TND groups (1.02 T 0.06 and in the ND + S and the TND + S groups (10.76 T 0.5 and 11.22 T 1.12 T 0.02 AU, P G 0.05) (Fig. 2F). 0.40 Km) when compared with the ND and TND groups The LV-ACE activity increase was prevented by the spi- (10.86 T 0.20 and 11.55 T 0.33 Km, respectively) (Fig. 5B). ronolactone treatment (1543 T 145 and 1578 T 100 UF per On the other hand, the CVF increase was prevented by the milligram) when compared with the ND and TND groups spironolactone treatment in the ND + S and TND + S groups (2083 T 161 and 1879 T 75 UF per milligram, P G 0.05) (1.46 T 0.53 and 1.37 T 0.05 Km per area) when compared (Fig. 5E). However, the AT1 receptor increase was not pre- with the ND and TND groups (2.32 T 0.28 and 2.0 T 0.11 Km vented by the spironolactone treatment compared with the ND per area, P G 0.05) (Fig. 5C). Similar results were observed and TND groups (1.10 T 0.11 and 1.11 T 0.12 vs 1.02 T 0.2 in gene expression of collagen type III where the increase and 1.15 T 0.16 AU; data not shown).

1842 Official Journal of the American College of Sports Medicine http://www.acsm-msse.org

FIGURE 4—Effects of pharmacological block of AT1 receptor and nandrolone decanoate on cardiac hypertrophy (A), cardiomyocytes diameter (B), CVF (C), cardiac collagen expression (cardiac type I (white bar) and type III (black bar)) (D), LV-ACE activity (E), aldosterone synthase (CYP11B2 (white bar)) and 11A-hydroxysteroid dehydrogenase (11A-HSD2 (black bar)) gene expression (F) and inflammatory factors TGFA (white bar) and osteopontin (black bar) gene expression. Nandrolone decanoate (ND, n = 7), ND + losartan (ND + L, n = 7), trained ND (TND, n = 7) and trained ND + losartan (TND + L, n = 7). Representative blots are above D, F, and G. Targeted bands were normalized to cardiac GAPDH. Data are presented as mean T SD. ‡P G 0.05 versus ND. &P G 0.05 versus TND.

The relative gene expression of CYP11B2 and 11A-HSD2 169 and 1381.60 T 147, P G 0.05) and TND groups (1244.02 T increases was prevented by the spironolactone treatment 113 and 1674.34 T 326, P G 0.05). (Fig. 5F) in the ND + S (0.82 T 011 and 0.76 T 0.16) and TND + S groups (0.99 T 017 and 0.86 T 0.25) when compared with the TND group (1.47 T 0.27 and 1.49 T 0.28, P G 0.05) DISCUSSION and also when compared with the ND group (1.23 T 0.2 and 1.24 T 0.22, P G 0.05), except the TND + S group. The main findings of this study show for the first time that The relative gene expression of TGFA and osteopontin the cardiac aldosterone and inflammatory factor, TGFA and (Fig. 5G) increase was prevented by the spironolactone treat- osteopontin, participate in cardiac fibroses induced by ND ment in the ND + S (833.37 T 187 and 914 T 07 T 136, with or without the association to physical training. These respectively) and TND + S groups (833.75 T 80 and 935.28 T effects were reinforced by the fact that both AT1 receptor 157, respectively) when compared with the ND (1089.21 T and mineralocorticoid receptors antagonist prevented the

DELETERIOUS HEART EFFECTS BY NANDROLONE DECANOATE Medicine & Science in Sports & Exercised 1843

FIGURE 5—Effects of pharmacological block of mineralocorticoid receptor and ND on cardiac hypertrophy (A), cardiomyocytes diameter (B), CVF (C), cardiac collagen expression (cardiac type I (white bar) and type III (black bar)) (D), LV-ACE activity (E), aldosterone synthase (CYP11B2 (white bar)) and 11A-hydroxysteroid dehydrogenase (11A-HSD2 (black bar)) gene expression (F) and inflammatory factors TGFA (white bar) and osteopontin (black bar) gene expression. Nandrolone decanoate (ND, n = 7), ND + spironolactone (ND + S, n = 7), trained ND (TND, n = 7), and trained ND + spironolactone (TND + S, n = 7). Representative blots are above D, F, and G. Targeted bands were normalized to cardiac GAPDH. Data are presented as mean T SD. ‡P G 0.05 versus ND. &P G 0.05 versus TND.

increase of cardiac collagen and diastolic dysfunction ob- effect, where the anabolic steroid or ND treatment did not served in ND and ND trained groups. alter the BP (9,27), confirming our results. BP and cardiac effects of ND. Our results show that As was observed in the ND-treated groups, the losartan or ND treatment did not alter the BP; however, the effects of spironolactone treatment did not alter the BP because the anabolic steroids on BP are still controversial in the litera- doses used were described in the literature as sufficient to ture. Some studies showed an increase in BP in anabolic block the actions of angiotensin II and aldosterone without steroid users (21). The mechanism involved can be related interfering with the BP of normotensive rats (5,11); how- to the anabolic steroid action increasing the sympathetic ever, we have shown that ND effects on cardiac hypertrophy nervous system activity, endothelial dysfunction, and baro- and function were not associated with the systemic renin– reflex control (2). Other studies did not observe the same angiotensin system but with its local effects.

1844 Official Journal of the American College of Sports Medicine http://www.acsm-msse.org

Copyright © 2011 by the American College of Sports Medicine. Unauthorized reproduction of this article is prohibited. Cardiac hypertrophy (CH) observed in the T group is a correlation between the expression of CYP11B2 and the typical response of aerobic training by swimming and re- expression of collagen type III in animals treated with ND. flects physiological CH where an increase in cardiac mass The effects of aldosterone are modulated by binding to the without functional impairment occurs (14,20,27) as we mineralocorticoid receptors, but aldosterone actions depend showed by echocardiography. The swimming training pro- on various factors, including the glucocorticoids concentra- tocol induced CH and the increase in cardiomyocyte diam- tions, which act as mineralocorticoid receptors antagonist in eter but not cardiac collagen (CVF or collagen type I and III the heart by inhibiting the aldosterone actions (24). 11A-HSD2 expression). On the other hand, in the TND group, the dia- enzyme inactive metabolites binding to mineralocorticoid re- stolic dysfunction was observed, suggesting pathological ceptors contributing to increased aldosterone action on these CH. Similar results were observed in other studies where a receptors (18). 11A-HSD2 enzyme expression was increased decrease in peak velocity during early diastolic filling in with ND (40% and 121.5%) and TND (68.6% and 167%) anabolic steroid users was observed, by echocardiography treatments compared with the C and T groups, respectively. (9). Diastolic dysfunction was observed in weight lifters These results suggest that, in addition to an increase in aldo- who used anabolic steroids compared with those who did sterone syntheses, the ND treatment also altered the mineral- not (21). The results observed in this study corroborate ocorticoid receptor selectivity, providing a major action of this finding in anabolic steroids users. aldosterone. The diastolic dysfunction has been strongly associated to Our results also suggest that aerobic training is associated AI SCIENCES BASIC increased interstitial collagen. Fibrillar collagens, types I with lower aldosterone actions because 11A-HSD2 enzyme and III, are the major structural proteins of the myocardial expression was lower in the T group compared with the C collagen matrix (9) and are responsible for distributing the group. However, more studies are needed to understand the forces working on the heart, exerting an important influence effects of physical training on 11A-HSD2 enzyme expres- on ventricular compliance (38). We observed in a previous sion and aldosterone levels. study that the exposure to supraphysiological ND doses The aldosterone actions on cardiac fibrosis were sug- might lead to tissue necrosis and diastolic dysfunction, gested to be related to inflammatory factors TGFA and resulting in structural changes similar to those observed in osteopontin where, in characteristic features of hyperaldo- the early stages of heart failure (27). These data lead us to steronism, increased expressions of inflammatory factors suggest that the diastolic dysfunction observed in TND in the heart plus interstitial and perivascular fibrosis are group can be induced by the increases in CVF and expres- observed (28). An interesting result of the present study was sion of collagen type III. the higher expression of inflammatory factors TGFA and The actions of angiotensin II on cardiac hypertrophy and osteopontin and their positive correlation with the increase fibrosis are well described in the literature (27,38); however, of CYP11B2 expression observed with ND treatment. More- some actions attributed to angiotensin II may be directly over, the increased inflammatory factors’ expression was related to the synthesis and release of aldosterone (26,39). positively correlated with collagen type III expression in- The direct role of aldosterone as a mediator in cardiac hyper- creased in the ND-treated groups. These results suggest that trophy and fibrosis has been observed, causing deleterious the aldosterone effects on cardiac collagen induced by ND can effects on the cardiovascular system. The aldosterone has be related to high TGFA and osteopontin expression. been associated with inflammatory responses, inducing tissue The role of osteopontin on cardiac fibrosis has been con- damage, collagen synthesis, and cardiac remodeling (26), firmed in mice with osteopontin deficiency, where the aldo- regardless of hemodynamic changes, suggesting local aldosterone actions on cardiac fibrosis were inhibited (31). The sterone effects (5). aldosterone actions on myocardial fibrosis and cardiac On the basis of these facts, we investigated the hypothesis remodeling mediated by osteopontin have also been shown that cardiac aldosterone may be associated with deleterious in studies with angiotensin II and aldosterone blockers that effects induced by treatment with ND and its association to were effective in inhibiting the osteopontin expression in the swimming training. Thus, we investigated the mineralocor- infarcted area of the myocardium, reducing collagen and ticoid receptors CYP11B2 and the 11A-HSD2 expression on preventing cardiac hypertrophy (39). The expression of TGFA the heart. The expression of mineralocorticoid receptors was has been increased by the activation of AT1 receptors (3). not modified by ND treatment; however, aldosterone syn- TGFA exerts its actions on cardiomyocytes, leading to tissue thase gene (CYP11B2) and 11A-HSD2 enzyme expression necrosis, and on fibroblasts, increasing the expression of was increased by ND treatment. These results suggest that proteins related to fibrosis (3). TGFA has also been shown to ND treatment may lead to an increase in cardiac aldosterone be released by aldosterone, leading to an increase in the ex- synthesis because the increase in CYP11B2 gene expression pression of growth factors and connective tissue (32). These was related to high aldosterone concentrations, as has been observations corroborate the results observed in this study. well demonstrated in the literature (37). Effects of losartan and spironolactone treat- Increased expression of the CYP11B gene is also related ment. The AT1 receptor antagonist treatment (losartan) to increased in cardiac collagen synthesis (37), confirming prevented increasing the CYP11B2 and 11A-HSD2 expres- the results presented in this study that showed a positive sion. The activation of AT1 receptors is involved on the

DELETERIOUS HEART EFFECTS BY NANDROLONE DECANOATE Medicine & Science in Sports & Exercised 1845

Copyright © 2011 by the American College of Sports Medicine. Unauthorized reproduction of this article is prohibited. pathological conditions of cardiac aldosterone synthesis and Losartan and spironolactone prevented the LV-ACE activ- their blockade prevents the increase of aldosterone synthase ity increase in the ND and TND groups. The ACE activity expression (8,39), confirming the results observed in this increase may have contributed to the development of heart study; however, these mechanisms are not fully understood. fibrosis because there are high levels of ACE activity in the Because we observed that the increase in CYP11B2 expres- fibrotic area of the heart (19). In our earlier study, we also sion was directly correlated to the increase in collagen type III showed that the increase in cardiac ACE activity and angio- expression and inflammatory factors, TGFA and osteopontin, tensin II concentrations was correlated with collagen con- we can suggest that the effects observed with Losartan treat- centration (27). The LV-ACE activity may also be related to ment on cardiac collagen may be associated with lower car- the concentration of aldosterone. diac aldosterone action. Besides the increase in angiotensin II, the LV-ACE activ- Considering that cardiac aldosterone can be related to ity may also be related to the concentration of aldosterone. the deleterious effects induced by ND, a mineralocorticoid The relation between ACE and aldosterone has been shown receptor antagonist was administered, spironolactone, to in studies with ACE inhibitors, where ACE inhibitors sup- analyze these effects. press aldosterone production. On the other hand, plasma An important point to be discussed regarding the pharma- aldosterone concentrations may rise over time during long- cologic treatments is the action of spironolactone on androgen term treatment with ACE inhibitors in dogs with congestive receptors. Spironolactone is structurally a steroid and can act heart failure. This phenomenon is called aldosterone escape, as an antiandrogen, decreasing the production and blocking and it showed that the aldosterone might have an important the effect of androgens in the target tissue (25). However, the role on cardiac fibroses even when ACE activity is blocked effects of spironolactone on the blockade of androgen re- or decreased (22). ceptors seem to be dose-dependent and occur when admin- In addition, aldosterone increases angiotensin II binding, istered at high doses (100 mgIdj1) (25). In the present study, upregulates the expression of AT1, increases the ACE activ- the rats were treated with 10 mgIkgj1Idj1 of spironolactone, ity, and potentiates angiotensin II–stimulated intracellular approximately 6 mgIdj1, which is an extremely low dose to signaling and proliferation in peripheral cardiovascular tis-

BASIC SCIENCES induce antiandrogenic effects, however inhibited the cardiac sues (16,17,30,36). Thus, our results suggest that a low actions of aldosterone. Thus, this result leads us to suggest LV-ACE activity can be one of the factors responsible for that the effects observed by spironolactone treatment were not the decrease in cardiac collagen with losartan or spirono- by the androgen receptors blocking. These results are cor- lactone treatment; however, we cannot discard the possibility roborated in a study where spironolactone was administered that the effects of LV-ACE could be related to the aldosterone at the dose of 80 mgIkgj1Idj1 in spontaneously hypertensive action because the increase in aldosterone action increased rats, and it was observed that its effects on cardiac tissue were LV-ACE activity and was responsible for ND’s effects on not related to the blockade of androgen receptors (35). the heart. However, more studies are necessary to understand We showed that spironolactone and losartan treatments these mechanisms. were effective in preventing collagen expression. Spi- Therefore, spironolactone treatment in the TND and ND ronolactone prevented CVF in the ND + S and TND + S groups prevented the CYP11B cardiac and 11A-HSD2 ex- groups compared with their respective controls. Also, it pression increase. Both CYP11B2 and 11A-HSD2 are directly prevented the increase in collagen type I and type III ex- associated to cardiac fibrosis (24). Thus, the lower expression pression in the ND + S and TND + S groups compared with of these genes observed with spironolactone therapy can also the TND group and in collagen type I and III expression in be responsible for the minor cardiac fibrosis found, confirm- the TND + S group compared with the ND group, con- ing the participation of aldosterone on cardiac fibroses in- firming the involvement of mineralocorticoid receptors and duced by ND treatment. aldosterone in the cardiac collagen increase induced by ND. As previously reported, the effects of aldosterone on An interesting result was observed in cardiac hypertrophy cardiac fibrosis can be related to an increase in inflammatory and cardiomyocytes diameter. Unlike the results observed factors TGFA and osteopontin. Both losartan and spiro- with the losartan treatment, the spironolactone treatment nolactone treatments decreased the CYP11B2 expression did not modify the cardiomyocytes diameter and cardiac and, consequently, the expression of inflammatory factors. hypertrophy. These data might be the result of the action of These results may explain the similar effects observed with angiotensin II on cardiomyocytes. The actions of angioten- both treatments, contributing to the beneficial effects observed sin II through AT1 receptors are responsible for activat- in these groups. ing a variety of intracellular signaling pathways, increasing In the present study, we showed similar effects with the expression of genes related to hypertrophy (40). Thus, blockers of AT1 or mineralocorticoids receptors on cardiac blocking AT1 receptors with losartan would be expected to aldosterone synthases, inflammatory factors, and preventing prevent the effects of angiotensin II on cardiac hypertrophy deleterious cardiac effects induced by ND. The effects of and cardiomyocytes diameter. In a previous study, we angiotensin II and aldosterone on cardiac fibrosis were well showed similar results, where losartan prevented theses demonstrated in the literature and can stimulate cardiac effects induced by swimming training (20). effects by distinct pathways (5,16,17,18,30,36). However,

1846 Official Journal of the American College of Sports Medicine http://www.acsm-msse.org

Copyright © 2011 by the American College of Sports Medicine. Unauthorized reproduction of this article is prohibited. the interplay between aldosterone and angiotensin II at have activated the crosstalk mechanisms, and when the angio- the target tissue level is very complex and still poorly tensin II or aldosterone action were blocked, this mechanism understood. was also blocked. However, we did not perform any experi- Recently, a mechanism of crosstalk between the miner- ment to confirm the crosstalk between AT1 and the mineral- alocorticoid receptors and the AT1 receptors has been pro- ocorticoid receptor. More studies are necessary to understand posed, in which when angiotensin II and aldosterone act at the exact mechanism involved in renin–angiotensin aldo- the same time on their respective receptors, there were dif- sterone system regulation and the effects induced by ND ferent effects from those observed when only one of them is treatment. Here, we have shown that ND treatment or its acting (10,17). It was demonstrated that signaling pathways association with swimming training increased the LV-ACE such as ERK1/2, JNK, and NF-JB to be activated need al- activity and CYP11B2 expression, suggesting the increase in dosterone and a functional AT1 receptor, suggesting that the both angiotensin II and aldosterone and promoting cardiac effects of aldosterone in cardiac fibroses depended in part on dysfunction. the activation of an angiotensin II–AT1 receptor–mediated Finally, we believe that this is the first study to show the pathway (10). In addition, it has been shown that angioten- effects of ND on cardiac aldosterone because an increase in sin II induced ventricular damage mediated by a mechanism aldosterone synthase and the 11A-HSD2enzymegeneexpres- dependent on signaling via the mineralocorticoid receptor sions was observed. Our results still suggest that the effects aldosterone (10,30) and that the aldosterone block restores of aldosterone on cardiac tissue are associated to inflamma- AI SCIENCES BASIC or prevents cardiac inflammation and remodeling caused by tory mediators such as TGFA and osteopontin. In conclusion, renin–angiotensin enhancement (30). These results showed ND and its association to swimming training promote cardiac that the aldosterone and angiotensin II could synergistically deleterious effects increasing interstitial collagen by cardiac promote deleterious cardiac effects via the interaction of the aldosterone action. AT1 and mineralocorticoid receptors. These data can explain the results observed in the present The authors thank Coordenaçaõ de Aperfeiç oamento de Pessoal study where both losartan and spironolactone were effective de Nı´vel Superior for the E. C. Carmo fellowship for the present in- in reducing cardiac fibroses induced by ND. The ND treat- vestigation and Dr. M. I. Phillips for critically reading the article. E. M. ment increased the LV-ACE activity and CYP11B2 expres- de Oliveira received scholarships from CNPq (process No. 307591/ 2009-3), Brazil. sion, suggesting the increase in both angiotensin II and The results of this study do not constitute endorsement by the aldosterone. Angiotensin II and aldosterone increase may American College of Sports Medicine.

REFERENCES 1. Alves MF, Araujo MC, Juliano MA, et al. A continuous fluores- 11. Li JS, Sharifi AM, Schiffrin EL. Effect of AT1 angiotensin– cent assay for the determination of plasma and tissue angiotensin receptor blockade on structure and function of small arteries in I–converting enzyme activity. Braz J Med Biol Res. 2005;38(6): SHR. J Cardiovasc Pharmacol. 1997;30:75–83. 861–8. 12. Lombes M, Oblin ME, Gasc JM, Baulieu E, Farman N, Bonvalet 2. Beutel A, Bergamaschi CT, Campos RR. Effects of chronic ana- JP. Immunohistochemical and biochemical evidence for a cardio- bolic steroid treatment on tonic and reflex cardiovascular control in vascular mineralocorticoid receptor. Circ Res. 1992;71:503–10. male rats. J Steroid Biochem Mol Biol. 2005;93(1):43–8. 13. Mazancova´ K, Kopeck] M, Miksı´kI,Pa´cha J. 11A-Hydroxysteroid 3. Booz GW, Baker KM. Molecular signalling mechanisms control- dehydrogenase in the heart of normotensive and hypertensive rats. ling growth and function of cardiac fibroblast. Cardiovasc Res. J Steroid Biochem Mol Biol. 2005;94(1–3):273–7. 1995;30:537–43. 14. Medeiros A, Oliveira EM, Gianolla R, Casarini DE, Negra˜o CE, 4. Bradford MM. A rapid and sensitive method for the quantitation of Brum PC. Swimming training increases cardiac vagal activity and microgram quantities of protein utilizing the principle of protein– induces cardiac hypertrophy in rats. Braz J Med Biol Res. 2004;37: dye binding. Anal Biochem. 1976;72:248–54. 1909–17. 5. Brilla CG, Matsubara LS, Weber KT. Anti-aldosterone treatment 15. Melchert RB, Welder AA. Cardiovascular effects of androgenic– and the prevention of myocardial fibrosis in primary and secondary anabolic steroids. Med Sci Sports Exerc. 1995;27(9):1252–62. hyperaldosteronism. J Mol Cell Cardiol. 1993;25:563–75. 16. Michel F, Ambroisine ML, Duriez M, Delcayre C, Levy BI, 6. Chomczynski P, Sacchi N. Single step method of RNA isolation Silvestre JS. Aldosterone enhances ischemia-induced neovascular- by acid guanidinium thiocyanate–phenol–chloroform extraction. ization through angiotensin II–dependent pathway. Circulation. Anal Biochem. 1987;162:156–9. 2004;109(16):1933–7. 7. Junqueira LC, Bignolas G, Brentani RR. Picrosirius staining plus 17. Min LJ, Mogi M, Li JM, Iwanami J, Iwai M, Horiuchi M. Aldo- polarization microscopy, a specific method for collagen detection sterone and angiotensin II synergistically induce mitogenic response in tissue sections. Histochem J. 1979;11:447–55. in vascular smooth muscle cells. Circ Res. 2005;97:434–42. 8. Kawano H, Toda G, Nakamizo R, Koide Y, Seto S, Yano K. 18. Nagata K, Obata K, Xu J, et al. Mineralocorticoid receptor antag- Valsartan decrease Type I collagen synthesis in patients with hyper- onism attenuates cardiac hypertrophy and failure in low-aldosterone trophy cardiomyopathy. Circ J. 2005;69:1244–8. hypertension rats. Hypertension. 2006;47:656–64. 9. Krieg A, Scharhg J, Alberts T, Kinderman W, Urhause A. Cardiac 19. Oliveira EM, Krieger JE. Chronic A-adrenoceptor stimulation and tissue Doppler in steroid users. Int J Sports Med. 2007;28:638–43. cardiac hypertrophy with no induction of circulating renin. Eur J 10. Lemarie´ CA, Paradis P, Schiffrin EL. New insights on signaling Pharmacol. 2005;520:135–41. cascades induced by cross-talk between angiotensin II and aldo- 20. Oliveira EM, Sasaki MS, Cerencio M, Barauna VG, Krieger JE. sterone. J Mol Med. 2008;86:673–8. Local renin–angiotensin system regulates LV hypertrophy induced

DELETERIOUS HEART EFFECTS BY NANDROLONE DECANOATE Medicine & Science in Sports & Exercised 1847

Copyright © 2011 by the American College of Sports Medicine. Unauthorized reproduction of this article is prohibited. by swimming training independent of circulating renin: a pharmaco- 31. Sam F, Xie Z, Ooi H, et al. Mice lacking osteopontin exhibit in- logical study. J Renin Angiotensin Aldosterone Syst. 2009;10:15–23. creased left ventricular dilation and reduced fibrosis after aldoste- 21. Pearson AC, Schiff M, Mrosek D, Labovitz AJ, Williams GA. rone infusion. Am J Hypertens. 2004;17:188–93. Left ventricular function in weightlifters. Am J Cardiol. 1986;58: 32. Satoh M, Nakamura M, Saitoh H, et al. Aldosterone synthase 1254–9. (CYP11B2) expression and myocardial fibrosis in the failing 22. Pitt B. ‘‘Escape’’ of aldosterone production in patients with left human heart. Clin Sci. 2002;102:381–6. ventricular dysfunction treated with an angiotensin converting 33. Silvestre JS, Robert V, Heymes C, et al. Myocardial production of enzyme inhibitor: implications for therapy. Cardiovasc Drugs Ther. aldosterone and corticosterone in the rat. J Biol Chem. 1998;273: 1995;9(1):145–9. 4883–91. 23. Pope HG Jr, Katz DL. Affective and psychotic symptoms asso- 34. Teichholz LE, Kreulen T, Herman MV, et al. Problems in echo- ciated with anabolic steroid use. Am J Psychiatry. 1988;145(4): cardiographic volume determinations: echocardiographic angio- 487–90. graphic correlations in the presence or absence of asynergy. Am J 24. Qin W, Rudolph AE, Bond BR, et al. Transgenic model of Cardiol. 1976;37:7–11. aldosterone-driven cardiac hypertrophy and heart failure. Circ Res. 35. Veliotes DG, Woodiwiss AJ, Deftereos DA, Gray D, Osadchii O, 2003;93:69–76. Norton GR. Aldosterone receptor blockade prevents the transition 25. Reismann P, Liko´ I, Igaz P, Pato´cs A, Ra´cz K. Pharmacological to cardiac pump dysfunction induced by A-adrenoreceptor activa- options for treatment of hyperandrogenic disorders. Mini Rev Med tion. Hypertension. 2005;45(5):914–20. Chem. 2009;9(9):1113–26. 36. Ye P, Kenyon CJ, MacKenzie SM, et al. Regulation of aldosterone 26. Robert V, Silvestre JS, Charlemagne D, et al. Biological determi- synthase gene expression in the rat adrenal gland and central ner- nants of aldosterone-induced cardiac fibrosis in rats. Hypertension. vous system by sodium and angiotensin II. Endocrinology. 2003; 1995;26:971–8. 144(8):3321–8. 27. Rocha FL, Carmo EC, Roque FR, et al. Anabolic steroids induce 37. Yoshimura M, Nakamura S, Ito T, et al. Expression of aldosterone cardiac renin–angiotensin system and impair the beneficial effects synthase gene in failing human heart: quantitative analysis using of aerobic training in rats. Am J Physiol Heart Circ Physiol. 2007; modified real-time polymerase chain reaction. J Clin Endocrinol 293:H3575–83. Metabol. 2002;87:3936–40. 28. Rocha R, Rudolph AE, Frierdich GE, et al. Aldosterone induces a 38. Weber KT, Brilla CG. Pathological hypertrophy and cardiac vascular inflammatory phenotype in rat heart. Am J Physiol Heart interstitium. Fibrosis and renin–angiotensin–aldosterone system. Circ Physiol. 2002;283:H1802–10. Circulation. 1991;83(6):1849–65. 29. Sahn DJ, Demaria A, Kisslo J, Weyman A. Recommendations re- 39. Zhang YL, Zhou SX, Lei J, Yuan GY, Wang JF. Blockades of

BASIC SCIENCES garding quantitation in M-mode echocardiography: results of survey angiotensin and aldosterone reduce osteopontin expression and of echocardiographic measurements. Circulation. 1978;58:1072–83. interstitial fibrosis infiltration in rats with myocardial infarction. 30. Sakurabayashi-Kitade S, Aoka Y, Nagashima H, et al. Aldosterone J Clin Med. 2008;121:2192–6. blockade by spironolactone improves the hypertensive vascular 40. Zhu YC, Zhu YZ, Lu N, Wang MJ, Wang YX, Yao T. Role of hypertrophy and remodeling in angiotensin II overproducing trans- angiotensin AT1 and AT2 receptors in cardiac hypertrophy and genic mice. Atherosclerosis. 2009;60:206–54. cardiac remodelling. Clin Exp Pharmacol Physiol. 2003;30:911–18.

1848 Official Journal of the American College of Sports Medicine http://www.acsm-msse.org