UNIVERSITY OF CINCINNATI
Date:______
I, ______, hereby submit this work as part of the requirements for the degree of: in:
It is entitled:
This work and its defense approved by:
Chair: ______
IDENTIFICATION OF STRESS-RESPONSIVE GENES IN THE EARLY LARVAL STAGE OF THE FATHEAD MINNOW PIMEPHALES PROMELAS
A dissertation submitted to the
Division of Graduate Studies of the University of Cincinnati
in partial fulfillment of the requirements for the degree of
DOCTOR OF PHILOSOPHY
in the Department of Biological Sciences of the Graduate School of Arts and Sciences
2005
BY
Solange Smita Lewis
B. Sc., Kishinchand Chellaram College, University of Bombay, 1993 M. Sc., Topiwala National Medical College, University of Bombay, 1995 M. S., University of Louisiana at Lafayette, 1998
ABSTRACT
This project studied the transcriptional response in larval fathead minnows to three different stressors, copper, zinc and heat. Differential display was used to identity stress-responsive genes in the genetically uncharacterized Pimephales promelas larvae.
Two hundred and sixty-one clearly sequenced candidate bands were identified as being differentially expressed by copper, of which 148 were unique genes. One hundred and sixty-eight clearly sequenced candidate bands showed differential expression by zinc,
100 of which were unique genes. One hundred and sixty-seven heat-responsive differentially expressed bands were obtained, of which 107 were unique genes. Eight-five novel ESTs for the fathead minnow were homologous to functional genes from the NCBI database. In addition, this study identified 143 cDNAs homologous to genomic sequences of undetermined function within the NCBI database. Twenty-three dose-responsive genes that were identified in samples from two different stress experiments were quantified using an alternative more sensitive technique, real-time PCR. Gene expression was validated for two independent data sets from each of the stress experiments. Two genes, carboxypeptidase B and 60S ribosomal protein L12, were consistently repressed by copper in all gene assays. One gene, carboxypeptidase B, was consitently repressed by zinc in all gene assays of two independent experiments. One gene, fast muscle troponin I, was consistently repressed in response to thermal stress using samples from two independent experiments.
ii
ACKNOWLEDGEMENTS
I thank my advisor Dr. Stephen Keller for his guidance, support and
encouragement during the course of this project. It has been a privilege to work with
someone so creative. I also thank Dr. Keller for patiently teaching me the fundamentals
of molecular biology. I thank my committee members Dr. Michael Miller, Dr. Craig
Tomlinson, Dr. Kenneth Petren and Dr. Mark Bagley for their contribution to this project.
I acknowledge the input of two past committee members, the late Dr. Thomas Kane and
Dr. David Lattier. Dr. James Lazorchak directed the toxicity tests with fathead minnow
larvae. Members of Craig Tomlinson’s lab and Dr. Jorge Santodomingo made it possible
for me to complete real-time PCR analyses. Richard Haugland and Eunice Varughese
taught me the basics of real-time PCR. Denise Gordon, Robert Flick, Marianna Brown-
Augustine and Suzanne Jackson were very helpful with differential display experiments, sequencing and spectrophotometry. Melinda Hsu ran some differential display gels. Dr.
Scott Keely and Dr. James Stringer were very helpful with data analyses and real-time
PCR.
I thank my friend Dr. Juliann Waits for her advice and support during my Ph.D.
program. I am indebted to many friends in Cincinnati for making life here bearable,
especially Dr. Donna Schlemm, Nancy Bitter, Marge, Franz, Chris and Sarah Wilke,
Tracy and Joyce Jamison, and, Doug and Colleen Coombs.
As always, I am deeply grateful to my family for their support and understanding
during the course of this program, which seemed interminable to them.
iii TABLE OF CONTENTS
ABSTRACT...... ii
ACKNOWLEDGEMENTS...... iii
LIST OF TABLES...... viii
LIST OF FIGURES...... xii
INTRODUCTION...... 1
I. Choice of the Three Stressors Used...... 3
II. The Fish Larval Stage...... 4
III. Effects of Copper, Zinc and Elevated Temperature in Larval Fish...... 6
IV. Effects of Copper, Zinc and Elevated Temperature in Adult Fish...... 9
V. Toxicity Tests and Gene Expression...... 13
MATERIALS AND METHODS...... 21
I. Pimephales promelas Larvae and Test Conditions...... 21
II. Stress Experiments...... 22
A. Copper Exposure A...... 22
B. Copper Exposure B...... 23
C. Zinc Exposure A...... 24
D. Zinc Exposure B...... 24
E. Thermal Stress Experiment A...... 25
F. Thermal Stress Experiment B...... 26
III. RNA Extraction...... 27
IV. RNA Analysis...... 29
V. Differential Display...... 31
iv A. Reverse Transcription for First Strand cDNA Synthesis...... 31
B. PCR of cDNAs with arbitrary primers and fluorescent-labeled anchored
primers...... 32
C. Differential Display of cDNAs on Polyacrylamide Gels...... 34
D. Reamplification of Differentially Expressed Bands...... 38
VI. Sequencing Candidate Bands Obtained from Differential Display...... 39
A. Purification of DNA...... 39
B. DNA Sequencing...... 41
C. Sequence Identity Searches...... 43
VII. Quantitative Measurement of Gene Expression...... 44
A. Primer Design...... 46
B. Reverse Transcription Step (RT-PCR)...... 50
C. Initial Assays with Real Time PCR...... 51
D. PCR Amplification Efficiency...... 51
E. Real-time PCR with Larval RNA Samples…………………………...... 53
F. Melting Curve Analysis...... 56
G. Calculation of Fold-Change in Gene Expression...... 57
H. Data Analysis of Gene Expression Differences Between Control and
Stressed Larvae...... 60
RESULTS...... 62
I. Forty-eight Hour Copper Exposure A...... 62
II. Forty-eight Hour Copper Exposure B...... 63
III. Forty-eight Hour Zinc Exposure A...... 63
v IV. Forty-eight Hour Zinc Exposure B...... 64
V. Thermal Stress Experiment A...... 65
VI. Thermal Stress Experiment B...... 65
VII. RNA Analysis...... 66
VIII. Differential Display Results...... 70
IX. Sequencing Results...... 72
X. Selection of Candidate Bands for Real-Time PCR Assays...... 75
XI. Other Bands of Interest...... 76
XII. Real-Time PCR Results...... 76
XIII. Comparison of Real-Time PCR Gene Expression Data Among the “A” and
“B” Sets of Stress Experiments...... 82
DISCUSSION...... 85
I. Variability in Stress Experiments……………………………………………...85
II. Relationship of Stress and RNA…...... 90
III. The Stress Genome of the Fathead Minnow………...... 91
IV. The Transcriptional Response to Stress……………………………………...92
V. Identification of Common Stress Genes……………………………………...96
VI. Limitations of Differential Display...... 97
VII. Real-Time PCR View of the Transcriptional Response to Stress………....101
VIII. Limitations of Real-Time PCR...... 104
IX. Evaluation of Hypothesis and Conclusions...... 106
LITERATURE CITED...... 109
APPENDIX 1...... 272
vi APPENDIX 2...... 282
vii
LIST OF TABLES
Table1: Proteins or mRNA transcripts in adult fish affected by copper...... 125
Table 2: Proteins or mRNA transcripts in adult fish affected by zinc...... 126
Table 3: Proteins or mRNA transcripts in adult fish affected by heat stress...... 128
Table 4: Preparation of the RT Core mix...... 32
Table 5: HIEROGLYPH arbitrary primer sequence information...... 33
Table 6: PCR reaction mixture for amplification of cDNAs with fluorescent anchored primers and arbitrary primers from the HIEROGLYPH kit...... 33
Table 7: PCR setup for reamplification of differentially expressed cDNA bands...... 38
Table 8: PCR setup for DNA sequencing...... 41
Table 9: Primers used for real-time polymerase chain reaction...... 47
Table 10. Amplification and reaction efficiency values associated with the slopes produced by plotting CT against log10 concentration of DNA samples...... 53
Table 11. Real-time PCR set-up for samples from experiments A...... 55
Table 12. Real-time PCR set-up for samples from experiments B...... 55
Table 13: Results from the 48-hr copper exposure A to Pimephales promelas larvae stating the number of survivors in the control and treatment groups and percentage survivorship...... 130
Table 14: Water quality measurements for copper experiment A...... 130
Table 15: Results from the 48-hr copper exposure B to Pimephales promelas larvae, stating the overall number of survivors in the control and treatment groups and percentage survivorship...... 130
Table 16: Live fish in each treatment chamber at the start of copper experiment B, 24 hrs later and at the conclusion of the experiment at 48 hrs...... 131
Table 17: Water quality measurements for copper experiment B...... 131
viii Table 18: Results from the 48-hr zinc exposure A to Pimephales promelas larvae stating the number of survivors in the control and treatment groups and percentage survivorship...... 132 Table 19: Water quality measurements for the zinc experiment A...... 132
Table 20: Results from zinc exposure B to Pimephales promelas larvae stating the overall number of survivors in the control and treatment groups and percentage survivorship...... 132
Table 21: Live fish in each treatment chamber at the start of zinc experiment B, 24 hrs later and at the conclusion of the experiment at 48 hrs...... 133
Table 22: Water quality measurements for zinc experiment B...... 133
Table 23: Results from the 24-hr and 48-hr thermal stress experiment A at 36ºC with Pimephales promelas larvae stating the number of survivors in the control and treatment groups and percentage survivorship...... 134
Table 24: Water quality measurements for thermal stress experiment A...... 134
Table 25: Results from the second 48-hr 36ºC heat stress experiment B with Pimephales promelas larvae stating the overall number of live fish in the control and treatment groups and percentage survivorship...... 134
Table 26: Live fish in each treatment chamber at the start of thermal stress experiment B, 24 hrs later and at the conclusion of the experiment at 48 hrs...... 135
Table 27: Water quality measurements for thermal experiment B of 48 hours duration...... 135
Table 28: Spectrophotometric readings of larval RNA samples from copper experiment A...... 136
Table 29: Spectrophotometric readings of larval RNA samples from copper experiment B...... 136
Table 30: Analyses of larval RNA extracts from copper experiment B...... 137
Table 31: Spectrophotometric readings of larval RNA samples from zinc experiment A...... 137
Table 32: Spectrophotometric readings of larval RNA samples from zinc experiment B...... 138
Table 33: Analyses of larval RNA samples from zinc experiment B...... 138
ix Table 34: Spectrophotometric readings of larval RNA samples from thermal stress experiment A...... 139
Table 35: Spectrophotometric readings of larval samples from thermal stress experiment B...... 139
Table 36: Analyses of larval RNA samples from thermal stress experiment B...... 140
Table 37: A list of the copper candidate bands obtained from the differential display technique, their specific response to copper and BLAST identity matches...... 141
Table 38: A list of the zinc candidate bands obtained from the differential display technique, their specific response to zinc and BLAST identity matches...... 167
Table 39: A list of the thermal stress candidate bands obtained from the differential display technique, their specific response to heat stress, time period and BLAST identity matches...... 188
Table 40: Two hundred and sixty-one copper candidate bands with clear sequence data...... 209
Table 41: One hundred and sixty-eight zinc candidate genes with clear sequence data...... 220
Table 42: A One hundred and sixty-eight candidate bands identified from the thermal stress experiment with clear sequence data...... 227
Table 43: Twenty-three candidate bands from differential display analysis chosen for real-time PCR analysis...... 235
Table 44: Genes that were identified in all three stress experiments from the differential display analysis...... 237
Table 45: Genes only identified in the differential display analysis of samples from copper experiment A...... 238
Table 46: Genes only identified in the differential display analysis of samples from zinc experiment A...... 240
Table 47: Genes only identified in the differential display analysis of samples from thermal stress experiment A...... 241
Table 48: Reaction efficiencies calculated for primer pairs of genes analyzed by real-time PCR...... 242
x Table 49: Real-time PCR results of the twenty-three selected genes for copper A samples, with corrections for reaction efficiency differences...... 244
Table 50: Real-time PCR results of the twenty-three selected genes for zinc A samples, with corrections for reaction efficiency differences...... 246
Table 51: Real-time PCR results of the twenty-three selected genes for thermal stress A samples, with corrections for reaction efficiency differences...... 248
Table 52: Real-time PCR results of the twenty-three selected genes in terms of fold- change in gene expression for group B copper samples, corrected for reaction efficiency differences and RNA concentration...... 250
Table 53: Real-time PCR results of twenty-three selected genes for group B zinc samples, corrected for reaction efficiencies and total RNA concentration...... 252
Table 54: Real-time PCR results of twenty-three selected genes for group B thermal stress samples, corrected for reaction efficiencies and total RNA concentration...... 254
Table 55: A summary table comparing gene expression changes in twenty-three genes in experiments A and B when copper, zinc and elevated temperature were used to stress fathead minnow larvae...... 256
Table 56: Gene expression measurement of experiment B samples relative to total RNA concentration...... 258
xi LIST OF FIGURES
Figure 1: A typical standard curve showing the median fluorescence signal from DNA standards using PicoGreen dye...... 41
Figure 2: A typical DNA sequence judged to be a good read with little background signal, high peaks and clearly identifiable nucleotides...... 43
Figure 3: A formaldehyde-agarose gel with RNA samples from thermal stress experiment A...... 260
Figure 4: RNA recovery per fish in µg/µl from Copper Experiment A...... 261
Figure 5: RNA recovery per fish in µg/µl from Copper Experiment B...... 262
Figure 6: RNA recovery per fish in µg/µl from Zinc Experiment A...... 263
Figure 7: RNA recovery per fish in µg/µl from Zinc Experiment B...... 264
Figure 8: RNA recovery per fish in µg/µl from Thermal Stress Experiment A...... 265
Figure 9: RNA recovery per fish in µg/µl from the 48-hour Thermal Stress Experiment B at 36ºC...... 266
Figure 10: A differential display gel picture captured by a fluorescence scanner, with a virtual grid superimposed on it...... 267
Figure 11: A gene ontology showing a distribution of functional genes affected by copper, zinc and heat stress...... 269
Figure 12: A representative real-time polymerase chain reaction amplification curve for the sequence QPCR4:carboxypeptidase B in one of the control samples from copper experiment B...... 270
Figure 13: A representative melt curve for the sequence QPCR4:carboxypeptidase B for a control sample from copper experiment B...... 271
xii INTRODUCTION
The objective of this project was to identify differentially expressed stress-
responsive genes in newly hatched fathead minnow (Pimephales promelas Rafinesque)
larvae. The three environmental stressors used to elicit a physiological response in this fish were the metals copper and zinc, and, elevated temperature. Several life stages of the fathead minnow are routinely used in freshwater toxicity tests to evaluate the potential hazard posed to fish species by environmental pollutants (Manner and Dewese, 1974;
Weber, 1993). The fathead minnow is easy to breed in laboratories, widely available through fish hatcheries, is sensitive to a wide range of pollutants (Weber, 1993) and hence satisfies most of the requirements for being a model toxicity test organism (Landis and Wu, 1995).
The fathead minnow Pimephales promelas was chosen for this study on account
of its widespread use in toxicity tests, and, wealth of information in terms of several
toxicology studies as described in the following pages of the introductory section. The
taxonomy of this species is as follows (Integrated Taxonomic Information
System/www.itis.usda.gov; NCBI database – taxonomy ID 90988):
Kingdom: Animalia Phylum: Chordata Subphylum: Craniata/Vertebrata Superclass: Osteichthyes (bony fishes) Class: Actinopterygii (ray-finned fishes) Subclass: Neopterygii Infraclass: Teleostei Superorder: Ostariophysi Order: Cypriniformes Superfamily: Cyprinoidea Family: Cyprinidae (carps and minnows) Subfamily: Leuciscinae Genus: Pimephales (Rafinesque 1820 – bluntnose minnows) Species: Pimephales promelas (fathead minnow)
1
Despite its prominent use in toxicological studies, there is a lack of genetic information
about Pimephales promelas and its genome is virtually unknown as yet. Cytogenetic
studies have determined that P. promelas has 2n = 50 chromosomes (Li and Gold, 1991).
For any fish species, the early larval stage is one wherein it is most sensitive to the environment (Gardner and LaRoche, 1973; McKim, 1977; McKim et al., 1978;
Scudder et al., 1988; von Westernhagen, 1988). In terms of survival, the only other life stage of fish deemed more important is the reproductive stage and specifically in the case of oviparous fish, the spawning stage. At the larval post-hatch stage, the protective chorion layer of the egg no longer provides a barrier between the developing fish and its environment (Kyle, 1926). For this reason, larvae are more sensitive than either chorion- enclosed embryos or more developmentally advanced juveniles that may be able to cope better with environmental changes because their organs are fully functional.
The fathead minnow does fall short on some requirements as a model test species:
its genetic composition is usually heterogeneous within a population, there are relatively
few studies on its genome (59 NCBI nucleotide entries to date), it has not been tested
with as many compounds as other non-fish vertebrate species, as a sentinel species it may
not have the same response to pollutants as the target species which the test results will
be applied to protect, and, toxicity tests are not studied in terms of its interaction with
other organisms normally present in ecosystems which would encompass parameters
such as biomagnification, behavior, etc. (Chapman, 2000; Landis and Wu, 1995; Vittozzi
and De Angelis, 1991).
2 Choice of the Three Stressors Used
There are varying definitions of stress, and Pickering (1981) loosely summarized it as the adaptive response of an organism to some kind of stimulus after the definition of
Hans Selye (1956). In this study, environmental stress deals with the altered water conditions to which fathead minnow larvae were exposed. Copper and zinc were chosen as metal stressors, while elevated temperature was chosen as the non-metal stressor.
Copper is highly toxic to freshwater fish, second in rank to mercury (Moore and
Ramamoorthy, 1984). Most 96-hr LC50 values for freshwater adult fish lie between 0.017
and 1.0 mg/L, but copper toxicity can decrease with increasing water hardness (Moore
and Ramamoorthy, 1984). Mount (1968) tested chronic copper toxicity over the course
of a year, starting with six-week-old Pimephales promelas in hard water (182-216 mg/L
CaCO3), and determined that a concentration of 95 µg/L killed half the test population. In
a second similar chronic copper study with P. promelas in soft water, Mount and Stephan
(1969) found that 18.4 µg/L copper caused 50% mortality. Zinc is one of the least toxic
of all metals, being about fivefold less toxic than copper (Wood, 2001). In embryonic P.
promelas, 96-hr LC50 values ranged from 0.34 mg/L at the initial exposure age of 14 hrs
(gastrula) to 1.49 mg/L at the 24-hour stage (tailbud stage) in moderately hard water of
84.7-90.1 mg/L CaCO3 (Ramey, 1988). Brungs (1969) found that a zinc concentration of
0.18 mg/L was sufficient to reduce spawning in adult fathead minnows. Both copper and zinc, being chemically similar metals, were expected to have a more similar mechanism
of toxicity compared to the non-metal stress, heat. The adult fathead minnow can
withstand temperatures ranging from 1.5˚C to 33.2˚C, depending on previous acclimation temperature (Brett, 1956). It therefore has a fairly high thermal tolerance in comparison
3 to other freshwater fish species (Brett, 1956). The known harmful effects of the three stressors to fish are described in detail in subsequent sections that follow. Although this study was performed with larval fish, most gene expression studies found in the literature deal with adult fish and hence both larval and adult toxicology are reviewed in subsequent sections. Another reason for reviewing adult toxicology is that very few histology and morphological studies have been done with larval fish specifically characterizing the effects of the selected stressors on various organs or tissues.
The Fish Larval Stage
The effects of stress in fish larvae are expected to be characteristically different from those in adults because larvae have different morphological and metabolic features described as follows. The incubation period of fathead minnow eggs is approximately 5 days or 120 hours; however some amount of limited hatching may occur before this time
(Markus, 1934; Devlin et al. 1996). The term “larva” in this study refers to a young fish that has just emerged from its egg up to the juvenile stage when it closely resembles an adult of the same species. The larvae used in this study were less than 24 hours post- hatch at the start of the experiments (total age ≤ 144 hours) and were still living on the contents of their yolk sacs. After emerging from the chorion that encases the developing embryo, teleost larvae are transparent with some pigmentation. The notochord and myotomes are still clear; there is some cartilage development and no ossification
(Blaxter, 1969; Jobling, 1995). There is a well-developed primordial fin fold in the sagittal plane, but most of the other fins are as yet undeveloped (Blaxter, 1969). Although there is a functional heart within the embryo, blood vessels have still not developed fully,
4 there are no pigmented red blood cells and hence hemoglobin is not yet binding oxygen
for respiration (Blaxter, 1969). In the developing larva, the eyes are usually the first to
develop function while the mouth and jaws generally begin functioning after the yolk sac
is completely absorbed (Jobling, 1995). At this stage, because of undeveloped gills,
respiration is achieved primarily through the two-layered epithelium of the larva (Blaxter,
1969; Somasundaram, 1985). Gradually, the processes of skeletal formation and
branchial development occur and the primordial fin is replaced by a median fin. The
development of the gills continues almost to the juvenile stage and replaces the skin as
the main exchange surface for respiration. Fathead minnow larvae are more
developmentally advanced compared to salmonid larvae, and possess movable jaws,
functional eyes, a streamlined yolk sac, some musculature, neuromasts along the lateral
line, and, some pigmentation at hatching (Devlin et al., 1996). At hatching, the larva
shows the primordial origin of the gill, the gill anlage, which is not yet functional (Devlin
et al., 1996). The heart and liver are prominent and the brain has developed to some
extent at hatching (Devlin et al., 1996). Bile is produced by the gall bladder and hence
both it and the intestine have a green-yellow color that makes them visible (Scudder,
1984; Devlin et al., 1996). Newly hatched larvae exhibit negative phototaxis, indicating
functional eyes, and show active mouth movement (Scudder, 1984). The swim bladder,
intestine, optic cups and blood cells show pigmentation by this stage (Devlin et al., 1996).
The yolk sac is absorbed around 32 hours post-hatch and fathead minnow larvae begin exogenous feeding around 56.5 hours post-hatch (Devlin et al., 1996).
Based on the above description of the larval stage, it should be apparent that the
skin is the main site of exchange for toxic chemicals present in the environment, it is the
5 respiratory surface and it performs osmoregulation at this stage since the gills have not yet fully developed. Temperature should affect membrane integrity, the rate of metabolism and the activities of proteins already present within the developing larva.
Effects of Copper, Zinc and Elevated Temperature in Larval Fish
Very few morphological and physiological studies have been performed with copper-exposed larval fish. Scudder et al. (1988) studied developmental rates of fathead minnow embryos and larvae exposed to copper concentrations ranging from 61-621µg/L.
Embryos exposed to copper concentrations 338 µg/L and higher showed a significantly higher rate of developmental abnormalities that included the following:
(1) failure of eyes to emerge from enclosed tissue,
(2) deformed maxillary bones and mandibles,
(3) malformed lower jaws,
(4) misshapen fins that were also reduced in size,
(5) kyphosis, lordosis and scoliosis, and,
(6) numerous eye defects including orientation defects, defective lenses and
microphthalmia.
Larvae are more sensitive to copper exposure than embryos. All copper-exposed larvae had significantly lower weight and length compared to controls, indicating lower developmental rates (Scudder et al., 1988). Developmental abnormalities were found in all copper-exposed (61 µg/L onwards) larvae and included, in addition to all of the abnormalities listed above, opercular defects and deformed branchial apparatuses.
6 The Carreau and Pyle (2005) study with 84-96 day post-hatch fathead minnows
exposed to 10 µg/L copper during embryonic development found that metal exposure
caused olfactory dysfunction, suggesting that copper also affects the ability of fish to
sense smell and hence fish may not be able to detect chemical cues of prey items,
predators and communication signals of conspecifics.
In Atlantic herring Clupea harengus embryos exposed to 6-120 ppm zinc, emerging larvae showed significant epidermal changes (Somasundaram, 1985). Oral cavity epithelia and other areas of the larvae showed necrosis and signs of sloughing
(Somasundaram, 1985). The epithelial cells contained more vesicles and intracellular spaces, and, mitochondria were swollen. The epithelium consists of microridges and microvilli. In zinc-affected cells, the microridges were clumped together. Cells designated as chloride cells had fewer mitochondria, Golgi apparatuses were absent and the smooth endoplasmic reticulum had decreased in volume (Somasundaram, 1985). Zinc also affected brain neurons in Clupea harengus larvae that were exposed to 0.5, 2.0, 6.0 and 12.0 ppm zinc sulfate as embryos (Somasundaran et al., 1984a). In mid and hind brain neurons, there was significant swelling of nuclear membranes and rough endoplasmic reticulum (Somasundaram et al., 1984a). The mitochondrial volume in the brain neurons was also significantly reduced at 2.0 ppm Zn onwards (Somasundaram et al., 1984a). Somasundaram et al. (1984b) also observed an increase in morphological abnormalities in Clupea harengus yolk-sac larvae with increasing zinc concentration
(0.05-12 ppm). These morphological abnormalities included deformities of the jaw, head, optic capsules, otic capsules and vertebral column (Somasundaram et al., 1984b).
7 Ramey (1988) reported that embryonic fathead minnow exposed to 0.5 – 3.0
mg/L zinc showed various abnormalities at four days post-hatch. These abnormalities
included bends in the vertebral axis, peritoneal and pericardial edema, and, severe cardiac
and ophthalmic edema at higher zinc concentrations. Larvae exposed to zinc sulfate after
hatching were more sensitive compared to embryos, and the rate of developmental
abnormalities increased (Ramey, 1988).
Most embryonic and larval thermal fish studies have dealt with cold temperature
stress rather than elevated temperature. Fukuhara (1990) studied the embryos and larvae
of four fish species (Acanthopagrus schlegeli, Engraulis japonica, Pagrus major and
Paralichthys olivaceus) at rearing temperatures from 10ºC to 21 ºC. Yolk absorption was greater at higher temperatures, as was physical activity and growth. In addition, mouth opening and eye pigmentation occurred only after the yolk sac was completely absorbed at 21ºC but these developmental changes occurred before yolk absorption at temperatures of 16ºC and 18ºC in Pagrus major, indicating a favorable trait that may confer greater survivorship in low-food environments (Fukuhara, 1990). Myogenesis in embryos is greatly affected by temperature. In Atlantic herring embryos reared at different temperatures, the number of inner muscle fibers was increased at higher temperatures but muscle thickness was greater at low temperatures (Johnston et al., 1995). Temperature also influenced timing in the development of pectoral fin buds, pronephric tubules, contractile protein synthesis and somite stage itself (Johnston et al., 1995). Temperature has an effect on the ultrastructure, number and phenotype of many fish larval muscles
(Johnston and Hall, 2004). In addition, early larval stages rely more on aerobic than anaerobic respiration compared to older larvae and juveniles; because water holds less
8 oxygen at higher temperatures, respiration may not be providing enough oxygen as at a more optimal temperature (Johnston and Hall, 2004). The cause of death due to upper lethal temperatures in fish is thought to be primarily due to a halt in brain and nervous activity, possibly caused by an inactivation of the respiratory center due to oxygen deprivation (Brett, 1956).
In response to metal stress, newly-hatched larvae emerging from exposed eggs show skeletal deformities, eye deformities and eye reduction (von Westernhagen, 1988).
With heat stress, more spinal deformities such as curvature and spirality of the notochord are prevalent (von Westernhagen, 1988). In this study, it was expected that both metals and temperature would cause hypoxic stress to the larvae. Metals were expected to bind to the epithelium and damage the respiratory surface thereby causing hypoxic stress.
Temperature was expected to result in hypoxic stress because water at high temperatures contains lower levels of dissolved oxygen. It was expected that increased temperature would increase metabolism in larvae, whereas copper and zinc exposure might slow it down because of their toxic effect on cells. And because of the types of developmental abnormalities observed in metal-stressed larvae, it was expected that the affected genes would probably encode muscle development, skeletal formation and metabolism. A shift from aerobic to anaerobic respiration was expected due to reduced oxygen exchange and absorption by stressed fish larvae.
Effects of Copper, Zinc and Elevated Temperature in Adult Fish
In adult fish, copper is known to precipitate secretions from gills, and cause asphyxiation (Carpenter, 1927; Stokes, 1979; Tsai, 1979). Playle et al (1993) suggested
9 that initially gills secrete mucus to complex metals, but after this capacity is exceeded mucus secretion is halted and the metals become available to the epithelial cells of the gills through ionic channels. Histological examination of Cyprinus carpio gill tissue exposed to copper sulfate revealed epithelial hyperplasia of the primary and secondary epithelium, and, several secondary lamellae were fused at a 4 mg/L CuSO4 concentration
(Karan et al., 1998). Subepithelial edema, changes in chloride and mucus cells, and changes in the appearance of gill lamellae were also observed (Karan et al., 1998). Acute copper exposure to the winter flounder Pseudopleuronectes americanus resulted in detrimental pathological changes in gill tissue, liver, kidneys and hemopoietic tissue
(Baker, 1969). Therefore, there is evidence that several different organs in fish are affected by copper and other metals, and, that different organs are affected in different ways. Acute copper exposure resulted in fatty metamorphosis in the liver, necrosis in kidneys and destruction of cells within the gill tissues (Baker, 1969). Of all the organs where copper is known to accumulate, the liver has been shown to have the maximum capacity for its storage (Stokes, 1979). Hutchinson et al. (1974) measured copper levels from the liver, gills, kidney and muscle of northern pike, northern rock bass, brown bullhead, redhorse sucker and white sucker living in metal-contaminated water. Copper concentrations in the liver were between 2.8-30.3 ppm, those in the kidneys were between 1.7-6 ppm, the gill copper concentrations ranged from 1.3 to 2.1 ppm, and those of the muscles lay in the range 1.3-1.7 ppm (Hutchinson et al., 1974). Copper is also known to damage mechanoreceptors of the lateral line canals and chemoreceptors within olfactory organs of the mummichog Fundulus heteroclitus and Atlantic silverside
Menidia menidia (Gardner and LaRoche, 1973). Chronic copper exposure to fathead
10 minnows affects many life-history characteristics. Pimephales promelas exposed to
95µg/L copper sulfate in hard water for 11 months showed almost 50% mortality, delayed sexual maturity and blocked any spawning (Mount, 1968). Various studies in
copper-exposed fish have found differential changes in proteins and mRNA transcripts
(Table 1).
The gills are the primary target organs of zinc toxicity (Hogstrand et al., 2002). In
common with many metal pollutants, zinc causes necrosis of chloride and pavement
epithelial cells of gills, lifting of epithelial pavement cells from basement membrane,
leukocyte (macrophage) infiltration of chloride cells, hypertrophy of pavement cells,
excess mucus secretion and proliferation of these epithelial cells within the respiratory
lamellae (Wood, 2001). Rainbow trout (Salmo gairdneri Richardson) exposed to lethal zinc sulfate concentrations were unable to maintain oxygen uptake, had bradycardia, low partial pressure of oxygen in blood, and increased coughing (Skidmore, 1970). Eisler and
Gardner (1973) reported that 60 mg/L zinc caused damage to the oral epithelium of the mummichog Fundulus heteroclitus. In rainbow trout, a low dose of 0.8 mg/L zinc caused alkalosis, while a high dose of 1.5 mg/L caused acidosis due to hypoxia and increased lactic acid production (Spry and Wood, 1984). Exposure to 0.8 mg/L zinc in soft water caused a loss of sodium, chloride and potassium ions and a complete halt in the uptake of calcium ions (Spry and Wood, 1985). Like most other heavy metals, zinc decreases reproduction in fish (Hogstrand and Wood, 1996). Specifically, egg production was found to decrease by 17% at 0.18 mg/L zinc concentration (Brungs, 1969). High zinc concentrations result in reduced spawning (Brungs, 1969). Like copper, many studies
11 have found that zinc exposure results in differential production of proteins and mRNA
transcripts (Table 2).
Fish are ectotherms, and hence environmental temperature strongly influences
body temperature. Water at high temperature has a lower ability to hold oxygen (Horne
and Goldman, 1994; Landis and Wu, 1995). Therefore, fish living in water at high
temperatures also have low amounts of dissolved oxygen circulating around their gills.
Biochemical reaction rate increases with increasing temperature up to the peak rate, and then falls beyond that range (Landis and Wu, 1995). Because of the increased metabolic rate, available oxygen is consumed faster and more waste products are generated (Landis and Wu, 1995). As temperature tolerance of a fish species reaches its upper limit, initial behavioral changes include a reluctance to feed, sudden bursts of activity, decline in sensory perception, rolling and pitching, defecation, and, fast ventilatory movements
(Elliott, 1981). The fish then becomes less active, often floats on its side and back and increases ventilation (Elliott, 1981). The final behavioral response, when the fish is close
to death, is to restrict movement to the operculum, pectoral fins and eyes (Elliott, 1981).
Besides the endocrine response to thermal stress, the secondary responses include
changes in osmoregulation and ion balance, changes in acid-base balance, alteration in
metabolic processes, changes in growth rate, changes in reproduction and behavior
(Crawshaw, 1980; Elliott, 1981). Carp myosin ATPase enzyme activity was different between warm- and cold-water acclimated fish (Hwang et al., 1990). Fish acclimated to cold water had a higher ATPase activity. Membranes become more fluid at cold
temperatures, and, protein activity and stability is affected (Hochachka and Somero,
2002). Exposure of fish to high temperature generally results in the expression of heat
12 shock proteins and heat shock factor 1 (Dyer et al., 1990; Airaksinen et al., 1998;
Buckley and Hofmann, 2002; Lund et al., 2002; Podrabsky and Somero, 2004). A cDNA microarray study with the annual killifish Austrofundulus limnaeus revealed several other genes affected by temperature fluctuation besides the heat shock genes (Podrabsky and
Somero, 2004). In the Podrabsky and Somero (2004) study, over 90% of the 4992 cDNAs studied changed less than two-fold in expression. Two genes, the high mobility group protein B1 (HMGB1) and HMG-CoA synthase, had more than a six-fold change in expression. HMGB1 was found to be down-regulated in response to high temperature, while HMG-CoA synthase was up-regulated (Podrabsky and Somero, 2004). Proteins and mRNA transcripts are known to be differentially expressed in fish exposed to high temperature (Table 3).
Toxicity Tests and Gene Expression
There are several endpoints in toxicity tests, death being the endpoint most frequently used to set water quality standards for aquatic organisms. However, there are other measurements that may be more physiologically informative about fish populations exposed to pollutants. These measures include effects of pollutants on growth, reproduction, developmental rate, spawning, etc. Acute and chronic toxicity tests are routinely carried out with the fathead minnow as the model freshwater test species. Acute toxicity tests, carried out over a relatively short period of an organism’s life cycle, use percent survivorship as the endpoint. Acute toxicity tests usually last 96 hours or less, although some may be carried out for a week up to 10 days (Sprague, 1969). Chronic and sublethal toxicity tests are carried out over a significant portion of an organism’s life-
13 cycle and measure parameters such as growth, development and reproduction (Landis and
Wu, 1995). The advantage of acute toxicity tests is that they provide a quick and standard
method to rank various environmental pollutants in terms of their potential hazard to ecosystems (Landis and Wu, 1995). The advantage of chronic toxicity tests is that they
provide knowledge about harmful physiological or behavioral effects of pollutants on
different life stages of a species. The disadvantages of carrying out chronic toxicity tests
are their long duration, difficulty and tediousness in performing them, and, they do not
provide a rapid assessment of the threat posed by a novel pollutant or chemical mixture to
an aquatic ecosystem.
Some of the criticisms of acute toxicity tests are (1) that they do not reflect other
effects (e.g., growth, abnormalities, etc.) other than survivorship or a population-level
parameter in the test organisms (Ankley et al., 1997), and, (2) there is inter-laboratory
and within-laboratory variability in toxicity test results (Chapman, 2000). Because of
these shortcomings and physiologically uninformative results of standard acute toxicity
tests, the purpose of this study was to determine if gene expression could be used in
conjunction with acute toxicity tests to provide more sensitive and consistent measures of
stress effects in an organism.
In an historical context, the first large-scale assessment of gene expression with a
48 sequence-cDNA microarray was studied by Schena et al. (1995) in Arabidopsis
thaliana root and leaf tissue, which resulted in over five-fold expression differences for
26 genes between the two tissues studied. Leaf tissue had over 500-fold higher expression of CABI, a light-regulated gene, compared to root tissue (Schena et al., 1995). DeRisi et
al. (1997) characterized genome-wide gene expression over the course of a metabolic
14 cycle in the yeast Saccharomyces cerevisiae. This study characterized temporal changes in cellular transcription as the organism went from the anaerobic to the aerobic state
(diauxic shift) in response to glucose depletion from the growth medium (DeRisi et al.,
1997). There was a shift in gene induction from glycolytic genes to those involved in the citric acid cycle and electron transport chain. In addition, several genes of uncharacterized function were shown to respond to changes in cellular metabolism. Also involved with the shift to aerobic respiration were several genes encoding protein synthesis, ribosomal proteins, tRNA synthetases, translation factors, elongation factors and initiation factors, all of which were repressed (DeRisi et al., 1997). Lashkari et al.
(1997) characterized gene expression patterns of Saccharomyces cerevisiae under different environmental conditions of heat shock, cold shock, and, steady-state galactose and glucose. Lashkari et al. (1997) proposed using genome-wide expression platforms to understand all possible genes that could be affected under different conditions, some of which are shared between different treatments, to better understand the common and separate pathways whereby cells respond to specific environmental changes. All of the above studies lead to the conclusions that physiological changes in cells are reflected by
concurrent changes in their transcriptional machinery, that different environmental
conditions may share some common genetic pathways, and, that different organs and
tissues in a multicellular organism will have different transcriptional responses to the
same environmental factor.
Bartosiewicz et al. (2000, 2001) successfully used microarrays in toxicological
studies with mice to characterize large-scale gene expression changes induced by
toxicants. The Bartosiewicz (2000) study utilized a 148 EST microarray encoding phase I
15 and II metabolizing enzymes, DNA repair enzymes, stress proteins, cytokines and housekeeping genes to examine the effects of β-naphthoflavone on mice liver. This study showed that some genes such as Cyp1a1 and Cyp1a2, belonging to the cytochrome P450 family, were proportionately induced with higher doses of β-naphthoflavone, while other genes like metallothionein were only induced at specific doses. There was also 18-60%
variability in signal that Bartosiewicz et al. (2000) attributed to individual differences in the animals tested. The Bartosiewicz et al. (2001) study with mice observed distinct gene
expression patterns associated with a specific stressor and its dose. This study found
some liver genes up-regulated by many different stressors, while other genes were
specifically expressed in response to one particular stressor. In response to cadmium
chloride (metal salt), metallothionein-I and –II genes, heat shock protein genes 105, 86, and 25, c-jun, jun-b, growth-factor-induced protein gene, chop 10 and acetyltransferase
96 were all up-regulated, while methyltransferase 111, Cyp2f2 and Cyp3a11 genes were
down-regulated at the highest concentration of 10 mg/kg. Some genes, including Hsp
105, 86 and 25, and, jun-b, showed a dose response in their expression pattern to cadmium. The genes up-regulated by a 10 mg/kg concentration of the chlorinated hydrocarbon trichloroethylene included Cyp2a, Hsp 25 and Hsp 86, the latter two also induced by cadmium and therefore commonly affected by two pollutants. In response to the polycyclic aromatic hydrocarbon benzo(a)pyrene, the hepatic genes Cyp1a1 and
Cyp1a2 were up-regulated, both of which were unique to the stressor. Benzo(a)pyrene induced a unique expression pattern in mice, and none of the 148 genes studied showed a similar response to cadmium or trichloroethylene. From these studies, it can be inferred that some genes respond to pollutants in a dose-responsive manner, some genes may
16 share a common induction pathway by multiple classes of pollutants, but most stress-
affected genes are unique thereby providing a singular transcriptional profile for a
specific environmental stressor.
In this study, stress-induced differentially expressed genes were identified using
the differential display technique, a technique appropriate for use in an organism with an
uncharacterized genome. The mRNA differential display technique was pioneered by
Liang and Pardee (1992) and has been used to detect changes in gene expression due to a
variety of causes such as exposure to pollution, disease and different developmental stages (Rhodes and Van Beneden, 1996; Geschwind et al., 2001; Virtaneva et al., 2001).
Many toxicological studies have successfully utilized differential display to identify up-
regulated or down-regulated genes in animals and specifically in fish for responses to
toxicants or temperature (Rhodes et al., 1997; Lee and Goetz, 1998; Liao and Freedman,
1998; Denslow et al., 2001a; Denslow et al., 2001b; Carginale et al., 2002; Larkin et al.,
2002; Picard and Schulte, 2003; Picard and Schulte, 2004). All these studies yielded
differentially expressed candidate genes in response to some treatment, and expression of
some candidate genes was validated using a second technique. Alternatively, many
studies have used suppressive subtractive hybridization or an assembly of expressed
sequence tags (ESTs) on microarrays to identify gene expression patterns in altered
physiological states of fish (Karsi et al., 1998; Gracey et al., 2001; Williams et al., 2003).
Therefore, there are several techniques to identify differentially expressed genes in cells
and animals. The differential display technique has the advantage of not requiring prior
knowledge of genomic sequences, thus making it an unbiased and systematic method of
screening for differentially expressed genes (Liang, 2002). Differential display has
17 another advantage over subtractive hybridization for its ability to directly identify dose-
responsive genes. Microarrays have the advantage over both techniques in that they can
be used over several different time points, can identify dose-responsive genes, and, up to
several thousands of genes can be analyzed at one time. However, microarrays are more costly and require substantial knowledge of an organism’s genome.
Candidate genes that responded proportionally to the level/concentration of stress
and that were identified by more than one stressor were further validated using the real- time PCR technique. Real-time PCR, a technique pioneered by Higuchi et al. (1993), is known for its sensitivity in detecting changes in gene expression (Malinen et al., 2003;
Palmer et al., 2003). Palmer et al. (2003) were able to detect HIV-1 RNA levels as low as
0.781 copies/ml using this technique and Malinen et al. (2003) found the assay to be superior to dot-blot DNA hybridization probes for identifying bacterial genomes from fecal DNA preparations or artificial DNA mixtures. Real-time PCR has been successfully employed for detecting changes in gene expression in various fish species. It has been used to validate the expression of candidate genes obtained using differential display in two populations of the killifish Fundulus heteroclitus from different thermal environments (Picard and Schulte, 2004). Picard and Schulte (2004) confirmed that three of five candidate genes, glucokinase, serine-threonine kinase 10 and cRAF, responded to handling stress. However, the up-regulation of these genes was only observed in Southern populations of killifish and not for the Northern populations studied, suggesting that the response of these genes to stress might be regulated differently in populations that have genetically diverged over the course of evolution (Picard and Schulte, 2004). Real-time
PCR has also been used to validate candidate genes obtained using subtractive
18 hybridization in the winter flounder Pleuronectes americanus exposed to nonylphenol
(Baldwin et al., 2005). Of the twenty-two genes analyzed using real-time PCR, five were
confirmed as being differentially expressed and included an EST (expressed sequence tag), C-type lectin domain, complement component C8b, cathepsin L and FKBP2
(Baldwin et al., 2005). Williams et al. (2003) used real-time PCR to confirm the expression of four differentially expressed genes, as detected using cDNA microarrays, in the European flounder Platichthys flesus from polluted sites. Two genes, CYP1A and
UDP-glucuronosyltransferase, were significantly up-regulated in male fish from polluted waters (Williams et al., 2003). Another gene, translation elongation factor 1, was
significantly down-regulated in fish from the polluted site while Cu/Zn SOD was not
significantly up-regulated in fish from polluted water (Williams et al., 2003). Real-time
PCR has also been employed to measure specific gene expression changes in fish in
responding to various stressors or hormones (Chen et al., 2004; Gonzalez et al., 2005;
Karsi et al., 2005). Chen et al. (2004) used real-time PCR to study metallothionein gene
expression during development of zebrafish and inferred significant maternal
contribution of metallothionein mRNA. Gonzalez et al. (2005) studied 13 genes in brain,
muscle and liver tissue of zebrafish fed 5 and 13.5 µg methymercury, which led to the
finding that these genes in brain tissue did not respond to the treatment while some of the
13 genes in both the liver and muscle showed an immediate response. Karsi et al. (2005)
studied the expression of proopiomelanocortin, a gene involved in the stress response
mediated by the hypothalamic-pituitary-adrenal axis, to low-water stress in Ictalurus
punctatus. Proopiomelanocortin expression increased in response to stress, but its
19 expression appeared to be negatively regulated by the concentration of cortisol (Karsi et al., 2005).
From all of the gene expression studies mentioned earlier, it is evident that transcription changes synchronously with physiological alterations in cells. The genetic pathways of the transcriptional response to different environmental conditions may be shared or different. The main hypothesis of this experiment was that exposure of fathead minnow larvae to three stressors copper, zinc and heat would cause a small subset of differentially expressed genes to show a similar transcriptional response irrespective of the specific stressor.
20 MATERIALS AND METHODS
Pimephales promelas Larvae and Test Conditions
Fathead minnow (Pimephales promelas) larvae used for all the experiments were
from the Newtown-USEPA stock population at the Andrew W. Breidenbach
Environmental Research Center (AWBERC). The larvae were less than 24 hours post-
hatch and living on the contents of their yolk sacs, hence no food was provided either
before or during the stress exposures. All larvae appeared healthy and active at the start
of the experiments. Tests were of 48 hours duration, except for one thermal stress
experiment that lasted 24 hours. Dead larvae were removed from test water at the 24-hour
water change and at the conclusion of the 48-hour acute tests. Dead larvae were inactive,
and turned a cloudy, opaque white from a clear olive color when alive. The water used
for the experiments was standard, synthetic, moderately hard, reconstituted water
prepared in the following manner (Weber, 1993). For 20 L of standard, synthetic,
moderately hard reconstituted water (MHRW), add 19 L reverse osmosis MILLI-Q®
Super Q filtered or equivalent deionized water to a clean carboy. Add 1.20 g MgSO4,
1.92 g NaHCO3 and 0.080 g KCl to the water and then aerate the water overnight.
Dissolve 1.20 g of CaSO4.2H2O to 1 L of deionized water in a separate flask and add this
to the 19 L of prepared water. Aerate water for another 24 hours to dissolve all the chemicals and stabilize the water. pH, alkalinity and hardness are measured. The pH range should be between 7.4 and 7.8, hardness between 80-100 mg CaCO3/L and
alkalinity between 60-70 mg CaCO3/L.
21 Stress Experiments
The first set of stress experiments (A) were performed to identify stress and dose-
responsive candidate genes that responded to three stressors using the differential display technique, while the second set of experiments (B) were used to test the statistical significance of differential gene expression at a single dose of the stressor using real-time
PCR.
Copper Exposure A
Fathead minnow larvae were exposed to copper concentrations of 50 µg/L, 125
µg/L and 200 µg/L in the form of copper sulfate (in MHRW) for 48 hours. The copper
stock solution concentration was 1000 µg/L and each of the copper test solutions was
prepared by adding the appropriate amount of stock solution to 1 liter of MHRW. For
example, 50 µl of stock solution were added to 1 liter MHRW to obtain a concentration
of 50 µg/L copper solution, 200 µl of stock were added to 1 liter MHRW for a
concentration of 200 µg/L copper, etc. The toxicity test used was the static-renewal type, which meant that the control and test solutions were changed after 24 hours. There were
300 ml of each test solution in 400 ml beakers, each containing 25 larvae. The larvae were less than 24 hours post-hatch. There was a 16 hours light: 8 hours dark cycle in the exposure chamber and the temperature was maintained at 25ºC ± 1°C. The number of fish in each treatment and control group were selected with a view to collecting approximately 100 survivors in each group at the end of the exposure. A survivorship of approximately 50% was expected from the highest copper exposure of 200 µg/L. There were 100 larvae in the control group, 125 larvae in the 50 µg/L treatment, 150 larvae in
22 the 125 µg/L treatment and 250 larvae in the 200 µg/L treatment. During the changing of
test solutions after 24 hours and at the conclusion of the test, dead larvae were removed
and discarded. After 48 hours of copper exposure, survivors from the control and
experimental groups were collected and placed in clean water. Fish from at least two
beakers were pooled into a 50 ml sterile Nalgene tube so that each tube contained about
50 larvae, to be used for RNA isolation. There were two biological replicates in the
experimental and control groups, each consisting of approximately 50 fish larvae.
Copper Exposure B
Fathead minnow larvae less than 24 hours post-hatch were exposed to 200 µg/L
copper (in the form of copper sulfate). From the previous copper exposure A, it was expected that this concentration would result in approximately 50% mortality. The copper stock solution was 1000 µg/L. Six liters of the test solution were prepared by dissolving
1.2 ml of the copper stock solution in 4.8 liters MHRW. Two hundred and fifty larvae
served as controls, while 500 larvae were exposed to the 200 µg/L copper solution. The
experimental conditions were exactly the same as in exposure A. Test and control solutions were changed after 24 hours and dead larvae were removed and discarded. At
the end of the 48-hr exposure, dead larvae were discarded and surviving fish from at least
two test chambers pooled together so that there were approximately 40-50 fry in each 50
ml Nalgene tube, to be subsequently used for RNA isolation. Therefore, there were at
least 5 replicates in the control and experimental groups.
23 Zinc Exposure A
Zinc sulfate (ZnSO4.7H2O) was used to prepare a 1000 µg/L stock solution.
Concentrations of 200 µg/L, 400 µg/L, 600 µg/L and 900 µg/L were prepared by adding
the appropriate amount of stock solution to MHRW. Twenty-five fish, less than 24 hours
post-hatch, were placed in 300 ml test solution in a 400 ml beaker. At the beginning of
the toxicity test, there were 100 larvae in the control group, 125 larvae in the 200 µg/L
treatment, 150 larvae in the 400 µg/L treatment, 200 larvae in the 600 µg/L treatment and
500 larvae in the 900 µg/L treatment. The zinc toxicity test lasted 48 hours. The
experiment chamber had 16 hours light: 8 hours dark cycle and a temperature of 25ºC ±
1°C. Test and control solutions were changed after 24 hours and dead larvae were
discarded at this stage. Following the 48-hour exposure period, dead larvae were
discarded while survivors from the control and experimental groups were collected and put in clean water. Fish from at least two beakers were pooled into a 50 ml sterile
Nalgene tube so that each tube contained approximately 50 larvae, to be used for RNA isolation.
Zinc Exposure B
Fathead minnow larvae less than 24 hours post-hatch were exposed to 800 µg/L
zinc (in the form of zinc sulfate). Approximately fifty percent mortality was expected in
the zinc-treated group, based on the results of experiment A. The zinc stock solution was
1000 µg/L. There were 300 ml MHRW in 500 ml plastic containers, each containing 25
larvae. To each of the test containers, 240 µl of the zinc stock solution were added
individually. Two hundred and fifty larvae served as controls, while 500 larvae were
24 exposed to the 800 µg/L zinc solution. The experimental conditions were exactly the
same as in exposure A. Test and control solutions were changed after 24 hours and dead
larvae removed and discarded. At the end of the 48-hr exposure, dead larvae were
discarded and survivors from at least two test chambers pooled together to obtain 40-50 fish in each 50 ml Nalgene tube, for immediate use in RNA isolation. There were at least five replicates in the control and experimental groups, each replicate consisting of 40-50 larvae.
Thermal Stress Experiment A
The thermal stress experiment was carried out for 24-hour and 48-hour time
periods. Therefore, there were two controls for each of the time periods. MHRW was placed in four 1-liter glass beakers. The volume of water in each container was approximately 1 liter. One hundred fish larvae were placed into each of two beakers designated as the 24-hr control and 48-hr control containers. One hundred and fifty fish were placed in the 24-hr test beaker, while 250 fish were placed in the 48-hr test beaker.
All fish larvae were less than 24 hours post-hatch. The two control beakers were placed in an environmental chamber at 25ºC ± 1°C that had a 16 hours light: 8 hours dark cycle.
The test containers were placed in an environmental chamber set at 36ºC ± 1°C with a 16 hours light:8 hours dark cycle. Fish larvae were placed into test containers at the start of the experiment. After 24 hours, surviving fish were collected from the 24-hr test control and experimental groups. After 24 hours, water from the 48-hr test and control solution was also changed. The experimental group received 36ºC water previously incubated in an environmental chamber. Dead fish were removed and discarded at this stage. At the
25 end of the 48-hr exposure period, dead larvae were discarded and survivors from the control and experimental containers collected in 50 ml Nalgene containers for RNA isolation. There were approximately 50 fish larvae in each Nalgene container.
Thermal Stress Experiment B
Thermal stress experiment B was a 48-hr exposure at 36ºC. Two hundred and fifty larvae served as controls, while 500 larvae were stressed at a temperature of 36ºC.
Fifty percent mortality was expected in the experimental group, based on earlier survivorship results from experiment A. Twenty-five larvae were placed in 300 ml
MHRW in 500 ml volume plastic containers. The control fish were placed in an environmental chamber at 25ºC ± 1°C with a 16 hours light: 8 hours dark cycle. The experimental group fish were placed in an environmental chamber set at 36ºC ± 1°C with a 16 hours light: 8 hours dark cycle. The fish in the experimental group were allowed to acclimate to the 36ºC temperature gradually. It took approximately 60 minutes for the water temperature to reach 36ºC from room temperature. Test and control solutions were changed after 24 hours and dead larvae removed. The test solution was incubated within the environmental chamber at 36ºC so that there would be no sudden temperature changes during the water transfer. After the 48-hr exposure period, dead larvae were discarded and 40-50 surviving fish pooled together in a sterile Nalgene tube along with the water from the test containers for RNA isolation. There were at least five replicates in the control and experimental groups, each consisting of between 40-50 fish larvae.
26 RNA Extraction
Total RNA was extracted from the pooled larvae in each Nalgene tube. At this
stage, the larvae would have been ≤ 72 hours post-hatch. Larvae from a single Nalgene
tube were placed into a 15 ml round-bottom plastic tubes and excess water removed using
disposable plastic Pasteur pipettes. One ml of Tri-Reagent LS (MRC Inc., Cincinnati,
OH) was added to 0.25 to 0.35 ml water with larvae (3 volumes Tri-Reagent: 1 volume
liquid sample) and the contents homogenized with a Tissue Tearor homogenizer (model #
985-370, Fisher Scientific). The homogenized contents in Tri-Reagent were transferred to
1.5 µl Eppendorf tubes. To the homogenized contents was added 0.14 ml
bromochloropropane (BCP) for separation of the homogenate into aqueous and organic
phases. The tubes were vortexed for 15 seconds and incubated at room temperature for 15
minutes. The tubes were centrifuged at 15,000 g for 15 minutes at 4ºC. Following
centrifugation, the contents separated into a colorless aqueous phase containing the RNA
and an organic pink-colored phase containing DNA and proteins. The aqueous phases
were transferred to fresh 1.5 µl Eppendorf tubes. To each of the aqueous layers was
added 0.7 ml of 100% isopropanol (at room temperature) to precipitate the RNA. The
tubes were incubated at room temperature for 15 minutes and centrifuged at 15,000 g for
15 minutes at 4ºC. The supernatants were discarded and 45 µl of nuclease-free (NF)
water (Sigma Aldrich, St. Louis, MO) were added to each pellet. To each tube, 5 µl of 7.5
M ammonium acetate were added and pipetted up and down to dissolve the pellet. To this mixture were added 120 µl of cold 100% ethanol. The tubes were frozen overnight in a -
20ºC freezer. The tubes were centrifuged the next day at 15,000 g for 15 minutes at 4ºC, supernatants discarded and 45 µl of NF-water added to the remaining pellets. Following
27 dissolution of the RNA pellets, the contents were treated with DNase using the DNA-free
kit (Ambion, Austin, TX) to remove any DNA that might have been present in the RNA
pellets. To each tube were added 5 µl of 10X DNase I buffer and 1 µl of rDNase I
enzyme (2 U/µl), and the mixture was incubated at 37ºC for 30 minutes in a heat block.
Following this, 5 µl of DNase inactivation slurry were added to inactivate the DNase I
enzyme and the tubes incubated at room temperature for 5 minutes. The tubes were
centrifuged at 10, 000 x g for 5 minutes and the supernatants containing the RNA
transferred to fresh 1.5 µl Eppendorf tubes. The ammonium acetate-ethanol step
(summarized above) was repeated and the contents frozen overnight in a freezer set at
-80ºC. The following day, the contents were centrifuged at 15,000 g for 15 minutes at
4ºC and RNA pellets retained. To each tube were added 45 µl NF-water. This RNA
solution was distributed into 9 µl aliquots. Four of these aliquots were stored at -80ºC for
further analysis. RNA was analyzed for concentration and integrity. Unless otherwise
stated, all reactions were carried out at room temperature.
To samples from experiments B, 5 ng of Brome Mosaic Virus (BMV) RNA
(Promega, Madison, WI) in 0.4 X Bovine Serum Albumin (Invitrogen, Carlsbad, CA)
were added to each of the individual tubes immediately after homogenization of the fish
in Tri-Reagent (Shibata et al., 1999). The BMV RNA served as the exogenous standard
(calibrator) for real-time PCR analyses. BMV is a single-stranded RNA virus that
normally infects grasses and some other plants, and is thought to be transmitted by
nematodes (Description of Plant Viruses – www.dpv.net). It has no DNA stage. BMV is
not known to infect fish or use them as vectors. BMV RNA is responsible for the translation of four proteins – 1a, 2a, 3a and coat protein. The BMV genome, consisting of
28 8216 nucleotides, has been completely sequenced (Ahlquist et al, 1981; Ahlquist et al.,
1984) and the functions of the four genes contained therein are also known. The first
RNA1 (3234 bps) encodes P1 (methyltransferase and helicase), RNA2 (2865 bps)
encodes P2 (RNA polymerase), RNA3 (2117 bps) encodes p3a (cell-cell movement of
virus, and, capsid protein) and RNA4 (816 bps) encodes the capsid protein (Dasgupta and
Kaesberg, 1982; Dinant et al., 1993; Mise et al., 1993). BMV is used as a molecular
marker weight size marker or as a positive control for translation reactions (Promega,
Madison, WI). BMV RNA was not added to fathead minnow RNA samples from
experiments A.
RNA Analysis
RNA quality was examined on a 10 x 6.5 cm 1.5% formaldehyde-agarose gel.
RNA loading dye was prepared by adding 15 µl of 10 mg/ml ethidium bromide to 150 µl
of bromophenol blue in 50% glycerol. Fresh RNA sample buffer consisted of 50%
formamide, 1X MOPS and 2M formaldehyde. The RNA sample was prepared for a gel
run by adding 3.0 µl RNA sample to 15.5 µl RNA sample buffer and 1.5 µl of the RNA
loading dye. This sample was denatured at 65ºC for 15 minutes, followed by chilling the
tubes on ice immediately for 2 minutes. The gel apparatus was first rinsed with 0.1N
NaOH to destroy RNases that may have been present. To prepare the gel, 0.3 g reagent
grade agarose was melted in 14.5 ml dH20 and 2 ml 10X MOPS running buffer (10X
MOPS: 0.2 M MOPS at pH 7, 0.05 M sodium acetate and 0.01 M EDTA at pH 7) in a microwave oven. When the solution cooled to 65ºC, 3.5 ml reagent grade formaldehyde was added and mixed well for a final concentration of 17.5%. This solution was then
29 poured into a gel tray with a comb and allowed to set for at least 20-30 minutes. The gel
was run submerged in 220-250 ml of 1X MOPS running buffer without formaldehyde.
The gel was electrophoresed at 20 volts for 5-6 hours and visually observed on a short-
wave ultraviolet light box. The integrity of the RNA was determined by visual
examination of distinct 28S and 18S rRNA bands. The 28S rRNA band should be
approximately twice as intense as the18S rRNA band. RNA samples from experiments B
were analyzed by contract on an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo
Alto, CA) for more accurate analyses of RNA quality. The Agilent 2100 Bioanalyzer
generates both gel and spectrophotometric data.
All RNA samples were dissolved in TLE buffer for spectrophotometric analysis.
TLE consists of 10 mM Tris and 0.1 mM EDTA at a pH of 8.0. A 1:100 dilution of RNA
(2.5 µl RNA + 247.5 µl TLE buffer) was prepared and read on a Shimadzu
spectrophotometer (Shimadzu Scientific Instruments, Columbia, MD) to determine RNA
purity and concentration. Optical density (in O.D. units) was measured at 260 and 280
nm. A 260/280 ratio greater than 1.8 indicates RNA of good quality. RNA concentration was determined using the following equation, based on a conversion factor of 1 O. D. at
260 nm being equal to 40 µg/ml of RNA:
RNA concentration = O.D.260 x 40 x dilution x 0.001 µg/µl (1)
RNA recovery per fish was estimated by dividing the final RNA concentration in
µg/µl by the number of fish within each sample. RNA recovered per fish was compared
within all treatments of an experiment. A one-way ANOVA with α=0.05 was performed
30 with experiment B samples (N = 5) to test for significant differences between the mean
amount of RNA from the control groups versus the mean amount of RNA recovered from
the stress-treated groups. A difference in mean values with an associated probability of
≤0.05 was considered statistically significant. Microsoft Excel was the computer software used for performing the ANOVAs.
Differential Display
The differential display technique involves the following general steps. Single-
stranded cDNA is produced from mRNA templates using reverse transcription. This
cDNA is then amplified by the polymerase chain reaction (PCR) to obtain several
double-stranded fragments. This amplified cDNA is screened on a denaturing
polyacrylamide gel, from which bands of interest can be excised and further amplified by
PCR. An advantage of differential display is that gene expression from several treatment groups can be simultaneously screened.
Reverse Transcription for First Strand cDNA Synthesis
The procedure for the differential display technique is found in the manual for the
fluoroDD HIEROGLYPH mRNA Profile Kit System for Differential Display (Beckman
Coulter Inc., Fullerton, CA). Total RNA collected from each experiment was diluted to
0.1 µg/µl using NF water. To 2 µl each of this diluted RNA were added 2 µl each of
anchored primers 1-6 (T7 dT12) from the kit. The sequences of the 6 anchored primers
(APs) used are listed below, with the underlined portions denoting the T7 sequence tag, which are followed by the polyT region with the 2 unique base pairs.
31 1. T7(dT12)AP1: 5’ACGACTCACTATAGGGCTTTTTTTTTTTTGA 3’
2. T7(dT12)AP2: 5’ACGACTCACTATAGGGCTTTTTTTTTTTTGC 3’
3. T7(dT12)AP3: 5’ACGACTCACTATAGGGCTTTTTTTTTTTTGG 3’
4. T7(dT12)AP4: 5’ACGACTCACTATAGGGCTTTTTTTTTTTTGT 3’
5. T7(dT12)AP5: 5’ACGACTCACTATAGGGCTTTTTTTTTTTTCA 3’
6. T7(dT12)AP6: 5’ACGACTCACTATAGGGCTTTTTTTTTTTTCC 3’
The RNA and APs were mixed in 0.2 ml thin-walled PCR tubes by pipetting up and
down and then incubated at 70ºC for 5 minutes. To each tube were added 16 µl of the RT
(reverse transcription) core mix (Table 4).
Table 4: Preparation of the RT Core mix (HIEROGLYPH, Beckman Coulter Inc) RT reaction Stock 1x reaction volume Final component concentration (16 µl) concentration Nuclease-free water -- 7.8 µl -- SuperScript II RT 5X 4.0 µl 1X buffer dNTP mix (1:1:1:1) 250 µM each 2.0 µl 25 µM each Dithiothreitol (DTT) 100 mM 2.0 µl 10 mM SuperScript II RT 200 units/µl 0.2 µl 2 units/µl enzyme
The RNA-AP-RT mixture was placed in a 0.5 ml GeneAmp® PCR System 9700 thermal
cycler (Applied Biosystems, Foster City, CA) using the following program: 42ºC for 5 minutes, 50ºC for 50 minutes, 70ºC for 15 minutes, followed by a hold at 4ºC. The tubes were removed and stored in a -20ºC freezer until required for PCR.
PCR of cDNAs with Arbitrary Primers and Fluorescent-Labeled Anchored Primers
Following first strand cDNA synthesis, the cDNA was amplified using
tetramethylrhodamine (TMR)-labeled anchored primers and any one of 20 different
32 arbitrary primers (ARPs) from the HIEROGLYPH kit (Beckman Coulter Inc., Fullerton,
CA). The sequences of the twenty 10-bp-long arbitrary primers are in Table 5, with the underlined portions denoting the M13 sequence tagged onto the primer. The reaction mixture for each PCR is shown in Table 6.
Table 5: HIEROGLYPH (Beckman Coulter Inc.) arbitrary primer sequence information. M13r-ARP1 5’ ACAATTTCACACAGGACGACTCCAAG 3’ M13r-ARP2 5’ ACAATTTCACACAGGAGCTAGCATGG 3’ M13r-ARP3 5’ ACAATTTCACACAGGAGACCATTGCA 3’ M13r-ARP4 5’ ACAATTTCACACAGGAGCTAGCAGAC 3’ M13r-ARP5 5’ ACAATTTCACACAGGAATGGTAGTCT 3’ M13r-ARP6 5’ ACAATTTCACACAGGATACAACGAGG 3’ M13r-ARP7 5’ ACAATTTCACACAGGATGGATTGGTC 3’ M13r-ARP8 5’ ACAATTTCACACAGGATGGTAAAGGG 3’ M13r-ARP9 5’ ACAATTTCACACAGGATAAGACTAGC 3’ M13r-ARP10 5’ ACAATTTCACACAGGAGATCTCAGAC 3’ M13r-ARP11 5’ ACAATTTCACACAGGAACGCTAGTGT 3’ M13r-ARP12 5’ ACAATTTCACACAGGAGGTACTAAGG 3’ M13r-ARP13 5’ ACAATTTCACACAGGAGTTGCACCAT 3’ M13r-ARP14 5’ ACAATTTCACACAGGATCCATGACTC 3’ M13r-ARP15 5’ ACAATTTCACACAGGACTTTCTACCC 3’ M13r-ARP16 5’ ACAATTTCACACAGGATCGGTCATAG 3’ M13r-ARP17 5’ ACAATTTCACACAGGACTGCTAGGTA 3’ M13r-ARP18 5’ ACAATTTCACACAGGATGATGCTACC 3’ M13r-ARP19 5’ ACAATTTCACACAGGATTTTGGCTCC 3’ M13r-ARP20 5’ ACAATTTCACACAGGATCGATACAGG 3’
Table 6: Composition of PCR reaction mixture for amplification of cDNAs using fluorescent anchored primers and arbitrary primers from the HIEROGLYPH kit. Component of Stock 1X reaction Final reaction concentration volume (10 µl) concentration Nuclease-free water -- 1.95 µl -- PCR buffer II 10X 1.0 µl 1X MgCl2 25 mM 1.5 µl 3.75 mM dNTP mix (1:1:1:1) 250 µM each 2.0 µl 50 µM each 5’ARP 2 µM 1.75 µl 0.35 µM 3’TMR-AP 10 µM 0.7 µl 0.70 µM RT mixture -- 1.0 µl -- Taq polymerase 5 units/µl 0.1 µl 0.05 units/µl
33 The 10 µl reactions were put in 0.2 ml tubes and placed in the 0.5 ml GeneAmp® PCR
System 9700 thermal cycler (Applied Biosystems, Foster City, CA) using the following program in 5 stages:
Stage 1: Denaturation at 95ºC for 2 minutes
Stage 2 (4 cycles): Denaturation at 92ºC for 15 seconds, annealing with primers at 50ºC for 30 seconds and extension at 72ºC for 2 minutes.
Stage 3 (30 cycles): Denaturation at 92ºC for 15 seconds, annealing with primers at 60ºC for 30 seconds and extension at 72ºC for 2 minutes
Stage 4: Extension at 72ºC for 7 minutes
Stage 5: Holding stage at 4ºC.
Differential Display of cDNAs on Polyacrylamide Gels
To the 10 µl reactions from the cDNA amplification step were added 3.75 µl of fluoroDD loading dye (Beckman Coulter Inc., Fullerton, CA). The tubes were returned uncapped to the thermal cycler and heated at 95ºC for 3:45 minutes for denaturation and concentration, then cooled down to 4ºC.
Low fluorescence glass plates (33 x 61 cm), one notched and one unnotched (P/N
146640, Beckman Coulter Inc.), were prepared in the following manner for running a polyacrylamide gel. The unnotched plate was cleaned with distilled water. It was then dried with lint-free paper towels (Kim wipes), laid down and precisely aligned on the
Beckman Coulter grid (P/N 146134). Both the unnotched glass plate and grid were held in position within the gel platform of the Excision workstation (P/N 146133, Beckman
Coulter Inc.). Using a pair of forceps, one circular donut-shaped self-adhesive permanent
34 reinforcement label (Avery #05722, Brea, CA) was placed on the unnotched plate to
encircle the grid spot labeled 1A. Another label was used to encircle the grid spot 19H on the unnotched glass plate. These two donut-shaped labels were used to align the unnotched plate to a grid, used for estimating the area of band collection from the gel.
The glass surface with the labels was the outer surface. The unlabeled inner surface was used to prepare the gel. The notched plate was cleaned in a similar manner. One side was treated with glass shield (P/N 146074, Beckman Coulter Inc) to make it water-repellent.
This side of the plate was used to prepare the gel. Prior to pouring a gel, both sides of the unnotched plate were cleaned with 10 N sodium hydroxide followed by several rinses with distilled water. Sodium hydroxide washes were done to make the plate surfaces hydrophilic. The notched plate was cleaned with distilled water and 70% alcohol. Spacers
(250 µm thick, 61 cm long) and combs (48-well sharkstooth, 250 µm thickness) (P/N
146607, Beckman Coulter Inc.) were cleaned with distilled water. The dry unnotched plate was placed on a dry/wash tray (P/N 146124, Beckman Coulter Inc) with raised pegs to hold it up from the drainage area below. The two spacers were laid along the length of the plate and a thin film of distilled water was used to hold them in place around the long edges of the unnotched plate.
A 5.6% denaturing polyacrylamide gel was prepared by mixing together 100 ml
5.6% HR-1000 gel matrix (P/N 146640, Beckman Coulter Inc.), 800 µl 10% ammonium
persulfate (freshly prepared) and 80 µl TEMED (N,N,N',N'-tetramethylethylenediamine).
This mixture was poured onto the clean, low fluorescence unnotched glass plate, and the
gel prepared by placing a notched glass plate over the liquid. Care was taken to ensure
that no large air bubbles were present in the gel. The comb was inserted with its flat
35 surface towards the gel and its 48-toothed surface facing out. Large binder clips were
used to clamp the unnotched plate, notched plate and comb together along three edges.
The bottom edge of the gel was not clamped so that excess gel could flow out. The gel was allowed to polymerize for at least one hour. Following gel polymerization, binder clips were removed and the outer sides of plates cleaned with distilled water. The polymerized gel was scanned on the GenomyxLRTM Fluorescent Imaging Scanner (P/N
146515, Beckman Coulter Inc.) to obtain a flat field baseline scan for later comparison
with a cDNA scan. The notched plate faced the inside of the scanner. The baseline scan
allows the computer to subtract any background signals and hence improves the signal to
noise ratio. Following the baseline scan, the gel was returned to the wash/dry tray. The
comb was removed from the gel and the now empty space cleaned well with distilled
water to remove any remaining stray traces of polymerized gel. The cavity above the main gel was flooded with distilled water. The comb was cleaned and reinserted into the gel, with the toothed points making contact with the gel surface. The space between two teeth of the comb comprised the wells into which cDNA samples were to be loaded. The
assembled plates were placed inside the GenomyxLR electrophoresis system (P/N
146000, Beckman Coulter Inc.). The upper buffer consisted of 0.5X TBE (Tris-borate-
EDTA) buffer at pH 8.3. The composition of 0.5X TBE is 5.4 gm Tris base, 2.75 gm
boric acid and 2 ml 0.5M EDTA at pH 8.0 made up to 1 liter with distilled water. The
lower buffer was 1X TBE at pH 8.3. The composition of 1X TBE is 10.8 gm Tris base,
5.5 gm boric acid and 4 ml 0.5M EDTA at pH 8.0 made up to 1 liter with distilled water.
The concentrated and denatured cDNA samples were loaded into wells in the gel using
ART 10 REACH pipette tips (Molecular BioProducts, Inc., San Diego, CA). Each sample
36 was run twice on the polyacrylamide gels using two different programs. The first
program was run at 2700 volts for 2.5 hours to obtain cDNA sequences ≤ 500 base pairs.
The same samples were run at 3000 volts for 5 hours to obtain cDNA bands 500 bp – 2 kb in size. Following the gel run, the outside of the glass plates was cleaned with distilled
water. The sandwich gel was scanned on the GenomyxLT™ Fluorescent Imaging
Scanner. Visually detectable differentially expressed bands (between controls and
treatment or between levels of treatment) were selected on the computer gel scan. A
virtual computer grid, which was in a computer file, was superimposed on the gel scan to
map out the position of selected bands on the gel. Selected bands were numbered on the
computer and on the grid. The sandwich gel was removed from the scanner and laid on
the wash/dry tray. The notched plate, comb and spacers were separated from the
unnotched plate with the gel. The gel was washed three times with distilled water to
remove all urea and dried each time for 10 minutes using a setting on the GenomyxLR
electrophoresis machine. Any trace of urea on the dried gel would be revealed as white
crystallized splotches, whereas urea-free gel would look clear. The actual grid
corresponding to the computer grid was marked and numbered with a permanent marker
in areas where selected bands were to be removed. The washed and dried gel was laid
onto the marked grid and selected sequences of interest were excised with a disposable
scalpel. The scraped gel slices were placed into a 1.5 ml Eppendorf tube, filled with 50 µl
TLE buffer and stored in a -20ºC freezer or 4ºC refrigerator.
37 Reamplification of Differentially Expressed Bands
The starting material for reamplification reactions consisted of the scraped gel bands in TLE buffer. The PCR setup for band reamplification is shown in Table 7 and used 24-mer M13 reverse and 22-mer T7 forward primers. The reamplification buffer used in this step had the following concentrations: 335 mM Tris-Cl, pH 8.8, 83 mM ammonium sulfate, 33.5 mM magnesium chloride, 33.5 µM disodium EDTA and 50 mM dithiothreitol.
Table 7: PCR setup for reamplification of differentially expressed cDNA bands. PCR component Stock concentration 1X reaction (20 µl) Final concentration Nuclease-free water -- 8.2 µl -- Reamplification 5X 4.0 µl 1X buffer dNTP mix (1:1:1:1) 1 mM 1.6 µl 20 µM M13 reverse primer 2 µM 2.0 µl 0.2 µM T7 forward primer 2 µM 2.0 µl 0.2 µM Taq polymerase 5 Units/µl 0.2 µl 0.05 units/µl Gel band in TLE 2.0 µl --
Tubes filled with the reaction mixture were placed in a 0.5 ml GeneAmp® PCR
System 9700 thermal cycler (Applied Biosystems, Foster City, CA) using the following cycling parameters: 95ºC denaturation for 2 minutes, followed by 30 cycles of 92ºC for 2 minutes, 60ºC for 0.30 minutes and 72ºC for 2 minutes. The 30 cycles were followed by an extension temperature of 72ºC for 7 minutes, and a hold at 4ºC. Following the reamplification reaction, DNA products were run on a 1.5% agarose gel at 200 volts for 2 hours. The running buffer was 0.5X TBE, 2 µl loading dye were used with each DNA sample and ethidium bromide was the stain used to view bands under short- or longwave ultraviolet light. Bands were usually between 100 and 1000 bps long. Bands from each lane were cut out and placed in fresh 1.5 ml Eppendorf tubes. If the reamplification step generated more than one band per reaction, all bands were cut and labeled as a, b, c, etc.
38 The bands were purified immediately using the MinElute kit or else stored in a -20ºC freezer.
Sequencing of selected bands obtained using differential display
Purification of DNA
Cut bands, either frozen or directly cut from a gel, were purified using the
MinElute gel extraction kit (Qiagen Inc., Valencia. CA). To each gel slice were added
500 µl of QG buffer (MinElute kit). The tube containing the gel slice in QG buffer was incubated in a heat block at 50ºC for one hour. During the incubation period, the tube was vortexed 2-3 times to ensure maximum dissolution of DNA. Following incubation, 150
µl of 100% isopropanol were added to this mixture to dilute the solution. The contents were then placed in a 2 ml collecting tube and centrifuged at 10, 000 g for 1 minute. The filter with the bound DNA was washed first with 500 µl QG buffer and centrifuged at
10, 000 g for 1 minute. A second wash consisted of 750 µl PE buffer (MinElute kit) on the filter. The tube was centrifuged at 10, 000 g for 1 minute. After discarding the collected liquid, the tube was centrifuged at 10, 000 g to eliminate as much PE buffer as possible. The column, with the filter and purified DNA, was placed in a sterile 1.5 ml
Eppendorf tube. Ten µl of EB buffer (MinElute kit) were added to the center of the filter and the tube was incubated at room temperature for 10 minutes. The tubes were centrifuged at 10, 000 g for 2 minutes and purified DNA collected in the Eppendorf tube.
DNA was quantified using the PicoGreen kit (Molecular Probes, Inc., Eugene,
OR) to ensure that there was a sufficient quantity (over 10 ng/ml) for sequencing reactions. The procedure was performed as follows. A standard 1000 ng DNA/ml
39 solution was prepared using Lambda HinD III dsDNA stock of 100 µg/ml (PicoGreen
kit). This stock was serially diluted in a 1:50 ratio with TLE buffer 10 times to obtain
concentrations of 1000 ng/ml, 667 ng/ml, 444 ng/ml, 296 ng/ml, 198 ng/ml, 132 ng/ml,
88 ng/ml, 59 ng/ml, 39 ng/ml, 26 ng/ml, 17 ng/ml and 0 ng/ml. These were pipetted in 50
µl volumes into the first twelve wells of a 96-well microplate. Unknown DNA samples
were diluted with TLE buffer in a 1:1000 ratio. Fifty µl of each diluted DNA solution
were added to the wells of the microplate. Stock PicoGreen solution was diluted 1:200 in
TLE buffer. To each of the wells were added 50 µl of the diluted PicoGreen solution. The
samples were mixed by repeatedly pipetting up and down. The microplate was scanned
using the FluorImager 595 multi-purpose fluorescence scanner (Amersham Biosciences
Inc., Sunnyvale, CA) and unknown DNA concentrations determined by comparison to
the standard curve. A typical standard curve generated using known standards is shown in
Figure 1. Following 676 analyses (entire copper batch), it was determined that the
MinElute method yielded adequate quantities of DNA. Therefore, concentration estimation was deemed unnecessary for the remaining samples from the zinc and thermal stress experiments.
40 35000.00
30000.00
25000.00
20000.00
15000.00 Median signal 10000.00
5000.00
0.00 0.00 91.00 182.00 274.00 366.00 456.00 547.00 639.00 731.00 821.00 912.00 DNA concentration in ng/ml
Figure 1: A typical standard curve showing the median fluorescence signal (excitation maximum at 498 nm and emission maximum at 520 nm) from DNA standards using PicoGreen dye.
DNA Sequencing
After reamplification, isolation on an agarose gel and purification, cDNA was sequenced. The DNA sequencing reactions of selected bands were prepared as shown in
Table 8. The sequencing buffer consisted of 200mM Tris and 5 mM MgCl2 at pH 9.0.
Table 8: PCR setup for DNA sequencing. PCR component Stock concentration 1X reaction (20 µl) Final concentration Nuclease-free water -- 5.4 µl -- M13 primer 2 µM 1.6 µl 0.16 µM Sequencing buffer 5X 6.0 µl 1.5X BigDye 3.0 Reaction mix 2.0 µl -- DNA template -- 5 µl --
41 The reaction mixtures in thin-walled PCR tubes were run in a thermal cycler with
the following conditions: 35 cycles of 96ºC for 30 seconds, 50ºC for 15 seconds and 60ºC
for 4 minutes, followed by a holding temperature of 4ºC. Reactions were then purified of
terminator dyes using Performa DTR Gel Filtration Cartridges or Performa DTR 96-Well
Plate Kits (standard or short plates, Edge BioSystems, Gaithersburg, MD) following the
manufacturer’s specifications. Cartridges were used if only a small number of reactions
had to be purified, while plates were used for purifying 96 reactions at a time. When cartridges were used, tubes were centrifuged at 750 x g for 2 minutes. The original tube was discarded and the inner cartridge transferred to a fresh tube. The contents of the sequencing reaction were added to the cartridge gel and tubes centrifuged at 750 x g for 2 minutes. The eluate was the purified sequencing reaction. When DTR 96-well Standard
Plates were used, the 96-well standard plate was stacked onto the 96-well flat bottom polystyrene receiving plate. The plate was centrifuged at 850 x g for 3 minutes. The receiving plate was discarded and the 96-well standard plate was stacked onto a 96-well
V-bottom receiving plate. Sequencing reactions (20 µl) were added to the filtration gel in each well of the standard plate and the plate was centrifuged at 850 x g for 3 minutes.
The eluates were the purified sequencing reaction. When 96-well Performa DTR short- plate kits were used, the short plate and flat bottom receiving plate were first centrifuged at 850 x g for 2 minutes. The receiving plate was discarded and the short plate was put onto the 96-well V-bottom plate. Ten µl of sequencing reaction was added to the gel in each well, and the plate centrifuged at 850 x g for 5 minutes. The eluates were the purified sequencing reactions.
42 Purified sequencing reactions (10 µl volume from short plates, 20 µl from
cartridges or long plates) were loaded into an ABI 96-well optical plate and read on an
ABI 3100 Automated Capillary DNA Sequencer (Applied Biosystems, Foster City, CA).
The quality of the sequence reads was visually evaluated based on sharp peaks and
negligent amount of background signal. Reads judged to be good were over 200 bp in
length and had few indeterminate nucleotides. A typical good DNA sequence read is
shown in Figure 2.
Figure 2: A typical DNA sequence judged to be a good read with little background signal, high peaks and clearly identifiable nucleotides.
Sequence Identity Searches
Putative DNA sequence identity was determined by searching in the National
Center for Biotechnology Information nucleotide database (http://www.ncbi.nlm.nih.gov) using the BLAST tool (Altschul et al., 1997) with the default maximum e-value set at 10.
An e-value < 10-4 was considered as the criterion for a good BLAST match. All
differential display sequences were searched in the NCBI database, irrespective of
whether the sequences had a good read or not. This was done to establish sequence
identity and to identify commonly affected genes between different stress experiments.
The closest homologous match to gene entries in the NCBI library, its e-value, accession
number and identity, was recorded as the differential display band identity. Those
43 sequences that had no BLAST hits were classified as having “no significant similarity”
(NSS).
Quantitative Measurement of Gene Expression
Real-time reverse transcription PCR, and specifically the relative quantification or
comparative method, was the technique employed to validate the expression of twenty-
three candidate genes obtained from differential display. The technique can be
summarized as follows: RNA is converted to cDNA using reverse transcriptase, PCR
with gene-specific primers is carried out using the template cDNA, and, real-time
instruments quantify DNA after every amplification cycle. A fluorescent dye is incorporated into the DNA amplicon and its emission is detected by the instrument.
When the fluorescence rises above a baseline value, sometime during the exponential growth phase of the PCR, it begins to be read as a signal. Therefore, the higher the number of the cDNA templates, the lower will be the detection value that the instrument measures.
Real-time PCR instruments detect the kinetics of PCR product accumulation
within each well of a reaction plate (Saunders, 2004). This product, bound with a
fluorescent dye, is detected only when the target DNA sequence has been amplified to
yield several amplicons with the incorporated dye. The dye first used in this technique
was ethidium bromide (Higuchi et al., 1993). SYBR Green I has replaced ethidium bromide in singleplex reactions. Other dyes such as FAM, TAMRA and JOE are used for multiplex real-time PCR with nucleic acid probes (Lee et al., 2004). At the beginning of a PCR reaction, no fluorescence signal is detected. Real-time PCR instruments can detect
44 amplicons during the exponential phase when the amplification efficiency of a reaction is
100%, meaning that the PCR product is doubled with each cycle (Saunders, 2004). As
DNA quantities reach ng/µl concentrations during the progress of a PCR, the efficiency is reduced because the amplicons re-associate in the annealing stage of a 3-step PCR cycle
(Saunders, 2004). A PCR reaction starts out in the linear phase (first 10-15 cycles,
proceeds to the exponential phase and finally goes into a plateau phase when there is no
net synthesis of DNA amplicons (Saunders, 2004; Wong and Medrano, 2005). Real-time
PCR machines quantify the amount of DNA product by measuring the number of cycles needed for the fluorescent signal to reach a threshold level (CT = threshold cycle) or the
second derivative maximum of the fluorescence versus cycle number (Saunders, 2004).
This signal is proportional to the original amount of template present at the start of a reaction, assuming a reaction efficiency of 100%. Therefore, the fewer the number of template DNA strands at the start of the reaction, the larger will be the CT –value and vice versa.
There are two methods used for measuring mRNA transcripts: one is absolute
quantification and the other is relative quantification (the comparative method). For use
of absolute quantification, it is necessary to have a standard curve prepared from serially
diluted known amounts of DNA standards and it is important that all primer pairs have
the same reaction efficiency (Wong and Medrano, 2005). In relative quantification, either
an internal or external reference sample (the calibrator) is required for normalization of
expression due to differences in tissue extracts, total RNA concentration and PCR
methodology. Relative quantification assumes equal reaction efficiencies of the calibrator
and target gene-specific primers.
45 Primer Design
Primers for 23 selected gene sequences (obtained from sequencing differential display bands) and an exogenous reference gene (BMV) were designed using the Primer
Express® v2.0 software (Applied Biosystems, Foster City, CA). The 23 selected gene
sequences with annotations and identities can be found in Appendix 1. These primers
were designed to have an annealing temperature between 58-60ºC and 30-80% GC content. The program selects for PCR amplicons 50-150 base pairs long as they promote high-efficiency amplification (Sequence Detection Systems Chemistry Guide, Applied
Biosystems, 2003). The twenty-three primer pairs used are listed in Table 9. Table 9 also lists 18S universal primers that were used for experiment A samples, but does not state sequence information because these were patented primers purchased from Ambion
(Austin, TX).
46 Table 9: Primers used for real-time polymerase chain reaction.
Sequence no. Accession no. Forward Primer Reverse Primer %GC Expected Expected (5’Æ 3’) (5’Æ 3’) amplicon Tm of size (bps) amplicon (ºC) 18S (universal) -- Ambion (proprietary) Ambion (proprietary) -- 315 -- BMV (Brome Mosaic Virus) NC_002026 TTTTGGACTGAAG CTTCGAGCGC 53 72 81 AGGACTTATTCG TTGGTCTTG QPCR1: aldolase B (Danio NM_194367.3 AGGCTGGGA GCTTGTATTCCC 49 69 79 rerio) CAGGATGCT TTTTGATGCAA QPCR2: skeletal D50028.1 TGCCCCTCCTG TGGAGAGGGA 60 62 84 α-actin (Cyprinus carpio) AGCGTAAG AGCCAGGAT QPCR3: α-tropomyosin (Danio NM_131105 TTTTCTTCCATGT TGCTCCATCC 45 73 78 rerio) TTCTGTCTTTTTC CCACTGAGA QPCR4: NM_021278.1 CCGTCAAAAGAA TGCATAGAAGAGT 49 73 80 β-thymosin (Mus musculus) ACCATTGAACA GGAGAACGAGTT QPCR5: carboxypeptidase B AB099302.1 CGCTAGCCATGT AACCCTGTATTCA 52 71 81 (Paralichthys olivaceus) GCTCAACA CAAGGCTTTCT QPCR6: chymotrypsinogen B1 NM_212618.1 TCTCCTGCTCAG CCAGGGAAGTCG 54 68 82 (Danio rerio) ATCAACACTCA TCAGTGGTT QPCR7: cytochrome c oxidase AF294832.1 ACCTTCTTAGCC CATGCAGCGGC 49 83 80 subunit III (Oncorhynchus GTCTGCCTTA TTCGAA nerka) QPCR8: cytochrome b U66606.1 CAGAAAACTTCA ACAGGAAATAT 48 69 79 (Pimephales notatus) CCCCAGCAA CACTCGGGTTGA QPCR9: elongation factor-1 α AF485331.1 CCCTCTTGGTCGC ACGCTCTTGATGA 56 66 83 (Cyprinus carpio) TTTGCT CACCAACAG
47 Sequence no. Accession no. Forward Primer Reverse Primer %GC Expected Expected (5’Æ 3’) (5’Æ 3’) amplicon Tm of size (bps) amplicon (ºC) QPCR10: eukaryotic translation NM_173263.13 GCCAGGACCTTG TGCGCCAAGTGTA 50 66 80 elongation factor γ (Danio CATTTCC GGACTCA rerio) QPCR11: guanine nucleotide- AY423038.1 GGTTTCATGCGT CCACCCGCAGGAC 54 61 82 binding protein (Danio rerio) GCGTTTC ACAA QPCR12: fast muscle specific AY333450.1 CAGAGAGAGGCC GAGTGCAGCAGCC 60 70 84 heavy myosin chain 4 (Danio GCAAAGTG CACAAC rerio) QPCR13: isocitrate BC063967.1 GGGTGTGCGTGG CAGTCGGCAAGAC 61 76 85 dehydrogenase 2 (Danio rerio) AGACTGT CCTGAAT QPCR14: 60S ribosomal protein AY648813.1 CAGGCAAGCAGC TTCCTTCAGGGCC 58 64 83 L12 (Danio rerio) GATTGAG TTGATGA QPCR15: ribosomal protein AF401581.1 TGGTCCTGGCTGG TGCCATCATCAAT 51 63 80 L27 (Ictalurus punctatus) ACGTT GTTCTTAACAA QPCR16: proteasome 26S NM_002810.1 CGGGAGATCCAG CTCCGCGGGAGTC 56 64 83 subunit (Homo sapiens) AGAACAATG GAAT QPCR17: proteasome subunit 7 AF155581.1 GCCCAACATGGA AAGATACCAGCCG 57 63 83 beta (Danio rerio) GGAGGAT CTATTGCA QPCR18: survival motor neuron NM_212601.1 TCACCTTCGCTGG GCCCTCCTCCACT 54 68 82 domain containing 1 (Danio CTATGGT TCTTTGAG rerio) QPCR19: stathmin (Gallus NM_00100185 CCAGAAAATGGA TTCTCTTTGAATTT 44 72 78 gallus) 8.1 AGCCAACAA CTCGTTCATAGC QPCR20: Troponin T3a, fast, BC053304.1 GGAGGAGCTTGG CAGGACGACGCA 59 68 84 skeletal muscle (Danio rerio) CAAATTCA CTTACTTTCTG
48 Sequence no. Accession no. Forward Primer Reverse Primer %GC Expected Expected (5’Æ 3’) (5’Æ 3’) amplicon Tm of size (bps) amplicon (ºC) QPCR21: titin (Danio rerio) AY081167.1 TGCCAACATCTCT GCTCTGGCCAAAT 42 71 77 GGATTTCC GGTTGA QPCR22: Troponin TnnT3b AF425741.1 CCTTCATTCAGCA CCGCCTTTGATAG 48 67 79 (Danio rerio) GGCATCTC CCTCTGAT QPCR23: Fast muscle troponin AF425744.1 GCCGCAGGCATC CCGCTTCCAGCAG 58 60 83 I (Danio rerio) ATTTG ATTGAA
49 Reverse Transcription Step (RT-PCR)
Reverse transcription of total RNA, isolated with Tri-Reagent and DNase-treated,
was performed using the ProtoScript® First Strand cDNA Synthesis Kit (New England
BioLabs, Beverly, MA) following the manufacturer’s specifications. In a sterile
RNase/DNase-free 0.5 ml tube, 1-2 µg/µl of RNA were added to 4 µl of dNTP mix (2.5
mM dATP: 2.5 mM dCTP: 2.5 mM dGTP: 2.5 mM dTTP) and 2 µl of RNA-binding
primers. The RNA-binding primers were different for samples from experiments A and
B. For experiment A samples, the RNA-binding primers were random nonamers (15
µM). For experiment B samples, the RNA-binding primers were 2 µl of 50 µM polyT
primers (dT23VN: V=A/G/C, N=nucleotide) and 2 µl of a 50 µM solution of reverse
BMV primer (Table 9). NF-water was added for a volume of 16 µl. This mixture was
heated at 70ºC for 5 minutes, briefly microcentrifuged to collect sample together and
chilled promptly on ice.
To this 16 µl mixture were added 2 µl of 10X RT buffer, 1 µl of RNase inhibitor
(10 units/µl) and 1 µl of 25 units/µl Moloney-Murine Leukemia Virus (M-MuLV)
Reverse Transcriptase (RT) for a total volume of 20 µl. This 20 µl mixture was incubated at 42ºC for 60 minutes followed by an enzyme inactivation step at 95ºC for 5 minutes.
Following these incubations, 80 µl of NF water was added for a 1:5 dilution. 1 µl of this diluted mixture was used in each subsequent PCR reaction.
50 Initial Assays with Real Time PCR
Real-time PCRs were performed either on an ABI PRISM 7000 Sequence
Detection System (Applied Biosystems, Foster City, CA) or an Opticon™ 2 machine (MJ
Research/Bio-Rad Laboratories, Waltham, MA) depending on availability. 18S ribosomal
RNA was the endogenous control for experiment A RNA samples, the same samples that
were used to identify candidate genes by differential display. Brome Mosaic Virus RNA
was the exogenous control for experiment B RNA samples, used for inferring statistical
significance of gene expression differences between control and stressed fish. The
comparative CT method was used for relative quantification of genes of interest. Three
proprietary kits were evaluated for the QPCR technique on an ABI PRISM 7000
sequence detection system (Applied Biosystems, Foster City, CA). Platinum® SYBR®
Green qPCR SuperMix-UDG (Invitrogen, Carlsbad, CA) was found to work consistently well, yielding products of the expected sizes and DNA dissociation peaks, and hence was the reagent kit chosen for all subsequent reactions. The real-time PCR reaction using
SYBR Green I dye was chosen because of its relatively lower cost to the Taqman method, low coefficient of variation (14.2%), and because it can be used for melting curve analysis. Melting curves provide an analysis of the quality of the PCR and an inference of product size based on its expected GC content (Becker, 1996; Schmittgen et al., 2000; Bustin and Nolan, 2004).
PCR Amplification Efficiency
Reaction efficiency was performed for 25 primer pairs to determine if the
polymerase chain reaction resulted in a doubling of DNA template in each cycle within
51 its logarithmic phase. Reaction efficiency is more important in real-time PCR analysis
when the absolute method of quantification is employed, but is also recommended when
using the comparative method because it simplifies calculations. Reaction efficiency for
each set of primers was determined using the following method. Four 5-fold dilutions of cDNA from fathead minnow RNA were prepared and CT values obtained using real-time
PCR. The rate at which a PCR amplicon is produced is called the PCR amplification
efficiency. If the amplicon quantity doubles during the geometric phase of amplification,
then the reaction is 100% efficient (Guide to Performing Relative Quantitation of Gene
Expression Using Real-Time Quantitative PCR, Applied Biosystems, 2004). CT values were plotted against the log10 of concentrations to obtain a standard curve. The slope of
the semi-log regression line was then calculated. Efficiency (E) was then estimated as a
percentage using the equation:
E = (10 -1/slope – 1) x 100 (2)
(Guide to Performing Relative Quantitation of Gene Expression Using Real-Time
Quantitative PCR, Applied Biosystems, 2004). If the slope has a value of -3.32, the
reaction is 100% efficient. Table 10 shows the efficiencies associated with slope values
from -3.1 to -3.6 (Mx4000 Multiplex Quantitative PCR System, Application note # 10,
Stratagene). It is more important that the reaction efficiencies between the internal standard and the target gene be as close as possible than they approach 100% efficiency
(Livak and Schmittgen, 2001).
52 Table 10: Amplification and reaction efficiency values associated with the slopes produced by plotting CT against log10 concentration of DNA samples. Slope Amplification Efficiency -3.60 1.8957 0.8957 -3.55 1.9129 0.9129 -3.50 1.9307 0.9307 -3.45 1.9492 0.9492 -3.40 1.9684 0.9684 -3.35 1.9884 0.9884 -3.30 2.0092 1.0092 -3.25 2.0309 1.0309 -3.20 2.0535 1.0535 -3.15 2.0771 1.0771 -3.10 2.1017 1.1017
Real-time PCR with Larval RNA Samples
Reactions for experiment A RNA samples were set up using the reagents listed in
Table 11. The endogenous 18S rRNA control was amplified using primers and a competimer from the QuantumRNA™ 18S Internal Standards Kit (Ambion Inc., Austin,
TX). The ratio of primer:competimer was chosen as 3:7. Initial assays were performed with RNA samples and primer:competimer ratios of 1:9, 2:8 and 3:7. A ratio of 3:7 yielded a CT value of 15.37 that was close enough to most target CT values, yet a little lower than them for ease in calculating fold-change differences. Bustin and Nolan (2004) have suggested using a standard (endogenous or exogenous) that has approximately the same expression levels as the target, and, that expression between the two genes show a linear difference, i.e. have the exponential part of the amplification curve in the same range. Reactions for experiment B RNA samples were set up as shown in Table 12.
The PCR mix used was the Platinum SYBR Green qPCR SuperMix-UDG
(Invitrogen, Carlsbad, CA). This mix at 2X concentration contains SYBR Green 1
53 fluorescent dye, Platinum Taq DNA polymerase (60 U/ml) precomplexed with antibodies
to prevent activity at room temperature, MgCl2 (6 mM), KCl (100 mM), 40 mM Tris-HCl
(pH 8.4), 40 U/ml uracil DNA glycosylase (UDG), stabilizers and 400 µM each of
deoxyribonucleotide triphosphates (dATP, dGTP, dCTP and dUTP). The ROX reference
dye consists of a glycine conjugate of 5-carboxy-X-rhodamine, succinimidyl ester (25
µM) in 20 mM Tris-HCl (pH 8.4), 0.1 mM EDTA and 0.01% Tween 20. ROX is used to
normalize the fluorescent reporter signal in some instruments. Tween 20, dimethyl
sulfoxide (DMSO) and glycerol were also added to the reaction mixture in the proportions used by Hoffman (2004). Real-time PCR reactions were initially performed using the additive 1µl of 20X bovine serum albumin (PCR grade) with the reaction mix, but the additives Tween 20, DMSO and glycerol produced a better reaction with QPCR1: aldolase B primers. The reaction with Tween 20, DMSO and glycerol had a much better amplification and sharper melting curve compared to the reaction with BSA as the additive. Hence, Tween 20, DMSO and glycerol were chosen as the additives. The use of
chemical additives to PCR reactions has been known to improve the reaction itself (Pomp
and Medrano, 1991). Dimethyl sulfoxide was shown to improve product quality in PCR
sequencing reactions by reducing background and increasing the product intensity
(Winship, 1989). Organic solvents in general, as well as high temperature, promote
unwinding of the DNA helix thereby preventing secondary structure formation (Lee et
al., 1981). DMSO also reduces recombinant molecule formation during PCR reactions
(Shammas et al., 2001). Tween 20, a non-ionic detergent, enhances the PCR reaction
when inhibiting substances are present in the tissue of DNA origin (Demeke and Adams,
1992).
54 Table 11: Real-time PCR set-up for cDNA samples from experiments A. PCR component Stock concentration 1X reaction (25 µl) Final concentration NF- water -- 3.625 -- Tween 20 1% 0.25 0.01% DMSO 10% 0.625 0.025% Glycerol 10% 2.5 0.1% ROX reference dye 50X 0.5 1X SYBR PCR mix 2X 12.5 1X Forward Primer 50 µM 2.0 4 µM Reverse Primer 50 µM 2.0 4 µM cDNA template 1:5 dilution 1.0 --
Table 12: Real-time PCR set-up for cDNA samples from experiments B. PCR component Stock concentration 1X reaction (25 µl) Final concentration NF- water -- 1.625 -- Tween 20 1% 0.25 0.01% DMSO 10% 0.625 0.025% Glycerol 10% 2.5 0.1% ROX reference dye 50X 0.5 1X SYBR PCR mix 2X 12.5 1X Forward Primer 50 µM 3.0 6 µM Reverse Primer 50 µM 3.0 6 µM cDNA template 1:5 dilution 1.0 --
The cycling parameters for real-time PCR were: incubation at 50ºC for 2 minutes, incubation at 95ºC for 10 minutes, followed by 45 cycles of 95ºC for 30 seconds, 57ºC for 60 seconds and 72ºC for 30 seconds. The 45 cycles were followed by a melting curve step as described in the following section. The initial incubation at 50ºC was to activate the UDG enzyme to remove contamination from any previous runs on the machine, while the 95ºC incubation for 10 minutes was for the activation of Taq DNA polymerase. The same real-time reactions were performed with RNA extract diluted 1:50 or 1:100
(depending on whether 1 µl or 2 µl were used in the reverse transcription reaction) in NF water as the RT-minus controls to estimate the contribution to fluorescence by genomic
DNA. An initial reaction was also performed with primers alone minus any template to
55 test the contribution of the two primers in product formation. SYBR Green I binds to the
minor groove of DNA and thus gets incorporated into primer dimers and any other nonspecific amplification products in the PCR. Therefore, using RT-minus controls and
template-free reactions was the only way to estimate the contribution of undesired
products to the fluorescence signal measured over the course of the PCR. If these controls
had CT values that were well over the exponential phase of the target sequences (>35),
their contributions were judged to be negligible and ignored from calculations. The target
amplification would already have reached the plateau phase by the time primer or
genomic DNA contributed to fluorescent signals.
Melting Curve Analysis
Melting curve analysis verifies the generation of a single end product in each PCR when its two DNA strands separate completely at a specific temperature. When a double- stranded DNA (dsDNA) product incorporated with SYBR Green I dye denatures, there is a sharp decline in fluorescence. The sharpest decline will be produced by the most abundant dsDNA product in the PCR that was primarily responsible for fluorescence measured by the real-time instrument. The denaturation temperature of dsDNA is dependent primarily on its GC content, length and sequence (Ririe et al., 1997); hence the melting curve indicates whether a single amplicon produced the fluorescent signal during the real-time reaction. A sharp single peak indicates the presence of a single amplicon and the specific melt temperature should correspond to that predicted by the Primer
Express software (Table 9). A smaller peak preceding the larger peak indicates primer dimers whereas several small peaks represent formation of nonspecific products.
56 A melting curve analysis was performed with each real-time PCR product to
determine primer specificity, i.e., the amplification of a single product with minimum
primer-dimer formation and the absence of non-specific products. Following a real-time
PCR on the ABI 7000 or Opticon machine, a melting curve analysis was performed and
consisted of steadily raising the temperature from 65ºC to 92ºC, reading fluorescence
with every 0.2ºC rise in temperature.
Calculation of Fold-Change in Gene Expression
The comparative ∆∆CT method was followed for calculating fold-change gene
expression differences (Livak and Schmittgen, 2001). During the course of a real-time
PCR, fluorescence from SYBR Green I is read by the PCR instrument. From this, the
threshold cycle (CT) is estimated when the fluorescence signal rises above a manually set background level, called the threshold line. The CT is thus the PCR cycle at which the
amplicon is present in sufficient quantities to be distinguished from background
fluorescence. CT values are logarithmic. The one criterion for using the ∆∆CT method is
that the reaction efficiencies of the target (gene of interest) and exogenous/endogenous
control be approximately equal or close in value (Guide to Performing Relative
Quantification of Gene Expression Using Real-Time Quantitative PCR, Applied
Biosystems, 2004; Livak and Schmittgen, 2001). Target and the exogenous/endogenous
control reactions have to be run at the same time in different wells of the same plate.
Therefore, it is necessary to run the exogenous/endogenous controls with every plate.
From the CT values of the target and reference genes, the ∆CT was calculated using the following equation:
57 ∆CT = CT target - CT reference (3)
The ∆∆CT was then calculated by subtracting the average ∆CT of the stressed larvae (n =
2 or n = 5) from the average ∆CT of the control larvae (unstressed) in the following
manner:
∆∆CT = ∆CT stress - ∆CT control (4)
The fold-change in gene expression was calculated using the following equation:
Fold-change in gene expression = 2-∆∆Ct (5)
This equation assumes a 2-fold amplification with each cycle. The calculations followed here are done in a different way from most other researchers (personal communication, T.
D. Schmittgen). If there are several replicates, the ∆CT reference is randomly paired with
another ∆CT target and five different ∆∆CT values are obtained. In this study, the ∆CT
values from each treatment group were averaged before the fold-change was calculated
relative to control samples.
In addition to the above standard method for calculating fold change in gene
expression, the calculations for samples A were repeated with a correction for reaction efficiency. Fold-change differences in gene expression in samples B were calculated with corrections for both reaction efficiency and total RNA concentration differences among samples. The equations used for the correction of efficiency differences are described below. The exponential amplification of an amplicon within a PCR can be stated as follows (Livak and Schmittgen, 2001):
n Xn = X0 × (1 + EX) (6)
where Xn represents the number of target molecules after n cycles of the PCR, X0 denotes
the initial number of target molecules at the start of the PCR, EX is the PCR reaction
58 efficiency and n is the number of cycles within the PCR. The threshold cycle CT represents the fractional cycle number at which the target is amplified to a specific volume and the PCR amplification of the target amplicon can then be represented as
(Livak and Schmittgen, 2001):
C XT = X0 × (1 + EX) TX (7)
And, a similar equation can be applied to denote the amplification of a reference gene R
(Livak and Schmittgen, 2001):
C RT = R0 × (1 + ER) TR (8)
At the threshold level, the concentration of target molecules and reference molecules is
equal. Therefore,
C C R0 × (1 + ER) TR = X0 × (1 + EX) TX (9)
And, the initial number of molecules of the target relative to the reference gene can be
stated as:
C X0 (1 + ER) TR ------= ------(10) C R0 (1 + EX) TX
When comparing fold-change gene expression differences in cDNA from two different
RNA populations, one set from a control group X0C and one set from an experimental
RNA population X0E, the difference between the two cDNA sets can be compared as follows assuming that the quantities of the reference gene are the same in both samples:
C C X0E (1 + ER) TRE (1 + ER) TRC ------= ------÷ ------(11) C C X0C (1 + EX) TXE (1 + EX) TXC
Total RNA corrections were incorporated into the equation, using the ratio between RNA in the control samples versus the experimental samples:
59 X0E RNAcontrol ------× ------(12) X0C RNAexperimental
Data Analysis of Gene Expression Differences Between Control and Stressed Larvae
Using uncorrected data, ∆CT values of experiment B samples (n = 5) were used to estimate statistical significance of gene expression differences between stressed and control larvae. Experiment A samples had only 2 replicates within each experimental group and hence data were not analyzed statistically due to lack of power. Instead, an arbitrary fold-change cutoff value was used to distinguish meaningful change in gene expression. SYSTAT v. 10 (SPSS, Inc., 2000) was the software used for data analyses of experiment B samples. ∆CT values were not transformed because PCR is an exponential process and the ∆CT’s were already log-values. The ∆CT values of the control and stress groups were compared using a one-way analysis of variance (ANOVA). The α-value was set at 0.05. ANOVAs showing a difference between means with an associated p-value
<0.05 were considered significant. The assumptions for the ANOVA are that samples be randomly drawn from a population (independence), homogeneity of variances
(homoscedasticity) and normality of data (Sokal and Rohlf, 1995). The independence assumption was met, and data were examined for normal distribution by eye. ANOVAs are very robust to violations of the assumptions. However, if the standard deviations in either of the two groups (control or treated) differed by more than a value of 2 (Hamadeh and Afshari, 2004), then the homoscedasticity assumption was considered violated and a nonparametric Kruskal-Wallis one-way analysis of variance was used to test for significant differences between the means of the two groups (Sokal and Rohlf, 1995).
60 The Kruskal-Wallis test is conservative for very small sample sizes, but is still robust for
N = 5 (Sokal and Rohlf, 1995). It ranks variates from the smallest to the largest, sums them up between groups, and then looks for significant differences between rank sums
(Sokal and Rohlf, 1995). The closer the rank sums are to each other, the less the difference between them.
61 RESULTS
In all experiments, the response of fathead minnow larvae to stressors was
measured in terms of lethality and transcriptional analysis. Higher lethality in fish treated
with copper, zinc or elevated temperature indicated higher stress. The behavior of
stressed larvae was in general similar for the different stressors used. Stressed larvae were
sluggish in activity compared to controls. Some larvae showed signs of loss of balance
and swam on their sides. Two experiments were performed for each stressor. In experiments A, the aim was to identity genes that showed a response to the concentration or level of the stressor. In experiment B, the variation in transcriptional response of select genes to a specific dose of the stressor was measured. This was done to test for significant differences in gene expression between control and stressed fish.
Forty-eight Hour Copper Exposure A
Copper A experiment results in terms of fish survivorship are shown in Table 13.
Following the 48-hr copper exposure to fathead minnow larvae, the 200 µg/L copper
solution resulted in a mortality of 44%, while 50µg/L copper treatment resulted in a
mortality of 8.8%. The lethality in the various treatment groups was proportional to the
copper concentration used.
No major differences in water quality were observed between the control group of
0 µg/L Cu and the experimental groups that contained copper. The pH, dissolved oxygen
and conductivity levels of pooled water samples from each treatment group are shown in
Table 14. The initial measurements were taken at the start of the experiment, while final
readings were measured at the conclusion of the experiment. pH values decreased slightly
62 and dissolved oxygen decreased by about 0.5 mg/L in each water container. Conductivity
increased by 14-20 µmhos/cm in the experimental chambers and the temperature in test
solutions was between 24-25ºC.
Forty-eight Hour Copper Exposure B
Results from the single dose 48-hr copper exposure in terms of fish survivorship
are summarized in Table 15. Fish mortality in the 200 µg/L copper solution was 11.6%,
much lower compared to copper exposure A with a mortality of 44%. There was little
cup-to-cup variation in mortality (Table 16). Fish from various cups were pooled together
for RNA isolation (Table 16).
There were no obvious water quality differences between the control (0 µg/L Cu)
and experimental group (200 µg/L Cu). Table 17 summarizes the water quality
measurements taken at the start and end of the experiment in terms of conductivity, pH,
temperature and dissolved oxygen. Initial measurements were taken at the start of the
experiment, while final values were measured at the conclusion of the experiment 48
hours later. pH values fell slightly during the course of the experiment. Dissolved oxygen
ranged from 7.7-8.8 mg/L, while conductivity ranged from 308-330 µmhos/cm.
Temperature of the test water ranged from 21.9-24.3ºC.
Forty-eight Hour Zinc Exposure A
Zinc exposure A results in terms of fish survivorship are summarized in Table 18.
Following the 48-hr zinc exposure, 900 µg/L zinc-treated larvae had a mortality of 65%, while 200µg/L Zn-treated larvae had a mortality of 7.2%. There was no mortality in the
63 control group. The zinc stress did not cause a proportionate mortality with higher
concentration. The 600µg/L Zn-treated larvae had lower mortality of 11% compared to a
mortality of 39.66% in the 400 µg/L Zn treatment group.
The pH, dissolved oxygen and conductivity measurements of the pooled water
samples from each treatment group are shown in Table 19. Initial values indicate those
water measurements taken at the start of the experiment, while final measurements
denote those taken at the conclusion of the test 48 hours later. pH of test water ranged
from 7.75-7.92. Dissolved oxygen consistently decreased in all test containers by 0.1 to
0.5 mg/L. It decreased most markedly in the test group containers with the severest
mortality (900 µg/L). Temperature in the test containers ranged between 24.5-24.7ºC.
Forty-eight Hour Zinc Exposure B
The results from the second 48-hr zinc experiment at a single dosage in terms of
fish survivorship are summarized in Table 20. The mortality was 42.2% in the 800 µg/L
concentration. One fish died within the control group. Table 21 shows the number of
survivors in each individual experimental chamber and the containers from which fish were combined together to obtain a pooled sample for RNA isolation. In this exposure, there was cup-to-cup variation in mortality. Two cups had 0% survivorship at the end of
48 hours while cup 19 had only 5 survivors.
No major water quality differences were detected between control group and
experimental group containers (Table 22). pH of test water ranged from 7.47-7.89.
Dissolved oxygen decreased markedly by 1.1 mg/L in the control group water and by 1.2
64 mg/L in the experimental group test container. Conductivity ranged from 309-337
µmhos/cm and temperature was between 24.1-25ºC.
Thermal Stress Experiment A
The results of the 24-hour and 48-hour heat stress experiments at 36ºC in terms of
fish survivorship are summarized in Table 23. Larvae experienced 28.67% mortality in
the 24-hr experiment and 64.8% mortality in the 48-hr experiment. No larvae died in
either of the two control groups.
The water quality measurements taken at the start and end of the experiment in
terms of conductivity, pH, temperature and dissolved oxygen are summarized in Table
24. pH of test water was within the range 7.65-8.01. Dissolved oxygen decreased by 0.4-
0.5 mg/L within the control water and by 0.6-0.7 mg/L within the heated water. pH and
dissolved oxygen were lower within the heat-treated groups compared to the controls at
25ºC. Conductivity ranged between 301-321 µmhos/cm. Temperature in the test
containers increased to that of the environmental chamber into which all the test
containers were placed.
Thermal Stress Experiment B
Table 25 shows the results of thermal stress experiment B in terms of fish survivorship. The second thermal stress experiment at 36ºC for 48 hours resulted in
39.6% mortality in the treated group. One fish died in the control group. Table 26 shows the number of fish used in each experimental container, the number of fish alive at the
24-hr water change, the number of live fish at the end of the experiment and the RNA
65 tubes into which fish from individual containers were pooled together. Cup 12 and Cup 5 had fewer survivors compared to other cups.
Water quality measured in terms of pH, dissolved oxygen and conductivity are shown in Table 27. pH of test water ranged from 7.42-8.02. Dissolved oxygen decreased by 1.4 mg/L in the control group containers and by 2.3 mg/L in the experimental group water at 36ºC. Dissolved oxygen tends to decrease with increasing temperature and hence hypoxia was assumed to be part of the heat stress treatment. Conductivity ranged from
315-341 µmhos/cm.
RNA Analysis
A typical 1.5% formaldehyde-agarose gel with good quality, undegraded fathead minnow RNA is shown in Figure 3. The gel shows total RNA samples from fish larvae used in thermal experiment A. C1 and C2 are from the 24-hour control group, 11 and 12 are replicates from the 24-hr treatment at 36ºC, C3 and C4 are samples from the 48-hr control group, and, 21 and 22 are samples from the 48-hr treatment at 36ºC. The 28S rRNA bands (closer to loading wells) are about twice as intense as the 18S rRNA bands below. RNA from all experiments was analyzed either on formaldehyde-agarose gels or on an Agilent Bioanalyzer prior to subsequent use. If it was found to be degraded, the experiment was repeated and RNA extracted and analyzed again. Only RNA judged to be undegraded and of good quality was used for differential display and real-time PCR analyses.
Spectrophotometric readings for the copper A RNA samples are shown in Table
28, which also has RNA concentrations calculated from the O. D. reading at 260 nm
66 using equation (1). The 260/280 ratios for all RNA samples were above 1.8, indicating
that the RNA was of good quality. The average amount of RNA recovered per fish within
each copper treatment is described by the bar graphs in Figure 4. Because there were only
two replicates within each treatment, no data analysis was performed. The average
amount of RNA did not vary much among the various treatment groups, indicating that
the stress treatment did not diminish the total RNA within the affected population of
larval fish. The average amount of RNA may not reflect how mRNA concentration was affected by stress because rRNAs contribute most to the O. D. reading.
Spectrophotometric readings for copper experiment B RNA samples are shown in
Table 29. The 260/280 ratios were calculated, taking into account subtractions of the 320
nm O.D. readings from those at 260 and 280 nm. The 260/280 ratios are all above 1.8,
indicating good quality RNA. RNA concentration was calculated from the 260 nm reading using equation (1) and used to estimate quantity desired in subsequent reactions
(viz., reverse transcription reactions).
Table 30 shows Agilent 2100 Bioanalyzer analyses of all RNA samples from
copper experiment B. The 260/280 ratios above 1.8 indicate high purity of the RNA
extract. The Agilent 2100 Bioanalyzer output yielded a gel read of the RNA, which
showed intact rRNA with clear 28S and 18S bands, the 28S bands being approximately
twice as intense as the 18S bands (results not shown). The calculated RNA concentrations
for the copper B samples using Agilent Bioanalyzer readings were lower compared to
those calculated from spectrophotometer readings. The average amount of RNA
recovered per fish from each group within copper experiment B is described by the bar
graphs in Figure 5. Using Microsoft Excel, an ANOVA statistical test (α = 0.05) was
67 performed to analyze differences of mean RNA recovery from control and copper- exposed fish. There was no significant difference between the mean amount of RNA recovered from control fish versus the slightly lower amount of RNA from copper-treated fish (F-ratio = 0.03796, df =9, p = 0.85038).
Spectrophotometric readings for zinc experiment A RNA samples are shown in
Table 31. All the samples had 260/280 ratios greater than 1.8, indicating high purity of
RNA extracts. Table 31 shows the RNA concentration in µg/µl calculated from O. D. readings at 260 nm using equation (1). The average amount of RNA recovered per fish within each zinc treatment is described by the bar graphs in Figure 6. The average amount of RNA did not vary much among the various treatment groups, indicating that zinc exposure did not have a marked effect on the total RNA concentration between controls and the zinc-exposed larvae.
Spectrophotometric readings at 260 nm and 280 nm for zinc experiment B RNA samples are shown in Table 32. The 260/280 ratio was calculated taking into account the subtraction of the 320 nm reading. All samples had 260/280 ratios greater than 1.8, indicating high purity of RNA extracts. Table 32 also states the RNA concentration in
µg/µl calculated from the O. D. reading at 260 nm using equation (1).
Table 33 shows Agilent 2100 Bioanalyzer analyses of RNA samples from zinc experiment B. The 260/280 ratios were all above 1.8, indicating that the RNA extract had very few impurities. As with earlier samples from the copper experiment, there were differences between the O.D. readings from the Shimadzu spectrophotometer and the
Agilent 2100 Bioanalyzer. In general, 260/280 ratios were lower and RNA concentration higher from Bioanalyzer readings. The gel reads from the Agilent 2100 Bioanalyzer
68 showed clear 28S and 18S bands, indicating that the rRNA was undegraded. The average
amount of RNA recovered per fish within each treatment group is described by the bar
graphs in Figure 7. Using Microsoft Excel, an ANOVA (α = 0.05) was performed to test
for differences in average amounts of RNA recovered from control and zinc-stressed fish.
There was no significant difference between the mean amount of RNA recovered from
control fish versus the amount of RNA from 800 µg/L zinc-treated fish (F-ratio =
0.933858, df = 9, p = 0.362164), indicating that stress did not affect the total amount of
RNA in zinc-treated fish.
Spectrophotometric readings and calculated RNA concentrations of thermal stress
experiment A RNA samples are shown in Table 34. The 260/280 ratios were calculated,
taking into account the subtraction of the 320 nm O. D. reading from both the 260 nm
and 280 nm readings. The 260/280 ratios were above 1.8, surpassing the minimum criterion for RNA purity. The average amount of RNA recovered per fish within each thermal stress treatment is described by the bar graphs in Figure 8. There was a decrease in the average amount of RNA recovered per fish from both thermal stress groups compared to control samples. There was an approximately 44% decrease in the average amount of RNA recovered from fish treated at 36ºC for 48 hours compared to control fish at 25ºC.
Spectrophotometric readings for thermal stress experiment B samples are shown
in Table 35. The 320 nm O.D. readings were subtracted from the 260 nm and 280 nm
readings before calculation of the 260/280 ratios. The 260/280 ratios were all above 1.8,
indicating high purity of the RNA extract. The RNA concentration was calculated from
the 260 nm O.D. readings using equation (1).
69 Table 36 shows 260/280 ratios and RNA concentrations obtained from the
Agilent 2100 Bioanalyzer for thermal stress experiment B RNA samples. In common
with other samples (copper and zinc experiments), the Agilent 2100 Bioanalyzer
generated different data compared to the Shimadzu spectrophotometer. However, these
differences did not in any way indicate sample impurity. The 260/280 ratios from the
Agilent Bioanalyzer analyses were lower than those from the Shimadzu spectrophotometer and there were also differences in the RNA concentration. The gel
reads from the Agilent 2100 Bioanalyzer showed intact 28S and 18S bands, indicating
that RNA extracts were undegraded. The average amount of RNA recovered per fish
between the control samples at 25ºC and the 48-hr stressed samples at 36ºC are described
by the bar graphs in Figure 9. Using Microsoft Excel, an ANOVA (α = 0.05) was performed to test for differences in means of the control and thermal-stressed groups.
There was no significant difference between the mean amount of RNA recovered from control fish versus the amount of RNA from thermal-stressed fish (F-ratio = 1.694268, df
= 9, p = 0.229269). This implied that thermal stress did not decrease or increase the total amount of RNA within stressed fish.
Differential Display Results
Thirty-eight differential display gels were run with cDNA samples from copper
experiment A, 42 gels run with zinc experiment A cDNA samples and 32 gels run with
thermal stress experiment A cDNA samples. Six anchor primers were consistently used
with RNA samples from all the three experiments. However, anchor-arbitrary primer
combinations varied among samples from the three different experiments because the
70 arbitrary primers were selected randomly. Figure 10 shows a typical differential display
gel, along with the virtual grid, which was electrophoresed for 2.5 hours at 2700 volts.
Visually observed differentially expressed bands are marked by numbers for isolation and
further analysis. These candidate bands showed an observable change in intensity
between control and treatment groups. Bands that showed different intensities at different
doses of the stressor were collected as dose-responsive candidates. Candidate bands were
said to be up-regulated by a stressor if the gel showed more intense bands in any of the treated samples compared to controls. If the control bands were more intense than treatment samples, the bands were designated as being down-regulated. Less than 1% of observed bands showed intensity variation between duplicate samples from the same experimental group. This consistency was observed in 2197 differential display bands of copper A RNA samples and 2507 bands of zinc A RNA samples, generated using different anchor and arbitrary primers. If there was inconsistent band expression among the treatment groups analyzed, the bands were designated as being “variable” in expression. All selected bands were marked on the grid and scraped from the gel for further analysis. In general, gels electrophoresed for 2.5 hours had more bands compared with the 5-hour gels. This was so because the 2.5 hours electrophoresis resolved bands less than 500 bps and differential display PCR appeared to favor the formation of smaller
DNA amplicons. If certain primer pairs did not produce clearly distinguishable bands between the different treatment groups, that whole set of bands was ignored from further analysis.
Candidate bands were excised if they showed intensity differences between
treatment and control samples. A total of 654 stress responsive candidate bands were
71 obtained from the differential display gels of copper A samples, 507 stress-responsive bands were obtained from zinc A samples and 493 such candidate bands were obtained from thermal stress experiment A samples. Therefore, 20-29% of all bands produced during RT-PCR showed some response to stress. Candidate bands from thermal stress samples were designated as being up- or down-regulated compared to controls for specific time periods (24-hr or 48-hr). There were noticeable differences in band intensity between 24-hr and 48-hr samples from thermal stress experiment A.
Reamplification of most bands was successful using the polymerase chain
reaction with M13 and T7 primers. Thirteen of the 654 copper candidate bands failed to
reamplify. Every zinc candidate band was successfully reamplified and only five of the
493 heat candidate bands failed to reamplify. In 67 of the 1654 reamplification PCRs,
more than one amplicon was produced from one excised differential display band.
Assuming that the excision may have included nearby bands on the gel and not being
able to presume which one was the actual candidate, the bands were labeled a, b, c and so
on and all were treated as belonging to the particular numbered candidate band with its
characteristic gene expression response observed on the differential display gel.
Sequencing Results
Differential display, sequencing and identity matches of all the bands are shown
in Tables 37, 38 and 39. Altogether with the additional amplicons from reamplification,
the copper-responsive candidate bands numbered 676, there were 554 zinc-responsive candidate bands and 532 thermal stress-responsive bands. In case the band’s sequence did not have a BLAST hit, it was designated as having “no significant similarity” (NSS).
72 All the reamplified bands did not yield clear data from sequencing reactions.
Bands may not have yielded a readable sequence as a result of contaminants present in the DNA extract, not enough DNA being present in a sample, or, interference from other transcripts that may have been simultaneously reamplified. For copper experiment A, 261 clear sequences were obtained that were more than 200 bps in length and had little or no background signal. Nine of the 261 sequences were the result of multiple amplicons from a single band when reamplified. Therefore, the recovery of interpretable sequence data from differential display was 38.53% out of 654 bands for copper experiment A. Out of the 261 clear copper-responsive bands, 121 were down-regulation candidates, 116 were up-regulation candidates and 24 were either variable or did not change in expression. Of the 261 clear bands, 161 cDNAs were homologous to genes of known function and of these, 77 were unique. Ninety-two cDNAs were homologous to ESTs of undetermined function, of which 67 were unique. Eight copper stress candidate bands were not identified in the NCBI database. For zinc experiment A, 168 clearly readable sequences were obtained. Ten bands were obtained from candidate cDNAs that yielded more than one amplicon on reamplification. Hence, the recovery of interpretable sequence data for zinc experiment A was 31.16% of 507 bands. Out of the zinc experiment’s 168 readable bands, 62 were down-regulation candidates, 96 were up-regulation candidates and 10 were variable in expression. One hundred and eleven bands were homologous to genes of known function, of which 59 were unique. Two zinc-responsive candidate genes did not have a BLAST match within the NCBI database and 55 matched ESTs of unknown function. Of the 55 ESTs, 39 had unique identities. One hundred and sixty-eight readable sequences were obtained from thermal stress experiment A, with 11 sequences from
73 multiple amplicons generated from individual differential display bands. The recovery of
interpretable sequence data for thermal stress experiment was therefore 31.84% of 493
bands. Of the 168 readable bands from the thermal stress samples, 65 were down-
regulation candidates, 97 up-regulation candidates, 2 were variable in expression patterns
and 6 were time-specific bands. Of the 168 readable bands, 99 sequences were
homologous to genes of known function and 72 of these were unique. One thermal stress
candidate band did not have a BLAST match, while 68 candidate genes matched ESTs of unknown function. Of these 68 candidate bands, 50 had unique identities. The stress candidate bands with clear sequences are listed in Tables 40 (copper experiment A), 41
(zinc experiment A) and 42 (thermal stress experiment A).
Only 5 primer combinations were common to gels from all three experiments.
The combinations are: anchor primer 6 with arbitrary primer 1, anchor primer 3 with
arbitrary primer 3, anchor primer 4 with arbitrary primer 15, anchor primer 5 with
arbitrary primer 1, and, anchor primer 5 with arbitrary primer 3. Of these combinations,
only three bands were commonly identified by differential display of copper, zinc and
heat stress cDNA samples. These three gene identities were elongation factor-1 α, fast
muscle troponin I and NADH dehydrogenase subunit 2. Three gene identities were
common to zinc and copper differential display – heat shock cognate 70 kDa, troponin
TnnT3b and β-thymosin. Twenty-two gene identities were associated with a specific
stressor, despite the same primer combinations used. Five gene identities were produced
with more than one different pair of primer combinations. Fast muscle troponin I (Danio
rerio), troponin TnnT3b (Danio rerio) and elongation factor-1 α (Cyprinus carpio) were
identified from cDNA bands produced using anchor primers 5 and 6 in combination with
74 arbitrary primer 1. NADH dehydrogenase subunit 2 (Hybopsis winchelli) was identified
from cDNA bands generated with anchor primer 4 in combination with arbitrary primer
15, as well as from anchor primer 5 with arbitrary primer 3. Candidate bands identified as
Carassius auratus mitochondrial DNA were generated from anchor primers 5 and 3 in
combination with arbitrary primer 3.
To obtain an insight into metabolic pathways affected by the individual stressors,
all differential display-derived cDNA bands that were homologous to functional genes
were categorized into gene ontologies using the web program
http://genereg.ornl.gov/gotm. Figure 11 shows gene ontologies of identified genes
obtained from differential display of copper, zinc and heat stress RNA samples. The
predominant group of genes identified from the gels were ribosomal protein genes,
followed by muscle or contractile protein genes, followed by regulatory and
mitochondrial genes, then by genes controlling metabolism and lastly by tissue protein
genes and protein-folding genes. Therefore, the genes affected by stress appear to be of diverse function. Despite the different stressors used to elicit the stress response in fathead minnow larvae and different primer sets used to target differential gene expression, the functional categories of genes affected by all three stressors are similar and proportionate.
Selection of Candidate Genes for Real-Time PCR Assays
A comparison was made of dose-dependent bands from the three stress A
experiments that were over 200 bps long, had clear readable sequences and that were identified with homologous genes with e-values <10-4. Gene commonly identified by
75 differential display of cDNA samples from at least two stress experiments were selected
for validation by real-time PCR. The twenty-three bands that were common to at least
two stressors, dose-responsive and had clear sequence data are shown in Table 43. The
sequences for these twenty-three candidate genes are in Appendix 1.
Other Bands of Interest
There were a few bands that responded to all three stressors and had clear
sequence data. However, these bands were either not identified as dose-responsive in two stress treatments or else were not categorized as having clear sequence data from at least two experiments. The 12 bands are listed in Table 44 with their expression responses to each of the three stressors.
Differential display-derived candidate cDNAs identified only in the copper stress
experiment are listed in Table 45, those identified only in the zinc stress experiment are listed in Table 46 and those identified in the thermal stress experiment are listed in Table
47. It is not possible to determine whether these genes were specific to the stressor since each collection was produced by different arbitrary primers in combination with anchor primers 1-6.
Real-Time PCR Results
All the primer pairs used for real-time analysis were successful in amplifying
products from cDNA. The melting curves for each of the products also corresponded to
the expected values shown in Table 9. Figure 12 shows a typical amplification graph for
QPCR5: carboxypeptidase B. The increase in fluorescence is due to the incorporation of
76 SYBR Green I dye into double-stranded DNA. Figure 13 shows the associated melting curve of this product at 81ºC. If amplicons did not melt at expected Tm values with single peaks, those specific samples were not analyzed further.
Reaction efficiencies for all the primer pairs used for real-time PCR are shown in
Table 48. The reaction volumes used for all reactions was 25 µl with the final MgCl2 concentration being 3.0 mM in each reaction. There were differences in real-time PCR methodology for experiments A and B RNA samples. For real-time PCR of experiment A samples, 18S rRNA was the endogenous standard and random nonamers were used for reverse transcription reactions. The 18S primers used had an expected product size of 315 bps. 18S rRNA primers were used with competimer in a 3:7 ratio. Group B RNA samples were artificially spiked with 5 ng BMV as the exogenous standard. PolyT primers and
BMV reverse primer were used for the reverse transcription reaction. With group A samples, 2 µl of each primer were used per reaction. With group B samples, 3 µl of each primer were used in a reaction. The expected amplicon size for all primers used, except
18S, was less than 100 bps. The efficiency values of Group A primers ranged from
76.469 for the 18S endogenous standard up to 124.83 for α-tropomyosin (QPCR3). An efficiency value of 76 is low for a standard, but the proprietary primers in this case were not optimized because an equivalent CT value to that of other primer combinations was desired. With group B samples, efficiency values ranged from 86.733 (QPCR14: 60S ribosomal protein L12) up to 118.380 for carboxypeptidase B (QPCR5). BMV primers had an efficiency of 94.208, which fell between the lowest and highest primer efficiency values within group B reactions.
77 For fold-changes in gene expression calculated using real-time PCR data, only
values above 1.7 were considered as being informative because it is difficult to separate
fold-changes that are small from variation between samples. This arbitrary cutoff value
was based on microarrays studies (Tan et al., 2002; Ton et al., 2002) and because of
statistical significance on data from this study, which is explained later on. Fold-changes
in gene expression calculated using real-time PCR data of copper A samples are shown in
Table 49. A value of 1.000 indicates no fold-change difference in gene expression from
copper-treated samples versus control samples. Therefore, the closer the fold-change
value to 1.000, the less is the difference in gene expression between a copper-treated and
control sample. Gene expression directional changes (up- or down-regulation) of stress-
treated groups versus controls are also listed.
When compared with differential display results, nine genes were confirmed for
expression changes in response to copper using real-time PCR. Real-time PCR results did
not contradict differential display observations for any of the genes analyzed. Six up- regulated genes had fold-changes greater than 2.0, including cytochrome b, fast muscle
specific heavy myosin chain 4, proteasome 26S subunit, survival motor neuron domain
containing 1, Troponin T3a, titin and troponin I. Of these up-regulated genes, titin had
over a ten-fold change. Five genes were down-regulated over two-fold by copper and
included carboxypeptidase B, cytochrome c oxidase subunit III, isocitrate dehydrogenase
2, ribosomal protein L12 and ribosomal protein L27. Of these down-regulated genes,
ribosomal protein L27 showed a five-fold change in expression in response to 200 µg/L
copper exposure in fathead minnow larvae. Eight genes did not show over a 1.7-fold
change to be considered informative.
78 Results of fold-change gene expression differences from real-time PCR analyses
of zinc A RNA samples are in Table 50. When compared with differential display results,
two genes carboxypeptidase B and proteasome subunit 7 beta had the same directional
change in gene expression with real-time PCR. One gene, isocitrate dehydrogenase 2,
was induced over 1.7-fold in contradiction to the observed repression of this gene from differential display. Only proteasome subunit 7 beta was induced almost two-fold by
zinc. The remaining 20 genes analyzed using real-time PCR showed less than a 1.7-fold
change in expression for 900 µg/L zinc-treated larvae.
Results of fold-changes in gene expression from real-time PCR analyses of
thermal stress A RNA samples are shown in Table 51. When compared with differential
display results, the expression of two genes was validated by real-time PCR. The two
genes were titin and fast muscle troponin I, both down-regulated approximately 3-fold.
The gene isocitrate dehydrogenase 2 was found to be down-regulated using real-time
PCR as opposed to its observed induction in differential display. The expression of two
genes, fast muscle specific heavy myosin chain 4 and proteasome 26S, was characterized,
both being down-regulated about 2-fold. Seventeen genes analyzed with real-time PCR
showed less than a 1.7-fold change to be considered informative.
The repeated stress experiments had at least five replicates within each treatment and a single dose or level of the stress. Results of fold-change calculations and one-way
ANOVAs from the real-time PCR analyses of copper B samples are shown in Table 52.
The one-way ANOVA statistical analyses of real-time PCR data from copper experiment
B indicated significant fold-changes in gene expression for 4 candidate genes, including
carboxypeptidase B, 60S ribosomal protein L12, survival motor neuron domain
79 containing 1 and titin. All copper B ΔCT means had a normal distribution and standard deviations were less than 2.0. Therefore, there was no need for using nonparametric statistics in any analysis. Of the four significantly expressed genes, the two genes carboxypeptidase B and 60S ribosomal protein L12 had the same directional changes in expression observed by differential display and as quantified by real-time PCR analysis of copper A samples. The gene stathmin was down-regulated over 1.7-fold by copper in fathead minnow larvae, but the expression change was not statistically significant. The remaining 18 genes did not show over a 1.7 fold-change in expression and hence were considered to be “unchanged”.
Fold-change calculations and one-way ANOVA results from real-time PCR data
of zinc B samples are shown in Table 53. In response to zinc, 17 candidate genes were
down-regulated over 1.7 fold. Data analyses of zinc B real-time PCR data using a one- way ANOVA (α=0.05) showed significant fold-changes gene expression differences for
14 of these 17 candidate genes. The significantly affected candidate genes included
aldolase B, α-tropomyosin, carboxypeptidase B, chymotrypsinogen B1, eukaryotic
translation elongation factor γ, guanine-nucleotide-binding protein, fast muscle specific
heavy myosin chain 4, ribosomal protein L27, survival motor neuron domain containing
1, stathmin, troponin T3a, titin, troponin TnnT3b and fast muscle Troponin I. All these
down-regulated genes had over a twofold-change in gene expression. With zinc B sample
ΔCT means, only one gene assay for 60S ribosomal protein L12 had standard deviations
over 2.0. Hence, a Kruskal-Wallis test was also performed with these ΔCT means. The
controls had a rank sum of 22 while the Zn-treated group had a rank sum of 33. The
associated probability was 0.251 (non-significant). Six down-regulated genes had over a
80 four-fold change in gene expression and included survival motor neuron domain containing 1, stathmin, troponin T3a, titin, troponin TnnT3b and fast muscle troponin I.
Four genes did not change over 1.7-fold and were considered uninformative. Of the 23 genes analyzed from zinc B samples with real-time PCR, one gene carboxypeptidase B showed similar expression as differential display and real-time PCR analysis of zinc A samples.
Fold-change differences in gene expression and one-way ANOVA results of the real-time PCR analyses of thermal stress B samples are shown in Table 54. Eighteen candidate genes were down-regulated and one gene up-regulated over 1.7-fold by the
36ºC heat treatment for 48 hours. Data analyses of thermal stress B real-time PCR results using a one-way ANOVA (α=0.05) indicated significant fold-changes in gene expression for 4 of the 23 candidate genes. The significantly down-regulated candidate genes included aldolase B, skeletal α-actin, α-tropomyosin and troponin T3a. In thermal stress
B real-time PCRs, two gene assays had ΔCT means with standard deviations over 2.0 - titin and troponin TnnT3b. Data from both these assays were analyzed with a Kruskal-
Wallis analysis of variance. Both were non-significant: for the titin analysis, the p-value was 0.462 (control rank sum = 22; treated rank sum = 23) and the troponin TnnT3b analysis had a p-value of 0.999 (control rank sum = 25; treated rank sum = 20). Although statistical significance was only obtained for four genes, 16 genes showed over a two-fold down-regulation in response to the heat treatment. These genes included aldolase B, skeletal α-actin, α-tropomyosin, cytochrome c oxidase subunit III, elongation factor-1 α, eukaryotic translation elongation factor γ, guanine-nucleotide-binding protein, fast muscle specific heavy myosin chain 4, isocitrate dehydrogenase 2, 60S ribosomal protein
81 L12, ribosomal protein L27, proteasome 26S subunit, proteasome subunit 7 beta, survival motor neuron domain containing 1, troponin T3a and fast muscle troponin I. One gene, troponin TnnT3b, showed over a three-fold up-regulation in response to heat. Four genes did not change over 1.7-fold in expression. Only one gene, troponin T3a, was down- regulated in the thermal stress B samples and in real-time PCR analyses of thermal stress
A samples.
Comparison of Real-Time PCR Gene Expression Between the “A” and “B” Sets of Stress
Experiments
Real-time PCR results of experiments A and B were compared to assess whether
there were similar gene expression changes in response to different stressors. When
comparing the expression patterns among different stressors, a 1.7 fold-change was set as
the cut-off point for differences in gene expression between stress and control RNA
samples. This arbitrary value was selected based on the lowest fold-change value that was
statistically significant (Table 52) and also based on microarray fold-change cutoff values
used in the literature (Tan et al., 2002; Ton et al., 2002). Comparison of the gene
expression response to the three stressors copper, zinc and thermal stress in Group A
experiment samples is shown in Table 55. None of the candidate genes were similarly
expressed in response to all three stressors. Carboxypeptidase B was consistently down- regulated by both copper and zinc experiments A and B. Common expression patterns in response to the same stressor were rare, either with the direction of expression being different or the fold-change not being large enough to be considered informative. In 72 of the 138 gene expression assays, the fold-change was less than 1.7. The gene β-thymosin
82 was not affected by any of the three stressors using this stringency. In the copper experiments, only carboxypeptidase B and 60S ribosomal protein L12 were down- regulated by copper over 1.7-fold in both experiments A and B. In zinc experiments A and B, carboxypeptidase B was the only gene to be down-regulated over 1.7-fold. Within the thermal stress experiments, there was a pattern of down-regulated genes in both experiments A and B. These five genes included fast muscle specific heavy myosin chain
4, isocitrate dehydrogenase 2, proteasome 26S subunit, troponin T3a and fast muscle troponin I.
A change in the direction of gene expression was observed in 5 of 138 real-time
assays between samples A and B treated with the same stressor. In copper experiments A
and B, one real-time PCR assay showed induction and the other repression of the three
genes survival motor neuron domain containing 1, stathmin and titin. In zinc experiments
A and B, change in direction of gene expression was observed for isocitrate
dehydrogenase 2 and proteasome subunit 7 beta. No such contradiction was observed in
real-time PCR assays of thermal stress samples. To address the question of directional
change in gene expression between experiments A and B, three samples from zinc
experiment B were assayed using 18S as the endogenous standard. Expression for three
genes, proteasome 26S subunit, proteasome subunit 7 beta and titin, was comparable to
expression in experiments A. In 800 µg/L zinc-treated larvae, proteasome 26S subunit
was induced 3.7762 ± 1.58 fold, proteasome subunit 7 beta was induced 4.46 ± 1.53 fold
and titin was induced 1.5575 ± 1.93 fold. Therefore, the choice of endogenous standard
determines the calculation of fold-change. To assess which standard was more accurate,
samples from experiment B were quantified using total RNA as the internal standard.
83 Because 18S and 28S comprise most of the rRNA, it was assumed that Agilent
Bioanalyzer RNA concentrations could be used directly as standards using the following
equation:
C X0E (1 + EXC) TXC RNAexperimental ------= ------× ------(13) C XTC (1 + EXE) TXE RNAcontrol
Where X0E represents initial number of target molecules from the experimental group,
XTC represents initial number of target molecules from control group, E stands for
C C amplification efficiency of PCR reaction, while TXE and TXC represent threshold cycles of the experimental and control groups respectively. “RNA” denotes the RNA concentration. The results of these gene expression calculations for experiment B samples are shown in Table 56. Values equal to 1.000 denote no fold change, values below 1.000 represent gene repression relative to controls and values above 1.000 represent gene induction. Samples from copper B and thermal stress B agreed completely with the previous analysis using BMV as the exogenous standard. With zinc B samples, most gene expression calculations using either BMV or total RNA as standards were in agreement with each other. However, proteasome 26S subunit showed over 1.7-fold induction using total RNA as a standard as opposed to repression when BMV was used as the reference gene. When the arbitrary fold-change cutoff value of 1.7 is applied, gene expression changes were very similar among the stress experiments B using either BMV or total
RNA as the exogenous standard (Table 56). Twenty-two of 23 genes analyzed were in complete agreement using either BMV or total RNA.
84 DISCUSSION
The hypothesis of this study was that a common gene expression pattern would be observed in response to different environmental stressors in larval fathead minnows. To
test this hypothesis, fish larvae were stressed using copper, zinc and elevated temperature. Candidate genes were identified using differential display on fish RNA. The
expression of twenty-three genes that showed a dose-response to stressors was measured
using real-time PCR. A comparison among the different stress tests is described below in
the context of reasons for differential mortality in repeated tests, RNA recovery from fish and its significance, differential display results and real-time PCR results of selected genes for six stress experiments. The hypothesis is then evaluated taking into account all of these results.
Variability in Stress Experiments
The stress experiments using copper, zinc and heat on fathead minnow larvae generally resulted in proportionate mortality with level or duration of the stressor.
However, stress level did not result in equivalent mortality when experiments were
repeated under the same conditions. The repeated stress tests, labeled experiments B, had
different results from the initial experiments, labeled A. Therefore, experiments A and B
could only be considered equivalent in terms of the specific stressor and level of stress
used, but were different in percent mortality, and probably in the physiological and
transcriptional response of the fathead minnow larvae tested. The reasons for the different
outcomes of stress tests, measured as percent survival and transcriptional activity of
specific genes, may be due to several different reasons. Slight differences in water
85 chemistry, variability in the developmental program of the larvae and genetic
polymorphism may have played a role in the variable mortality and transcriptional
profiles of the larvae.
In copper experiment A, fish had a mortality of 44% at 200 µg/L, whereas 200
µg/L copper-exposed fish in experiment B had a lower mortality of 11.6%. Water quality
is known to affect the toxicity of copper to fish (Lloyd, 1961; Mount, 1968; Mount and
Stephan, 1969; Andrew, 1976; Brungs et al., 1976; Howarth and Sprague, 1978; Hodson et al., 1979). Water quality is measured in terms of pH, water hardness, dissolved oxygen,
temperature and the presence of other metals or organic substances in water. Increased
hardness of water decreases copper toxicity to fish by reducing its bioavailability. A 95
µg/L chronic copper concentration in hard water resulted in 50% mortality to adult to
Pimephales promelas (Mount, 1968), whereas 18.4 µg/L Cu in soft water was sufficient
to cause the same mortality (Mount and Stephan, 1969). Howarth and Sprague (1978)
studied the interaction of water hardness and pH on copper lethality to rainbow trout.
They found that pH in soft water (30 mg/L water hardness) had little effect on copper
lethality. pH affected copper lethality in rainbow trout at higher water hardness levels of
100 and 360 mg/L (Howarth and Sprague, 1978). At pH 6 and 7 lethality was greatest, it decreased at pH 5 and 8 and again increased at pH 9 (Howarth and Sprague, 1978). Low
dissolved oxygen increases copper toxicity to fish. Lloyd (1961) compiled results of
several studies to demonstrate a correlation between low dissolved oxygen levels and
increased toxicity of copper salts in the rainbow trout Salmo gairdnerii. Temperature may
influence toxicity either positively or negatively, depending on the toxicant used
(Sprague, 1970). For metals, increased temperature is thought to enhance toxicity.
86 Water quality parameters were kept fairly constant between the two copper experiments (Tables 14 and 17). The few minor water quality differences between the two copper experiments that may have contributed to the different mortalities are detailed below. The conductivity of water increased over the course of the two experiments in both controls and copper-treated containers. This may be because of the fish losing cations such as Na+ and Ca+ to the surrounding water. pH was slightly higher in
experiment A than in experiment B, whereas conductivity was slightly lower in
experiment A compared to experiment B. Higher conductivity readings denote increased
water hardness. Therefore, the water used in experiment A was softer compared with
experiment B water. Temperature was slightly higher in experiment A compared to
experiment B. The only water quality parameter that did not vary much between
experiments A and B was the concentration of dissolved oxygen.
Water chemistry affects the bioavailability and toxicity of zinc to fish, just as in
the case of copper (Lloyd, 1961; Bradley and Sprague, 1985; Hogstrand et al., 1994;
Newman and Unger, 2003; De Schamphelaere and Janssen, 2004). Reducing the amount
of dissolved oxygen increases zinc toxicity to fish (Lloyd, 1961). In adult fish, calcium
competes strongly with zinc for binding sites on gills (Spry and Wood, 1985) and
therefore increased water hardness would decrease the bioavailability of zinc to exposed
fish. pH at 7 in combination with low water hardness of 8.4 mg CaCo3/L made a zinc solution most toxic to rainbow trout compared to higher or lower pHs (Bradley and
Sprague, 1985). Increasing water hardness decreases the toxicity of zinc, and increasing pH increases the toxicity of zinc in very soft water with <1 mg CaCo3/L (Bradley and
87 Sprague, 1985). Zinc is precipitated out of water when hardness increases and hence its bioavailability to fish is reduced.
The 900 µg/L zinc concentration of experiment A resulted in 65% mortality,
while the 800 µg/L zinc concentration of experiment B had a mortality of 42.2%. Zinc
experiments A and B were separate experiments because of different concentrations.
However, both concentrations resulted in fairly high mortality. The water chemistry of
the zinc experiments varied from one set of experiments to the next (Tables 19 and 22).
Water used for the 900 µg/L zinc exposure showed a rise in conductivity, probably
implying an increase in cation concentration because of ion loss from the fish themselves.
This was similar to observations in water chemistry of copper experiments, and, with
both the control and 800 µg/L Zn treatment in experiment B. Final temperature was
slightly greater in zinc experiment B compared to experiment A.
Mortality in the 48-hour 36ºC thermal stress A experiment was 64.8% compared
to the 39.6% mortality of experiment B. The thermal stress experiments A and B were
carried out slightly differently and hence can be considered independent experiments,
even though both had controls at 25˚C and stressed fish at 36˚C. In experiment A,
experimental group fish were subjected to a more acute heat shock, because they were
directly put into heated water. In experiment B, fish were place into unheated water and then incubated, allowing about an hour for acclimatization to the increased water temperature. In thermal stress experiments, water chemistry parameters (Tables 24 and
27) were expected to change because of temperature, but the water chemistry in experiments A and B were expected to change similarly. There were, however, minor differences in the water quality of experiments A and B. A decrease in dissolved oxygen
88 was expected with increased temperature because water’s ability to hold oxygen
decreases as temperatures increase from 4ºC onwards. pH should also decrease if
respiration rates increase and there is more dissolved carbon dioxide or PCO2 in water.
Presumably, increasing temperature would also increase metabolic activity and result in
the release of metabolites through the epithelium of larvae. However, these metabolites
were not cations, because there were no large increases in conductivity in the water used
for either of the thermal stress experiments. When thermal stress experiment A water
chemistry is compared to that of thermal stress experiment B, the dissolved oxygen in water measured in the 48-hr treatment at 36˚C for experiment B was much lower (5.8 mg/L) compared to the same treatment in experiment A (7.0 mg/L). There was a similar disparity within the control groups at 25˚C with 6.6 mg/L dissolved oxygen in experiment
B water and 7.6 mg/L dissolved oxygen in experiment A water. This may be because of the test containers used. Experiment A used 1-liter beakers to hold the fish, while experiment B had a lower volume of water in each container (300 ml). However, the same fish density was maintained across experiments A and B. Other than the fish being subjected to a more acute shock in experiment A than B, there is no explanation for why there was a disparity in percent mortality between the two experiments. The dissolved oxygen measured in water would suggest that fish in experiment B were under more hypoxic stress compared to those in experiment A.
The Pimephales promelas fish populations used for all experiments were obtained
from the EPA-Newtown Center, and the genetic heterogeneity within the population may
have contributed to the different results of the repeated stress experiments. Genotypically
different fathead minnow are known to exhibit differential survivorship to copper
89 (Schlueter et al., 1995; Schlueter et al., 1997). Allozyme studies with Pimephales
promelas exposed to copper found an associated survivorship with specific genotypes at
the GPI-1 (glucose-6-phosphate isomerase), IDH-1 (isocitrate dehydrogenase) and MDH-
2 (malate dehydrogenase) loci (Schlueter et al., 1995; Schlueter et al., 1997).
Genotypically different fish may thus have been exhibited differential survivorship to stress, and the populations used in the B experiments may have had a different genetic make-up compared to the populations used in the A experiments.
Relationship of Stress and RNA
The amount of RNA recovered per fish may be an indication of its overall level of
metabolic activity. While RNA recovery from fish in copper and zinc experiments A and
B were consistent, the RNA recovery from fish in thermal stress experiments was
different between experiments A and B. In the thermal stress experiments, RNA
recovered from the 48-hour treated fish in experiment A was 44% lower compared to that
recovered from controls. In contrast, the amount of RNA recovered from 48-hour treated
fish in experiment B was slightly higher than that from controls. All three stressors were
expected to produce hypoxic stress, although the mechanisms would have been different between heavy metals and elevated temperature. General protein synthesis was expected to decrease under all stress conditions due to hypoxic stress, except for those proteins necessary to protect others from degradation during physiological change. Based on average RNA concentration per fish, reduced transcriptional activity in stressed fish can be inferred in thermal stress experiment A but not in fish from any other experiments.
90 The amount of RNA present reflects the amount of transcriptional activity within a cell, but may not reflect the protein content. Smith et al. (1999) examined RNA synthesis using [3H] uridine in the crucian carp Carassius carassius in response to 48-hr anoxia and found that there were tissue-specific changes in RNA synthesis. Brain RNA synthesis decreased 29%, while the heart increased RNA synthesis by 132% and the liver increased it by 871% (Smith et al., 1999). Smith et al. (1996) also demonstrated that protein synthesis was down-regulated more than 95% in the liver, 53% in heart muscle,
52% in red muscle and 56% in white muscle in the crucian carp responding to anoxic stress. Therefore, RNA synthesis apparently increases to meet the protein demands of a cell when proteins are either used, lost or get degraded during the stress response. Protein synthesis requires ATP to be readily available, that ATP being generated through aerobic respiration requiring mitochondria. Hypoxic conditions where oxygen is limited should therefore slow down protein synthesis, as was observed in fish cells with a relationship between oxygen consumption and protein synthesis (Smith and Houlihan, 1995).
The Stress Genome of the Fathead Minnow
The differential display technique was successful at obtaining candidate genes that responded to stress. The candidate gene sequences contributed to the genomic information about the fathead minnow Pimephales promelas. Altogether, 1762 sequences were collected as candidate bands for stress response in larval fathead minnows, 99% of which were amplified and sequenced. Five hundred and ninety-seven bands had clear sequences, of which 211 matched cDNA clones of undetermined function from various genomic libraries. One hundred and five bands of high sequence quality matched
91 functional genes in the NCBI database, of which 85 were not previously reported in the
Pimephales promelas genomic literature (comparison with gene list of EcoArray 200-
gene fathead minnow chip, Catalog No. CH-FHM-200, Alachua, FL). Most of the
sequences matched genes or cDNA clones obtained from cyprinid fish, those of the
zebrafish Danio rerio being the most common. Both the zebrafish and fathead minnow
belong to the same taxonomic family, but are placed in different subfamilies. In view of
their evolutionary relationship and also because the zebrafish genome is one of the best
characterized fish genomes, it was expected that the fathead minnow sequences would show some homology with zebrafish ESTs.
The Transcriptional Response to Stress
The use of random primer combinations in differential display for identifying
stress-dependent RNAs indicated that each stressor was affecting the same gene ontology in the fathead minnow larvae. From Figure 11, it can be observed that the majority of genes involved in the stress response encoded proteins that played a role in protein
synthesis, followed by genes encoding contractile proteins. The genes affected by all
three stressors, although not identical, generally belong to the same functional categories.
The gene ontology suggests that stress affects similar metabolic pathways but different
genes within those biochemical events. Several ribosomal protein genes were identified
in response to all three stressors (copper, zinc and heat) in fathead minnow larvae. Some of these ribosomal protein genes were common to two or more stressors (60S ribosomal protein L12, L27, L18a, L3, S15, S3A and 40S ribosomal protein S4 genes), while most were identified in response to one specific stressor. Ribosomal protein L21, L26, L4,
92 L5b, L7, S25 and S5 genes were identified as being differentially expressed in response
to copper. Ribosomal proteins S21 and S24 genes were identified as being affected by zinc stress. And ribosomal protein L13 and L32 genes were affected by thermal stress.
Other genes such as those encoding translation elongation factors or translation initiation factors are also included in the ribosome/protein synthesis bar graph in Figure 11. The
short subunits of ribosomal proteins (S) are involved in tethering mRNA to the ribosome
and preventing other parts of the mRNA from interfering with the translated region
(Broderson and Nissen, 2005). The large ribosomal subunits (L) function in the
peptidyltransferase center of the ribosomes (Khaitovich and Mankin, 2000). Repression
of ribosomal proteins was observed in the Gracey et al. (2001) study with hypoxic stress
in Gillichthys mirabilis. Ribosomal proteins are also known to be associated with
physiological changes in yeast (DeRisi et al., 1997; Eisen et al., 1998). Because
ribosomal protein genes and other translation/transcription protein genes comprised the
largest functional group of genes affected by stress, it might be worthwhile to pursue
their biochemical role in stress-regulatory pathways to better understand how cells
respond to stress.
The next group of functional genes affected by stress in this study were those
encoding contractile proteins, including α-actin, α-actinin, α-tropomyosin, desmin,
myosin heavy and light chains, parvalbumin, titin and troponins. Some of these genes
were up-regulated and some down-regulated in response to the three stressors in
differential display. The genes affected were similar to some reported in the Gracey et al.
(2001) study of hypoxia-induced gene expression in Gillichthys mirabilis muscle tissue,
in which actin, myosin and tropomyosin genes were down-regulated. Podrabsky and
93 Somero (2004) found the contractile protein genes for myosin heavy and light chains, and for α-tubulin, differentially expressed in response to fluctuating temperature stress. Ton et al. (2002) found several contractile protein genes down-regulated by hypoxia over a period of 120 hours in embryonic zebrafish. These genes encoded cardiac myosin light chain 2, skeletal myosin light chain 3 and parvalbumin beta (Ton et al., 2002). Stress- induced differential expression of genes encoding specific muscles would influence fish larvae more critically than adult fish. Young embryos and larvae have a high growth rate
(Finn et al., 2002), with myogenesis critically needed to increase the fish’s body mass and to provide the locomotory prowess needed to evade predators and search for food.
Elongated but immature muscle fibers are detected as early as 30 hours after fertilization in fathead minnow larvae and they continue to grow and develop striated banding patterns prior to hatching (Devlin et al., 1996). Therefore, stress-induced changes in muscle gene expression might drastically influence the rate of muscle synthesis. Because several muscles such as tropomyosin and actin interact with each other, an increase in the synthesis of one with decreased synthesis of another muscle fiber might lead to developmental abnormalities in musculature frequently observed in young fish stressed by pollutants (Scudder, 1984; von Westernhagen, 1988; Colavecchia et al., 2004). This irregular muscle growth would inevitably affect the survival of the fish because undeveloped muscles would prevent the fish from effectively catching prey, evading predators or enduring long bouts of swimming.
Besides the abovementioned categories of genes, there were some expected genes whose expression was altered in response to all three stressors. These genes putatively encoded ATPase Na+/K+ transporting, beta 1a polypeptide, heat shock protein 90-beta
94 and heat shock cognate 70kDa protein. Considering that osmoregulation is affected by
both metal and heat stress on account of changes at the membrane level, it was not
surprising that a gene that regulated the Na+/K+ balance was affected by all three
stressors. Heat shock proteins are known to be synthesized in response to several types of
stress. However, the gene expression response of the heat shock proteins, as ascertained
by differential display alone, was not always up-regulation. 200 µg/L copper exposure
repressed both heat shock protein 90-beta and heat shock cognate 70kDa. However, gene
expression assays at a particular time point in the stress response of an organism
represent just that – the amount of mRNA transcripts encoding a particular protein. The
assays may not reflect the amount of protein already present within the organism, which
may inhibit further transcription of its mRNA transcript by a negative feedback loop. One gene most conspicuous by its absence in this study was metallothionein. This liver
protein sequesters excess metal ions that enter an organism and releases the ions when
needed, hence providing protection against increased metal ion exposure. Metallothionein genes were not detected by the differential display technique because they may have been
present in large amounts in both controls and stressed fish. Chen et al. (2004) found that metallothionein was expressed in the zebrafish embryo and early larval stages, as early as the one-celled stage (the liver has not yet developed at this stage). Their conclusions from
the study were that metallothionein transcripts are probably supplied maternally and that
metallothionein may play a very important role in various developmental activities (Chen
et al., 2004).
95 Identification of Common Stress Genes
Twenty-three genes showed a dose-response and were identified in differential display of cDNA samples from at least two stress A experiments. Seven of the 23 genes selected for real-time PCR validation were not previously reported as stress genes. These seven genes included β-thymosin, chymotrypsinogen B1, guanine nucleotide-binding protein, proteasome 26S subunit, proteasome subunit 7 beta, survival motor neuron domain containing 1 and stathmin. The remaining genes or similar genes have all been previously reported as stress responsive (Eisen et al., 1998; Gracey et al., 2001;
Stürzenbaum et al., 2001; Hogstrand et al., 2002; Ton et al., 2002; Brouwer et al., 2004;
De Angelis et al., 2004; Podrabsky and Somero, 2004; Sarropoulou et al., 2005).
The significance of the genes previously not identified with stress is discussed below. β-thymosin is a cytoskeletal protein, chymotrypsinogen B1 is a protein-digesting enzyme synthesized by the pancreas while guanine nucleotide-binding protein is a receptor of activated protein kinase C (RACK), responsible for signal transduction
(Hamilton and Wright, 1999). Proteasomes are known to operate in the stress response by removing abnormal proteins thus allowing cells to adapt to changing environments.
Proteasome 26S specifically is known to degrade proteins by ubiquitination (Hilt and
Wolf, 1996). Survival motor neuron domain containing 1 protein plays a role in translation. Stathmin or p19 is a cytoplasmic phosphoprotein with a regulatory role in cells, being used to prevent the disassembly of microtubules (Koppel et al., 1990).
Stathmin is expressed in neurons, is developmentally regulated and has been suggested to play a role in neuron differentiation (Schubart, 1988).
96 Limitations of Differential Display
Only a fraction of the fathead minnow genome was sampled in this study, some of
which was differentially expressed in response to stressors. The differential display
technique requires a large number of primer combinations to detect all possible cDNAs
present within cells or organisms (Debouck, 1995). In this study, the whole organism was
used. The expected number of ESTs from a single mammalian cell is around 15,000,
while 100,000-150,000 cDNAs are expected from the entire mouse or human genome
(Ali et al., 2001). The mouse and human haploid genome size is estimated to be 3.0 x 109 base pairs. Cyprinids, on the other hand, have between 1.6-2.2 picograms of haploid
DNA (Hinegardner, 1968). This puts the estimate of the cyprinid haploid genome size between 1.5 to 2.0 x 109 base pairs, about half to two-thirds the size of the mouse or
human genome. Because the whole organism was used, it would have been very time-
intensive to have used the differential display technique to obtain all possible
differentially expressed ESTs.
The general shortcomings of the differential display technique include false
positives, low reproducibility of banding patterns, problems associated with primer
design for RT-PCR, and, non-detection of rare mRNA transcripts (Liang et al., 1994;
Bertioli et al., 1995; Liang and Pardee, 1995; McClelland et al., 1995; Graf et al., 1997;
Mohr et al., 1997; Matz and Lukyanov, 1998). False positives refer to differentially expressed bands produced not as a consequence of differential mRNA expression, but due to some anomaly of the PCR reaction. Anchored oligo-dT primers with 50-60% G/C content bind more strongly to RNA than A/T-rich primers and this is though to bias primer annealing to only particular RNA strands (Graf et al., 1997). Low band
97 reproducibility is mainly a consequence of the anchored primer not binding consistently
to the same mRNA in the annealing reaction. The last problem encountered with this
technique is its bias toward high-copy and abundant mRNA species. This sometimes
leads to non-detection of rare mRNA transcripts that may be as rare as 15 copies per cell
(Bertioli et al., 1995) The Gene Specific Relative RT-PCR user manual (Ambion, Austin,
TX) states that RT-PCR requires at least one-hundred copies of a message for detection in practice, though in theory every single copy should be amplified by the reaction. In
this study, there were very few problems associated with band reproducibility and this
problem occurred in less than 1% of the bands observed in differential display.
Minimization of false positives was attempted by running two biological samples
alongside each other (Sompayrac et al., 1995) and bands were selected as candidate genes
for differential gene expression only if changes in band intensity were observed in both
duplicates of an experimental group. All of the anchored primers used had either a G or
C; hence there may have been a bias towards certain mRNA species. Based on the fact
that multiple candidate bands were homologous to a single gene using BLAST, the
inference is that most of the genes identified from differential display were abundant in
the RNA samples. Band redundancy is a common problem encountered in differential
display and was frequently observed in this study (Ledakis et al., 1998).
In this study, a high percentage of differentially expressed sequences were
identified with those already present in databases. Only seven out of 597 clear sequences
failed to match a gene or cDNA clone within the NCBI database. A majority of the
sequences generated by differential display are between 100-500 bp (Liang and Pardee,
1992; Jurecic et al., 1998) and may represent the 3' untranslated regions (UTRs) of
98 mRNA. Sunyaev et al. (2000) showed that the 3'UTRs of genes are more conserved than
degenerate sites in the human genome. The fathead minnow genes seem to be conserved
at the 3’UTR as almost 99% of differential display-derived clear sequence data matched
an EST within the NCBI database. Only 597 of 1762 bands had clear sequence data. The
low success rate in this regard could be attributed to more than one sequence being
present in a cut differential display band, poor sequence reaction, impurities within the
isolated amplicon, or, not enough starting DNA to generate a good signal for sequence
analysis.
Sequences that had the same BLAST match were often obtained from two
separate anchor primers in combination with the same arbitrary primer or vice versa. In
most cases, either the arbitrary or the anchor primer was the same. This degeneracy may have been caused by anchor primers binding nonspecifically to regions of mRNA, or due to nonspecific binding of arbitrary primers to cDNA. The RT reaction takes place at
50ºC; this temperature may not be high enough for specific primer-mRNA binding. Non- specific binding of primers probably implies that the mRNAs targeted by differential display were present in high numbers and rare transcripts ignored, a criticism put forward by Bertioli et al. (1995). Mathieu-Daudé et al. (1996) claimed the reverse situation.
Abundant mRNA sequences would be so well amplified that they would not show differential expression because of equal band intensities in all experimental groups.
Another problem encountered while using the differential display technique was
that frequently on reamplifying the cut candidate sequences, there would be more than
one amplicon produced by the PCR and detected on the agarose gel used to detect them.
An explanation for this is the anomalous band migration of DNA fragments in
99 polyacrylamide gels. DNA bands with high A-T content exhibit this anomalous migration independent of what is expected from their molecular weights (Stellwagen, 1983).
Therefore, even though the resolving power of polyacrylamide gels is considered high,
different sized products were obtained from bands that should have been the same length
and hence undetectable by separation in agarose.
Further difficulties interpreting differential display results were encountered when
cDNA products were sequenced and identified. Frequently, the same BLAST-identified
gene showed up- and down-regulation in different gels from differential display. This
may have been due to non-specific PCR, or, limitations of the BLAST algorithm or NCBI
database in distinguishing between individual genes and those present within a gene
family. Only a specific gene may have been present in the database, or the BLAST match
showed it to be the closest match. Therefore, even though the differential display may
have been accurate and bands detected correctly, there may have been some error in
attributing identity to a target sequence because of the sequence alignment tool used. In
such cases, if there were more than three hits for that gene identity, the majority were
considered as the expression response and noted as such. This is further evidence that a
second technique, made more sensitive by the use of gene-specific primers or probes, is
required to confirm expression changes observed in differential display. The BLAST
algorithm is known to work well when the length of the probe sequence is greater than
200 base pairs (Anderson and Brass, 1998). Most clear sequence reads over 200 bps in length were homologous to an EST in the GenBank database. However, sequence homology by BLAST does not always ensure that sequences have the same protein function for the following reasons. Some sequence stretches are common and/or
100 multifunctional, and, are present in more than one gene of diverse function (Primrose and
Twyman, 2004). Genes become similar either due to convergence or because of homology (Eisen, 1998). Convergent genes are similar due to events independent of
descent from a common ancestor, while homologous genes imply that they share a
common function because they have evolved from a common ancestor (Eisen, 1998).
One example is the α/β hydrolase stretch that is found in catalytic enzymes and also in a
cell adhesion molecule (Primrose and Twyman, 2004). Genes may have acquired other
functions over the course of evolution, or they may have more than one function, or, the
database itself may contain entry errors (Primrose and Twyman, 2004). It is therefore
important to establish gene function independently in order to confidently assign a
function to a stretch of DNA sequence. The BLAST algorithm sometimes will result in
hits that do not necessarily denote phylogenetic relationships between the target probe
being analyzed and its nearest match (Koski and Golding, 2001), although in this study
most BLAST matches aligned with teleost fish sequences, those of the zebrafish Danio rerio being most prevalent.
Real-Time PCR View of the Transcriptional Response to Stress
Because of the inherent inaccuracy of the differential display procedure, gene
expression was measured in experiment A samples using real-time PCR with 18S rRNA
as the endogenous reference gene. 18S was selected as the internal reference gene based
on its use in another study (Hoffman, 2004), because universal primers were available for
this gene and because it is known to show very little variability (Aerts et al., 2004). Gene
expression was measured in the high-dose samples compared to controls because
101 transcriptional responses in the higher doses were expected to be dramatic and also
because of the expense of real-time PCR reagents. In copper experiment A with fathead
minnow larvae, fifteen genes had over 1.7- fold changes in gene expression and nine of
these were validated from the differential display analysis. When the copper experiment
was repeated and samples assayed again using real-time PCR with BMV as the reference
gene, two genes were significantly repressed in common with analyses from the previous
copper experiment A. The two genes were carboxypeptidase B and 60S ribosomal
protein L12. For fathead minnow stressed by 900 µg/L zinc, three genes showed over 1.7
fold-change differences in experiment A samples. Even though 14 genes were
significantly down-regulated in 800 µg/L Zn-treated larvae, only carboxypeptidase B was validated across gene expression assays of samples A and B. When thermal stress samples from experiments A and B were compared, the gene troponin I was consistently down-regulated across differential display and real-PCR assays. However, because of the fewer number of thermal stress candidate genes whose expression was categorized by
differential display, it is worthwhile to note that both fast muscle specific heavy myosin
chain 4 and troponin T3a were consistently down-regulated in thermal stress samples A and B as analyzed by real-time PCR.
Comparison of gene expression patterns between experiment A and B samples, as
shown in Table 55, reveals that many of the genes studied did not show enough of a fold-
change difference to be considered informative. Seventy-two gene expression assays of
138 were inconclusive because fold-change values were less than 1.7. Sixty-six gene
assays of 138, on the other hand, contributed to an understanding of gene expression in
stressed fathead minnow larvae. Of the 23 genes assayed with real-time PCR, only one
102 gene β-thymosin showed little expression change in stress-treated fish compared to
controls. Therefore, most candidate genes obtained using differential display are probably
affected by stress in fathead minnow larvae.
When copper-stressed larval groups were compared, in three real-time PCR
assays of survival motor neuron domain containing 1, stathmin and titin, the direction of
gene expression changes was different in samples A and B. This was also observed for
two genes within the zinc experiments, isocitrate dehydrogenase 2 and proteasome subunit 7 beta. There were no contradictions observed in directional gene expression changes between the A and B thermal stress experiments. To resolve how the reference gene and procedure used may have contributed to some of the anomalous expression
observed for the same stressors, zinc B samples were assayed with 18S as the
endogenous standard and use of random nonamer primers for reverse transcription. For
two genes proteasome 26S subunit and proteasome subunit 7 beta, gene expression
changed in direction over 1.7 fold compared to gene expression assays involving BMV as
the reference gene and polyT reverse transcription primers. For one gene, titin, the fold-
change was below 1.7 and hence considered inconclusive. Therefore, the calculation of
gene expression is dependent on the choice of standard and procedure used. The choice
of primers used for the reverse transcription reaction is critical in real-time PCR and fold-
change calculations for a gene can vary as much as 24-fold when different primers are
used (Ståhlberg et al., 2004). Therefore, it is recommended that when specific fold-
changes in gene expression are compared, the real-time PCR methodology used must be
consistent and preferably performed using the same master mix (Ståhlberg et al., 2004).
103 Limitations of Real-Time PCR
The difficulties encountered when using real-time PCR were many. One of them
was finding a good housekeeping gene that could be used as a normalizer or standard.
This gene has to have similar expression to target genes being assayed and an amplification efficiency close to 100% (Bustin and Nolan, 2004). Using the exogenous standard BMV to normalize experiment B samples worked well in real-time PCR analyses. BMV primers had a reaction efficiency of 94.21, which is within the 100±10% range. Reverse transcription reactions could be performed using both poly-dT primers and the BMV reverse primer. The advantage of this method was that only mRNA was
targeted for reverse transcription into cDNA, which was also targeted during reverse
transcription in differential display. PolyT primers in RT reactions generally result in a
single cDNA strand from an mRNA strand, as the only binding site for the primer is the
3’ polyA tail, hence there would be no disadvantage of a message being represented
multiple times due to more than one binding site. PolyT RT primer is therefore a sensitive
primer for use in reverse transcription and subsequently for the real-time PCR assay.
However, using the BMV did not correct for differences in total RNA concentration and
hence fold-change calculation of gene expression had to incorporate this additional
correction.
The endogenous standard 18S rRNA was perforce used to assay experiment A
samples by real-time PCR. This was the standard chosen because the genome information for Pimephales promelas is scarce and no other well-known housekeeping gene sequence information was available. The 18S rRNA primers amplified a fragment that was expected to be 315 bps long. The reaction efficiency for the 18S primers was only 76.47,
104 which is rather low. The amplification efficiency is best for DNA amplicon sizes between
50-150 bps, as better strand separation is expected during the denaturation stage of PCR and more template is available for the reaction. The longer 315 bp amplicons would be expected to reduce the amplification efficiency. Using the 18S rRNA for the internal standard also implied that random nanomers were used in the reverse transcription reaction instead of poly-dT primers because polyT primers do not bind rRNA. The use of random nonamers in the RT reaction, as well as the lower volume of gene-specific primers used, resulted in amplification efficiencies that were different from those obtained with poly-dT cDNAs. The amplification efficiencies for most primer pairs, however, were still in the 100±10% range. Use of nanomer random primers implies that the RNA population was analyzed differently compared to the differential display and real-time analyses with oligo-dT primers. Random primers provide less sensitivity in
PCR reactions, especially for rare transcripts, and yield shorter cDNAs on average. The majority of cDNA produced using random primers would be from rRNA and hence the primers may be competing with rare transcripts present in the sample (Bustin and Nolan,
2004). Furthermore, it may generate more than one cDNA transcript for the same product since it can bind to the original transcript at more than one point (Bustin and Nolan,
2004). The comparatively low temperature (42ºC) at which reverse transcriptase works is not advantageous to specific binding and therefore increases the chances of random non- specific binding of random nonamers to abundant RNA species (Bustin and Nolan,
2004). This choice of reverse transcription primer is therefore not an ideal one, especially for rare transcripts. The endogenous standard 18S used may not be an ideal standard for assaying samples from metal experiments because the total RNA amount may be
105 affected. Zinc inhibits RNA polymerase I (observed in human cells), which generates all the rRNA subunits from a larger product (Nagamine et al., 1979).
Evaluation of Hypothesis and Conclusions
The hypothesis of the experiment was that there is a small subset of commonly expressed genes that respond to different stressors. Using differential display, a comparison of all identified cDNAs revealed thirty-five genes commonly affected in at least two stress experiments. However, most of the commonly identified genes did not have an identical expression pattern of response to the three stressors in differential display. Twenty-three of the differential display-derived stress candidate genes, observed to be dose-responsive, were assayed for expression changes using real-time PCR. The hypothesis was not conclusively supported by gene expression comparison using real- time PCR analyses. A few genes were consistently informative in real-time PCR assays.
One gene, carboxypeptidase B, was down-regulated over 1.7-fold in samples from copper- and zinc-stressed fish. No commonly expressed gene was identified for all three stressors. There appear to be different genes affected by the three stressors copper, zinc and heat and many of these genes did not show an identical directional change in expression assays. CarboxypeptidaseB and ribosomal protein L12 were consistently repressed in copper-treated fish using differential display and real-time PCR, while carboxypeptidase B was consistently repressed in zinc-treated samples. Troponin I was consistently repressed in all thermal stress samples using real-time PCR. Because of the small number of common genes identified by differential display, more stress candidate genes are probably needed to test the hypothesis more rigorously. The variable mortality
106 associated with the repeated stress tests may have played a role in determining the unique
transcription patterns observed in response to each stressor over time. Ideally, the study
should be repeated on individuals from an isogenic strain with minimum genetic
polymorphisms. In addition only fish populations with similar stress-associated
mortalities should be further studied for gene expression differences.
The results from this study suggest that:
(1) differential display is useful in identifying physiologically responsive genes in genetically uncharacterized organisms, (2) when measuring gene expression with real- time PCR, the same methodology should be used to measure comparative fold changes, and, (3) the transcriptional response to copper, zinc and thermal stress in fathead minnow larvae is not identical as assayed by differential display and real-time PCR.
The similar gene ontology pattern obtained from stressed fathead minnow larvae probably implies that the fish follow a sequential transcriptional program, more associated with development than being stress-responsive; stressors may disrupt this program rather than inducing a particular stress response in the fish at this early life stage.
The results from this study suggest that the expression of candidate genes is perturbed in some way by environmental stress. However, the pattern of this perturbation is not predictable.
In adult fish, the stress response is centrally mediated by the hypothalamic-
pituitary-interrenal and brain-chromaffin axes, which results in the release of
corticosteroids and catecholamines (Wendelaar Bonga, 1997). These hormones then
cause secondary and tertiary stress responses. Barry et al. (1995) found that whereas
interrenal cells from larval rainbow trout could produce cortisol, whole fish did not
107 produce cortisol in response to stress, probably because the hypothalamic-pituitary-
interrenal axis activation required more brain development than was present at 2 weeks
post-hatch. The brain of the fathead minnow may have been at a very early stage of development, which did not enable larvae to deal with stress in a consistent, organized manner. Age may also be a factor in causing different gene expression responses to stress. In a study with the Atlantic cod Gadus morhua, Finn et al. (2002) found that
larvae increased their mean body mass almost 2000 times within 48 days. This suggests a
very high metabolic rate, implying that the gene expression response in larvae may be as
highly dynamic as its growth rate. Hence, if fish differ slightly in terms of age, the gene expression pattern itself would be changing rapidly and it might be difficult to predict a consistent stress-responsive pattern. It is known that the stress response in fish differs in different species and within different subpopulations of the same species (Barton, 2002).
Therefore, genetic polymorphism of fathead minnow populations may cause differences in gene expression patterns exhibited by them in response to stress. Epigenetics may also play a role in determining which genes are expressed in larvae to begin with.
Future work to test the hypothesis should include a larger collection of genes,
preferably on a gene chip, to test for a common gene expression pattern with different
stressors in genetically similar fathead minnow larvae. It may also be worthwhile to test
fish that have completed the initial developmental phase to measure how their
transcriptional response to stress differs from that of newly hatched larvae.
108 LITERATURE CITED
Aerts, J. L., M. I. Gonzalez and S. L. Topalian. 2004. Selection of appropriate control genes to assess expression of tumor antigens using real-time PCR. BioTechniques 36(1): 84-91.
Ahlquist, P., V. Luckow and P. Kaesberg. 1981. Complete nucleotide sequence of Brome Mosaic Virus RNA3. Journal of Molecular Biology 153: 23-38.
Ahlquist, P., R. Dasgupta and P. Kaesberg. 1984. Nucleotide sequence of the Brome Mosaic Virus genome and its implications for viral replication. Journal of Molecular Biology 172: 369-383.
Airaksinen, S., C. M. I. Råbergh, L. Sistonen and M. Nikinmaa. 1998. Effects of heat shock and hypoxia on protein synthesis in rainbow trout (Oncorhynchus mykiss) cells. The Journal of Experimental Biology 201: 2543-2551.
Ali, M., A. F. Markham and J. D. Isaacs. 2001. Application of differential display to immunological research. Journal of Immunological Methods 250: 29-43.
Altschul, S. F., T. L. Madden, A. A. Schäffer, J. Zhang, Z. Zhang, W. Miller and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 25(17): 3389-3402.
Anderson, I., and A. Brass. 1998. Searching DNA databases for similarities to DNA sequences: when is a match significant? Bioinformatics 14(4): 349-356.
Andrew, R. W. 1976. Toxicity relationships to copper forms in natural waters. Pages 127- 143 in Andrew, R. W., P. V. Hodson and D. E. Konasewich (eds.): Toxicity to Biota of Metal Forms in Natural Water. Proceedings of a workshop held in Duluth, MN, October 7-8, 1975.
Ankley, G. T., R. D. Johnson, G. Toth, L. C. Folmar, N. E. Detenbeck, and S. P. Bradbury. 1997. Development of a research strategy for assessing the ecological risk of endocrine disruptors. Rev. Toxicol. 1: 71-106.
Applied Biosystems. 2004. Guide to Performing Relative Quantitation of Gene Expression Using Real-Time Quantitative PCR. Applied Biosystems, Foster City, CA.
Applied Biosystems. 2003. Sequence Detection Systems, ABI PRISM®7900HT, 7000, 7700; GeneAmp®5700: Chemistry Guide. Applied Biosystems, Foster City, CA.
Baker, J. T. P. 1969. Histological and microscopical observations on copper poisoning in the winter flounder (Pseudopleuronectes americanus). Journal of the Fisheries Research Board Canada 26: 2785-2793.
109 Barry, T. P., M. Ochiai and J. A. Malison. 1995. In vitro effects of ACTH on interrenal corticosteroidogenesis during early larval development in rainbow trout. General and Comparative Endocrinology 99: 382-387.
Barton, B. A. 2002. Stress in fishes: a diversity of responses with particular reference to changes in circulating corticosteroids. Integrative and Comparative Biology 42: 517-525.
Bartosiewicz, M., M. Trounstine, D. Barker, R. Johnston and A. Buckpitt. 2000. Development of a toxicological gene array and quantitative assessment of this technology. Archives of Biochemistry and Biophysics 376(1): 66-73.
Bartosiewicz, M., S. Penn and A. Buckpitt. 2001. Applications of gene arrays in environmental toxicology: fingerprints of gene regulation associated with cadmium chloride, benzo(a)pyrene, and trichloroethylene. Environmental Health Perspectives 109: 71-74.
Becker, A., A. Reith, J. Napiwotzki and B. Kadenbach. 1996. A quantitative method of determining initial amounts of DNA by polymerase chain reaction cycle titration using digital imaging and a novel DNA stain. Analytical Biochemistry 237: 204-207.
Bertioli, D. J, U. H. A Schlicter, M. J. Adams, P. R Burrows, H-H. Steinbiβ, and J. F. Antoniw. 1995. An analysis of differential display shows a strong bias towards high copy number mRNAs. Nucleic Acids Research 23 (21): 4520-4523.
Blaxter, J. H. S. 1969. Development: eggs and larvae. Pages 177-252 in W. S. Hoar and D. J. Randall, editors. Fish Physiology, Volume III. Academic Press, Inc., New York, NY.
Blaxter, J. H. S. 1988. Pattern and variety in development. Pages 1-58 in Hoar, W. S., and D. J. Randall (eds.): Fish Physiology, volume XI, Part A. Academic Press, San Diego, CA.
Bradley, R. W., and J. B. Sprague. 1985. Influence of pH, water hardness, and alkalinity on the acute lethality of zinc to rainbow trout (Salmo gairdneri). Canadian Journal of Fisheries and Aquatic Sciences 42: 731-736.
Brett, J. R. 1956. Some principles in the thermal requirements of fishes. The Quarterly Review of Biology 31(2): 75-87.
Broderson, D. E., and P. Nisson. 2005. The social life of ribosomal proteins. FEBS Journal 272: 2098-2108.
Brungs, W. A. 1969. Chronic toxicity of zinc to the fathead minnow, Pimephales promelas Rafinesque. Transactions of the American Fisheries Society 2: 272-279.
110 Brungs, W. A., J. R. Geckler and M. Gast. 1976. Acute and chronic toxicity of copper to the fathead minnow in a surface water of variable quality. Water Research 10: 37-43.
Bustin, S. A., and T. Nolan. 2004. Analysis of mRNA expression by real-time PCR. Pages 125-184 in Edwards, K., J. Logan and N. Saunders (eds.): Real-Time PCR. An Essential Guide. Horizon Bioscience, Norfolk, UK.
Buckley, B. A., and G. E. Hofmann. 2002. Thermal acclimation changes DNA-binding activity of heat shock factor 1 (HSF1) in the goby Gillichthys mirabilis: implications for plasticity in the heat-shock response in natural populations. The Journal of Experimental Biology 205: 3231-3240.
Callard, D., B. Lescure and L. Mazzolini. 1994. A method for the elimination of false positives generated by the mRNA differential display technique. BioTechniques 16(6): 1096-1103.
Carginale, V., C. Capasso, R. Scudiero and E. Parisi, 2002. Identification of cadmium- sensitive genes in the Antarctic fish Chionodraco hamatus by messenger RNA differential display. Gene 299: 117-124.
Carpenter, K. E. 1927. The lethal action of soluble metallic salts on fishes. British Journal of Experimental Biology 4: 378-390.
Carreau, N. D., and G. G. Pyle. 2005. Effect of copper exposure during embryonic development on chemosensory function of juvenile fathead minnows (Pimephales promelas) . Ecotoxicology and Environmental Safety 61: 1-6.
Chapman, P. M. 2000. Whole effluent toxicity testing – usefulness, level of protection, and risk assessment. Environmental Toxicology and Chemistry 19: 3-13.
Chen, W-Y, J. A. C. John, C-H Lin, H-F Lin, S-C Wu, C-H Lin and C-Y Chang. 2004. Expression of metallothionein gene during embryonic and early larval development in zebrafish. Aquatic Toxicology 69: 215-227.
Cheung, A. P. L., T. H.-J. Lam, and K. M. Chan. 2004. Regulation of Tilapia metallothionein gene expression by heavy metal ions. Marine Environmental Research 58: 389-394.
Colavecchia, M. V., S. M. Backus, P. V. Hodson and J. L. Parrott. 2004. Toxicity of oil sands to early life stages of fathead minnows (Pimephales promelas). Environmental Toxicology and Chemistry 23(7): 1709-1718.
Costa, M. L., R. C. Escaleira, V. B. Rodrigues, M. Manasfi and C. S. Mermelstein. 2002. Some distinctive features of zebrafish myogenesis based on unexpected distributions of the muscle cytoskeletal proteins actin, myosin, desmin, α-actinin, troponin and titin. Mechanisms of Development 116: 95-104.
111
Costa, M. L., R. C. Escaleira, M. Manasfi, L. F. De Souza and C. S. Mermelstein. 2003. Cytoskeletal and cellular adhesion proteins in zebrafish (Danio rerio) myogenesis. Brazilian Journal of Medical and Biological Research 36: 1117-1120.
Crawshaw, L.I. 1980. Temperature regulation in vertebrates. Annual Review of Physiology 42: 473-91.
Dasgupta, R., and P. Kaesberg. 1982. Complete nucleotide sequences of the coat protein messenger RNAs of brome mosaic virus and cow-pea chlorotic mottle virus. Nucleic Acids Research 10(2): 703-713.
De Angelis, M., R. Di Cagno, C. Huet, C. Crecchio, P. F. Fox and M. Gobbetti. 2004. Heat shock response in Lactobacillus plantarum. Applied and Environmental Microbiology 70(3): 1336-1346.
de Schamphelaere, K. A. C., and C. R. Janssen. 2004. Bioavailability and chronic toxicity of zinc to juvenile rainbow trout (Oncorhynchus mykiss): comparison with other fish species and development of a biotic ligand model. Environmental Science and Technology 38: 6201-6209.
Debouck, C. 1995. Differential display or differential dismay? Current Opinion in Biotechnology 6: 597-599.
Demeke, T., and R. P. Adams. 1992. The effects of plant polysaccharides and buffer additives on PCR. BioTechniques 12(3): 332-334.
Denslow, N. D., C. J. Bowman, R. J. Ferguson, H. S. Lee, M. J. Hemmer and L. C. Folmar. 2001a. Induction of gene expression in sheepshead minnows (Cyprinodon variegatus) treated with 17β-estradiol, diethylstilbestrol, or ethinylestradiol: the use of mRNA fingerprints as an indicator of gene regulation. General and Comparative Endocrinology 121: 250-260.
Denslow, N. D., H. S. Lee, C. J. Bowman, M. J. Hemmer and L. C. Folmar. 2001b. Multiple responses in gene expression in fish treated with estrogen. Comparative Biochemistry and Physiology Part B 129: 277-282.
DeRisi, J. L., V. R. Iyer and P. O. Brown. 1997. Exploring the metabolic and genetic control of gene expression on a genomics scale. Science 278: 680-686.
Devlin, E. W., J. D. Brammer, R. L. Puyear and J. M. McKim. 1996. Prehatching development of the fathead minnow Pimephales promelas Rafinesque. USEPA publication EPA/600/R-96/079, Cincinnati, OH.
112 Dinant, S., M. Janda, P. A. Kroner and P. Ahlquist. 1993. Bromovirus RNA replication and transcription require compatibility between the polymerase- and helicase-like viral RNA synthesis proteins. Journal of Virology 67(12): 7181-7189.
Donaldson, E. M., and H. M. Dye. 1975. Corticosteroid concentrations in sockeye salmon (Oncorhynchus nerka) exposed to low concentrations of copper. Journal of the Fisheries Research Board Canada 32(4): 533-539.
Dyer, S. D., K. L. Dickson, E. G. Zimmerman and B. M. Sanders. 1991. Tissue-specific patterns of synthesis of heat-shock proteins and thermal tolerance of the fathead minnow (Pimephales promelas). Canadian Journal of Zoology 69: 2021-2027.
Eisen, M. B., P. T. Spellman, P. O. Brown and D. Botstein. 1998. Cluster analysis and display of genome-wide expression patterns. Proceedings of the National Academy of Sciences USA 95: 14863-14868.
Eisen, J. A. 1998. Phylogenomics: improving functional predictions for uncharacterized genes by evolutionary analysis. Genome Research 8: 163-167.
Eisler, R., and G. R. Gardner. 1973. Acute toxicology to an estuarine teleost of mixtures of cadmium, copper and zinc salts. Journal of Fish Biology 5: 131-142.
Elliott, J. M. 1981. Some aspects of thermal stress on freshwater teleosts. Pages 209-245 in Pickering, A. D. (ed.): Stress and Fish. Academic Press, London, UK.
Finn, R. N., I. Rønnestad, T. van der Meeren and H. J. Fyhn. 2002. Fuel and metabolic scaling during the early life stages of Atlantic cod Gadus morhua. Marine Ecology Progress Series 243: 217-234.
Fukuhara, O. 1990. Effects of temperature on yolk utilization, initial growth, and behaviour of unfed marine fish-larvae. Marine Biology 106: 169-174.
Gardner, G. R., and G. LaRoche. 1973. Copper induced lesions in estuarine teleosts. Journal of the Fisheries Research Board Canada 30: 363-368.
Geschwind, D. H., J. Ou, M. C. Easterday, J. D. Dougherty, R. L. Jackson, Z. Chen, H. Antoine, A. Terkikh, I. L. Weissman, S. F. Nelon, and H. I. Kornblum. 2001. A genetic analysis of neural progenitor differentiation. Neuron 29: 325-339.
Gonzalez, P., Y. Dominique, J. C. Massabuau, A. Boudou and J. P. Bourdineaud. 2005. Comparative effects of dietary methylmercury on gene expression in liver, skeletal muscle, and brain of the zebrafish (Danio rerio). Environmental Science and Technology 39(11): 3972-3980.
113 Gracey, A. Y., J. V. Troll and G. N. Somero. 2001. Hypoxia-induced gene expression profiling in the euryoxic fish Gillichthys mirabilis. Proceedings of the National Academy of Sciences USA 98(4): 1993-1998.
Graf, D., A. G. Fisher, and M. Merkenschlager. 1997. Rational primer design greatly improves differential display-PCR (DD-PCR). Nucleic Acids Research 25 (11): 2239- 2240.
Guigó, R., P. Agarwal, J. F. Abril, M. Burset and J. W. Fickett. 2000. An assessment of gene prediction accuracy in large DNA sequences. Genome Research 10: 1631-1642.
Hamadeh. H. K., and C. A. Afshari. 2004. Toxicogenomics, Principles and Applications. Wiley-Liss, Hoboken, NJ.
Hamilton, L. C., and J. M. Wright. 1999. Isolation of complementary DNAs coding for a receptor for activated C kinase (RACK) from zebrafish (Danio rerio) and tilapia (Oreochromis niloticus): constitutive developmental and tissue expression. Marine Biotechnology 1: 279-285.
Heikkila, J. J., G. A. Schultz, K. Iatrou and L. Gedamu. 1982. Expression of a set of fish genes following heat or metal ion exposure. The Journal of Biological Chemistry 257 (20): 12000-12005.
Higuchi, R., C. Fockler, G. Dollinger and R. Watson. 1993. Kinetic PCR analysis: real- time monitoring of DNA amplification reactions. Bio/technology 11: 1026-1030.
Hilt, W., and D. H. Wolf. 1996. Proteasomes: destruction as a programme. Trends in Biochemical Science 21: 96-102.
Hinegardner, R. 1968. Evolution of cellular DNA content in teleost fishes. The American Naturalist 102 (928): 517-523.
Hochachka, P. W., and G. N. Somero. 2002. Biochemical Adaptation. Mechanism and Process in Physiological Evolution. Oxford University Press, New York, NY.
Hodson, P. A., U. Borgmann and H. Shear. 1979. Toxicity of copper to aquatic biota. Pages 307-312 in Nriagu, J. O. (ed.): Copper in the Environment, Part II. Health Effects. John Wiley and Sons, New York, NY.
Hoffmann, J. L. 2004. Altered gene expression: a mechanism of reproductive toxicity in zebrafish (Danio rerio) exposed to benzo[a]pyrene. Doctoral dissertation, Miami University, Oxford, OH.
Hogstrand, C., R. W. Wilson, D. Polgar and C. M. Wood. 1994. Effects of zinc on the kinetics of branchial calcium uptake in freshwater rainbow trout during adaptation to waterborne zinc. Journal of Experimental Biology 186: 55-73.
114
Hogstrand, C., and C. M. Wood. 1996. The physiology and toxicology of zinc in fish. Pages 61-84 in Taylor, E. W. (ed.): Toxicology of Aquatic Pollution. Cambridge University Press, Cambridge, UK.
Hogstrand, C., S. Balesaria, and C. N. Glover. 2002. Application of genomics and proteomics for study of integrated response to zinc exposure in a non-model fish species, the rainbow trout. Comparative Biochemistry and Physiology Part B 133: 523-535.
Horne, A. J., and C. R. Goldman. 1994. Limnology. Second edition. McGraw-Hill, Inc., New York, NY.
Howarth, R. S., and J. B. Sprague. 1978. Copper lethality to rainbow trout in waters of various hardness and pH. Water Research 12: 455-462.
Hutchinson, T. C., A. Fedorenko, J. Fitchko, A. Kuja, J. Vanloon, and J. Lichwa. 1974. Movement and compartmentation of nickel and copper in an aquatic ecosystem. Pages 565-585 in Nriagu, J. O. (Ed.): Environmental Biogeochemistry, Metal Transfer and Ecological Mass Balances. Ann Arbor Science Publishers, Inc.
Hwang, G. C., S. Watabe and K. Hashimoto. 1990. Changes in carp myosin ATPase induced by temperature acclimation. Journal of Comparative Physiology 160: 233-239.
InterPro database. www.ebi.ac.uk/interpro.
Jobling, M. 1995. Environmental Biology of Fishes. Chapman and Hall, London, UK.
Johnston, I. A., V. L. A. Vieira and M. Abercromby. 1995. Temperature and myogenesis in embryos of the Atlantic herring Clupea harengus. The Journal of Experimental Biology 198: 1389-1403.
Johnston, I. A. 2001. Genetic and environmental determinants of muscle growth patterns. Pages 141-186 in Johnston, I. A. (ed.): Muscle Development and Growth. Academic Press, San Diego, CA.
Johnston, I. A., and T. E. Hall. 2004. Mechanisms in muscle development and responses to temperature change in fish larvae. Pages 85-116 in Govoni, J. J. (ed.): The Development of Form and Function in Fishes and the Question of Larval Adaptation. American Fisheries Society Symposium 40. American Fisheries Society, Bethesda, MD.
Jurecic, R., Nachtman, R. G., Colicos, S. M., and J. W. Belmont. 1998. Identification and cloning of differentially expressed genes by long-distance differential display. Analytical Biochemistry 259: 235-244.
115 Karan, V. S. Vitorović, V. Tutundžić and V. Poleksić. 1998. Functional enzymes activity and gill histology of carp after copper sulfate exposure and recovery. Ecotoxicology and Environmental Safety 40: 49-55.
Karsi, A., P. Li, R. A. Dunham and Z J Liu. 1998. Transcriptional activities in the pituitaries of channel catfish before and after induced ovulation by injection of carp pituitary extract as revealed by expressed sequence tag analysis. Journal of Molecular Endocrinology 21: 121-129.
Karsi, A., G. C. Waldbieser, B. C. Small and W. R. Wolters. 2005. Genomic structure of proopiomelanocortin gene and expression during acute low-water stress in channel catfish. General and Comparative Endocrinology 143: 104-112.
Khaitovich, P., and A. S. Mankin. 2000. Reconstitution of the 50S subunit with in vitro- transcribed 23S rRNA: a new tool for studying peptidyltransferase. Pages 229-243 in Garrett, R. A., S. R. Douthwaite, A. Liljas, A. T. Matheson, P. B. Moore and H. F. Noller (eds.): The Ribosome: Structure, Function, Antibiotics and Cellular Interactions. ASM Press, Washington, D. C.
Koppel, J., M-C Boutterin, V. Doye, H. Peyro-Saint-Paul and A. Sobel. 1990. Developmental tissue expression and phylogenetic conservation of stathmin, a phosphoprotein associated with cell regulations. Journal of Biological Chemistry 265(7): 3703-3707.
Koski, L. B., and G. B. Golding. 2001. The closest BLAST hit is often not the nearest neighbor. Journal of Molecular Evolution 52: 540-542.
Kyle, H. M. 1926. The Biology of Fishes. The Macmillan Company, New York, NY.
Landis, W. G., and M-H Wu. 1995. Introduction to Environmental Toxicology. Impacts of Chemicals Upon Ecological Systems. Lewis Publishers, Boca Raton, FL.
Larkin, P., T. Sabo-Attwood, J. Kelso and N. D. Denslow. 2002. Gene expression analysis of largemouth bass exposed to estradiol, nonylphenol, and p,p’-DDE. Comparative Biochemistry and Physiology Part B 133: 543-557.
Lashkari, D. A., J. L. DeRisi, J. H. McCusker, A. F. Namath, C. Gentile, S. Y. Hwang, P. O. Brown and R. W. Davis. 1997. Yeast microarrays for genome wide parallel genetic and gene expression analysis. Proceedings of the National Academy of Sciences USA 94: 13057-13062.
Ledakis, P., H. Tanimura and T. Fojo. 1998. Limitations of differential display. Biochemical and Biophysical Research Communications 251: 653-656.
116 Lee, C-H., H. Mizusawa and T. Kakefuda. 1981, Unwinding of double-stranded DNA helix by dehydration. Proceedings of the National Academy of Sciences USA 78(5): 2838-2842,
Lee, P. H., and F. W. Goetz. 1998. Characterization of a novel cDNA obtained through differential display PCR of phorbol ester-stimulated ovarian tissue from the brook trout (Salvelinus fontinalis). Molecular Reproduction and Development 49: 112-118.
Lee, M. A., D. J. Squirrell, D. L. Leslie and T. Brown. 2004. Homogeneous fluorescent chemistries for real-time PCR. Pages 31-70 in Edwards, K., J. Logan and N. Saunders (eds.): Real-Time PCR. An Essential Guide. Horizon Bioscience, Norfolk, UK.
Li, Y., and J. R. Gold. 1991. Cytogenetic studies in North American minnows (Cyprinidae). XXII. Chromosomal nucleolar organizer regions in the genus Pimephales. Canadian Journal of Zoology 69: 2826-2830.
Liang, P., and A. B. Pardee. 1992. Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 257: 967-971.
Liang, P., W. Zhu, X. Zhang, Z. Guo, R. P. O’Connell, L. Averboukh, F. Wang and A. B. Pardee. 1994. Differential display using one-base anchored oligo-dT primers. Nucleic Acids Research 22(25): 5763-5764.
Liang, P., and A. B. Pardee. 1995. Recent advances in differential display. Current Opinion in Immunology 7: 274-280.
Liang, P. 2004. A decade of differential display. BioTechniques 33(2): 338-346.
Liao, V. H-C., and J. H. Freedman. 1998. Cadmium-regulated genes from the nematode Caenorhabditis elegans. The Journal of Biological Chemistry 273(48): 31962-31970.
Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using -∆∆C real-time quantitative PCR and the 2 T method. Methods 25: 402-408.
Lloyd, R. 1961. Effect of dissolved oxygen concentration on the toxicity of several poisons to rainbow trout (Salmo gairdneri Richardson). Journal of Experimental Biology 38: 447-455.
Lund, S. G., D. Caissie, R. A. Cunjak, M. M. Vijayan and B. L. Tufts. 2002. The effects of environmental heat stress on heat-shock mRNA and protein expression in Miramichi Atlantic salmon (Salmo salar) parr. Canadian Journal of Fisheries and Aquatic Sciences 59: 1553-1562.
117 Malinen, E., A. Kassinen, T. Rinttilä and A. Palva. 2003. Comparison of real-time PCR with SYBR Green I or 5’-nuclease assays and dot-blot hybridization with rDNA-targeted oligonucleotide probes in quantification of selected faecal bacteria. Microbiology 149: 269-277.
Manner, H. W., and C. M. Dewese. 1974. Early embryology of the fathead minnow Pimephales promelas Rafinesque. Anatomical Record 180: 99-110.
Markus, H. C. 1934. Life history of the blackhead minnow (Pimephales promelas). Copeia 3: 116-122.
Mathieu-Daudé, F., J. Welsh, T. Vogt and McClelland. 1996. DNA rehybridization during PCR: the ‘Cot effect’ and its consequences. Nucleic Acids Research 24(11): 2080- 2086.
Matz, M. V., and S. A. Lukyanov. 1998. Differential strategies of differential display: areas of application. Nucleic Acids Research 26 (24): 5537-5543.
McClelland, M., F. Mathieu-Daudé, and J. Welsh. 1995. RNA fingerprinting and differential display using arbitrarily primed PCR. Trends in Genetics 11(6): 242-246.
McKim, J. M. 1977. Evaluation of tests with early life stages of fish for predicting long- term toxicity. Journal of the Fisheries Research Board Canada 34: 1148-1154.
McKim, J. M., J. G. Eaton, and G. W. Holcombe. 1978. Metal toxicity to embryos and larvae of eight species of freshwater fish-II: copper. Bulletin of Environmental Contamination and Toxicology 19: 608-616.
Mise, K., R. F. Allison, M. Janda and P. Ahlquist. 1993. Bromovirus movement protein genes play a crucial role in host specificity. Journal of Virology 67(5): 2815-2823.
Mohr, S., P. Cullen, R. Schmidt, A. Cignarella and G. Assman. 1997. Avoidance of false positives in PCR-based mRNA differential display during investigation of nonstandardized tissues or cells. Clinical Chemistry 43: 182-184.
Moore, J. W., and S. Ramamoorthy. 1984. Heavy Metals in Natural Waters, Applied Monitoring and Impact Assessment. Springer-Verlag New York Inc., New York, NY.
Mount, D. I. 1968. Chronic toxicity of copper to fathead minnows (Pimephales promelas, Rafinesque). Water Research 2: 215-223.
Mount, D. I., and C. E. Stephan. 1969. Chronic toxicity of copper to the fathead minnow (Pimephales promelas) in soft water. Journal of the Fisheries Research Board Canada 26: 2449-2457.
118 Nagamine, Y., D. Mizuno and S. Natori. 1979. Selective inhibition of zinc of RNA synthesis initiation in the RNA polymerase I reaction. FEBS Letters 99: 29-32.
Newman, M. C., and M. A. Unger. 2003. Fundamentals of Ecotoxicology. Second edition. Lewis Publishers, Boca Raton, FL.
Palmer, S., A. P. Wiegand, F. Maldarelli, H. Brazmi, J. M. Mican, M. Polis, R. L. Dewar, A. Planta, S. Liu, J. A. Metcalf, J. W. Mellors and J. M. Coffin. 2003. New real-time reverse transcriptase-initiated PCR assay with single-copy sensitivity for human immunodeficiency virus type I RNA in plasma. Journal of Clinical Microbiology 41 (10): 4531-4536.
Picard, D. J., and P. M. Schulte. 2004. Variation in gene expression in response to stress in two populations of Fundulus heteroclitus. Comparative Biochemistry and Physiology Part A 137: 205-216.
Pickering, A. D. 1981. The concept of biological Stress. Pages 1-9 in Pickering, A. D. (ed.): Stress and Fish. Academic Press, London, UK.
Playle, R. C., and D. G. Dixon. 1993. Copper and cadmium binding to fish gills: estimates of metal-gill stability constants and modelling of metal accumulation. Canadian Journal of Fisheries and Aquatic Sciences 50: 2678-2687.
Podrabsky, J. E., and G. N. Somero. 2004. Changes in gene expression associated with acclimation to constant temperatures and fluctuating daily temperatures in an annual killifish Austrofundulus limnaeus. The Journal of Experimental Biology 207: 2237-2254.
Pomp, D., and J. F. Medrano. 1991. Organic solvents as facilitators of polymerase chain reaction. BioTechniques 10(1): 58-59.
Primrose, S. B. and R. M. Twyman. 2004. Genomics, Applications in Human Biology. Blackwell Publishing, Malden, MA.
Råbergh, C. M. I., A. Airaksinen, A. Soitamo, H. V. Björklund, T. Johansson, M. Nikinmaa and L. Sistonen. 2000. Tissue-specific expression of zebrafish (Danio rerio) heat shock factor 1 mRNAs in response to heat stress. The Journal of Experimental Biology 203: 1817-1824.
Ramey, B. A. 1988. Teratogenic effects of zinc on embryo-larval stages of the fathead minnow. Research Report no. 172, University of Kentucky, Water Resources Research Institute, Lexington, KY.
Rhodes, L. D., and R. J. Van Beneden. 1996. Gene expression analysis in aquatic animals using differential display polymerase chain reaction. Pages 161-183 in Ostrander, G. K. (Ed.): Techniques in Aquatic Toxicology, CRC Press, Inc., Boca Raton, FL.
119 Rhodes, L. D., G. R. Gardner and R. J. Van Beneden. 1997. Short-term tissue distribution, depuration and possible gene expression effects of [3H]TCDD exposure in soft-shell clams (Mya arenaria). Environmental Toxicology and Chemistry 16(9): 1888- 1894.
Řičicová, M., and Z. Palková. 2003. Comparative analyses of Saccharomyces cerevisiae RNAs using Agilent RNA 6000 Nano Assay and agarose gel electrophoresis. FEMS Yeast Research 4: 119-122.
Sanders, B. M., J. Nguyen, L. S. Martin, S. R. Howe and S. Coventry. 1995. Induction and subcellular localization of two major stress proteins in response to copper in the fathead minnow Pimephales promelas. Comparative Biochemistry and Physiology 112C(3): 335- 343.
Sarropoulou, E., G. Kotoulas, D. M. Power and R. Geisler. 2005. Gene expression profiling of gilthead sea bream during early development and detection of stress related genes by the application of cDNA microarray technology. Physiological Genomics 23: 182-191.
Saunders, N. A. 2004. An introduction to real-time PCR. Pages 1-11 in Edwards, K., J. Logan and N. Saunders (eds.): Real-Time PCR. An Essential Guide. Horizon Bioscience, Norfolk, UK.
Schena, M., D. Shalon, R. W. Davis and P. O. Brown. 1995. Quantitative monitoring of gene expression patterns with a complementary DNA microarray. Science 270: 467-470.
Schimttgen, T. D., B. A. Zakrajsek, A. G. Mills, V. Gorn, M. J. Singer and M. W. Reed. 2000. Quantitative reverse transcription-polymerase chain reaction to study mRNA decay: comparison of endpoint and real-time methods. Analytical Biochemistry 285: 194-204.
Schlueter, M. A., S. I. Guttman, J. T. Oris and A. J. Bailer. 1995. Survival of copper- exposed juvenile fathead minnows (Pimephales promelas) differs among allozyme genotypes. Environmental Toxicology and Chemistry 14(10): 1727-1734.
Schlueter, M. A., S. I. Guttman, J. T. Oris and A. J. Bailer. 1997. Differential survival of fathead minnows, Pimephales promelas, as affected by copper exposure, prior population stress, and allozyme genotypes. Environmental Toxicology and Chemistry 16(5): 939- 947.
Schubart, U. K. 1988. Expression of phosphoprotein p19 in brain, testis, and neuroendocrine tumor cells. The Journal of Biological Chemistry 263(24): 12156-12160.
Scudder, B. C. 1984. The Effect of Copper on the Development of the Fathead Minnow Pimephales promelas Rafinesque. Master’s Thesis, California State University, Hayward, CA.
120 Scudder, B. C., J. L. Carter and H. V. Leland. 1988. Effects of copper on development of the fathead minnow, Pimephales promelas Rafinesque. Aquatic Toxicology 12: 107-124.
Selye, H. 1956. The Stress of Life. McGraw-Hill Book Company, Inc., New York, NY.
Shammas, F. V., R. Heikkilä, and A. Osland. 2001, Fluorescence-based method for measuring and determining the mechanisms of recombination in quantitative PCR. Clinica Chimica Acta 304: 19-28.
Shibata, M., T. Hariya, M. Hatao, T. Ashikaga and H. Ichikawa. 1999. Quantitative polymerase chain reaction using an external control mRNA for determination of gene expression in a heterogeneous cell population. Toxicological Sciences 49: 290-296.
Skidmore, J. F. 1970. Respiration and osmoregulation in rainbow trout with gills damaged by zinc sulfate. Journal of Experimental Biology 52: 481-494.
Smith, R. W., and D. F. Houlihan. 1995. Protein synthesis and oxygen consumption in fish cells. Journal of Comparative Physiology 165: 93-101.
Smith, R. W., D. F. Houlihan, G. E. Nilsson and J. G. Brechin. 1996. Tissue-specific changes in protein synthesis in vivo during anoxia in crucian carp. American Journal of Physiology 271: R897-R904.
Smith, R. W., D. F. Houlihan, G. E. Nilsson and J. Alexandre. 1999. Tissue-specific changes in RNA synthesis in vivo during anoxia in crucian carp. American Journal of Physiology 277: R690-R697.
Sokal, R. R., and F. J. Rohlf. 1995. Biometry. Third edition. W. H. Freeman and Company, New York, NY.
Somasundaram, B., P. E. King and S. E. Shackley. 1984a. The effects of zinc on the ultrastructure of the brain cells of the larvae of Clupea harengus L. Aquatic Toxicology 5: 323-330.
Somasundaram, B., P. E. King and S. E. Shackley. 1984b. Some morphological effects of zinc upon the yolk-sac larvae of Clupea harengus L. Journal of Fish Biology 5: 333-343.
Somasundaram, B. 1985. Effects of zinc on epidermal ultrastructure in the larva of Clupea harengus. Marine Biology 85: 199-207.
Sompayrac, L., S. Jane, T. C. Burn, D. G. Tenen and K. J. Danna. 1995. Overcoming limitations of the mRNA differential display technique. Nucleic Acids Research 23(22): 4738-4739.
Sprague, J. B. 1969. Measurement of pollutant toxicity to fish. I. Bioassay methods for acute toxicity. Water Research 3: 793-821.
121
Sprague, J. B. 1970. Measurement of pollutant toxicity to fish. II. Utilizing and applying bioassay results. Water Research 4: 3-32.
Spry, D. J., and C. M. Wood. 1984. Acid-base, plasma ion and blood gas changes in rainbow trout during short term toxic zinc exposure. Journal of Comparative Physiology B 154: 149-158.
Spry, D. J., and C. M. Wood. 1985. Ion flux rates, acid-base status, and blood gases in rainbow trout, Salmo gairdneri, exposed to toxic zinc in natural soft water. Canadian Journal of Fisheries and Aquatic Sciences 42: 1332-1341.
Spry, D. J., and C. M. Wood. 1985. Ion flux rates, acid-base status, and blood gases in rainbow trout, Salmo gairdneri, exposed to toxic zinc in natural soft water. Canadian Journal of Fisheries and Aquatic Sciences 42: 1332-1341.
Ståhlberg, A., J. Håkansson, X. Xian, H. Semb and M. Kubista. 2004. Properties of the reverse transcription reaction in mRNA quantification. Clinical Chemistry 50: 509-515.
Stellwagen, N. C. 1983. Anomalous electrophoresis of deoxyribonucleic acid restriction fragments on polyacrylamide gels. Biochemistry 22: 6186-6193.
Stoiber, W., J. R. Haslett, R. Wenk, P. Steinbacher, H-P Gollmann and A. M. Sänger. 2002. Cellularity changes in developing read and white muscle at different temperatures: simulating natural environmental conditions for a temperate freshwater cyprinid. The Journal of Experimental Biology 205: 2349-2364.
Stokes, P. M. 1979. Copper accumulations in freshwater biota. Pages 358-381 in Nriagu, J. O. (Ed.): Copper In the Environment, Part I. Ecological Cycling. John Wiley & Sons, New York.
Stratagene. Undated. Mx4000 Multiplex Quantitative PCR System, Application note # 10. Stratagene, LaJolla, CA.
Stürzenbaum, S. R., S. Cater, A. J. Morgan and P. Kille. 2001. Earthworm pre- procarboxypeptidase: a copper responsive enzyme. Biometals 14: 85-94.
Sunyaev, S. R., W. C. Lathe III, V. E. Ramensky and P. Bork. 2000. SNP frequencies in human genes, an excess of rare alleles and differing modes of selection. Trends in Genetics 16: 335-337.
Tan, F.-L., C. S. Moravec, J. Li, C. Apperson-Hansen, P. M. McCarthy, J. B. Young and M. Bond. 2002. The gene expression fingerprint of human heart failure. Proceedings of the National Academy of Sciences USA 99: 11387-11392.
122 Ton, C., D. Stamatiou, V. J. Dzau and C-C Liew. 2002. Construction of a zebrafish cDNA microarray: gene expression profiling of the zebrafish during development. Biochemical and Biophysical Research Communications 296: 1134-1142.
Tsai, C-F. 1979. Survival, overturning and lethal exposure times for the pearl dace, Semolitus margaritus (Cope), exposed to copper solution. Comparative Biochemistry and Physiology 64C: 1-6.
Vallee, B. L., and K. H. Falchuk. 1993. The biochemical basis of zinc physiology. Physiological Reviews 73(1): 79-118.
Virtaneva, K., F. A. Wright, S. M. Tanner, B. Yuan, W. J. Lemon, M. A. Caligiuri, C. D. Bloomfield, A. de la Chapelle and R. Krahe. 2001. Expression profiling reveals fundamental biological differences in acute myeloid leukemia with isolated trisomy 8 and normal cytogenetics. Proceedings of the National Academy of Sciences USA 98(3): 1124-1129.
Vittozzi, L., and G. De Angelis. 1991. A critical review of comparative acute toxicity data on freshwater fish. Aquatic Toxicology 19: 167-204.
von Westernhagen, H. 1988. Sublethal effects of pollutants on fish eggs and larvae. Pages 253-346 in Hoar, W. S., and D. J. Randall (eds.): Fish Physiology, Volume XIA. Academic Press, Inc., New York, NY.
Weber, C. I. (ed.)1993. Methods for Measuring the Acute Toxicity of Effluents and Receiving Waters to Freshwater and Marine Organisms (4th ed.). EPA/600/4-90/027F.
Wendelaar Bonga, S. E. 1997. The stress response in fish. Physiological Reviews 77(3): 591-625.
Williams, T. D., K. Gensberg, S. D. Minchin and J. K. Chipman. 2003. A DNA expression array to detect toxic stress response in European Flounder (Platichthys flesus). Aquatic Toxicology 65: 141-157.
Winship, P. 1989. An improved method for directly sequencing PCR amplified material using dimethyl sulphoxide. Nucleic Acids Research 17 (3): 1266.
Wong, M. L., and J. F. Medrano. 2005. Real-time PCR for mRNA quantitation. BioTechniques 75: 75-85.
Wood, C. M. 2001. Toxic responses of the gill. Pages 1-89 in Schlenk, D., and, W. H. Benson (Eds.): Target Organ Toxicity in Marine and Freshwater Teleosts. Volume 1 – Organs. Taylor and Francis, London, UK.
123 Xu, Y., J. He, X. Wang, T. M. Lim and Z. Gong. 2000. Asynchronous activation of 10 muscle-specific protein (MSP) genes during zebrafish somitogenesis. Developmental Dynamics 219: 201-215.
124
Table 1: Proteins or mRNA transcripts in adult fish affected by copper.
Identity Response to Type of Function Species and Citation copper Product organ Metallothionein increased at mRNA binds and Tilapia (gills Cheung et low dose only sequesters and liver) al. (2004) (1 mg/kg) metal ions stress70 (heat increased at protein protein- Pimephales Sanders et shock protein) high folding promelas (cell al. (1995) concentrations activity; line) (>400 µM) stress protein Cortisol low doses of protein maintains Oncorhynchus Donaldson copper blood nerka and Dye pressure, (1975) inhibits swelling
125 Table 2: Proteins or mRNA transcripts in adult fish affected by zinc.
Identity Response Type of Function Species and Citation to zinc Product organ Metallothionein increased protein binds and Chinook Heikkila et sequesters salmon al. (1982) metal ions embryo cell line several stress increased protein protein Chinook Heikkila et proteins folding salmon al. (1982) embryo cell line Asparaginyl up- mRNA gene Oncorhynchus Hogstrand tRNA regulated regulation mykiss gill et al. synthetase tissue (2002) (Homo sapiens) zinc finger up- mRNA gene Oncorhynchus Hogstrand protein 216 regulated regulation mykiss gill et al. (Mus musculus) tissue (2002) 40S ribosomal up- mRNA translation Oncorhynchus Hogstrand protein S17 regulated mykiss gill et al. (Ictalurus tissue (2002) punctatus) 40S ribosomal up- mRNA translation Oncorhynchus Hogstrand protein S3 regulated mykiss gill et al. (Homo sapiens) tissue (2002) cold inducible up- mRNA translation Oncorhynchus Hogstrand RNA binding regulated mykiss gill et al. protein tissue (2002) (Xenopus laevis) translation up- mRNA protein Oncorhynchus Hogstrand initation factor regulated synthesis mykiss gill et al. 3 subunit 6 tissue (2002) (Homo sapiens) Chromobox up- mRNA meiosis Oncorhynchus Hogstrand homologue 4 regulated mykiss gill et al. (Homo sapiens) tissue (2002) class I cytokine up- mRNA immunity Oncorhynchus Hogstrand (Homo sapiens) regulated mykiss gill et al. tissue (2002) glutathione S- up- mRNA attachment of Oncorhynchus Hogstrand transferase regulated glutathione to mykiss gill et al. (Gallus gallus) other tissue (2002) molecules
126 Identity Response Type of Function Species and Citation to zinc Product organ tight junction up- mRNA Paracellular Oncorhynchus Hogstrand protein ZO-2 regulated transport; mykiss gill et al. isoform (Homo signaling; tissue (2002) sapiens) structure 6- up- mRNA glycolysis Oncorhynchus Hogstrand phosphofructo- regulated mykiss gill et al. 2-kinase (Mus tissue (2002) musculus) ring-H2 finger up- mRNA zinc binding; Oncorhynchus Hogstrand protein (Oryza regulated ubiquitination mykiss gill et al. sativa) tissue (2002) Apolipoprotein increased protein -- Oncorhynchus Hogstrand A-I (Sparus mykiss gill et al. aurata) tissue (2002) proto-oncogene increased protein -- Oncorhynchus Hogstrand protein c-fos mykiss gill et al. (Cyprinus tissue (2002) carpio) cytosolic increased protein -- Oncorhynchus Hogstrand phospholipase mykiss gill et al. A2 (Danio tissue (2002) rerio) Na+/H+ increased protein -- Oncorhynchus Hogstrand exchanger mykiss gill et al. (Oncorhynchus tissue (2002) mykiss) ovarian cystatin decreased protein -- Oncorhynchus Hogstrand (Cyprinus mykiss gill et al. carpio) tissue (2002) Growth decreased protein -- Oncorhynchus Hogstrand regulator mykiss gill et al. (Danio rerio) tissue (2002) glucose-6- decreased protein -- Oncorhynchus Hogstrand phosphate mykiss gill et al. dehydrogenase tissue (2002) (Fugu rubripes)
127 Table 3: Proteins or mRNA transcripts in adult fish affected by heat stress.
Identity Response to Type of Function Species and Citation elevated Product organ temperature Hsp 60 kDa increased protein stress protein Pimephales Dyer et al. promelas gill (1990) Hsp 68 kDa increased protein stress protein Pimephales Dyer et al. promelas gill, (1990) brain Hsp 70 kDa increased protein stress protein Pimephales Dyer et al. promelas gill, (1990) muscle, brain Hsp 78 kDa increased protein stress protein Pimephales Dyer et al. promelas gill, (1990) muscle Hsp 90 kDa increased protein stress protein Pimephales Dyer et al. promelas gill, (1990) muscle, brain Hsp 100 kDa increased protein stress protein Pimephales Dyer et al. promelas gill, (1990) muscle Hsp 30 increased mRNA stress protein Salmo salar Lund et al. (2002) zHSF1b decreased mRNA heat shock Danio rerio Råbergh et transcription gills al.(2000) factor zHSF1b decreased mRNA heat shock Danio rerio Råbergh et transcription liver al.(2000) factor zHSF1b present mRNA heat shock Danio rerio Råbergh et transcription gonads al.(2000) factor HSF1 increased mRNA heat shock Gillichthys Buckley and transcription mirabilis Hofmann factor (2002) calreticulin increased mRNA Protein Austrofundulu Podrabsky disulfide s limnaeus and Somero isomerase liver (2004) ∆6-fatty acyl decreased mRNA Membrane Austrofundulu Podrabsky desaturase stability s limnaeus and Somero liver (2004) Polyunsaturat decreased mRNA Membrane Austrofundulu Podrabsky ed fatty acid stability s limnaeus and Somero elongase liver (2004)
128 Identity Response to Type of Function Species and Citation elevated Product organ temperature HMG-CoA decreased mRNA Cholesterol Austrofundulu Podrabsky synthase biosynthesis s limnaeus and Somero liver (2004) p137 increased mRNA Glycosylphos Austrofundulu Podrabsky phatidylinosit s limnaeus and Somero ol-anchored liver (2004) membrane protein Glycogen increased mRNA Glycogen Austrofundulu Podrabsky synthase synthesis s limnaeus and Somero liver (2004) Pyruvate decreased mRNA glycolysis Austrofundulu Podrabsky kinase s limnaeus and Somero liver (2004) 6-phospho- decreased mRNA Pentose Austrofundulu Podrabsky gluconate de- phosphate s limnaeus and Somero hydrogenase shunt liver (2004) Isocitrate de- decreased mRNA Oxidative Austrofundulu Podrabsky hydrogenase metabolism s limnaeus and Somero liver (2004) 26S decreased mRNA Protein Austrofundulu Podrabsky proteasome degradation s limnaeus and Somero subunit regulation liver (2004)
129 Table 13: Results from the 48-hr copper exposure A to Pimephales promelas larvae stating the number of survivors in the control and treatment groups and percentage survivorship.
Copper Number of fish at Number of Percentage concentration the start of the survivors after 48 survivorship experiment hours 0 µg/L (control) 100 100 100% 50 µg/L 125 114 91.2% 125 µg/L 150 103 68.67% 200 µg/L 250 140 56%
Table 14: Water quality measurements for copper experiment A. pH, dissolved oxygen, conductivity and temperature were measured at the beginning and at the termination of the experiment. Water from replicates within a treatment was combined together and measured.
Copper Replicates pH Dissolved Conductivity Temperature concentration oxygen (µmhos/cm) (ºC) (mg/L) Initial Final Initial Final Initial Final Initial Final 0 µg/L 1-4 8.22 8.11 8.3 7.8 300 320 24.0 24.8 50 µg/L 1-5 8.23 8.11 8.2 7.7 300 315 24.1 24.7 125 µg/L 1-6 8.17 8.02 8.3 7.7 298 317 24.1 24.7 200 µg/L 1-10 8.16 8.09 8.2 7.6 299 312 24.3 25.0
Table 15: Results from the 48-hr copper exposure B to Pimephales promelas larvae, stating the overall number of survivors in the control and treatment groups and percentage survivorship.
Copper Number of fish at Number of Percentage concentration the start of the survivors after 48 survivorship experiment hours 0 µg/L (control) 250 250 100% 200 µg/L 500 442 88.4%
130 Table 16: Live fish in each treatment chamber at the start of copper experiment B, 24 hrs later and at the conclusion of the experiment at 48 hrs. The RNA tubes into which fish from 2 chambers were pooled together are also listed.
Treatment Replicate Number of Number of Number of RNA tube number live fish at 0 live fish at 24 live fish at 48 number hrs hrs hrs Controls (0 1 25 25 25 C-1 µg/L Cu) 2 25 25 25 C-1 3 25 25 25 C-2 4 25 25 25 C-2 5 25 25 25 C-3 6 25 25 25 C-3 7 25 25 25 C-4 8 25 25 25 C-4 9 25 25 25 C-5 10 25 25 25 C-5 200 µg/L Cu 1 25 24 23 Cu-1 2 25 22 20 Cu-1 3 25 25 24 Cu-2 4 25 25 24 Cu-2 5 25 23 19 Cu-3 6 25 25 25 Cu-3 7 25 25 24 Cu-4 8 25 24 23 Cu-4 9 25 23 22 Cu-5 10 25 24 23 Cu-5 11 25 25 24 Cu-8 12 25 24 23 Cu-9 13 25 23 22 Cu-6 14 25 21 21 Cu-8 15 25 19 17 Cu-9 16 25 22 21 Cu-7 17 25 21 21 Cu-7 18 25 23 22 Cu-10 19 25 24 22 Cu-6 20 25 22 22 Cu-10
Table 17: Water quality measurements for copper experiment B. pH, dissolved oxygen, conductivity and temperature were measured at the beginning and at the termination of the experiment. Water from replicates within a treatment was pooled together and measured.
Copper Replicates pH Dissolved Conductivity Temperature concentration oxygen (µmhos/cm) (ºC) (mg/L) Initial Final Initial Final Initial Final Initial Final 0 µg/L 1-10 7.92 7.88 8.8 8.0 308 330 21.9 24.2 200 µg/L 1-20 7.86 7.85 8.8 7.7 320 328 22.0 24.3
131 Table 18: Results from the 48-hr zinc exposure A to Pimephales promelas larvae stating the number of survivors in the control and treatment groups and percentage survivorship.
Zinc concentration Number of fish at Number of Percentage the start of the survivors after 48 survivorship experiment hours 0 µg/L (control) 100 100 100% 200 µg/L 125 116 92.8% 400 µg/L 150 104 69.34% 600 µg/L 200 178 89% 900 µg/L 500 175 35%
Table 19: Water quality measurements for the zinc experiment A. pH, dissolved oxygen, conductivity and temperature were measured at the beginning and at the termination of the experiment. Water from replicates within a treatment was combined together and measured.
Zinc Repli- pH Dissolved Conductiv- Temperature concentra- cates oxygen (mg/L) ity (ºC) tion (µmhos/cm) Initial Final Initial Final Initial Final Initial Final 0 µg/L 1-4 7.75 7.92 8.0 7.9 296 296 24.6 24.5 200 µg/L 1-5 7.80 7.89 8.1 7.8 296 298 24.5 24.5 400 µg/L 1-6 7.89 7.84 8.1 7.8 306 297 24.5 24.7 600 µg/L 1-8 7.90 7.82 8.0 7.7 294 301 24.7 24.6 900 µg/L 1-10 7.90 7.79 8.2 7.8 297 312 24.6 24.6
Table 20: Results from zinc exposure B to Pimephales promelas larvae stating the overall number of survivors in the control and treatment groups and percentage survivorship.
Zinc concentration Number of fish at Number of Percentage the start of the survivors after 48 survivorship experiment hours 0 µg/L (control) 250 249 99.6% 800 µg/L 500 289 57.8%
132 Table 21: Live fish in each treatment chamber at the start of zinc experiment B, 24 hrs later and at the conclusion of the experiment at 48 hrs. The RNA tubes into which fish from 2 chambers were pooled together are also listed.
Treatment Replicate Number of Number of Number of RNA tube number live fish at 0 live fish at 24 live fish at 48 number hrs hrs hrs Controls (0 1 25 25 25 C-1 µg/L Zn) 2 25 25 25 C-1 3 25 25 25 C-2 4 25 25 25 C-2 5 25 25 25 C-3 6 25 25 25 C-3 7 25 25 25 C-4 8 25 25 25 C-4 9 25 25 25 C-5 10 25 25 24 C-5 800 µg/L Zn 1 25 18 15 Zn-1 2 25 18 18 Zn-4 3 25 22 17 Zn-6 4 25 18 17 Zn-3 5 25 17 13 Zn-5 6 25 20 15 Zn-5 7 25 23 19 Zn-2 8 25 21 15 Zn-4 9 25 22 18 Zn-3 10 25 2 0 11 25 0 0 12 25 23 20 Zn-2 13 25 21 18 Zn-1 14 25 18 17 Zn-4 15 25 19 12 Zn-2 16 25 20 16 Zn-5 17 25 21 17 Zn-6 18 25 25 22 Zn-1 19 25 20 5 Zn-1 20 25 20 15 Zn-3
Table 22: Water quality measurements for zinc experiment B. pH, dissolved oxygen, conductivity and temperature were measured at the beginning and at the termination of the experiment. Water from replicates within a treatment was combined together and then measured.
Zinc Replicates pH Dissolved Conductivity Temperature concentration oxygen (µmhos/cm) (ºC) (mg/L) Initial Final Initial Final Initial Final Initial Final 0 µg/L 1-10 7.88 7.54 8.1 7.0 310 334 24.2 25.0 800 µg/L 1-20 7.89 7.47 8.0 6.8 309 337 24.1 24.9
133
Table 23: Results from the 24-hr and 48-hr thermal stress experiment A at 36ºC with Pimephales promelas larvae stating the number of survivors in the control and treatment groups and percentage survivorship.
Experiment groups Number of fish at Number of Percentage the start of the survivors at end of survivorship experiment experiment 24 hr control 100 100 100% 24 hr treatment 150 107 71.33% 48 hr control 100 100 100% 48 hr treatment 250 88 35.2%
Table 24: Water quality measurements for thermal stress experiment A. pH, dissolved oxygen, conductivity and temperature were measured at the beginning and at the termination of the experiment. Water from replicates within a treatment was pooled together and measured.
Temperature Replicates pH Dissolved Conductivity Temperature oxygen (µmhos/cm) (ºC) (mg/L) Initial Final Initial Final Initial Final Initial Final 25ºC (24 hrs) 1-4 8.00 8.01 8.0 7.6 315 321 25.0 25.0 36ºC (24 hrs) 1-6 7.97 7.67 7.6 7.0 301 307 35.7 36.1 25ºC (48 hrs) 1-4 8.01 7.90 8.0 7.5 315 320 24.9 25.0 36ºC (48 hrs) 1-10 8.00 7.65 7.7 7.0 302 305 35.8 36.4
Table 25: Results from the second 48-hr 36ºC heat stress experiment B with Pimephales promelas larvae stating the overall number of live fish in the control and treatment groups and percentage survivorship.
Experiment groups Number of fish at Number of Percentage the start of the survivors after 48 survivorship experiment hours 48-hr control 250 249 99.6% 48-hr treatment 500 302 60.4%
134 Table 26: Live fish in each treatment chamber at the start of thermal stress experiment B, 24 hrs later and at the conclusion of the experiment at 48 hrs. The RNA tubes into which fish from 2 chambers were pooled together are also listed.
Treatment Replicate Number of Number of Number of RNA tube number live fish at 0 live fish at 24 live fish at 48 number hrs hrs hrs Control group 1 25 25 24 C-2 at 25ºC 2 25 25 25 C-1 3 25 25 25 C-4 4 25 25 25 C-5 5 25 25 25 C-3 6 25 25 25 C-3 7 25 25 25 C-4 8 25 25 25 C-5 9 25 25 25 C-1 10 25 25 25 C-2 Heat stress 1 25 21 20 48-1 group at 36ºC 2 25 22 20 48-2 3 25 21 19 48-3 4 25 23 19 48-4 5 25 21 5 48-5 6 25 25 14 48-6 7 25 21 15 48-7 8 25 20 15 48-6 9 25 20 14 48-7 10 25 22 12 48-5 11 25 22 12 48-5 12 25 21 8 48-5 13 25 21 12 48-7 14 25 22 15 48-8 15 25 21 10 48-6 16 25 22 16 48-8 17 25 23 18 48-3 18 25 21 20 48-1 19 25 20 18 48-2 20 25 20 20 48-4
Table 27: Water quality measurements for thermal experiment B of 48 hours duration. pH, dissolved oxygen, conductivity and temperature were measured at the beginning and at the termination of the experiment. Water from replicates within a treatment was pooled together and measured.
Treatment Replicates pH Dissolved Conductivity Temperature oxygen (µmhos/cm) (ºC) (mg/L) Initial Final Initial Final Initial Final Initial Final Control (0ºC) 1-10 8.02 7.54 8.0 6.6 318 341 24.1 25.0 36ºC 1-20 8.00 7.42 8.1 5.8 315 319 35.1 35.6
135 Table 28: Spectrophotometric readings of larval RNA samples from copper experiment A. The optical density units at 260 and 280 nm, and the 260/280 ratio indicate RNA quality. RNA concentration in µg/µl was calculated from the reading at 260 nm.
Treatment Replicate O.D. at O. D. at 260/280 RNA 260 nm 280 nm ratio concentration (µg/µl) 0 µg/L Cu 1 0.256 0.122 2.098 1.024 2 0.202 0.103 1.961 0.808 50 µg/L Cu 1 0.314 0.154 2.038 1.256 2 0.287 0.139 2.064 1.148 125 µg/L 1 0.258 0.122 2.114 1.032 Cu 2 0.273 0.134 2.037 1.092 200 µg/L 1 0.339 0.162 2.092 1.356 Cu 2 0.319 0.154 2.071 1.276
Table 29: Spectrophotometric readings of larval RNA samples from copper experiment B. The optical density units at 260 and 280 nm, and the 260/280 ratio indicate RNA quality. RNA concentration in µg/µl was calculated from the reading at 260 nm.
Treatment Replicate O.D. at O. D. at 260/280 RNA 260 nm 280 nm ratio concentration (µg/µl) 0 µg/L Cu 1 0.969 0.416 2.366 3.876 2 0.376 0.151 2.588 1.504 3 0.437 0.179 2.530 1.748 4 0.426 0.174 2.534 1.704 5 0.451 0.186 2.520 1.804 200 µg/L 1 0.305 0.123 2.678 1.22 Cu 2 0.283 0.112 2.728 1.132 3 0.232 0.091 2.840 0.928 4 0.336 0.142 2.622 1.344 5 0.298 0.123 2.671 1.192 6 0.261 0.105 2.805 1.044 7 0.372 0.155 2.577 1.488 8 0.340 0.140 2.646 1.36 9 0.283 0.115 2.758 1.132 10 0.318 0.131 2.662 1.272
136 Table 30: Analyses of larval RNA extracts from copper experiment B. The Agilent 2100 Bioanalyzer was the instrument used, and yielded 260/280 ratios as well as RNA concentration in ng/µl, here converted to µg/µl.
Treatment Replicate 260/280 RNA ratio concentration (µg/µl) 0 µg/L Cu 1 2.07 0.4823 2 2.14 0.9200 3 2.02 0.9026 4 2.05 1.0789 5 2.02 1.1188 200 µg/L 1 2.04 0.7106 Cu 4 2.03 0.8132 7 2.03 0.8489 8 2.03 0.8114 10 2.07 0.6889
Table 31: Spectrophotometric readings of larval RNA samples from zinc experiment A. The optical density units at 260 and 280 nm, and the 260/280 ratio indicate RNA quality. RNA concentration in µg/µl was calculated from the reading at 260 nm.
Treatment Replicate O.D. at O. D. at 260/280 RNA 260 nm 280 nm ratio concentration (µg/µl) 0 µg/L Zn 1 0.268 0.118 2.271 2.144 2 0.386 0.171 2.257 3.088 200 µg/L 1 0.313 0.137 2.284 2.504 Zn 2 0.337 0.148 2.277 2.696 400 µg/L 1 0.600 0.264 2.272 4.800 Zn 2 0.197 0.085 2.317 1.576 600 µg/L 1 0.378 0.165 2.290 3.024 Zn 2 0.385 0.170 2.264 3.080 900 µg/L 1 0.506 0.222 2.279 4.048 Zn 2 0.428 0.189 2.264 3.424
137 Table 32: Spectrophotometric readings of larval RNA samples from zinc experiment B. The optical density units at 260 and 280 nm, and the 260/280 ratio indicate RNA quality. RNA concentration in µg/µl was calculated from the reading at 260 nm.
Treatment Replicate O.D. at O. D. at 260/280 RNA 260 nm 280 nm ratio concentration (µg/µl) 0 µg/L Zn 1 0.216 0.093 2.268 0.864 2 0.115 0.044 2.277 0.460 3 0.151 0.060 2.278 0.604 4 0.142 0.057 2.270 0.568 5 0.172 0.073 2.249 0.688 800 µg/L 1 0.192 0.082 2.261 0.768 Zn 2 0.183 0.077 2.272 0.732 3 0.148 0.061 2.262 0.592 4 0.152 0.064 2.294 0.608 5 0.118 0.046 2.290 0.472 6 0.074 0.025 2.280 0.296
Table 33: Analyses of larval RNA samples from zinc experiment B. The Agilent 2100 Bioanalyzer was the instrument used, and yielded 260/280 ratios as well as RNA concentration in ng/µl, here converted to µg/µl.
Treatment Replicate 260/280 RNA ratio concentration (µg/µl) 0 µg/L Zn 1 2.07 0.8903 2 2.04 1.1737 3 2.04 0.8537 4 2.06 0.9215 5 2.05 0.8054 800 µg/L 1 2.04 0.9555 Zn 2 2.05 0.7473 3 2.05 0.9376 4 1.96 0.8404 5 2.03 0.8567
138 Table 34: Spectrophotometric readings of larval RNA samples from thermal stress experiment A. The optical density units at 260 and 280 nm, and the 260/280 ratio indicate RNA quality. RNA concentration in µg/µl was calculated from the reading at 260 nm.
Treatment Replicate O.D. at O. D. at 260/280 RNA 260 nm 280 nm ratio concentration (µg/µl) 24-hr control 1 0.294 0.157 2.151 2.048 at 25ºC 2 0.222 0.123 2.151 1.480 24-hr heat 1 0.256 0.137 2.178 1.760 stress at 36ºC 2 0.242 0.133 2.159 1.624 48-hr control 1 0.227 0.126 2.135 1.520 at 25ºC 2 0.271 0.145 2.145 1.888 48-hr heat 1 0.129 0.081 2.043 0.752 stress at 36ºC 2 0.156 0.095 2.070 0.944
Table 35: Spectrophotometric readings of larval samples from thermal stress experiment B. The optical density units at 260 and 280 nm, and the 260/280 ratio indicate RNA quality. RNA concentration in µg/µl was calculated from the reading at 260 nm.
Treatment Replicate O.D. at O. D. at 260/280 RNA 260 nm 280 nm ratio concentration (µg/µl) 48-hr 1 0.479 0.214 2.225 1.916 control at 2 0.331 0.144 2.231 1.324 25ºC 3 0.314 0.137 2.222 1.256 4 0.296 0.128 2.230 1.184 5 0.494 0.222 2.216 1.976 48-hr stress 1 0.350 0.157 2.214 1.400 at 36ºC 2 0.340 0.150 2.229 1.360 3 0.178 0.079 2.217 0.712 4 0.317 0.141 2.220 1.268 5 0.179 0.074 2.248 0.716 6 0.245 0.105 2.216 0.980 7 0.219 0.094 2.227 0.876 8 0.184 0.080 2.229 0.736
139 Table 36: Analyses of larval RNA samples from thermal stress experiment B. The Agilent 2100 Bioanalyzer was the instrument used, and yielded 260/280 ratios as well as RNA concentration in ng/µl, here converted to µg/µl.
Treatment Replicate 260/280 ratio RNA concentration (µg/µl) 48-hr 1 1.99 1.1875 control at 2 2.01 1.7959 25ºC 3 2.01 1.2549 4 2.07 1.0144 5 2.05 0.8501 48-hr stress 1 2.03 1.0707 at 36ºC 2 1.93 1.3274 4 2.05 1.1416 6 2.03 1.1016 7 2.03 1.0686
140 Table 37: List of copper candidate bands obtained from the differential display technique, their specific response to copper and BLAST identity. Seq=sequence number, Anc=anchor primer, Arp=arbitrary primer, response=gene expression response to stressor with “up” denoting up-regulation, “down” denoting down-regulation and “variable” indicating variation in band expression, conc dep=concentration dependence and shows the specific copper concentration associated with the gene expression response, identity=BLAST match, species=species with homologous gene, E-value=expect value of BLAST match and Accession no.=GenBank accession number of homologous gene. If there was no BLAST match for the gene, it was designated as having “no significant similarity” (NSS) in the identity column. Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 1 1 6 variable 50 ug high Eukaryotic translation elongation factor 1 Danio rerio e-169 NM_173263.13 gamma 2 1 6 - - DNA sequence from clone/Human CRBP Danio rerio 4e-44 AL953841.5 3 1 6 up - Troponin T3a, skeletal, fast Danio rerio 3e-23 BC053304.1 4 1 6 Up - Complement C3 mRNA Ctenopharyngodon idella 4e-45 AY374472.1 5 1 6 variable - Isolate MOLR19 cytochrome b gene Luxilus chrysocephalus 7e-55 AF117167.1 6 2 7 down 200 low NSS 7 2 7 Down - ribosomal protein S15 Danio rerio 1e-04 NM_001001819.1 8 2 7 down - NSS 9 2 6 down - NSS 10a 2 2 down - Chromosome 4 Mus musculus 2.1 AL806524.9 10b 2 2 down - MRNA from chymotrypsin B precursor Gadus morhua 1e-04 AJ242521.1 11 2 2 up 200 high Genomic DNA from clone (titin?) Danio rerio 2e-09 AL772356.2 12 2 2 Down - NSS 13 2 2 down - Chromosome 18 Mus musculus 2.5 AC139334.3 14 2 2 Down 125/200 low Chromosome 14 Homo sapiens 9.0 AL162464.5 15 2 2 down 125/200 low Chromosome 14 Homo sapiens 8.5 AL162464.5 16 2 7 down 200 low 17 2 6 down - Eukaryotic translation elongation factor Danio rerio <0.001 NM_173263.1 18 2 6 Down - Eukaryotic translation elongation factor Danio rerio <0.001 NM_173263.1 19 2 6 Down - NSS 20 2 6 Down - NSS 21 2 2 Down - Chymotrypsin b precursor Gadus morhua 3e-06 AJ242521.1
141 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 22 2 2 down - Chymotrypsin b precursor Gadus morhua 2e-04 AJ242521.1 23 2 6 Down - Ribosomal protein L18 Ictalurus punctatus 4e-33 AF401572.1 24 2 18 down 200-low Ribosomal protein L21 Ictalurus punctatus 6e-62 AF401575.1 25 2 18 Variable - Keratin 4 (krt4) Danio rerio 6e-04 NM_131509.1 26 2 18 Up 125/200-high NSS 27 2 18 Down 125/200-low zgc:77877 Danio rerio 4e-35 NM_213011.1 28 2 18 Up - chromosome 11 Mus musculus 7.7 AL663090.15 29 2 17 Down - clone DKEY-52K20 Danio rerio 2e-22 BX649372.4 30 2 17 Variable - NSS 31 2 15 up - Fast skeletal muscle myosin light chain 3 Cyprinus carpio 1e-97 D85141.1 32 2 15 up 125/200-high 40 S ribosomal protein S3A Danio rerio 4e-57 NM_200059.1 33 2 15 Up - NSS 34 2 15 Up - phosphoglycerate mutase 2 (muscle) Danio rerio 4e-05 BC053127.1 35 2 15 Down 200-low NSS 36 2 18 down 200-low NSS 37 2 18 Down 200-low NSS 38 2 18 Down 200-low NSS 39 2 18 variable - NSS 40 2 17 Down 200-low Creatine kinase M2-CK Cyprinus carpio e-107 AF055289.1 41 2 17 Down - clone DKEY-52K20 Danio rerio 8e-34 BX649372.4 42 2 17 down - clone DKEY-52K20 Danio rerio 3e-30 BX649372.4 43 2 16 Up 50-high NSS 44 2 16 up 50-high NSS 45 2 15 Up - 40S ribosomal protein S4 mRNA Ictalurus punctatus 2e-50 AF402812.1 46 2 15 up 200-high Cytochrome b mitochondrial Pimephales notatus e-125 U66606.1 47 2 15 Down 200-low NSS 48 2 15 down 200-low NSS 49 2 15 Variable - NSS 50 2 17 down 125/200-low NSS
142 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 51 2 16 variable - NSS 52 3 8 Variable - ribosomal protein S11 (40S) Danio rerio 1.9 BC046054.1 53 3 8 down 125/200-low zgc:103639 Danio rerio 1.8 BC081501.1 54 3 8 Down 125/200-low Beta-actin Danio rerio 5e-13 AF057040.1 55 3 8 Down 125/200-low NSS 56 3 8 down 125/200-low Genomic DNA Variola minor virus 7.5 Y16780.1 57 3 8 down 200-low 12S ribosomal (mitochondrial) gene Hybopsis winchelli 5e-07 AF148344.1 58 3 7 Down 125/200-low NSS 59 3 6 down 200-low ribosomal protein L18 Ictalurus punctatus 1e-11 AF401572.1 60 3 6 Up - Chromosome 4 genomic DNA Oryza sativa 0.12 AL663008.3 61 3 3 Down 200-low proteasome (prosome, macropain) subunit Danio rerio 7e-34 NM_131151.1 62 3 3 Down 200-low chromosome 4 Mus musculus 8.1 AL627122.18 63 3 3 down 200-low NSS 64 3 3 Down 125/200-low Thymosin, beta 4, X chromosome Mus musculus 8e-09 NM_021278.1 65 3 3 down 125/200-low B6_ca-A mRNA for 20S proteasome beta 6 Carassius auratus 2e-49 AB035496.1 subunit 66 3 6 down 125/200-low Eukaryotic translation elongation factor 1 Danio rerio <0.001 NM_173263.1 gamma mRNA 67 3 6 Down 125/200-low Fast muscle troponin T isoform TnnT3b Danio rerio 4e-88 AF425741.1 68 3 6 Down 200-low Fast muscle troponin T isoform TnnT3b Danio rerio 2e-80 AF425741.1 69 3 6 Down 125/200-low NSS 70 3 6 Down 125/200-low ribosomal protein L10a Danio rerio 2e-68 BC071510.1 71 3 3 Up - NSS 72 3 6 Down 125/200-low zgc:92720 Danio rerio 7e-65 NM_001002586.1 73 3 3 Variable - 60S ribosomal protein L12 Danio rerio 1e-99 AY648813.1 74 3 8 Down 125/200-low NSS 75 3 6 Down 200-low Mitochondrial DNA Carassius carassius 5e-84 AY714387.1 76 3 6 Down 125/200-low zgc:92872 Danio rerio 1e-45 NM_001003432.1 77 3 6 Down 125/200-low NSS
143 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 78 3 3 variable - NSS 79 3 17 Down 125/200-down chromosome 9 Homo sapiens 9.2 AL353573.10 80 3 16 Down 125/200-down NSS 81 3 17 Down 200-down Solute carrier family 25 alpha member 5 Danio rerio 3e-09 NM_173247.1 82 3 17 Down 200-down ribosomal protein L34 * Ictalurus punctatus 7e-13 AF401588.1 83 3 17 Down 125/200-down Mouse DNA on chromosome 2 Mouse 7.1 AL772366.7 84 3 16 Down 125/200-down NSS 85 3 17 Down 125/200-down NSS 86 3 16 Up 125/200-up Eukaryotic translation initiation factor 2 Danio rerio 5e-20 AY648723.1 gamma, mRNA 87 3 17 Down 125/200-down Fast muscle troponin T isoform TnnT3b Danio rerio 9e-15 AF425741.1 88 3 17 Down 125/200-down NSS 89 3 17 Down 125/200-down 12 BAC RP11-510P12 Homo sapiens 7.0 AC068802.29 90 3 16 Up - Fast muscle troponin T isoform TnnT3b Danio rerio 5e-34 AF425741.1 91 3 16 Up - Fast muscle troponin T isoform TnnT3b Danio rerio 1e-28 AF425741.1 92 3 16 Variable - Fast muscle troponin T isoform TnnT3b Danio rerio 6e-16 AF425741.1 93 3 16 variable - Fast muscle troponin T isoform TnnT3b Danio rerio 4e-32 AF425741.1 94 3 Fast muscle troponin TnnT3b Danio rerio 1e-13 AF425741.1 95 3 17 Down - NSS 96 3 17 Variable - clone CH211-165I22 Danio rerio 2e-28 AL929509.15 97 3 17 Variable - Solute carrier family 25 Mus musculus 0.55 AY398420.1 98 3 16 Up 200-high Ribosomal protein L26 mRNA Ictalurus punctatus e-164 AF401580.1 99 3 16 Up 125/200-high ribosomal protein L27 Ictalurus punctatus e-122 AF401581.1 100 3 16 Up 200-high Ribosomal protein L27 Ictalurus punctatus e-108 AF401581.1 101 3 15 variable - NSS 102 3 15 Down - CPB mRNA for carboxypeptidase B Paralichthys olivaceus 2e-09 AB099302.1 103 3 15 Down - CPB mRNA for carboxypeptidase B Paralichthys olivaceus 2e-21 AB099302.1 104 3 15 Down - NSS
144 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 105 3 15 Down - NADH ubiquinone oxidoreductase subunit Semilabea prochilus E=0.011 AF068331.1 4L (ND4L) 106 3 14 200-low - clone CH211-246M6 Danio rerio 2.4 BX649296.3 107 3 14 variable - 40S ribosomal protein S4 Ictalurus punctatus 5e-75 AF402812.1 108 4 20 Up 200-high IMAGE:6961467 Danio rerio E=0.009 BC067637.1 109 4 20 down 125/200-low clone IMAGE:6961467 Danio rerio e-180 BC067637.1 110 4 20 up - Ribosomal protein L7 Danio rerio <0.0001 NM_213644.1 111 4 20 down proportional Ribosomal protein L7 Danio rerio e-165 NM_213644.1 112 4 20 variable 50-low clone DKEY-77A20 Danio rerio 4e-26 BX000358.11 113 4 20 up - Keratin 4 (krt4) mRNA Danio rerio 1e-26 NM_131509.1 114 4 20 down 125/200-low NSS 115 4 20 up 200-high clone CH211-10C6 Danio rerio 7e-19 BX000536.7 116 4 3 up - NSS 117 4 3 variable 50/125-low parvalbumin 1 Rivulus marmoratus 2e-06 AY682949.1 118 4 3 up 50/125-high Type I keratin mRNA Danio rerio 2e-37 AF174137.1 119 4 3 up - NADH dehydrogenase subunit 2 (ND2) Cyprinella lutrensis 7e-06 AF111210.1 120 4 3 up - NSS 121 4 3 up 125/200-high Transforming acidic coiled-containing Rattus norvegicus 3e-21 NM_001004415.1 protein 2 (TACC2) 122 4 3 Down 125/200-low zgc:91794 Danio rerio 4e-05 NM_001002217.1 123 4 3 down 125/200-low zgc:92611 Danio rerio 7e-44 NM_001002704.1 124 4 2 up 125/200-high NSS 125 4 2 Up 125/200-high NSS 126 4 2 up 125/200-high Gamma-crystallin (gamma-m2) mRNA Cyprinus carpio 1e-08 X12903.1 127 4 2 Down 125/200-low clone CH211-191G22 Danio rerio 8.9 BX255967.4 128 4 2 Down 125/200-low similar to 60S ribosomal protein L21 Rattus norvegicus 2e-16 XM_224348.2 129 4 2 down 125/200-low Beta-actin 1 Danio rerio 1e-85 BC063950.1 130 4 2 up 125/200-high Genomic DNA (titin?) Danio rerio 5e-60 AL772356.2 131 4 2 Down 125/200-low Ribosomal protein L21 Ictalurus punctatus 2e-64 AF401575
145 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 132 4 2 Down 125/200-low Type II cytokeratin (ckii) mRNA Danio rerio 1e-07 NM_131156.1 133 4 2 down 125/200-low Aldolase B mRNA Danio rerio 9e-24 NM_194367.3 134 4 20 up 200-high CPB mRNA for carboxypeptidase B Paralichthys olivaceus 0.006 AB099302.1 135 4 20 down - CPB mRNA for carboxypeptidase B Paralichthys olivaceus 1e-32 AB099302.1 136 4 20 Down - Ribosomal protein L7 mRNA Danio rerio e-164 NM_213644.1 137a 4 20 Down - Protocadherin-9 (PCDH9) Homo sapiens 2e-07 NM_020403.3 137b 4 20 down - clone DKEY-77A20 Danio rerio 1e-17 BX000358.11 138 4 20 up 200-high Seq from chromosome 18 Homo sapiens 6.5 AC103814.2 139 4 20 variable - NSS 140 4 20 up - Seq from chromosome 1 Mus musculus 6.6 AC114821.4 141 4 20 down 125/200-low Mitochondrial sequence Carpiodes carpio 4e-20 AY366087.1 142 4 20 up 200-high Cytochrome c oxidase subunit III gene; Oncorhynchus nerka 5e-38 AF294832.1 t-RNA-Gly gene; NADH dehydrogenase subunit 3 143 4 20 Down 125/200-low NSS 144 4 20 Down - NSS 145 4 20 down - NSS 146 4 9 Up 200-high Parvalbumin isoform 1d mRNA Danio rerio 2e-77 AF467914.1 147 4 9 Up - NSS 148 4 9 up - zgc:77704 Danio rerio 8.3 BC050168.1 149 4 9 Down - NSS 150 4 9 Down proportional NADH dehydrogenase subunit 2 Cyprinella gibbsi 2e-22 AF111219.1 151 4 9 Down 125/200-low Dnase gamma gene Mus musculus 6.7 AY024355.1 152 4 9 Down - Mitochondrial Chanos chanos 1.8 AB054133.1 153 4 3 up - NSS 154 4 3 Up - Type I keratin Danio rerio 5e-35 AF174137.1 155 4 3 up 125/200-high NSS 156 4 3 down 200 low NSS 157 4 3 up 125/200-high survival motor neuron domain containing 1 Danio rerio 2.2 BC067338.1
146 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 158 4 3 Down 125/200-low NADH ubiquinone oxidoreductase subunit Xenocyprioides parvulus 2e-07 AF036192.1 4L (ND4L), etc. 159 4 3 Down 125/200-low NSS 160 4 3 down 125/200-low interleukin 6 signal transductor pseudogene Homo sapiens 9.1 NG_002748.1 on chromosome 17 161 4 3 Down 125/200-low NSS 162 4 3 down 125/200-low BAC clone RP11-534O19 Homo sapiens 0.66 AC107390.4 163 4 2 Up 125/200-high creatine kinase M2-CK Cyprinus carpio 4e-85 AF055289.1 164 4 2 Up 125/200-high clone CH211-158M24 Danio rerio 0.62 BX510649.12 165 4 2 up 125/200-high NSS 166 4 2 variable 50-high clone CH211-13 Danio rerio 8.7 BX119902.4 167 4 2 up - Cytochrome c oxidase subunit I (COI) gene Notropis photogenis 2e-56 AY116187.1 168 4 2 up - Sequence from clone (titin?) Danio rerio 1e-35 AL772356.2 169 4 2 up 200-high SNC1-like protein (SNW) gene Arabidopsis thaliana 2.4 AY510018.1 170 4 2 Down 125/200-low clone IMAGE:7046318 Danio rerio 6e-47 BC076035.1 171 4 2 down 125/200-low Ribosomal protein L5b Ictalurus punctatus 1e-16 AF401557 172 4 2 Up 125/200-high NSS 173 4 2 Up 125/200-high clone CH211-158M24 Danio rerio 6e-10 BX510649.12 174 4 2 up 125/200-high myosin, heavy polypeptide 2, fast muscle Danio rerio 2e-06 NM_152982.2 specific 175 4 2 Down 200-low NSS 176 4 2 Down 200-low NSS 177 4 2 Down 200-low NSS 178 4 2 down 200-low NSS 179 4 15 up - NSS 180 4 15 Up - NADH dehydrogenase subunit 2 Cyprinella gibbsi 2e-80 AF111219.1 181 4 15 Up - Ribosomal protein L7a mRNA Ictalurus punctatus 5e-35 AF401560.1 182a 4 15 up 125/200-high Ribosomal protein L10 mRNA Ictalurus punctatus 6e-19 AF401563.1 182b 4 15 up 125/200-high NADH dehydrogenase subunit 2 Cyprinella gibbsi e-120 AF111219.1
147 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 182c 4 15 up 125/200-high NADH dehydrogenase subunit 2 Cyprinella gibbsi 2e-86 AF111219.1 183 4 15 up - NADH dehydrogenase subunit 2 Cyprinella gibbsi 3e-85 AF111219.1 184a 4 15 down 125/200-low clone RP71-47G15 Danio rerio 5e-44 BX465189.9 184b 4 15 down 125/200-low clone DKEY-13 Danio rerio 2e-09 BX842240.3 184c 4 15 down 125/200-low clone DKEY-202N14 Danio rerio 3e-11 BX322550.7 185 4 15 up - clone DKEY-13I15 Danio rerio 1e-14 BX842240.3 186 4 15 up - clone DKEY-13I15 Danio rerio 2e-09 BX842240.3 187 4 15 up - NSS 188 4 15 variable - NADH dehydrogenase subunit 2 (ND2) Cyprinella gibbsi 4e-88 AF111219.1 189 4 15 up - NADH dehydrogenase subunit 2 (ND2) Cyprinella gibbsi 1e-91 AF111219.1 190 4 15 up 50-higher NADH dehydrogenase subunit 2 Cyprinella gibbsi 4e-11 AF111219.1 191 4 15 up - NSS 192 4 15 up - NSS 193 4 10 Down 200-low Chymotrypsinogen B1 Danio rerio 1e-17 BC055574.1 194 4 10 down 125/200-low Chymotrypsinogen B1 Danio rerio 1e-17 BC055574.1 195 4 6 Up - clone DKEY-27P3 Danio rerio 7e-53 BX005320.4 196 4 6 up - NSS 197 4 6 up 125/200-high clone MGC:66406 IMAGE:5915478 Danio rerio 2e-86 BC055643.1 198 4 15 variable - NADH dehydrogenase subunit 2 Cyprinella gibbsi e-121 AF111219.1 199 4 15 variable 50-high PAC clone RP4-725G10 Homo sapiens 1.9 AC006970.6 200a 4 15 up 125/200-high PAC clone RP4-725G10 Homo sapiens 2.1 AC006970.6 200b 4 15 up 125/200-high ATPase subunits 8 and 6 Pimelodella chagresi 6e-13 AF040392.1 201 4 15 down - NSS 202 4 15 Up 200-high clone CH211-233H19 Danio rerio 2e-68 BX248397.7 203 4 15 up 200-high NSS 204 4 15 Down 125/200-low similar to neuronal transmembrane protein Gallus gallus 3e-05 XM_420266.1 Slitrk4 205 4 15 down 125/200-low similar to neuronal transmembrane protein Gallus gallus 0.53 XM_420266.1 Slitrk4
148 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 206 4 15 up 125/200-high NSS 207 4 15 down 125/200-low NSS 208 4 15 down 125/200-low NSS 209 4 15 down 125/200-low zgc:56717 Danio rerio 1e-04 NM_200968.1 210 4 15 down 125/200-low NSS 211 4 15 down 125/200-low NSS 212 4 15 down 125/200-low NSS 213 4 15 down 125/200-low NSS 214 4 15 down 125/200-low NSS 215 4 15 down 125/200-low clone CH211-69J13 Danio rerio 7.1 AL929386.11 216 4 15 down 125/200-low 3 BAC RP11-200I19 Homo sapiens 1.8 AC092933.21 217 4 15 down 125/200-low NSS 218 4 15 down 125/200-low NSS 219a 4 14 Up 125/200-high BAC clone RP23-2I10 Mus musculus 0.45 AC110815.6 219b 4 14 up 125/200-high BAC clone RP11-757K22 Homo sapiens 9.2 AC068037.5 220 4 14 up 125/200-high clone CH211-260P9 Danio rerio 8e-68 BX511124.5 221 4 14 Down - NSS 222 4 14 down - clone CH211-51E12 Danio rerio 2e-04 AL928834.15 223 4 14 up - NSS 224 4 14 down - clone CH211-260P9 Danio rerio 4e-26 BX511124.5 225 4 14 down - clone CH211-260P9 Danio rerio 1e-14 BX511124.5 226 4 14 down 125/200-low NADH dehydrogenase subunit 2 Lythrurus roseipinnis 6e-07 AF111231.1 227 4 14 down 125/200-low NADH dehydrogenase subunit 2 Cyprinella gibbsi 2e-07 AF111219.1 228 4 14 Down proportional Glutamate receptor 4 Carassius auratus 4e-05 U12018.1 229 4 14 down 125/200-low Glutamate receptor 4 Carassius auratus 0.037 U12018.1 230 4 10 down - clone CH211-10K1 Danio rerio 2e-09 BX324205.5 231 4 10 down - 12q22 BAC RPCI11-256L6 Homo sapiens 2.0 AC007298.17 232 4 10 down - NSS 233 4 10 down - clone CH211-197B6 Danio rerio 2.0 AL935324.8
149 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 234 4 10 down - chromosome 3 clone RP11-259K5 Homo sapiens 1.9 AC097359.2 235 4 10 down - chromosome 18 clone RP23-6P18 Mus musculus 7.8 AC020972.3 236 4 10 down - clone DKEY-206F10 Danio rerio 0.51 BX470188.11 237 4 10 down - NSS 238 4 10 down - NSS 239 4 6 up 200-high BAC clone RP11-44D21 Homo sapiens 0.14 AC108866.5 240 4 6 up - NSS 241 4 6 up - NSS 242 4 6 up - full-length cDNA Tetraodon nigriviridis 4e-05 CR722732.1 243 4 6 up - NSS 244 4 6 up - NSS 245 4 6 up - Cytochrome b gene Notropis texanus 3e-21 AF352267.1 246 4 6 up - NSS 247 4 6 up - zgc:91930 Danio rerio 6e-47 BC080261.1 248 4 6 up - NSS 249 4 6 up - Skeletal alpha actin Carassius auratus 0.002 D50029.1 250 4 6 up - BAC clone RP11-59F3 Homo sapiens 0.53 AC067961.8 251 4 6 up proportional clone CH211-231L18 Danio rerio 0.58 AL732635.7 252 4 6 up - NSS 253 4 6 Down 125/200-low NSS 254 4 6 down 125/200-low NSS 255 5 10 down 200-low Phosphoglycerate mutase 2 Danio rerio 8e-74 NM_201024.1 256 5 10 down 200-low NADH dehydrogenase subunit 2 Cyprinella gibbsi e-120 AF111219.1 257a 5 10 down 200-low Heat shock protein 90-beta Danio rerio 2e-40 NM_131310.1 257b 5 10 down 200-low Chymotrypsinogen B1 Danio rerio 4e-17 NM_212618.1 258 5 10 down 200-low NSS 259 5 10 down 200-low Aldolase B mRNA Danio rerio 3e-92 AF533646.1 260 5 10 down 200-low chromosome 17 Homo sapiens 8.7 AC002558.1 261 5 10 down 200-low NSS
150 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 262 5 10 down 200-low Kinesin family member 1B Mus musculus 0.40 NM_207682.1 263 5 10 up - Guanine nucleotide binding protein; p Danio rerio 5e-35 AY423038.1 264 5 10 down 200-low NSS 265 5 10 up 200-high desmin Danio rerio 8.4 NM_130963.1 266 5 10 Down - NSS 267 5 10 Down 125/200-low NSS 268 5 10 down 125/200-low NSS 269 5 5 up - Aldolase B Danio rerio <0.001 AF533646.1 270 5 5 up - Anionic trypsin Oncorhynchus keta 2e-80 AB091439.1 271 5 5 up - Proteasome subunit beta 7 Danio rerio 1e-32 AF155581.1 272 5 5 up - Proteasome subunit beta 7 Danio rerio 1e-17 AF155581.1 273 5 5 up 125/200-high LIM domain binding 3 like Danio rerio 4e-05 NM_199858.2 274 5 5 variable 50/125-high zgc:73262 Danio rerio 3e-15 NM_200765.1 275 5 5 up - clone RP11-23B16 on chromosome 13 Homo sapiens 8.8 AL161894.12 276 5 5 up - Mitochondrial DNA Carassius auratus 1e-79 AY771781.1 277 5 5 up 125/200-high cytochrome oxidase subunit II Hemibarbus maculatus 5e-57 AY704455.1 278 5 5 up - Mitochondrial DNA Myxocyprinus asiaticus 6e-41 AY526869.1 279 5 5 up 125/200-high NSS 280 5 5 up - cosmid C54E4 Caenorhabditis elegans 0.035 AF038609.2 281 5 5 up - clone RP71-30I22 in linkage group 8 Danio rerio 2e-37 AL590148.8 282 5 5 up 125/200-high clone RP71-30I22 in linkage group 8 Danio rerio 6e-41 AL590148.8 283 5 5 variable 50/125-high Chymotrypsinogen B1 Danio rerio 6e-31 NM_212618.1 284 5 5 up proportional BAC clone RP11-571I18 from 4 Homo sapiens 0.15 AC110792.3 285 5 5 up - titin Danio rerio 7e-10 AY081167.1 286 5 5 up - titin Danio rerio 8e-34 AY081167.1 287 5 5 variable 50/125-high NSS 288 5 5 up proportional titin Danio rerio 4e-17 AY081167.1 289 5 3 Down proportional Alpha-amylase mRNA Lates calcarifer 2e-46 AF416651.1 290 5 3 up 125/200-high BAC clone RP11-533K12 from 4 Homo sapiens 1.9 AC095063.2
151 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 291 5 3 Down chromosome 11q clone:RP11-617B3 Homo sapiens 0.56 AP003043.2 292 5 3 Down NADH ubiquinone oxidoreductase subunit Distoechodon tumirostris 4e-20 AF036179.1 4L; other genes 293 5 3 variable 125-high NSS 294 5 3 Down 200-low Furin Xenopus laevis 9.0 BC084090.1 295 5 3 Down 200-low NSS 296 5 1 down 125/200-low fast muscle troponin I Danio rerio 4e-85 AF425744.1 297a 5 1 up 200-high Fast muscle troponin I Danio rerio e-127 AF425744.1 297b 5 1 up 200-high clone BUSM1-71F1 in linkage group 9 Danio rerio 3e-98 BX248311.6 297c 5 1 up 200-high Elongation factor 1-alpha mRNA Cyprinus carpio 2e-65 AF485331.1 298 5 1 down 125/200-low Elongation factor-1 alpha Anduzedoras oxyrhynchus 1e-08 AY264231.1 299 5 1 down 125/200-low clone CH211-69M14 in linkage group 20 Danio rerio 0.13 AL929030.7 300 5 1 up 200-high NSS 301 5 1 down 125/200-low NSS 302 5 1 down 125/200-low 40S ribosomal protein S5 Danio rerio 2e-19 NM_173232.1 303 5 1 down 125/200-low NSS 304 5 1 down 125/200-low BAC clone CH251-137M10 from Y Pan troglodytes 0.51 AC147158.3 305a 5 5 variable 125-low Aldolase B mRNA Danio rerio <0.0001 AF533646.1 305b 5 5 variable 125-low Proteasome subunit beta 7 Danio rerio 1e-63 AF155581.1 305c 5 5 variable 125-low Mitochondrial DNA Carassius auratus 5e-72 AY714387.1 306 5 5 down 125/200-low Anionic trypsin Oncorhynchus keta 3e-80 AB091439.1 307 5 5 down 125/200-low Anionic trypsin Oncorhynchus keta 2e-80 AB091439.1 308 5 5 Down 125/200-low Myosin heavy chain Cyprinus carpio 0.55 AB104624.1 309 5 5 down 125/200-low NSS 310 5 5 Up 200-high Several genes Danio rerio 8e-21 AL590148.8 311 5 5 up 200-high Several genes Danio rerio 6e-34 AL590148.8 312 5 3 Up 125/200-high BAC clone RP24-369I6 from chromosome Mus musculus 2.1 AC124403.3 16 313a 5 3 Up 125/200-high NADH dehydrogenase subunit 2 Cyprinella monacha 7e-21 AF111228.1
152 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 313b 5 3 Up 125/200-high Mitochondrial DNA Carassius auratus 4e-82 AY714387.1 314 5 3 down - NSS 315 5 3 up 125/200-high NSS 316 5 3 up 125/200-high NSS 317 5 3 up - NSS 318 5 3 up - clone RP23-373N5 on chromosome 4 Mus musculus 9.0 AL928597.19 319 5 3 Down 125/200-low isolate 2 NADH dehydrogenase subunit 2 Hybopsis hypsinotus 0.025 AF216610.1 gene 320 5 3 Up 200-high NADH ubiquinone oxidoreductase subunits Distoechodon tumirostris 5e-32 AF036179.1 4L and 4 321 5 3 up 125/200-high NSS 322 5 1 up 50-high Fast muscle troponin I mRNA Danio rerio e-133 AF425744.1 323 5 1 down 125/200-low Elongation factor 1-alpha Cyprinus carpio 1e-48 AF485331.1 324 5 1 variable 50-high clone CH211-69M14 in linkage group 20 Danio rerio 0.15 AL929030.7 325 5 1 up - NSS 326 5 5 down 125/200-low NSS 327 5 5 Down 125/200-low cytochrome oxidase subunit II Hemibarbus maculatus 7e-49 AY704455.1 328 5 5 Down 125/200-low 3D7 chromosome 11 section 2 of 8 Plasmodium falciparum 0.55 AE014837.1 329 5 5 down 125/200-low chymotrypsinogen B1 Danio rerio 6e-04 NM_212618.1 330 5 5 down 125/200-low chymotrypsinogen B1 Danio rerio 8e-24 NM_212618.1 331 5 3 Up 125-high NSS 332 5 18 up 200-high zgc:103433 Danio rerio 0.15 BC083377.1 333 5 18 up - actinin, alpha 2 Danio rerio 0.039 AY391405.1 334 5 18 Up - NSS 335 5 18 Up - NSS 336 5 18 Up - clone RP1-191L6 on chromosome 20q12 Homo sapiens 2.2 AL009050.9 337 5 18 Up - 12 BAC RP11-363M20 Homo sapiens 2.3 AC073576.23 338 5 18 Up - zgc:76904 Danio rerio 1e-51 NM_207101.1 339 5 18 Up - NSS
153 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 340 5 18 Up 125/200-high clone RP11-365J16 on chromosome 10 Homo sapiens 0.16 AL445431.16 341 5 18 std - Ribosomal protein L21 Ictalurus punctatus 2e-43 AF401575.1 342 5 18 up - clone CH211-187I23 in linkage group 18 Danio rerio 9.0 AL935038.9 343 5 18 up 200-high NSS 344 5 18 Down 200-low NSS 345 5 18 Down 125/200-low NSS 346 5 18 down 200-low BAC clone RP11-785D16 from 2 Homo sapiens 8.4 AC112723.3 347 5 17 Up - clone DKEY-52K20 in linkage group 2 Danio rerio 9e-34 BX649372.5 348 5 17 Up - clone DKEY-52K20 in linkage group 2 Danio rerio 5e-29 BX649372.5 349 5 17 up - clone DKEY-52K20 in linkage group 2 Danio rerio 2e-06 BX649372.5 350 5 17 up - NSS 351 5 17 down 200-low NSS 352 5 17 up 200-high NSS 353 5 17 up - NSS 354 5 17 down proportional basic helix-loop-helix transcription factor Danio rerio 4e-05 AJ510221.1 355 5 17 Down - NSS 356 5 17 down - mRNA Oryza sativa 8.8 XM_467514.1 357 5 17 Up 125/200-high clone DKEY-16I5 in linkage group 12 Danio rerio 0.009 BX649366.5 358 5 17 up 125/200-high clone DKEY-16I5 in linkage group 12 Danio rerio 0.009 BX649366.5 359 5 17 down - clone DKEYP-82D1 in linkage group 2 Danio rerio 2.2 BX510333.14 360 5 17 up 200-high clone RP11-157N3 on chromosome 1 Homo sapiens 2.2 AL662904.4 361 5 17 up 200-high clone DKEY-16L23 in linkage group 2 Danio rerio 0.56 BX294132.11 362 5 17 down - NSS 363 5 17 down - ribosomal protein S25 Danio rerio 4e-08 NM_200815.1 364 5 17 down - ribosomal protein S25 Danio rerio 0.14 NM_200815.1 365 5 17 down - NSS 366 5 17 down - clone DKEY-38P12 Danio rerio 0.55 AL929346.5 367 5 17 up 200-high NSS 368 5 17 down 125/200-low NSS
154 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 369 5 17 down 125/200-low NSS 370 5 17 down 125/200-low NSS 371 5 17 down 125/200-low NSS 372 5 16 up 125/200-high Synaptotagmin 1 Rattus rattus 1e-69 AJ617615.1 373 5 16 down 125/200-low similar to Synaptotagmin-2 Pan troglodytes 2e-06 XM_525024.1 374 5 16 up 125/200-high synaptotagmin 1 Rattus rattus 2e-07 AJ617615.1 375 5 16 Up 125/200-high Similar to ribosomal protein L19 Xenopus laevis 2e-16 BC041546.1 376 5 16 up 125/200-high NSS 377 5 16 up 125/200-high Chromosome 8q23 Homo sapiens 2.3 AP002982.2 378 5 16 down 200-low Cytochrome c oxidase subunit III gene Carassius auratus 2e-65 AY219843.1 379 5 16 up 125/200-high NSS 380 5 16 up 125/200-high NSS 381 5 16 Down - ATPase, Na/K transporting, beta 1a Danio rerio 3e-33 NM_131668.3 polypeptide mRNA 382 5 16 down - ATPase, Na/K transporting, beta 1a Danio rerio 2e-10 NM_131668.3 polypeptide mRNA 383 5 16 up - Translation initiation factor 2 mRNA Danio rerio 7e-19 AY648723.1 384 5 16 Up 125/200-high NSS 385 5 16 up 125/200-high NSS 386 5 16 Up 200-high clone 132124R Lycopersicon esculentum 2.1 BT013465.1 387 5 16 up 200-high clone RP11-261P24 on chromosome 13 Homo sapiens 0.53 AL161896.16 388 5 16 Down - clone RP71-8L21 in linkage group 1 Danio rerio 1e-29 BX537132.7 389 5 16 down - clone RP71-8L21 in linkage group 1 Danio rerio 5e-32 BX537132.7 390 5 16 up 200-high NSS 391 5 16 down - NSS 392 5 16 down - NSS 393 5 16 down - NSS 394 5 16 down - NSS 395 5 16 down 200-low NSS
155 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 396 5 16 down 200-low NSS 397 5 16 Down 125/200-low Translationally-controlled tumor protein Danio rerio 0.036 AF288217.1 398 5 16 down - Translationally-controlled tumor protein Danio rerio 0.009 NM_198140.1 399 5 15 up 200-high Cytochrome b gene Pimephales notatus e-111 U66606.1 400 5 15 down 125/200-low Mitochondrial DNA Carassius carassius 2e-99 AY714387.1 401 5 15 Down 125/200-low NSS 402 5 15 up 125/200-high proteasome (prosome, macropain) 26S Homo sapiens 2e-31 NM_002810.1 subunit 403 5 15 down - NSS 404 5 15 down 125/200-low Partial mRNA for apolipoprotein A-I Cyprinus carpio 7e-16 AJ308993.1 405 5 15 down 125/200-low NSS 406 5 15 down - ribosomal protein S3A Danio rerio 0.036 NM_200059.1 407 5 15 down - collagen, type I, alpha 1 Danio rerio 3e-33 NM_199214.1 408 5 15 Down - acidic (leucine-rich) nuclear Danio rerio 5e-60 NM_212603.1 phosphoprotein 32 family, member B 409 5 15 down - acidic (leucine-rich) nuclear phosphoprotein Danio rerio 5e-60 NM_212603.1 family, member B 410 5 15 Down - NSS 411 5 15 Down - insulin-like growth factor 2 (IGF2) gene Ornithorhynchus anatinus 8.9 AY552324.1 412 5 15 Down proportional peptidylprolyl isomerase A (cyclophilin A) Danio rerio 0.14 NM_212758.1 413 5 15 down proportional peptidylprolyl isomerase A (cyclophilin A) Danio rerio 1e-08 NM_212758.1 414 5 15 Down 200-low NSS 415 5 15 down 200-low NSS 416 5 15 Down - NSS 417 5 15 Down - NSS 418 5 15 down - NSS 419 5 15 down - NSS 420 5 15 down - NSS 421 5 15 down - 12S ribosomal RNA and tRNA-Val genes Pteronotropis hubbsi 2e-07 AY216560.1
156 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 422 5 15 down - NSS 423 5 15 down - NSS 424 5 15 down - NSS 425 5 15 down - Chromosome 3L, section 65/83 Drosophila melanogaster 8.4 AE003520.4 426 5 15 down - NSS 427 5 18 up - NSS 428 5 18 up - zgc:66097 Danio rerio 2e-06 BC074055.1 429 5 18 up 50-high mitochondrial genome Pelomedusa subrufa 0.009 AF039066.1 430 5 18 up 50-high RAG5 gene for hexokinase Kluyveromyces lactis 8.8 X61680.1 431 5 18 up 125/200-high BAC clone RP11-16J22 from 2 Homo sapiens 0.010 AC104776.5 432 5 18 up - BAC clone RP23-450J12 from chromosome Mus musculus 8.8 AC124485.3 8 433 5 18 up - clone RP11-29O12 on chromosome 1 Homo sapiens 8.1 BX546457.1 434 5 18 up - zgc:76904 Danio rerio 6e-93 NM_207101.1 435 5 18 up - NSS 436 5 17 Up - ubiquinol-cytochrome c reductase core I Oncorhynchus mykiss 2e-37 AF465782.1 protein 437 5 17 Up - BAC R-737F10 of library RPCI-11 from Homo sapiens 8.6 AL512360.2 chromosome 14 438 5 17 up - clone CH211-273N7 in linkage group 18 Danio rerio 0.002 BX548245.14 439 5 17 Down 1225/200-low CCAAT/enhancer binding protein (C/EBP), Danio rerio 5e-97 NM_131884.2 beta 440 5 17 down 125/200-low CCAAT/enhancer binding protein (C/EBP), Danio rerio 5e-97 NM_131884.2 beta 441 5 17 down 125/200-low NSS 442 5 16 up 125/200-high NRRL Y-1140 Kluyveromyces lactis 2.3 XM_454249.1 443 5 16 up 125/200-high synaptotagmin 1 Rattus rattus 6e-72 AJ617615.1 444 5 16 Down - NSS 445 5 16 down - mitochondrial DNA Carassius auratus 2e-77 AY714387.1
157 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 446 5 16 down - NSS 447 5 16 down - ribosomal protein L4 Danio rerio 4e-79 BC067580.1 448 5 15 Down 125/200-low chromosome F of strain CLIB99 Yarrowia lipolytica 9.0 CR382132.1 449 5 15 down 125/200-low NSS 450 6 5 Down 200-low NSS 451a 6 5 Down 200-low 40S ribosomal protein S2 Ictalurus punctatus 9e-74 AF402809.1 451b 6 5 Down 200-low proteasome subunit beta 7 Danio rerio 1e-62 AF155581.1 451c 6 5 Down 200-low NSS 452a 6 5 Down 200-low proteasome subunit beta 7 Danio rerio 5e-69 AF155581.1 452b 6 5 Down 200-low NSS 453 6 5 Up 200-high clone DKEY-259L18 in linkage group 23 Danio rerio 1e-45 BX571850.7 454 6 5 Down proportional profilin 2 like Danio rerio 5e-29 NM_201466.2 455 6 5 Down 125/200-low NSS 456 6 5 Up 200-high titin Danio rerio 3e-17 AY081167.1 457 6 5 Up 200-high NSS 458 6 5 Down 200-low mitochondrial DNA Chanos chanos 7e-16 AB054133.1 459 6 5 Down 200-low NSS 460 6 5 Down 200-low NSS 461 6 5 Down 200-low 3D7 chromosome 11, section 2/8 Plasmodium falciparum 0.56 AE014837.1 462 6 5 Down - NSS 463 6 5 Down - NSS 464 6 3 variable 50/125-high NSS 465 6 3 variable 50/125-high fast skeletal myosin heavy chain 4 (mhc4) Danio rerio <0.0001 AY333450.1 466 6 3 down - chromosome 5 clone CTB-35F21 Homo sapiens 9.0 AC008667.10 467 6 3 down 200-low ribosomal protein L4 Danio rerio e-178 BC049520.1 468 6 3 down - 40S ribosomal protein S5 (rpS5) Danio rerio <0.0001 BC059443.1 469 6 3 Down - chromosome 8, clone RP11-960H2 Homo sapiens 0.14 AC107934.3 470 6 3 down - 60S ribosomal protein L12 Danio rerio e-114 AY648813.1 471 6 3 down proportional 60S ribosomal protein L12 Danio rerio e-119 AY648813.1
158 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 472 6 3 Down 200-low NSS 473 6 3 down 200-low NSS 474 6 3 Up 200-high fast skeletal muscle myosin heavy Danio rerio e-100 AF180893.1 polypeptide 1 (myhz1) 475 6 3 up 200-high fast skeletal muscle myosin heavy Danio rerio 2e-98 AF180893.1 polypeptide 1 (myhz1) 476 6 3 Down 200-low EF-1a mRNA for elongation factor 1a Oreochromis niloticus 4e-04 AB075952.1 477 6 3 down 200-low 4 BAC CH230-55N7 Rattus norvegicus 8.9 AC125643.3 478 6 3 Down - NSS 479 6 3 Down - NSS 480 6 3 Down 200-low survival motor neuron domain containing 1 Danio rerio 0.037 NM_212601.1 (smndc1), 481 6 3 down 200-low survival motor neuron domain containing 1 Danio rerio 2e-52 NM_212601.1 (smndc1), 482 6 1 Up 125/200-high fast muscle troponin I Danio rerio e-130 AF425744.1 483 6 1 Up 125/200-high clone DKEYP-67D2 in linkage group 9 Danio rerio e-102 BX640499.5 484 6 1 Up 125/200-high clone DKEYP-67D2 in linkage group 9 Danio rerio e-102 BX640499.5 485 6 1 up - troponin T3a, skeletal, fast Danio rerio 2e-78 NM_131565.1 486 6 1 Down proportional fast muscle troponin T isoform TnnT3b Danio rerio 1e-76 AF425741.1 487 6 1 Down 200-low elongation factor 1-alpha Cyprinus carpio e-135 AF485331.1 488 6 1 Down - elongation factor 1-alpha Cyprinus carpio 4e-33 AF485331.1 489 6 1 Down - NSS 490 6 1 Down 200-low heat shock cognate 70 kDa protein Carassius auratus 3e-98 AY195744.1 491 6 1 Down - NSS 492 6 1 Down 200-low actinin, alpha 2 (ACTN2) Danio rerio 4e-14 AY391405.1 493 6 1 Down 200-low actinin, alpha 2 (ACTN2) Danio rerio 7e-13 AY391405.1 494 6 1 Down 200-low heat shock cognate 70 kDa protein Carassius auratus e-100 AY195744.1 495 6 1 Down 200-low heat shock cognate 70 kDa protein Carassius auratus 8e-96 AY195744.1 496 6 1 Down proportional actinin, alpha 2 (ACTN2) Danio rerio 0.002 AY391405.1
159 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 497 6 1 Down - actinin, alpha 2 (ACTN2) Danio rerio 0.57 AY391405.1 498 6 1 Down 125/200-low fast muscle troponin I Danio rerio e-132 AF425744.1 499a 6 1 Down proportional fast muscle troponin I Danio rerio e-127 AF425744.1 499b 6 1 Down - clone DKEYP-67D2 in linkage group 9 Danio rerio e-102 BX640499.5 500 6 6 down 125/200-low fast muscle troponin T isoform TnnT3b Danio rerio e-128 AF425741.1 501 6 6 up proportional troponin T3a, skeletal fast Danio rerio 3e-51 BC053304.1 502 6 6 down 200-low mitochondrial DNA Carassius auratus 2e-83 AY714387.1 503 6 6 down - ribosomal RNA gene Ralstonia solanacearum 7e-56 AF012418.1 504 6 5 down - NSS 505 6 5 down 125/200-low NSS 506 6 5 up 200-high titin Danio rerio 9e-31 AY081167.1 507 6 5 up 200-high titin Danio rerio 0.006 AY081167.1 508 6 5 down 200-low mitochondrial DNA Cataetyx rubrirostris 2e-04 AP004407.1 509 6 5 down - NSS 510 6 5 down - NSS 511 6 5 down - NSS 512 6 5 down 200-low cosmid C54E4 Caenorhabditis elegans 0.035 AF038609.2 513 6 5 down 200-low NSS 514 6 5 down 200-low NSS 515 6 5 down 200-low NSS 516 6 5 down 200-low titin Danio rerio 7.6 AY081167.1 517 6 5 Up? clone RP71-30I22 in linkage group 8 Danio rerio 3e-24 AL590148.8 518 6 5 Up 200-high section 5/21 Pseudomonas putida KT24 5e-32 AE016778.1 519 6 5 up 200-high section 5 of 21 Pseudomonas putida KT24 3e-48 AE016778.1 520 6 5 Down 200-low NSS 521 6 5 down 200-low clone DKEY-111D8 in linkage group 10 Danio rerio 1.9 BX005349.6 522 6 5 Down 200-low BAC clone RP11-793B9 from 4 Homo sapiens 1.9 AC053544.5 523 6 5 down 200-low 12 BAC CH230-63N13 Rattus norvegicus 7.5 AC103576.8 524 6 5 Up 125/200-high NSS
160 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 525 6 5 up 125/200-high NSS 526 6 5 Down - NSS 527 6 5 down - NSS 528 6 5 down - NSS 529 6 3 up 200-high zgc:86706 Danio rerio 4e-11 NM_001002068.1 530 6 3 up 200-high fast skeletal muscle myosin heavy Danio rerio 4e-91 AF180893.1 polypeptide 1 (myhz1) 531 6 3 up 200-high NSS 532 6 3 up 200-high enolase 1, alpha (ENO1) Danio rerio 0.031 AY398342.1 533 6 3 up 200-high guanine nucleotide binding protein (G Danio rerio 7.6 NM_212609.1 protein), betapolypeptide 1 534 6 3 Down 200-low NSS 535 6 3 Down 200-low NSS 536 6 3 down 200-low NSS 537 6 1 down 125/200-low elongation factor 1-alpha Cyprinus carpio e-180 AF485331.1 538 6 1 up 200-high troponin T3a, skeletal, fast muscle Danio rerio 1e-66 NM_131565.1 539 6 1 down 200-low elongation factor 1-alpha Cyprinus carpio 2e-06 AF485331.1 540 6 1 down 200-low chromosome I, section 8/397 Leptospira interrogans 0.49 AE011199.1 541 6 1 Down - NSS 542 6 1 Up proportional ribosomal protein S5 (rps5) Danio rerio 6e-16 NM_173232.1 543 6 1 up 200-high ribosomal protein S5 (rps5) Danio rerio 1e-17 NM_173232.1 544 6 1 Down 200-low NSS 545 6 1 down 200-low myosin, heavy polypeptide 2, fast muscle Danio rerio 4e-57 NM_152982.2 specific 546 6 1 down 200-low actinin, alpha 2 (ACTN2) Danio rerio 4e-11 AY391405.1 547 6 1 Down - heat shock protein 70 Sycon raphanus 0.002 Y15109.1 548 6 1 down - NSS 549 6 1 Down 200-low NSS 550 6 1 down 200-low NSS
161 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 551 6 19 up 125/200-high NSS 552 6 19 Up 125/200-high clone CH211-271B14 in linkage group 5 Danio rerio 4e-08 BX247876.6 553 6 19 Up 125/200-high clone DKEYP-73D8 in linkage group 2 Danio rerio 0.002 BX323559.11 554 6 19 Up 200-high chromosome 3 clone RP11-644G8 Homo sapiens 8.8 AC092505.2 555 6 19 Up 125/200-high NSS 556 6 19 Up proportional alpha-tropomyosin (tpma) Danio rerio 2e-37 AF180892.1 557 6 19 down 125/200-low NSS 558 6 17 down 200-low clone DKEY-52K20 in linkage group 2 Danio rerio 1e-32 BX649372.5 559 6 17 down 200-low NSS 560 6 17 down 200-low NSS 561 6 17 Up 125/200-high zgc:92575 Danio rerio e-100 BC085674.1 562 6 17 up 200-high clone DKEY-16I5 in linkage group 12 Danio rerio 3e-12 BX649366.5 563 6 17 down 200-low basic helix-loop-helix transcription factor Danio rerio 0.54 AJ510221.1 (hey1 gene) 564 6 17 up 125/200-high NSS 565 6 17 Up 125/200-high brefeldin A-inhibited guanine Homo sapiens 3e-20 AB209324.1 nucleotide-exchange protein 1 (BIG1) 566 6 17 up 125/200-high chromosome 8, clone RP11-413C18 Homo sapiens 0.13 AC009634.9 567 6 17 down 200-low NSS 568 6 17 up - ribosomal protein S25 Danio rerio 7e-25 NM_200815.1 569 6 17 up 200-high fast muscle troponin I Danio rerio 0.13 AF425744.1 570 6 17 Down 200-low NSS 571 6 17 Down - NSS 572 6 17 Down - NSS 573 6 17 down - NSS 574 6 16 Down proportional alpha-tropomyosin (tpma) Danio rerio 1e-38 NM_131105.2 575 6 16 Down - NSS 576 6 16 Down - NSS 577 6 16 Down - NSS
162 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 578 6 16 Down proportional eukaryotic translation initiation factor 2 Danio rerio 8e-34 AY648723.1 gamma 579 6 16 Down proportional NADH dehydrogenase subunit I gene Ctenogobiops feroculus 9e-06 AF391435.1 580 6 16 Down - mitochondrial DNA Synbranchus marmoratus 5e-04 AP004439.1 581 6 16 Down - NSS 582 6 16 Down - chromosome 3 clone RP11-208J17 Homo sapiens 7.9 AC095029.3 583 6 15 Down 200-low 40S ribosomal protein S4 Ictalurus punctatus 4e-11 AF402812.1 584 6 15 Down 200-low chromosome 1, clone RP24-98E13 Mus musculus 2.6 AC130674.7 585 6 15 Down - NSS 586 6 15 Up 200-high isolate DOR85-6355 polyprotein (VP1) gene Human poliovirus 0.56 AF405636.1 587 6 15 up 50/125-high eukaryotic translation elongation factor 2 Danio rerio 2e-09 AY391422.1 588 6 15 - - ubiquitin-conjugating enzyme UbcM2 Homo sapiens 0.008 AF136176.1 589 6 15 variable 50/125-high NSS 590 6 15 down - ribosomal protein S3A Danio rerio 2e-53 NM_200059.1 591 6 15 variable 50/125-high NSS 592 6 15 Down - NSS 593 6 15 Down - C4BPA gene for C4bp alpha-chain Cavia porcellus 7.4 AB049468.1 594 6 15 Down - NSS 595 6 15 down - NSS 596 6 15 Up 200-high isolate A174 mitochondrion Homo sapiens 6e-22 AY714050.1 597 6 15 up 200-high isolate A174 mitochondrion Homo sapiens 1e-13 AY714050.1 598 6 15 Down - clone RP11-252O2 on chromosome Homo sapiens 7.8 AL133281.12 9p22.1-22.3 599 6 15 Down - NSS 600 6 15 Down - NSS 601 6 15 Up 200-high isolate T108 mitochondrion Homo sapiens 3e-11 AY714049.1 602 6 15 up 200-high isolate T108 mitochondrion Homo sapiens 2e-12 AY714049.1 603a 6 19 down - NSS 603b 6 19 down - NSS
163 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 603c 6 19 down - zgc:63682 Danio rerio 6e-16 NM_200906.1 604 6 19 Down - NSS 605 6 19 Down - mRNA for skeletal alpha-actin Cyprinus carpio 2e-59 D50028.1 606 6 19 down - ribosomal protein L3 mRNA Ictalurus punctatus e-118 BC091460.1 607 6 19 Down - guanine nucleotide binding protein (G Danio rerio <0.0001 AY423038.1 protein), beta polypeptide 2-like 1 608 6 19 Down - zgc:77263 Danio rerio 1e-91 NM_199820.2 609 6 19 Down - zgc:77263 Danio rerio <0.0001 NM_199820.2 610 6 19 variable 50-low BAC clone RP23-3H23 from X Mus musculus 2.2 AC098729.3 611 6 19 variable 50-low 82 BAC clone Gm_ISb001_091_F11 Glycine max cv Williams 0.14 AF541963.1 612 6 19 Up 125/200-high cathepsin D Oncorhynchus mykiss 8.6 U90321.1 613 6 19 up 125/200-high NSS 614 6 19 up 125/200-high zgc:63682 Danio rerio 1e-07 NM_200906.1 615 6 19 variable 50/125-high ribosomal protein L37a Ictalurus punctatus 3e-70 AF401594.1 616 6 19 up 200-high clone CH211-271B14 in linkage group 5 Danio rerio 9e-09 BX247876.6 617 6 19 up 200-high clone DKEYP-73D8 in linkage group 2 Danio rerio 0.002 BX323559.11 618 6 19 variable 50/125-high skeletal muscle actin mutant mRNA Cyprinus carpio 2e-47 AY395871.1 619 6 19 down proportional skeletal muscle alpha-actin Cyprinus carpio 7e-53 D50028.1 620 6 19 up 125/200-high NSS 621 6 19 variable 50/125-high skeletal muscle alpha-actin Cyprinus carpio 2e-68 D50028.1 622 6 19 Down - NSS 623 6 19 Down - NSS 624 6 19 down - NSS 625 6 17 down 200-low HCM2081 gene Homo sapiens 0.15 AY405009.1 626 6 17 down 200-low NSS 627 6 17 Down 200-low cDNA clone IMAGE:7395709 Danio rerio 6e-84 BC092811.1 628 6 17 Down 200-low NSS 629a 6 17 Down 200-low cDNA clone IMAGE:7395709 Danio rerio 4e-85 BC092811.1
164 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 629b 6 17 Down 200-low NSS 630a 6 17 Down 200-low cDNA clone IMAGE:7395709 Danio rerio 4e-85 BC092811.1 630b 6 17 Down 200-low similar to ATP synthase H+ transporting Xenopus laevis 2e-06 BC048772.1 mitochondrial FO complex subunit b, isoform 1 631 6 17 down 125/200-low clone CH211-163F10 in linkage group 2 Danio rerio 0.002 AL929518.16 632 6 17 up - chromosome 3 clone RP11-161L3 map 3p Homo sapiens 8.6 AC091069.2 633 6 17 Up 200-high zgc:92575 Danio rerio 1e-72 BC085674.1 634 6 17 up 200-high zgc:92575 Danio rerio 1e-85 BC085674.1 635 6 17 Down - clone RP24-147N6 from chromosome 6 Mus musculus 8.4 AC124689.5 636 6 17 down - basic helix-loop-helix transcription factor Danio rerio 3e-36 AJ510221.1 (hey 1 gene) 637 6 15 down 200-low NSS 638 6 15 Down 200-low NSS 639 6 15 down 200-low NSS 640 6 15 down 125/200-low mRNA for stathmin Gallus gallus 2e-28 NM_001001858.1 641 6 15 down 125/200-low mitochondrial DNA Synbranchus marmoratus 2.1 AP004439.1 642 6 15 up 200-high mRNA for stathmin Gallus gallus 3e-33 NM_001001858.1 643 6 15 Down - NSS 644 6 15 up 200-high NSS 645 6 15 Down - chromosome 8, clone RP11-468H14 Homo sapiens 2.1 AC079193.10 646 6 15 Down - NSS 647 6 15 down 200-low NSS 648 6 15 variable 50/125-high translation elongation factor 2 Danio rerio 4e-45 AY391422.1 649 6 15 down 200-low mitochondrial DNA Carassius carassius 3e-95 AY714387.1 650 6 15 down 125/200-low myosin, heavy polypeptide 2, fast muscle Danio rerio 2.4 NM_152982.2 specific 651 6 15 Down 200-low fast skeletal myosin light chain 3 Cyprinus carpio 6e-78 D85141.1 652 6 15 Down 200-low fast skeletal myosin light chain 3 Cyprinus carpio 7e-44 D85141.1
165 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 653 6 15 Down 200-low ubiquitin-conjugating enzyme UbcM2 Homo sapiens 4e-05 AF136176.1 654 6 15 down 200-low ribosomal protein S3A Danio rerio 2e-74 NM_200059.1
166 Table 38: A list of the zinc candidate bands obtained from the differential display technique, their specific response to zinc and BLAST identity matches. Seq=sequence number, Anc=anchor primer, Arp=arbitrary primer, response=gene expression response to stressor with “up” denoting up-regulation, “down” denoting down-regulation and “variable” indicating variation in band expression, conc dep=concentration dependence and shows the specific copper concentration associated with the gene expression response, identity=BLAST match, species=species with homologous gene, E-value=expect value of BLAST match and Accession no.=GenBank accession number of homologous gene. If there was no BLAST match for the gene, it was designated as having “no significant similarity” (NSS) in the identity column.
Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 655 1 5 Down - NSS 656 1 5 down - Chr. 3 cosmid c645 Schizosaccharomyces 0.57 AL049498.1 ponibe 657 1 5 Up 6/900 NSS 658 1 5 Up 6/900 NSS 659 1 5 Up 6/900 NSS 660 1 5 up 6/900 NSS 661 1 3 up 4/6/900 NSS 662 1 1 up 4/6/900 S6 ribosomal protein Pagrus major e-115 AY190727.1 663 1 1 up 4/6/900 keratin Carassius auratus e-131 L09744.1 664 1 1 up 4/6/900 zgc:55941 Danio rerio 3e-83 BC065885.1 665 1 1 up 6/900 full-length cDNA Tetraodon nigroviridis e-137 CR703467.2 666 1 1 up 4/6/900 NSS 667 1 1 up - NSS 668 1 1 up 4/6/900 myosin, heavy polypeptide 2, fast muscle Danio rerio <0.0001 NM_152982.2 specific 669 1 5 up 900 NSS 670 1 5 down - NSS 671 1 5 up 900 NSS 672 1 3 up - 60S ribosomal protein L12 Danio rerio e-124 AY648813.1 673 1 3 up - NADH dehydrogenase subunit 2 (ND2) Cyprinella pyrrhomelas 0.61 AF111227.1 674 1 3 up 6/900 survival motor neuron domain containing 1 Danio rerio 4e-79 BC067338.1
167 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 675 1 3 up 6/900 zgc:110843 Danio rerio 5e-23 NM_001014305.1 676 1 3 Up 6/900 NSS 677 1 3 up 6/900 Seq. from clone RP11-280L17 chr. 9 Homo sapiens 2.2 AL449344.5 678 1 3 Up - NSS 679 1 3 up - Chr. 2L section 68 of 83 Drosophila melanogaster 0.52 AE003659.2 680 1 3 Up - NSS 681 1 3 up - NSS 682a 1 1 up 2/400 Guanylyl cyclase 2e Rattus norvegicus 0.038 NM_024380.1 682b 1 1 up 2/400 Cytochrome c oxidase subunit III gene Carassius auratus 2e-25 AY219843.1 682c 1 1 up 2/400 NSS 683 1 1 up - NSS 684 1 1 Down 6/900 NSS 685 1 1 Down 4/6/900 NSS 686 1 1 Down 4/6/900 BAC clone RP11-264M11 from 2 Homo sapiens 7.4 AC019070.7 687 1 9 up 900 NSS 688 1 9 up - clone DKEYP-86G11 in linkage group 24 Danio rerio 2.2 CR376736.5 689 1 9 down 6/900 Chr. 13 BAC, clone MGS1-4370111 Mus musculus 2.3 AC112163.7 690 1 8 up - 12S ribosomal RNA gene Pimephales promelas stra 2e-35 AF126366.1 691 1 8 up - ribosomal protein S11 Danio rerio e-167 NM_213377.1 692 1 8 up - Myosin light chain 2 Engraulis japonicus 3e-52 AB042053.1 693 1 8 up - zgc:55693 Danio rerio 6e-10 NM_199885.1 694 1 8 Up - Myosin light chain Oncorhynchus kisutch 9.0 AF251130.1 695 1 8 up - Myosin light chain 2 Engraulis japonicus 2e-50 AB042053.1 696 1 7 up 4/6/900 NSS 697 1 7 down 6/900 DNA seq BAC R-11251 of lib RCPI-11 from Homo sapiens 9.4 AL049873.3 chr. 14 698 1 9 up 4/6/900 NSS 699 1 9 up 900 mitochondrial ATP synthase alpha-subunit Cyprinus carpio 1e-35 AB042437.1 700 1 9 up 900 NSS
168 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 701 1 9 up Proportional NSS 702 1 8 up - Myosin light chain 2 Engraulis japonicus 5e-20 AB042053.1 703 1 8 up - Genomic DNA from Chr 8 Oryza sativa 9.0 AP003875.3 704 1 8 up - Cytochrome c oxidase subunit I Notropis photogenis 4e-17 AY116187.1 705 1 8 up 900 NSS 706 1 8 up 900 NSS 707 1 8 down - NSS 708 1 7 up - zgc:56334 Danio rerio 3e-18 NM_199568.1 709 1 7 up - 70kDa protein 12A Mus musculus 9.1 NM_175199.1 710 1 7 up - ATP synthase, H+ transporting, Danio rerio 1e-20 BC076339.1 mitochondrial FO complex, subunit g 711 1 7 up - NSS 712 1 7 up - NSS 713 1 7 up - NSS 714 1 9 down 4/6/900 NSS 715 1 9 Up - Chr. 7 clone RP23-212G1 Mus musculus 9.9 AC136515.3 716 1 9 up - Chr. 6 clone RP23-11G22 Mus musculus 9.3 AC023173.3 717 1 9 up - BAC clone RP11-445N10 from 2 Homo sapiens 8.8 AC079923.5 718 1 13 Down - zgc:92237 Danio rerio <0.0001 NM_001003728.1 719 1 13 Down - zgc:66457 Danio rerio 4e-67 BC079529.1 720 1 13 Down 600/900 NSS 721 1 13 Down 600/900 NSS 722 1 13 Down 900 Skeletal alpha actin Cyprinus carpio 4e-36 D50028.1 723 1 13 Down - Skeletal alpha actin Cyprinus carpio 6e-07 AY395871.1 724 1 13 down 600/900 elastase A mRNA Danio rerio 0.010 AY583322.1 725a 1 12 down 600/900 zgc:92237 Danio rerio 7e-93 NM_001003728.1 725b 1 12 down 600/900 Ribosomal protein L37 Ictalurus punctatus 6e-25 AF401593.1 725c 1 12 down 600/900 DNA from clone CH211-129013 Danio rerio 2e-07 AL928740.6 726 1 12 up - Alpha-tropomyosin Danio rerio <0.0001 NM_131105.2
169 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 727a 1 12 Up - NSS 727b 1 12 Up - zgc:92237 Danio rerio 3e-77 NM_001003728.1 728a 1 12 Down 4/6/900 NSS 728b 1 12 Down 4/6/900 zgc:92237 Danio rerio 5e-88 NM_001003728.1 729a 1 12 up - NSS 729b 1 12 up - zgc:92237 Danio rerio 4e-82 NM_001003728.1 730 1 12 down - NSS 731a 1 11 Up - zgc:92237 Danio rerio 1e-84 NM_001003728.1 731b 1 11 Up - NSS 731c 1 11 Up - clone CH211-205H19 Danio rerio 2e-16 BX120012.24 732 1 11 Up Proportional zgc:91970 Danio rerio 1e-17 BC076550.1 733 1 11 Up - NSS 734 1 11 Up - NSS 735 1 11 Up - Genomic DNA, chr. 18p Homo sapiens 8.7 AP001017.5 736 1 11 Up - Eukaryotic translation elongation factor 1 Danio rerio e-126 AY099512.1 gamma 737 1 11 Up 4/6/900 NSS 738 1 11 up - BAC clone RP24-169N11 from chr. 17 Mus musculus 8.2 AC122422.4 739 1 13 up - 40S ribosomal protein S18 Danio rerio 2e-09 AY099517.1 740 1 13 Up - ribosomal protein L27 Danio rerio e-143 BC045965.1 741 1 13 Up - Myosin light chain 2 Sparus aurata 1e-17 AF150904.1 742 1 13 Up - 3 BAC RP11-166D18 Homo sapiens 2.2 AC016933.20 743 1 13 Down - cDNA clone cieg052g21 Ciona intestinalis 0.14 AK115429.1 744 1 13 Up - NSS 745 1 13 Up - Alpha tropomyosin Danio rerio 1e-17 AF180892.1 746 1 13 up - NSS 747 1 12 Up - NSS 748 1 12 Down 600/900 clone DKEYP-78B1 in linkage group 24 Danio rerio 9e-43 BX322785.6 749 1 12 Down 900 NSS
170 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 750 1 12 Down 900 Ran-binding protein 7 Danio rerio 0.002 AY286403.1 751 1 12 Down 600/900 NSS 752 1 11 Up 900 Eukaryotic translation elongation factor 1 Danio rerio e-119 AY099512.1 gamma 753 1 11 Down - NSS 754 1 11 Up 4/6/900 NSS 755 1 11 Down 4/6/900 NSS 756a 2 19 Variable NSS 756b 2 19 Variable Skeletal alpha actin Cyprinus carpio 1e-51 D50028.1 756c 2 19 Variable Alpha-tropomyosin Danio rerio 4e-39 AF180892.1 757 2 19 down - Ribosomal protein L37a Ictalurus punctatus 9e-74 AF401594.1 758 2 19 down - DC-2000 clone 3 actin gene Abralia sp. 6e-04 AF234941.1 759 2 19 up - eukaryotic translation initiation factor 3 Danio rerio 9e-40 AY648835.1 subunit 4 760 2 17 up 6/900 NSS 761 2 17 up 6/900 NSS 762 2 17 variable - NSS 763 2 17 Down 4/6/900 NSS 764 2 17 down 4/6/900 Clone CH211-160D14 in link grp 17 Danio rerio 8.4 AL928650.5 765 2 17 up 6/900 NSS 766 2 16 up 4/6/900 Alpha-tropomyosin Danio rerio 5e-38 AF180892.1 767 2 16 up - NSS 768 2 16 variable - Alpha-tropomyosin Danio rerio 2e-09 BC062870.1 769 2 16 up - NSS 770a 2 16 up - NSS 770b 2 16 up - Alpha-tropomyosin Danio rerio 5e-38 AF180892.1 771 2 16 up - BUSM1-258D18 in link grp 9 (titin?) Danio rerio 1e-94 AL772356.2 772 2 16 up - CH211-149G8 in link grp 1 Danio rerio 2.1 BX004781.7 773a 2 19 Up - clone CH211-73B10 in linkage group 20 Danio rerio 0.002 CR388421.11
171 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 773b 2 19 Up - Alpha-tropomyosin Danio rerio 1e-38 AF180892.1 774 2 19 Up - Alpha-tropomyosin Danio rerio 6e-38 AF180892.1 775 2 19 Up - NSS 776 2 19 down Proportional NSS 777 2 19 up - eukaryotic translation initiation factor 3 Danio rerio 8e-37 AY648835.1 subunit 4 778 2 19 down - elastase 2 Danio rerio 4e-11 BC042328.1 779 2 17 up 6/900 Alpha-tropomyosin Danio rerio 3e-33 AF180892.1 780 2 17 up - Alpha-tropomyosin Danio rerio 2e-37 AF180892.1 781 2 17 up Proportional NSS 782 2 17 Up - NSS 783 2 17 Up - Alpha-tropomyosin Danio rerio 1e-38 AF180892.1 784 2 17 Up - clone DKEY-16I5 in linkage group 12 Danio rerio 8e-25 BX649366.5 785 2 17 Up - clone IMAGE:7395709 Danio rerio 1e-66 BC092811.1 786 2 17 Up - Beta-fructofuranoside and Lycopersicon esculentum 8.7 AY173050.1 beta-fructofuranosidase genes 787 2 17 Down - NSS 788 2 16 Up 4/6/900 Alpha-tropomyosin Danio rerio 6e-38 AF180892.1 789 2 16 Up 900 BAC clone RP23-239I12 from 17 Mus musculus 8.3 AC122280.4 790 2 16 Down 6/900 ribosomal protein L27 Danio rerio <0.0001 BC045965.1 791 2 16 Down 6/900 Seq from clone RP1-191N21 on chr 6q27 Homo sapiens 8.9 AL031259.1 792 2 16 Down 6/900 ribosomal protein L27 Danio rerio e-124 BC045965.1 793 2 16 down 6/900 NSS 794 2 5 Up 6/900 NSS 795 2 5 Up 6/900 40S ribosomal protein S15 Danio rerio e-151 NM_001001819.1 796 2 5 Up 6/900 NSS 797 2 5 Up 6/900 NSS 798 2 5 up 4/6/900 NSS 799 2 3 Up 900 clone IMAGE:7158960 Danio rerio e-107 BC095863.1
172 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 800 2 3 Down 900 NSS 801 2 3 down 900 NSS 802 2 1 Down Proportional 14kDa apolipoprotein Ctenopharyngodon idella 4e-97 AY445924.1 803 2 1 Down Proportional Fast muscle troponin I mRNA Danio rerio e-133 AF425744.1 804 2 1 Down Proportional Elongation factor 1-alpha mRNA Cyprinus carpio e-146 AF485331.1 805 2 1 Down Proportional Troponin T3a, skeletal, fast Danio rerio 4e-48 NM_131565.1 806 2 1 Down 900 BUSM1-249N21 in link grp 9 Danio rerio 2e-40 AL732421.9 807 2 1 Up 6/900 NSS 808 2 1 up 6/900 NSS 809 2 5 up 6/900 NSS 810 2 5 up 6/900 ribosomal protein S15 Danio rerio 1e-51 BC081516.1 811 2 5 Up 6/900 NSS 812a 2 5 Up 6/900 Clone DKEY-46N18 in link grp 17 Danio rerio 2e-50 AL845481.5 812b 2 5 Up 6/900 Titin Danio rerio 5e-35 AY081167.1 813 2 5 up 6/900 zgc:92226 Danio rerio 0.55 BC085652.1 814 2 3 Down - 60S ribosomal protein L12 Danio rerio 4e-60 AY648813.1 815 2 3 Down - 60S ribosomal protein L12 Danio rerio 4e-79 AY648813.1 816 2 3 down 900 NSS 817 2 1 Down 6/900 14kDa apolipoprotein Ctenopharyngodon idella 3e-92 AY445924.1 818 2 1 Down 6/900 NSS 819 2 1 Down 6/900 Elongation factor 1-alpha mRNA Cyprinus carpio e-174 AF485331.1 820 2 1 Down 900 Seq from clone BUSM1-249N21 in link grp 9 Danio rerio 7e-25 AL732421.9 821 2 1 Down 4/6/900 ribosomal protein S24 Danio rerio 6e-13 BC081494.1 822 2 1 Down 4/6/900 Ribosomal protein S24 Danio rerio e-107 BC081494.1 823 2 1 Up - Elongation factor 1-alpha Cyprinus carpio 4e-79 AF485331.1 824 2 3 Up - Seq from clone CH211-51E12 in link grp 4 Danio rerio 0.003 AL928834.15 825 2 3 Up - NSS 826 2 3 Up - clone IMAGE:7158960 Danio rerio e-101 BC095863.1 827 2 13 Variable - NSS
173 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 828 2 13 variable - Chr 5 clone CTD-2367AII Homo sapiens 8.0 AC008967.3 829 2 12 Up - NSS 830 2 12 down 600 BUSM1-167C3 in link grp 9 Danio rerio 0.002 AL714003.6 831 2 12 up - ribosomal protein S21 Danio rerio 1e-44 BC071475.1 832 2 13 Down - Ribosomal protein L37 mRNA Ictalurus punctatus 2e-34 AF401593.1 833 2 12 Down 4/600 NSS 834 2 12 Down 600 NSS 835 2 12 Up 4/600 NSS 836 2 12 Up 4/600 NSS 837 2 12 Up 2/400-up Clone RP23-442N3 on chr 2 Mus musculus 0.48 AL833808.4 838 2 12 Down 2/400-up NSS 839 2 12 Variable - NSS 840 2 12 Up - NSS 841 2 12 Up 600 NSS 842 2 12 Up 600 NSS 843 2 13 Down - NSS 844 2 13 Down - NSS 845 2 12 Down 4/600 NSS 846 2 12 down 4/600 NSS 847 2 11 Up - NSS 848 2 11 Down 4/6/900 clone CH211-205H19 Danio rerio 0.032 BX120012.24 849 2 11 Up - Mitochondrion Huso huso 0.09 850 2 11 Up - NSS 851 2 11 up 600 NSS 852 2 11 Down - NSS 853 2 11 down - NSS 854 2 11 down - Chr. 16, clone RP24-398M18 Mus musculus 2.3 AC110178.6 855 2 13 down 4/6/900 Ribosomal protein L9 mRNA Danio rerio <0.0001 BC090911.1 856 2 12 Up - Chr 19, clone RP23-426K3 Mus musculus 9.0 AC101735.8
174 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 857 2 12 up - Clone BUSM1-167C3 in link grp 9 Danio rerio 3e-58 AL714003.6 858 2 12 down - NSS 859 2 12 down - NSS 860 2 11 down - NSS 861 2 11 down - clone MGC:112501 IMAGE:7413132 Danio rerio 3e-36 BC095836.1 862 2 11 down - carboxypeptidase B1 Danio rerio 6e-41 BC067637.1 863 2 11 down - NSS 864 2 11 down - NSS 865 3 5 down 4/6/900 Chr 16 clone CTC-496I23 Homo sapiens 2.2 AC134300.3 866a 3 5 up 6/900 ribosomal protein S15 Danio rerio <0.0001 BC081516.1 866b 3 5 up 6/900 NSS 866c 3 5 up 6/900 clone DKEY-31J3 in linkage group 14 Danio rerio 2e-31 BX571981.5 866d 3 5 up 6/900 NSS 867a 3 5 up 6/900 Proteasome subunit beta 7 Danio rerio 3e-70 AF155581.1 867b 3 5 up 6/900 Clone CH211-51E12 in link grp 4 Danio rerio 9e-06 AL928834.15 868 3 5 up 4/6/900 60S ribosomal protein L24 Danio rerio 2e-13 AY099532.1 869 3 5 up 4/6/900 NSS 870 3 5 down - cytochrome oxidase subunit II gene Hemibarbus maculatus 1e-07 AY704455.1 871 3 5 up 4/6/900 Seq from clone RP11-138I18 Homo sapiens 0.51 AL512631.11 872 3 5 up 4/6/900 NSS 873 3 5 up 4/6/900 ATPase Na+/K+ transporting, alpha 1a.1 Danio rerio 3e-05 BC063936.1 polypeptide mRNA 874 3 5 up 4/6/900 Titin Danio rerio 8e-40 AY081167.1 875 3 5 down 900 NSS 876 3 3 down 4/6/900 NSS 877 3 3 down 2/900 Thymosin, beta 4, X chr. Mus musculus 5e-10 NM_021278.1 878 3 3 down Proportional NSS 879 3 3 down - NSS 880 3 3 down 6/900 NSS
175 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 881 3 1 up - Elongation factor 1-alpha mRNA Cyprinus carpio 1e-17 AF485331.1 882 3 1 up - myosin, heavy polypeptide 2, fast muscle Danio rerio 2.0 BC071279.1 specific 883 3 1 down 6/900 NSS 884 3 1 down 4/6/900 BAC clone RP24-469G14 from chr 1 Mus musculus 1.9 AC126670.4 885 3 5 up 200-high Proteasome subunit beta 7 mRNA Danio rerio 7e-68 AF155581.1 886 3 5 down - zgc:73293 Danio rerio 1e-60 BC059619.1 887 3 5 variable 200-high Mitochondrial RNA Sarcocheilichthys 3e-39 AB054124.1 variegatus microoculus 888 3 5 down 900 selenophosphate synthetase 2 Danio rerio 1e-47 BC081590.1 889 3 5 Down 4/6/900 NSS 890 3 5 down 4/6/900 NSS 891 3 3 down 4/6/900 NSS 892 3 3 down - Nucleolar protein 5A, mRNA Danio rerio 1e-29 BC090915.1 893 3 3 down - Mitochondrial DNA Synbranchus marmoratus 8.4 AP004439.1 894 3 3 down - mRNA for beta-thymosin Oncorhynchus mykiss 3e-15 AJ250180.1 895 3 3 down - mRNA for beta-thymosin Oncorhynchus mykiss 2e-13 AJ250180.1 896 3 3 down - mRNA for beta-thymosin Oncorhynchus mykiss 2e-16 AJ250180.1 897a 3 3 down - Mitochondrial DNA Synbranchus marmoratus 6e-04 AP004439.1 897b 3 3 down - NSS 898a 3 1 Down 6/900 S6 ribosomal protein Pagrus major e-102 AY190727.1 898b 3 1 Down 6/900 clone DKEY-31J3 in linkage group 14 Danio rerio 1e-29 BX571981.5 898c 3 1 Down 6/900 ribosomal protein L18a Danio rerio 4e-05 BC049045.1 899 3 1 down 6/900 cytochrome c oxidase subunit II (COXII) gene Sarda sarda 2e-28 AY971771.1 900 3 19 Up 400-higher Alpha tropomyosin Danio rerio 6e-87 BC062870.1 901 3 19 Down - NSS 902 3 17 Up - NSS 903 3 17 up - ubiquinol-cytochrome c reductase core I Oncorhynchus mykiss 1e-32 AF465782.1 protein
176 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 904 3 17 Up - NSS 905 3 17 up - NSS 906 3 17 down 6/900 NSS 907 3 17 up - Seq from clone RP23-336G7 on chr 4 Mus musculus 0.58 AL627251.13 908 3 17 up 4/6/900 BAC clone RP11-321C18 from 2 Homo sapiens 2.3 AC092630.3 909 3 17 up 4/6/900 NSS 910 3 17 Down 4/6/900 NSS 911 3 17 down 4/6/900 NSS 912 3 15 up Proportional Cytochrome b gene Pimephales notatus e-136 U66606.1 913 3 15 down - NSS 914 3 15 down - Clone CTD-3184A7 on chr 20 Homo sapiens 8.5 AL353715.21 915 3 15 down Proportional Similar to chr 20 open reading frame 36 Xenopus laevis 8.1 BC044686.1 916 3 15 down 6/900 NSS 917 3 19 variable - clone RP71-86I11 in linkage group 9 Danio rerio 1e-08 BX640500.10 918 3 19 down 900 Skeletal alpha-actin Cyprinus carpio 1e-57 AY395870.1 919a 3 19 down 6/900 Skeletal alpha-actin Cyprinus carpio 4e-51 AY395870.1 919b 3 19 down 6/900 Chr 10 clone RP11-35101 Homo sapiens 2.3 AC022022.10 920 3 17 down 4/6/900 clone IMAGE:7395709 Danio rerio 8e-99 BC092811.1 921 3 17 down 4/6/900 Chr 5 clone CTC-254B4 Homo sapiens 0.57 AC022103.5 922 3 17 Down 900 NSS 923 3 17 down 900 Chr 8 clone CTD-224208 Homo sapiens 9.4 AC104376.6 924 3 15 down 900 carboxypeptidase B1 Danio rerio 1e-51 BC067637.1 925 3 14 down - Chr 10 seq from clone RP11-282I1 Homo sapiens 8.7 AL357127.17 926 3 14 down - LP65 Lactobacillus plantarum 2.1 AY682195.1 927 3 14 down - Chr 2, BAC clone RP11-220I15 Homo sapiens 2.3 AC062022.6 928 3 14 down 900 NSS 929 3 14 down 900 NSS 930 3 14 down 900 zgc:65840 Danio rerio 0.13 BC058848.1 931 3 8 Down Proportional NSS
177 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 932 3 8 Up 6/900 NSS 933 3 8 down 900 NSS 934 3 12 Up - zgc:92237 Danio rerio e-101 NM_001003728.1 935 3 12 up - zgc:92237 Danio rerio 2e-96 NM_001003728.1 936a 3 12 Down 6/900 zgc:92237 Danio rerio 5e-26 NM_001003728.1 936b 3 12 Down 6/900 clone DKEY-1P9 in linkage group 2 Danio rerio 2.3 BX088713.8 937 3 12 Down 6/900 NSS 938 3 12 down 4/6/900 NSS 939a 3 8 down 6/900 NSS 939b 3 8 down 6/900 clone DKEY-1P9 in linkage group 2 Danio rerio 2.5 BX088713.8 940 3 8 Down 4/6/900 NSS 941 3 8 down 4/6/900 chromosome 3, clone RP24-273H20 Mus musculus 0.15 AC157819.5 942 3 8 up - transportin 3 Danio rerio 3e-12 BC045332.1 943 4 19 Up 4/6/900 clone DKEY-29H15 in linkage group 1 Danio rerio 8.7 CR387998.7 944 4 19 up 900 NSS 945 4 19 Up 4/6/900 NSS 946 4 19 Up 4/6/900 NSS 947 4 19 Up 4/6/900 NSS 948 4 19 up 4/6/900 NSS 949 4 19 up 900 NSS 950 4 19 up Proportional NSS 951 4 19 Down Proportional clone CH211-1O14 in linkage group 5 Danio rerio 0.033 BX530075.7 952 4 19 down Proportional clone CH211-1O14 in linkage group 5 Danio rerio 0.008 BX530075.7 953 4 12 up - NSS 954 4 12 up - rtn4 Danio rerio 4e-14 AY899291.1 955 4 12 Up - NSS 956 4 12 Up - clone DKEY-81L13 in linkage group 5 Danio rerio 2.2 CR932980.11 957 4 12 Up - NSS 958 4 12 down - Clone RP23-3841C11 on chr 2 Mus musculus 8.6 AL808143.5
178 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 959 4 12 Down - NSS 960 4 12 down - NSS 961 4 11 up - NSS 962 4 11 Down - Similar to G7c protein (LOC309611) Rattus norvegicus 8.6 NM_212499.1 963 4 11 Down - phosphoinositide-3-kinase, regulatory subunit, Danio rerio 5e-29 BC081552.1 polypeptide 3 964 4 11 Down - NSS 965 4 11 down - NSS 966 4 11 Up - 12q BAC RP11-916013 Homo sapiens 0.54 AC078873.22 967 4 11 up - NSS 968a 4 19 up 6/900 clone CH211-10K1 in linkage group 14 Danio rerio 9e-06 BX324205.5 968b 4 19 up 6/900 Ribosomal protein L3 mRNA Danio rerio <0.0001 NM_001001590.1 969a 4 19 down 4/6/900 Skeletal alpha actin Cyprinus carpio 2e-59 D50028.1 969b 4 19 down 4/6/900 Skeletal alpha actin Cyprinus carpio 2e-40 D50028.1 969c 4 19 down 4/6/900 NSS 970 4 19 down 900 Chymotrypsinogen B1 Danio rerio e-126 BC055574.1 971a 4 12 Down 4/6/900 Skeletal alpha actin Cyprinus carpio 6e-41 D50028.1 971b 4 12 Down 4/6/900 Forkhead protein FKHR Danio rerio e-173 AF114262.1 972 4 12 up - chromosome 11 clone OSJNBa0072N24 map Oryza sativa 8.9 AC133006.6 C61883S 973a 4 11 down 4/6/900 NSS 973b 4 11 down 4/6/900 NSS 974 4 11 Up - NSS 975 4 11 up - NSS 976 4 11 down 6/900 X map Xp11.23 cosmid contig Homo sapiens 9.3 AF238380.3 977a 4 11 Down 4/6/900 NSS 977b 4 11 Down 4/6/900 Seq from clone DKEY-3708 Danio rerio 1e-15 AL840641.22 977c 4 11 Down 4/6/900 clone DKEY-225F5 in linkage group 3 Danio rerio 3e-12 BX682558.6 977d 4 11 Down 4/6/900 clone CH211-10K1 in linkage group 14 Danio rerio 2e-09 BX324205.5
179 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 978 4 11 down 4/6/900 NSS 979 4 17 up 6/900 zgc:103640 Danio rerio e-100 BC085570.1 980 4 17 Down - chymotrypsinogen B1 Danio rerio 0.58 BC055574.1 981 4 17 up 6/900 NSS 982 4 15 up - 40S ribosomal protein S4, mRNA Ictalurus punctatus 1e-88 AF402812.1 983 4 15 up 900 NADH dehydrogenase subunit 2 gene Hybopsis winchelli 2e-07 AF111233.1 984 4 15 up Proportional NSS 985 4 15 up Proportional chromosome UNK clone CH261-77K20 Gallus gallus 0.57 AC147644.3 986 4 15 Up 4/6/900 PAC clone RP4-725G10 from 7 Homo sapiens 2.2 AC006970.6 987 4 15 Up - NSS 988 4 15 Up 4/6/900 NSS 989 4 15 Up 4/6/900 clone CH211-1O14 in linkage group 5 Danio rerio 1e-66 BX530075.7 990 4 15 Up 2/4/600 NSS 991 4 15 Down - NSS 992 4 15 down - NSS 993 4 14 up 900 NSS 994 4 14 down Proportional sarcoendoplasmic reticulum calcium ATPase Danio rerio 2e-37 AY737278.1 (serca) 995 4 14 up 6/900 NSS 996 4 14 up Proportional NSS 997 4 14 Down 6/900 NSS 998 4 14 down 6/900 partial mitochondrial COI gene for Buthus occitanus 0.036 AJ506912.1 cytochrome oxidase subunit I, haplotype IB5b 999 4 17 down - cDNA clone IMAGE:7395709 Danio rerio 2e-93 BC092811.1 1000 4 17 up - clone IMAGE:7395709 Danio rerio 1e-66 BC092811.1 1001 4 15 up 4/6/900 QM (QM) mRNA Ctenopharyngodon idella e-179 AY762997.1 1002 4 15 down 6/900 NADH dehydrogenase subunit 2 gene Hybopsis winchelli 2e-87 AF111233.1 1003 4 15 up Proportional Seq from clone DKEYP-15G8 Danio rerio 9.1 AL929243.7 1004 4 14 down 900 sarcoendoplasmic reticulum calcium ATPase Danio rerio 4e-48 AY737278.1
180 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. (serca) 1005 4 14 down 900 sarcoendoplasmic reticulum calcium ATPase Danio rerio 9e-06 AY737278.1 (serca) 1006 5 5 Up - BAC clone RP11-674L1 from 2 Homo sapiens 9.1 AC073993.4 1007 5 5 Up - ATP synthase, H+ transporting mitochondrial Danio rerio 3e-64 BC045894.1 FO complex, subunit c 1008 5 5 Up - Mitochondrial DNA Synbranchus marmoratus 0.55 AP004439.1 1009 5 5 Up - clone mth2-46e9 Medicago truncatula 0.54 AC148406.12 1010 5 5 Up - NSS 1011 5 5 up - NSS 1012 5 3 Up 900 NSS 1013 5 3 up - Seq from clone CH211-202H10 Danio rerio 2.1 BX248328.6 1014 5 3 up - NSS 1015 5 3 down - NSS 1016 5 3 down - NSS 1017 5 1 up 6/900 Fast muscle troponin T isoform TnnT3b Danio rerio 9e-77 AF425741.1 1018 5 1 Up 6/900 clone RP11-486O22 on chromosome 10 Homo sapiens 8.8 AL356115.9 1019 5 1 down - NSS 1020 5 1 down - NSS 1021a 5 5 up 4/6/900 Aldolase B Danio rerio <0.0001 AF533646.1 1021b 5 5 up 4/6/900 Proteasome subunit beta 7 Danio rerio 1e-53 AF155581.1 1021c 5 5 up 4/6/900 Chr 16 clone CTD-2583P5 Homo sapiens 2.3 AC109597.3 1022 5 5 up - zgc:66382 Danio rerio e-158 BC055625.1 1023 5 5 up Proportional NSS 1024 5 5 down Proportional clone CH211-276I12 in linkage group 14 Danio rerio 4e-05 CR383676.21 1025 5 5 up 6/900 NSS 1026 5 5 up 4/6/900 Proteasome subunit beta 7 Danio rerio 1e-50 AF155581.1 1027 5 5 up - clone CH211-72A16 in linkage group 3 Danio rerio 5e-35 BX927395.18 1028 5 5 down - clone CH211-72A16 in linkage group 3 Danio rerio 1e-35 BX927395.18
181 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 1029 5 3 down Proportional zgc:77877 Danio rerio <0.0001 BC054669.1 1030 5 3 Down - NSS 1031 5 3 down - reticulon 1 Danio rerio 1e-23 BC052753.1 1032 5 3 Down - clone DKEYP-120E12 in linkage group 11 Danio rerio 8.1 BX537275.8 1033 5 3 Down - clone CH211-244A17 in linkage group 9 Danio rerio 0.035 BX511126.9 1034 5 3 down - NSS 1035 5 1 up 4/6/900 NSS 1036 5 1 down 4/6/900 NSS 1037 5 1 up - Fast muscle troponin T isoform TnnT3b Danio rerio 4e-39 AF425741.1 1038 5 16 down - clone IMAGE:7083922 Danio rerio 5e-69 BC076226.1 1039 5 16 up - zgc:92899 Danio rerio 3e-73 BC076355.1 1040 5 16 down - Seq from clone DKEY-210E13 Danio rerio 2e-31 BX511298.10 1041 5 16 Up - BAC clone CTD-2010B10 from 4 Homo sapiens 7.7 AC093721.3 1042 5 16 up - NSS 1043 5 15 up 6/900 Eukaryotic translation elongation factor 2 Danio rerio 3e-12 AY391422.1 1044 5 15 up - Cytochrome b gene Luxilus cornutus 4e-51 U66597.1 1045 5 15 up 4/6/900 Proteasome 26S subunit Mus musculus 6e-04 BC016433.1 1046 5 15 Up 6/900 NSS 1047 5 15 up 6/900 NSS 1048 5 15 up Proportional 40S ribosomal protein S3a Danio rerio 1e-72 AY648734.1 1049 5 14 down 4/6/900 cytochrome oxidase subunit I Gobiocypris rarus e-121 AY899292.1 1050 5 14 Down - NSS 1051 5 14 Down - NSS 1052 5 14 Down - NSS 1053 5 14 down - clone DKEY-14I6 in linkage group 8 Danio rerio 0.002 CR450778.7 1054 5 14 down 6/900 NSS 1055a 5 15 up 900 ATP synthase 8 and ATP synthase 6 Barbus gurneyi 1e-17 AF287383.1 1055b 5 15 up 900 NSS 1056 5 15 up - NADH dehydrogenase subunit 2 Hybopsis winchelli e-121 AF111233.1
182 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 1057a 5 15 up 4/6/900 mRNA for cathepsin L preprotein Cyprinus carpio e-135 AB128161.1 1057b 5 15 up 4/6/900 Cytochrome b gene Pimephales notatus e-133 U66606.1 1058 5 15 down 900 Stathmin Gallus gallus 7e-34 NM_001001858.1 1059 5 15 down 6/900 Cyclin G1 Danio rerio 7e-06 AY423016.1 1060 5 14 up 6/900 ATP synthase 8 and ATP synthase 6 Barbus gurneyi 6e-13 AF287383.1 1061 5 14 up 4/6/900 Cytochrome b gene Pteronotropes signipinnus 3e-27 AF261230.1 1062 5 14 up 900 BAC clone RP23-297M4 from 5 Mus musculus 0.11 AC125183.4 1063 5 14 up 6/900 ribosomal protein S3A Danio rerio 7e-80 BC059543.1 1064a 6 5 Down - Proteasome subunit beta 7 Danio rerio 1e-56 AF155581.1 1064b 6 5 Down - NSS 1064c 6 5 Down - Titin mRNA Danio rerio 3e-36 AY081167.1 1065 6 5 Down - NSS 1066 6 5 down - Chr. 10 clone RP11-165N2 Homo sapiens 6.7 AC027669.11 1067 6 5 up Proportional clone mth2-46e9 Medicago truncatula 0.40 AC148406.12 1068 6 5 up 6/900 NSS 1069 6 3 Up 4/6/900 NSS 1070 6 3 Up 4/6/900 NSS 1071 6 3 up 4/6/900 NSS 1072 6 3 up 6/900 clone IMAGE:7147104 Danio rerio 6e-34 BC078312.1 1073 6 3 down - NSS 1074 6 3 up 900 chromosome 17, clone RP11-613C6 Homo sapiens 6.6 AC015795.20 1075a 6 1 up Proportional Fast muscle troponin I mRNA Danio rerio e-131 AF425744.1 1075b 6 1 up Proportional projectin Procambarus clarkii 0.41 AB055927.1 1076a 6 1 down - NSS 1076b 6 1 down - fast myosin heavy chain 4 Danio rerio 7e-80 AY921650.1 1077 6 1 down - NSS 1078 6 1 down - genomic DNA, chromosome 1 Oryza sativa 6.3 AP008207.1 1079 6 1 down - NSS 1080 6 1 down - Heat shock cognate 70kDa Carassius auratus 5e-93 AY195744.1
183 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 1081 6 1 down 900 fast myosin heavy chain 4 Danio rerio 3e-57 AY921650.1 1082 6 1 Down - NSS 1083 6 1 Down 4/6/900 NSS 1084 6 1 down 4/6/900 NSS 1085 6 5 up 900 fast myosin heavy chain 4 Danio rerio 2e-67 AY921650.1 1086 6 5 Up 900 fast myosin heavy chain 4 Danio rerio 8e-55 AY921650.1 1087 6 5 up 900 NSS 1088 6 5 up 4/6/900 NSS 1089 6 5 Up 4/6/900 Proteasome subunit beta7 (PSMB7) Danio rerio 7e-34 AF155581.1 1090 6 5 up 4/6/900 Titin mRNA Danio rerio 1e-19 AY081167.1 1091 6 5 up 900 NSS 1092 6 5 Up - Titin mRNA Danio rerio 2e-25 AY081167.1 1093 6 5 up - Titin mRNA Danio rerio 1e-41 AY081167.1 1094 6 5 Up 6/900 Mitochondrial DNA Lamprogrammus niger 1e-10 AP004410.1 1095 6 3 Up 400 fast myosin heavy chain 4 Danio rerio 9e-21 AY921650.1 1096a 6 3 Up 400 NSS 1096b 6 3 Up 400 fast myosin heavy chain 4 Danio rerio 6e-34 AY921650.1 1097 6 3 Up 4/6/900 NSS 1098 6 3 up 4/6/900 Nucleolar protein 5A Danio rerio 6.4 AY423035.1 1099a 6 1 Up - Fast muscle troponin I mRNA Danio rerio 2e-09 AF425744.1 1099b 6 1 Up - fast myosin heavy chain 4 Danio rerio 1e-66 AY921650.1 1099c 6 1 Up - chromosome 11q, clone:RP11-651F18 Homo sapiens 6.2 AP002832.3 1100 6 1 Up - Fast muscle troponin I mRNA Danio rerio e-129 AF425744.1 1101 6 1 up 6/900 Fast muscle troponin I mRNA Danio rerio e-106 AF425744.1 1102 6 1 up 2/400 projectin Procambarus clarkii 0.42 AB055927.1 1103 6 1 Up - Elongation factor 1-alpha Cyprinus carpio 6e-28 AF485331.1 1104 6 1 up - Troponin T3a, fast skeletal muscle Danio rerio 4e-66 BC053304.1 1105 6 1 up 6/900 Fast skeletal muscle troponin T Danio rerio 1e-63 AF180889. 1106 6 1 down - NSS
184 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 1107 6 1 down 900 Fast muscle troponin T isoform TnnT3b Danio rerio 3e-54 AF425741.1 1108 6 5 up proportional fast myosin heavy chain 4 Danio rerio 1e-56 AY921650.1 1109 6 10 Up - Heat shock protein 90-beta Danio rerio 7e-43 AF042108.1 1110a 6 10 up - 3BAC RP11-485H21 Homo sapiens 7.2 AC074269.8 1110b 6 10 up - chromosome 1, clone RP23-395H12 Mus musculus 6.6 AC079134.24 1111 6 unknown zgc:66165 Danio rerio 0.027 BC054654.1 1112 6 unknown Isocitrate dehydrogenase 2 (NADP+) Danio rerio e-109 BC063967.1 1113 6 unknown BAC clone RP24-355K7 from chromosome 6 Mus musculus 0.44 AC132585.3 1114 6 unknown Slow muscle myosin heavy chain Danio rerio e-140 AF425742.1 1115 6 unknown MYH gene for myosin heavy chain Cyprinus carpio 0.007 AB182405.1 1116 6 unknown NSS 1117 6 unknown NSS 1118 6 unknown Lymphocyte enhancer binding factor 1 Danio rerio 1e-04 AF136454.1 1119 6 unknown PAC clone RP4-733B9 from 7 Homo sapiens 0.43 AC005532.2 1120 6 unknown similar to topoisomerase (DNA) III alpha Pan troglodytes 6.2 XM_511324.1 1121 6 unknown NSS 1122 6 unknown mitochondrion Salmo salar 2e-30 AF133701.1 1123 6 unknown NSS 1124 6 unknown NSS 1125 6 unknown NSS 1126 6 unknown NSS 1127 6 unknown Myosin heavy chain Oncorhynchus keta 1.6 AB076182.1 1128a 6 unknown trafficking protein particle complex 6b Danio rerio 2e-33 BC083391.1 1128b 6 unknown NSS 1129 6 unknown FLJ22626-like mRNA Danio rerio 8e-52 AY648738.1 1130 6 unknown NSS 1131 6 unknown NSS 1132 6 unknown NSS 1133 6 unknown chromosome 15, clone RP23-146F23 Mus musculus 6.6 AC113976.13
185 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 1134 6 unknown NSS 1135 6 unknown NSS 1136 6 unknown Isocitrate dehydrogenase 2 (NADP+) Danio rerio 0.097 BC063967.1 1137 6 15 up 6/900 BAC clone RP11-100C21 from 7 Homo sapiens 6.8 AC027269.5 1138 6 15 Up Proportional NSS 1139 6 15 up Proportional zinc finger protein 9 Danio rerio 6.7 BC056793.1 1140 6 15 Down 4/6/900 NSS 1141 6 15 Down - NSS 1142 6 15 Down - NSS 1143 6 15 Down - NSS 1144 6 15 down 4/6/900 Isocitrate dehydrogenase 2 (NADP+) Danio rerio 0.028 BC063967.1 1145 6 7 up - BAC clone RP23-258C20 from 1 Mus musculus 6.9 AC137515.3 1146 6 7 Down - NSS 1147 6 7 down - NSS 1148 6 10 Up 4/6/900 NSS 1149 6 10 Up 4/6/900 slow myosin heavy chain 1 Danio rerio <0.0001 AY921649.1 1150 6 10 Up - Heat shock protein 90-beta Danio rerio 3e-42 AF042108.1 1151a 6 10 up 400 NSS 1151b 6 10 up 400 Slow muscle myosin heavy chain mRNA Danio rerio 5e-81 AF425742.1 1152 6 15 up 4/6/900 Stathmin Gallus gallus 2e-12 NM_001001858.1 1153 6 15 up 4/600 NSS 1154 6 15 up - PAC clone RP5-1091B14 from 7 Homo sapiens 6.7 AC006354.2 1155 6 15 up - cDNA clone IMAGE:7177046 Danio rerio 5e-10 BC093000.1 1156a 6 7 down 6/900 zgc:101710 Danio rerio 0.43 NM_001006068.1 1156b 6 7 down 6/900 Clone OSJNAa0021B21, from chromosome 3 Oryza sativa 6.9 AC146619.1 1157 6 7 down 6/900 NSS 1158 6 15 Up 4/6/900 Selenoprotein T 1b (sept 1b), mRNA Danio rerio 6e-07 NM_178292.3 1159 6 15 Up 4/6/900 BAC clone RP24-512P7 from chr. 8 Mus musculus 0.45 AC134323.3 1160 6 15 Up 4/6/900 PAC clone RP4-733B9 from 7 Homo sapiens 0.43 AC005532.2
186 Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 1161 6 15 down 900 NSS
187 Table 39: A list of the thermal stress candidate bands obtained from the differential display technique, their specific response to heat stress, time period and BLAST identity matches. Seq=sequence number, Anc=anchor primer, Arp=arbitrary primer, response=gene expression response to stressor with “up” denoting up-regulation, “down” denoting down-regulation and “variable” indicating variation in expression of the band, level=time period at which gene expression response was observed, expression=specificity of time interval at which gene itself was expressed, identity=BLAST match, species=species with homologous gene, E-value=expect value of BLAST match and Accession no.=GenBank accession number of homologous gene. If there was no BLAST match for the gene, it was designated as having “no significant similarity” (NSS) in the identity column. Seq Anc Arp Response Level expression Identity Species E-value Accession no. 1162 1 7 Up 48 hr 48-specific Translationally-controlled tumor protein Labeo rohita 3e-80 AY028419.2 1163 1 7 --- 24-higher Heat shock 70kDa protein 12A Mus musculus 8.4 NM_175199.1 1164 1 7 down 24 hr 24-higher Heat shock 70kDa protein 12A Mus musculus 9.0 NM_175199.1 1165 1 7 up 48 hr 48-specific NSS 1166 1 7 up 24/48 Both batches eukaryotic translation initiation factor 2 Danio rerio 1e-51 AY648723.1 gamma 1167 1 7 Up 24/48 Both batches NSS 1168 1 7 up 48 48-specific ribosomal protein S15 Danio rerio 1e-35 BC076221.1 1169 1 5 down 24/48 Both batches Titin Danio rerio 3e-36 AY081167.1 1170 1 3 down 24 hr 24-higher cosmid Y43B11AM Caenorhabditis elegans 8.4 AC025718.2 1171 1 3 up 24/48 24-higher Seq from clone DKEY=209F7 in link. Danio rerio 1.9 BX005260.12 grp 16 1172 1 1 Up 24 24-specific beta A4-crystallin Danio rerio 8e-31 DQ000464.1 1173 1 1 Up 24 24-specific NSS 1174 1 1 Up 24 24-specific NSS 1175 1 1 Up 24 24-specific NSS 1176 1 1 up 24 24-specific Seq from clone BUSM1-249N21 in link. Danio rerio 5e-17 AL732421.9 grp. 9, similar to titin 1177 1 1 -- 24-higher mitochondrial DNA Carassius auratus 5e-60 AB111951.1 1178 1 1 Up-24 24/48 Both batches NSS Down-48 24/48 1179 1 3 up 24 24-specific clone CH211-198N5 in linkage group 8 Danio rerio 2.2 CR759968.6
188 Seq Anc Arp Response Level expression Identity Species E-value Accession no. 1180 1 5 Up 24 24-higher Mitochondrial ATP synthase c-subunit Cyprinus carpio 0.002 AB078926.1 precursor 1181a 1 5 up 24 24-higher ATP synthase H+ transporting Danio rerio e-112 BC045894.1 mitochondrial FO complex, subunit c 1181b/ 1 5 up 24 24-higher NSS 1182 1 5 up 24 24-higher PAC clone RP4-683L10 from 14q24.3 Homo sapiens 8.8 AC005226.1 1183 1 5 up 24 24-specific NSS 1184 1 5 down 24/28 Both batches Titin Danio rerio 1e-20 AY081167.1 1185 1 5 up 24 Both batches NSS 1186 1 5 variable Both batches NSS 1187 1 7 up 24/48 Both batches NSS 1188 1 7 up 48 Both batches NSS 1189 1 7 variable Both batches aldolase B Danio rerio e-106 AF533646.1 1190 1 1 up 24 24-specific Ribosomal protein L3 Danio rerio 9e-06 BC091460.1 1191 1 1 up 24 24-specific chromosome 10 clone RP11-134O16 Homo sapiens 0.55 AC079955.9 1192 1 1 up 24 24-specific NSS 1193 1 1 up 24 24-specific NSS 1194 1 1 up 24 Both batches NSS Down 48 1195 1 7 up 48 48-specific Translationally-controlled tumor protein Labeo rohita 1e-79 AY028419.2 1196 1 7 up 48 48-specific NSS 1197 1 5 up 24 24-specific ribosomal protein L18a Danio rerio e-103 BC049045.1 1198 1 5 Up 24 24-specific ribosomal protein L18a Danio rerio e-111 BC049045.1 1199a 1 5 Up 24 Both batches ribosomal protein L18a Danio rerio e-100 BC049045.1 1199b 1 5 Up 24 Both batches Zgc:56334 Danio rerio 2.1 BC046083.1 1199c 1 5 Up 24 Both batches NSS 1200 1 5 up 24 24-specific clone DKEY-53D3 in link grp 22 Danio rerio 2e-31 BX322657.13 1201 1 3 Up 48 48-specific NSS 1202 1 3 up 48 48-specific ribosomal protein L18a Danio rerio 2e-99 BC049045.1
189 Seq Anc Arp Response Level expression Identity Species E-value Accession no. 1203 1 3 up 24/48 Both batches clone DKEY-218L8 in linkage group 19 Danio rerio 2e-47 CR631129.10 1204 1 3 down 24 Both batches ribosomal protein L18a Danio rerio e-111 BC049045.1 1205 1 3 --- 48-specific NSS 1206 1 3 down 24 Both batches zgc:55941 Danio rerio 2e-31 BC065885.1 1207a 1 1 down 24/48 Both batches zgc:55941 Danio rerio 5e-26 BC065885.1 1207b 1 1 down 24/48 Both batches Elongation factor-1 alpha Carassius auratus 2e-25 AB056104.1 1208 1 1 up 24 24-specific NSS 1209 1 1 Up 24 24-specific Fast muscle troponin T isoform TnnT3b Danio rerio 4e-08 AF425741.1 1210 1 1 up 24 24-specific NSS 1211a 1 15 -- 48-specific Stathmin-like mRNA Oreochromis 3e-09 AY522581.1 mossambicus 1211b 1 15 -- 48-specific Cytochrome b gene Pimephales notatus e-123 U66606.1 1211c 1 15 -- 48-specific clone DKEY-218L8 in linkage group 19 Danio rerio 6e-47 CR631129.10 1211d 1 15 -- 48-specific Seq from clone RP11-565A2 on chr. 6 Homo sapiens 9.5 AL607079.7 1212 1 15 up 24/48 24-higher NSS 1213 1 15 up 24 24-specific NSS 1214 1 15 up 24 24-specific Carboxypeptidase B Paralichthys olivaceus 1e-22 AB099302.1 1215 1 15 up 24/48 Both batches NSS 1216 1 15 up 24/48 Both batches NSS 1217 1 15 up 24 24-higher ribosomal protein S3A Danio rerio 3e-48 BC059543.1 1218 1 15 Up 24 24-specific 2-peptidylprolyl isomerase A Danio rerio 1e-04 AY391452.1 1219 1 15 up 24 24-specific 2-peptidylprolyl isomerase A Danio rerio 8e-09 AY391452.1 1220 1 15 Up 24 24-specific NSS 1221 1 15 Up 24 24-specific BAC clone RP11-722I12 from 2 Homo sapiens 7.3 AC105054.6 1222 1 15 up 24 24-specific clone RP23-354J21 on chr. X Mus musculus 7.2 BX936351.12 1223 1 15 Down 24 Both batches NSS 1224 1 15 down 24 Both batches NSS 1225 1 10 Up 48 Both batches Desmin Danio rerio 9e-77 BC092715.1 1226 1 10 up 48 Both batches Desmin Danio rerio 3e-92 BC092715.1
190 Seq Anc Arp Response Level expression Identity Species E-value Accession no. 1227 1 10 variable Both batches NSS 1228 1 10 up 24 24-higher Guanine nucleotide binding beta Danio rerio 1e-23 AY423038.1 polypeptide 2-like 1 1229 1 10 up 24 Both batches zgc:92237 Danio rerio e-106 NM_001003728.1 1230 1 10 up 24 Both batches NSS 1231 1 10 up 24 Both batches NSS 1232 1 10 up 24 Both batches clone RP23-186F24 on chromosome 4 Mus musculus 5.3 AL669965.13 1233 1 10 up 24 24-specific NSS 1234 1 10 up 24 24-specific NSS 1235 1 2 down 24 24-specific NSS 1236 1 2 down 24 24-specific Keratin 18 Danio rerio 4e-14 BC065848.1 1237 1 2 up 24 24-specific Laminin receptor 1 Danio rerio 3e-09 AY391434.1 1238 1 2 up 24 Both batches NSS 1239 1 2 up 24/48 Both batches Basigin Danio rerio 8.1 BC065623.1 1240 1 2 down 48 Both batches NSS 1241 1 2 up 48 48-specific NSS 1242 1 2 up 48 48-higher NSS 1243 1 2 up 48 48-higher NSS 1244 1 2 up 48 48-higher Clone RK053A1H09 voltage-dependent Danio rerio 6e-10 AY394955.1 anion channel 2 1245 1 2 up 24 24-specific NSS 1246 1 2 up 24 24-specific NSS 1247 1 2 down 24 Both batches Gamma-crystallin Cyprinus carpio 3e-08 X12903.1 1248 1 2 up 24/48 Both batches NSS 1249 1 15 up 24 24-higher Eukaryotic translation elongation factor 2 Danio rerio 4e-04 AY391422.1 1250a 1 15 up 24 Both batches Fast skeletal myosin light chain 3 Cyprinus carpio e-143 D85141.1 1250b 1 15 up 24 Both batches NSS 1251 1 14 up 48 48-specific Seq from clone DKEY-57C15 in grp 22 Danio rerio 7e-06 BX511034.11 1252 1 14 down 48 Both batches Chr 1 genomic DNA Lotus corniculatus 0.12 AP006107.1
191 Seq Anc Arp Response Level expression Identity Species E-value Accession no. 1253 1 14 down 48 Both batches NSS 1254 1 2 Up 24/48 Both batches NSS 1255 1 2 up 24/48 Both batches NSS 1256a 1 15 down 24/48 48-higher Seq from clone RP71-34G2 in link grp 7 Danio rerio 1e-19 AL928906.4 1256b 1 15 down 24/48 48-higher Cytochrome b gene Pimephales notatus e-137 U66606.1 1256c 1 15 down 24/48 48-higher Seq from clone CH211-255F4 in link Danio rerio 2e-40 AL954741.9 grp 22 1257 1 15 up 48 48-specific NSS 1258a 1 15 down 24/48 48-higher Seq from clone RP11-192G4 on chr 1 Homo sapiens 0.1 AL356059.27 1258b 1 15 down 24/48 48-higher Seq from clone CH211-133L21 in link Danio rerio 1e-10 BX323873.9 grp 19 1259 1 15 up 24 Both batches Fast skeletal myosin light chain Cyprinus carpio e-141 D85141.1 1260a 1 15 up 24 Both batches NSS 1260b 1 15 up 24 Both batches 16S ribosomal gene Aphanius dispar dispar 2e-27 AF449330.1 1261 1 14 down 48 Both batches Zgc:63836 Danio rerio 0.1 BC058072.1 1262 1 14 down 48 Both batches NSS 1263a 1 10 down 24/48 Both batches Eukaryotic translation initiation factor3, Danio rerio 3e-51 BC057465.1 subunit 8 1263b 1 10 down 24/48 Both batches Seq from clone CH211-133L21 in link Danio rerio 6e-12 BX323873.9 grp 19 1264 1 10 down 24 Both batches Retinol-binding protein 2, cellular Danio rerio 5e-90 BC062286.1 1265 1 10 down 24 Both batches Collagen, type I, alpha 3 Danio rerio E<0.000 NM_201478.1 1266 1 10 up 24 24-specific NSS 1267 1 2 down 24 Both batches NSS 1268 1 2 -- 24-specific Genomic DNA, chr. 1 Lotus japonicus 6.4 AP006123.1 1269 1 2 up 24 Both batches NSS 1270 1 2 -- 24-higher 1271 2 5 Up 48 Both batches NSS 1272 2 5 -- 48-specific NSS
192 Seq Anc Arp Response Level expression Identity Species E-value Accession no. 1273 2 3 down 48 48-specific Seq from clone BUSM1-249N21 in link Danio rerio 2e-49 AL732421.9 grp 9, similar to titin 1274 2 3 down 48 - NSS 1275 2 1 up 48 Both batches 12 PAC RP1-267L14 Homo sapiens 6.5 AC073575.30 1276 2 1 up 24/48 Both batches NSS 1277 2 1 down 48 48-specific NSS 1278 2 5 up 48 Both batches Genomic DNA from clone Danio rerio 1e-41 BC071386.1 1279 2 5 down 48 Both batches Genomic DNA Saccharomyces 6.6 X79489.1 cerevisiae 1280 2 1 up 24/48 Both batches 12S ribosomal gene Luxilus chrysocephalus E<0.000 AY216540.1 1281 2 1 down 48 Both batches Elongation factor-1 alpha Cyprinus carpio 5e-35 AF485331.1 1282 3 11 up 24/48 Both batches Zgc:55564 Danio rerio e-114 BC045386.1 1283 3 11 up 24/48 Both batches NSS 1284 3 11 up 24/48 24-higher Chr 1 clone RP11-67L3 Homo sapiens 0.43 AC096536.2 1285a 3 11 up 24/48 Both batches NSS 1285b 3 11 up 24/48 Both batches Translation elongation factor 1 gamma Danio rerio e-117 AY099512.1 1286 3 11 down 24 Both batches NSS 1287 3 11 up 24/48 Both batches Translation elongation factor 1 gamma Danio rerio e-119 AY099512.1 1288 3 11 down 24 24-specific Translation elongation factor 1 gamma Danio rerio e-119 AY099512.1 1289 3 11 up 48 Both batches NSS 1290 3 11 up 48 Both batches Chr 4 genomic DNA Oryza sativa 6.2 AL731589.3 1291 3 11 up 24/48 Both batches NSS 1292 3 11 up 24 Both batches NSS 1293 3 11 up 24 24-specific NSS 1294 3 11 up 24 24-specific NSS 1295 3 11 up 24/48 Both batches 12S ribosomal gene Lepidomeda vittata 0.006 AF023191.2 1296 3 11 Down 24 24-specific Seq from clone DKEY-15N1 in link grp 3 Danio rerio 5.9 BX324157.4 1297 3 11 down 24 24-specific NSS 1298 3 11 up 24/48 Both batches NSS
193 Seq Anc Arp Response Level expression Identity Species E-value Accession no. 1299 3 10 Up 24 Both batches Intermediate filament protein type II Carassius auratus 1e-96 M87773.1 keratin 1300a 3 10 down 24/48 Both batches Intermediate filament protein type II Carassius auratus 4e-69 M87773.1 keratin 1300b 3 10 down 24/48 Both batches Genomic DNA from clone Danio rerio 5e-93 BC065473.1 1301a 3 10 up 24/48 Both batches Ribosomal protein L32 Epinephalus coioides 2e-89 AF450502.1 1301b 3 10 up 24/48 Both batches NSS 1302 3 10 down 48 Both batches Cellular apoptosis susceptibility protein Oreochromis niloticus 3e-08 AF547173.1 1303 3 10 up 24 Both batches Clone mth2-26b8 Medicago trunculata 6.1 AC134967.1 1304 3 10 up 24 Both batches NSS 1305 3 10 down 24 24-specific Seq from clone DKEY-104N21 in link Danio rerio 2e-24 BX323874.4 grp 16 1306 3 10 Down 24 Both batches Seq from clone CH211-51F10 in link Danio rerio 8e-21 BX510994.6 grp 19 1307 3 10 up 24 24-specific NSS 1308 3 10 down 24 Both batches NSS 1309 3 10 down 24 Both batches NSS 1310 3 10 up 24/48 Both batches NSS 1311a 3 4 down 24/48 Both batches Crystallin, beta A1 Xenopus laevis 5e-04 BC053794.1 1311b 3 4 down 24/48 Both batches Zgc:77704 Danio rerio 1e-32 BC063972.1 1312a 3 4 up 24/48 Both batches Crystallin, beta A1 Xenopus laevis 0.11 BC063972.1 1312b 3 4 up 24/48 Both batches Ribosomal protein L13 Danio rerio e-139 AY561516.1 1313 3 4 down 24/48 Both batches Myosin light chain 2 Danio rerio e-117 AY057074.1 1314 3 4 up 48 Both batches Seq from clone CH211-207E14 in link Danio rerio 9e-18 AL954678.8 grp 9 1315 3 4 up 24/48 Both batches NSS 1316 3 4 down 24/48 Both batches NSS 1317 3 4 down 24/48 Both batches Seq from clone BUSM1-167L3 in link Danio rerio 8e-12 AL714003.6 grp 9
194 Seq Anc Arp Response Level expression Identity Species E-value Accession no. 1318 3 4 down 24/48 Both batches NSS 1319 3 4 up 24/48 Both batches NSS 1320 3 4 up 24/48 24-higher NSS 1321 3 4 down 24/48 Both batches NSS 1322 3 4 down 24/48 Both batches NSS 1323 3 4 down 24/48 24-lower Hypothetical protein FLJ22419 Homo sapiens 0.38 BC007212.1 1324 3 4 down 24/48 48-higher NSS 1325 3 2 -- 48-higher Seq from clone DKEY-53H9 Danio rerio 0.44 AL929596.11 1326 3 2 up 24/48 Both batches NSS 1327 3 2 Up 24 both batches Type I cytokeratin Danio rerio 1e-22 AF084461 1328 3 2 up 24 Both batches NSS 1329 3 2 Up 48 Both batches NSS 1330 3 2 up 48 Both batches NSS 1331 3 2 up 24/48 Both batches Zgc:56171 Danio rerio e-101 BC045965.1 1332 3 2 down 24 Both batches cDNA clone Danio rerio 1e-13 BC071312.1 1333 3 2 up 24/48 Both batches Intestinal bacterium A97 16S ribosomal Oncorhynchus mykiss 5e-50 AY374113.1 RNA gene 1334 3 2 up 48 Both batches BAC clone RP11-560P13 from 2 Homo sapiens 0.42 AC105396.2 1335 3 2 up 48 Both batches ATPase Na+/K+ transporting alpha1a.1 Danio rerio 4e-41 BC045283.1 polypeptide 1336 3 2 Up 24/48 Both batches Clone DJ0514A23 Homo sapiens 6.3 AC004828 1337 3 2 up 24/48 Both batches NSS 1338 3 2 up 48 48-specific NSS 1339 3 10 down 24 24-specific Hypothetical protein Xenopus laevis 8e-12 BC054286.1 1340 3 10 up 48 Both batches Glutamic acid decarboxylase isoform 65 Carassius auratus 7e-40 AF149834.1 1340 down 24 Both batches 1341 3 11 up 24/48 Both batches NSS 1342 3 11 down 24/48 Both batches Clone DKEY-31N5 Danio rerio 6e-53 AL929222.6 1343 3 11 down 48 48-specific NSS
195 Seq Anc Arp Response Level expression Identity Species E-value Accession no. 1344 3 11 -- 48-specific DNA seq from clone RP11-213D2 on Homo sapiens 0.03 AL512636.12 chr 6 1345 3 11 -- 48-specific PAC clone RP4-630C24 Homo sapiens 0.44 AC004690.2 1346 3 11 down 24 Both batches BAC clone RP24-349M24 on chr. 12 Mus musculus 1.8 AC124398.4 1347a 3 11 down 24 Both batches Unsuccessful 1347b 3 11 down 24 Both batches Seq from clone DKEY-243E1 in link Danio rerio 6e-16 BX005423.9 grp 8 1347c 3 11 down 24 Both batches 3D7 chr. 10 section 5 of 7 Plasmodium falciparum 0.44 AE014833.1 1348 3 11 up 24 Both batches cDNA clone seq Danio rerio 3e-91 BC065887.1 1349 3 11 up 24 Both batches Seq from clone DKEYP-84F11 in link Danio rerio 2e-06 BX890617.13 grp 19 down 48 Both batches 1350 3 11 up 24 Both batches NSS 1351 3 11 down 24/48 Both batches NSS 1352 3 11 up 48 48-specific RK058A2C12 eukaryotic translation Danio rerio e-118 AY394968.1 elongation factor 1 gamma 1353 3 11 up 48 Both batches Clone seq RP11-111G7 on chr 13 Homo sapiens 6.9 AL136438.10 1354 3 11 up 48 Both batches BAC clone RP24-315E7 on chr 6 Mus musculus 1.7 AC122468.3 1355 3 11 up 24 Both batches Genomic DNA. Chr. 5 Arabidopsis thaliana 6.7 AB008264.1 1356 3 10 down 24 Both batches Seq from clone DKEY-31N5 Danio rerio 2e-80 AL929222.6 1357 3 10 up 24/48 Both batches Desmin Danio rerio e-128 U47113.2 1358 3 10 up 24/48 Both batches Intermediate filament protein type II Carassius auratus e-115 M87773.1 keratin 1359 3 10 down 48 Both batches NSS 1360 3 10 Up 24/48 Both batches Heat shock protein 90-beta Danio rerio 7e-40 AF042108.1 1361 3 10 up 24/48 48-higher Ribosomal protein L32 Epinephelus coiodes 3e-91 AF042108.1 1362 3 10 up 24/48 Both batches NSS 1363 3 10 down 24 24-specific Hypothetical protein Xenopus laevis 1e-07 BC054286.1
196 Seq Anc Arp Response Level expression Identity Species E-value Accession no. 1364 3 10 up 24 24-specific LP04242 Drosophila 1.7 AY118602.1 melanogaster 1365 3 10 down 24 Both batches NSS up 48 Both batches 1366 3 10 down 24 Both batches Chr 11 clone RP11-692M12 Homo sapiens 6.9 AC021443.27 up 48 Both batches 1367 3 4 down 24/48 Both batches Clone DKEY-31N5 Danio rerio 1e-38 AL929222.6 1368 3 4 Variable Both batches proteasome (prosome, macropain) 26S Danio rerio E<0.000 BC049471.11 subunit, ATPase, 1
1369 3 4 variable Both batches zgc:64156 Danio rerio e-136 BC057434.1 1370 3 4 down 24/48 Both batches Zgc:77704 Danio rerio 1e-44 BC063972.1 1371 3 4 up 24/48 Both batches Ribosomal protein L13 Danio rerio e-140 AY561516.1 1372 3 4 down 24/48 Both batches Myosin heavy chain mRNA Cyprinus carpio 1e-50 AB104623.1 1373 3 4 up 24 Both batches RK121A4C07 eukaryotic translation Danio rerio 0.027 AY398339.1 elongation factor 1 beta 2 1374 3 2 down 24 Both batches Bad reaction 1375 3 2 down 24/48 Both batches NSS 1376 3 2 down 24/48 Both batches Bad reaction 1377 3 11 down 24 24-higher Elongation factor-1 gamma Carassius auratus 2e-18 AB056105.1 1378 3 7 down 24/48 Both batches Bad reaction 1379a 3 7 down 48 48-specific Bad reaction 1379b 3 7 down 48 48-specific SEC61 gamma Harpagifer antarcticus 7e-34 AY258259.1 1380 3 7 down 48 Both batches NSS 1381 3 7 up 24/48 Both batches NSS 1382 3 7 Up 48 both batches BAC clone RP23-276H4 from chr. 10 Mus musculus 1.6 AC122810.4
1383 3 5 up 24/48 Both batches Heat shock cognate 70kDa protein Carassius auratus E<0.000 AY195744.1 gibelio
197 Seq Anc Arp Response Level expression Identity Species E-value Accession no. 1384 3 5 up 24/48 Both batches BAC clone RP24-171F12 on chr. 7 Mus musculus 7.1 AC127683.10 1385 3 5 up 24 Both batches ATPase Na/K transporting alpha1a.1 Danio rerio 1e-04 BC045283.1 polypeptide 1386 3 5 up 24/48 Both batches ATPase Na/K transporting alpha1a.1 Danio rerio 1e-47 BC045283.1 polypeptide 1387 3 5 up 48 48-specific NSS 1388 3 1 up 24/48 Both batches NSS 1389a 3 7 up 48 48-specific Clone DKEY-12H2 in link grp 20 Danio rerio 7.2 BX649298.7 1389b 3 7 up 48 48-specific mRNA for growth hormone Ctenopharyngodon 7e-34 X60474.1 idellus 1390 3 7 up 48 Both batches NSS 1391 3 7 down 24/48 Both batches NSS 1392 3 5 down 24/48 Both batches NSS 1393 3 7 up 24/48 Both batches NSS 1394 3 7 down 48 48-specific Clone BUSM1-167C3 in link grp 9 Danio rerio 1.6 AL714003.6 1395 3 7 down 24 Both batches mRNA for growth hormone C. idellus 2e-09 X60474.1 1396 3 7 up 24/48 Both batches SEC61 gamma Harpagifer antarcticus 3e-42 AY258259.1 1397 3 5 up 24/48 Both batches Heat shock cognate 70kDa protein Carassius auratus E<0.000 AY195744.1 gibelio 1398 3 5 up 24/48 Both batches Proteasome subunit beta 7 Danio rerio 5e-26 AF155581.1 1399 3 5 down 48 Both batches Clone CH211-247B3 in link grp 19 Danio rerio 7.4 BX322540.5 1400 3 5 up 24 Both batches Proteasome subunit beta 7 Danio rerio 2e-59 AF155581.1 1401 3 5 up 24/48 Both batches Proteasome subunit beta 7 Danio rerio 6e-50 AF155581.1 1402 3 5 up 24/48 Both batches ATP synthase H+ transporting, Danio rerio 1e-35 NM_131761.1 mitochondrial FO complex, subunit c 1403 3 3 down 24 24-specific NSS 1404a 3 3 down 24 24-specific CH211-167P9 in link grp 21 Danio rerio 0.029 AL772368.5 1404b 3 3 down 24 24-specific SEC61 gamma Harpagifer antarcticus 2e-37 AY258259.1 1405 3 3 down 24 24-specific BAC clone RP24-374020 on chr 7 Mus musculus 7.4 AC123053.4
198 Seq Anc Arp Response Level expression Identity Species E-value Accession no. 1406 3 3 -- 24-specific 12 BAC RP11-753B7 Homo sapiens 7.0 AC069262.24 1407 3 3 up 24 Both batches Intermediate filament protein type II Carassius auratus 6e-16 M87773.1 keratin 1408 4 16 down 24/48 Both batches NSS 1409 4 16 down 24/48 Both batches Clone RALU #16 Alu repeat seq Labeo rohita 0.007 AF432920.1 1410 4 16 down 24/48 Both batches NSS 1411 4 16 down 24/48 Both batches Retinol binding protein 1, cellular Danio rerio 1e-04 BC066514.1 1412 4 16 up 24/48 Both batches NSS 1413 4 16 down 24/48 Both batches Xp BAC RP11-702C7 Homo sapiens 6.4 AC079178.20 1414 4 15 down 24/48 Both batches NSS 1415 4 15 down 24/48 Both batches NADH dehydrogenase subunit 2 Hybopsis winchelli 2e-31 AF111233.1 1416 4 15 down 24/48 Both batches NSS 1417 4 13 up 24 24-specific NSS 1418 4 13 up 24/48 Both batches Ribosomal protein L9 Danio rerio e-108 AY141976.1 1419 4 13 up 24/48 24-higher Clone CH211-132M19 in link grp 21 Danio rerio 8e-06 BX510931.8 1420 4 13 up 24/48 Both batches IP4/PIP3 binding protein-like protein Lapemis hardwicki 0.45 AF165226.1 mRNA 1421 4 13 up 24/48 Both batches BAC clone RP23-381E19 Mus musculus 7.4 AC124515.4 1422 4 13 up 24/48 Both batches Skeletal alpha-actin Cyprinus carpio 8e-83 D50028.1 1423 4 9 down 48 Both batches NSS 1424 4 16 -- 24 24-specific Clone R2151A2B11 muscle cofilin 2 Danio rerio 2e-40 AY398324.1 1425 4 13 up 24 24-specific Heat shock protein 90 alpha Cyprinus carpio e-140 AF170295.2 1426 4 13 up 24/48 24-higher NSS 1427 4 13 up 24/48 24-higher Clone CH211-132M19 in link grp 21 Danio rerio 5e-04 BX510931.8 1428 4 13 up 24 24-specific Clone CH211-132M19 in link grp 21 Danio rerio 8e-06 BX510931.8 1429 4 4 up 24/48 Both batches Cosmid F58F6 Caenorhabditis elegans 0.48 AF036699.2 1430 4 4 down 24/48 Both batches Prostaglandin G/H synthase 2 mRNA Danio rerio 2e-46 AY028585.1 1431 4 4 down 24/48 24-higher Clone DKEYP-47D4 in link grp 20 Danio rerio 7.4 BX321888.21 1432 4 4 up 24/48 Both batches NSS
199 Seq Anc Arp Response Level expression Identity Species E-value Accession no. 1433 4 4 up 48 Both batches NSS 1434 4 4 down 24/48 Both batches NSS 1435 4 3 up 48 Both batches NSS 1436 4 2 down 24/48 Both batches Myosin regulatory light chain Cyprinus carpio E<0.000 AB037014.1 1437 4 2 up 24/48 Both batches Complement C3 mRNA Ctenopharyngodon 1e-93 AY374472.1 idella 1438 4 2 up 24 Both batches Chymotrypsinogen B1 Danio rerio 6e-16 BC055574.1 1439 4 2 up 24/48 Both batches NSS 1440 4 1 up 24/48 48-higher NSS 1441 4 1 down 24 Both batches NSS 1442 4 1 up 24 24-specific NSS 1443 4 1 down 24/48 Both batches Clone CH211-222E23 Danio rerio 6.3 BX537337.9 1444 4 2 down 24/48 Both batches 12 PAC RP23-454B23 Homo sapiens 0.49 AC005845.1 1445 4 2 down 24/48 Both batches NBRP Xenopus laevis 2e-06 BP687865.1 1446 4 1 up 24/48 Both batches Heat chock cognate 70kDa Carassius auratus E<0.000 AY195744.1 gibelio 1447 4 1 down 24/48 Both batches NSS 1448 4 1 up 48 Both batches Elongation factor-1-alpha mRNA Cyprinus carpio 8e-43 AF485331.1 1449 4 1 down 24/48 Both batches NSS 1450 4 1 up 48 Both batches Keratin 18 Danio rerio 4e-91 BC065848.1 1451a 4 4 up 48 Both batches Chymotrypsinogen B1 Danio rerio 1e-14 BC055574.1 1451b 4 4 up 48 Both batches Clone CH211-10K1 in link grp 14 Danio rerio 3e-11 BX324205.5 1452 4 4 -- 48-specific Clone DKEYP-113D7 in link grp 19 Danio rerio 8e-43 BX323079.1 1453 4 4 up 24/48 Both batches Cosmid F58F6 Caenorhabditis elegans 0.49 AF036699.2 1454a 4 3 up Both batches NSS 1454b 4 3 up Both batches Clone CH211-10K1 in link grp 14 Danio rerio 4e-04 BX324205.5 1455 5 4 up 24/48 Both batches NSS 1456 5 4 Up 24/48 24-higher BAC clone RP43-171M24 from 7 Pan troglodytes 5.7 AC147382.3 1457 5 4 up 24/48 24-higher Clone RP1-28010 on chr 1q32.3-41 Homo sapiens 6.0 HS28010.1
200 Seq Anc Arp Response Level expression Identity Species E-value Accession no. 1458 5 3 down 24/48 Both batches cDNA clone IMAGE:6961353 Danio rerio 2e-46 BC067631.1 1459 5 3 down 24/48 Both batches NSS 1460 5 3 down 48 48-specific NSS 1461 5 3 up 48 48-specific NSS 1462 5 2 Down 24/48 Both batches NSS 1463 5 2 down 24/48 Both batches Glutathione S-transferase pi mRNA Danio rerio 2e-70 AF285098.1 1464 5 2 up 48 Both batches Complement C3 mRNA Ctenopharyngodon 2e-83 AY374472.1 idella 1465 5 2 down 24/48 48-lower NSS 1466a 5 2 down 24 Both batches Clone seq Danio rerio 1e-10 BX323079.7 1466b 5 2 down 24 Both batches Chr 19 clone Homo sapiens 6.2 AC011455 1467 5 2 up 24 Both batches NSS 1468 5 2 down 24/48 24-lower NSS 1469a 5 1 down 24/48 Both batches Fast muscle troponin I mRNA Danio rerio e-121 AF425744.1 1469b 5 1 down 24/48 Both batches Elongation factor 1-alpha Cyprinus carpio 3e-79 AF485331.1 1470 5 1 down 24/48 Both batches Hypothetical protein MGC76205 Xenopus laevis 6.6 BC064238.1 1471 5 1 up 24/48 Both batches NSS 1472 5 1 down 24 Both batches Chr 18 clone RP11-183C12 Homo sapiens 1.5 AP005403.3 1473 5 4 up 48 48-specific NSS 1474 5 4 down 24 Both batches Zgc:56380 Danio rerio e-136 NM_200951.2 1475 5 4 up 48 Both batches Clone RP71-1N18 in link grp 22 Danio rerio 1e-13 AL645755.20 1476 5 4 down 48 48-specific NSS 1477 5 4 down 24/48 Both batches Aminopeptidase P AP-P Caenorhabditis elegans 1.6 NM_071761.2 1478 5 4 down 24/48 Both batches NSS 1479 5 4 down 24/48 Both batches 28S ribosomal RNA Anomotarus chauoiri 6.5 AF438019.1 1480 5 4 down 24/48 Both batches Clone RP23-21L20 on chr. X Mus musculus 6.7 BX088567.6 1481 5 4 Down 24/48 Both batches NSS 1482 5 4 down 24/48 Both batches NSS 1483 5 4 down 24/48 Both batches NSS
201 Seq Anc Arp Response Level expression Identity Species E-value Accession no. 1484 5 4 down 24 Both batches TW-183 section ¼ Chlamydophila 6.6 AE017157.1 pneumoniae 1485 5 3 down 48 Both batches Adenosyl homocysteinase Medicago trunculata 0.11 AY224188.1 1486 5 3 down 48 Both batches Zgc:77825 Danio rerio 1e-41 BC065875.1 1487 5 3 Down 48 Both batches clone IMAGE:6961353 Danio rerio 9e-58 BC067631.1 1488 5 3 down 48 Both batches clone IMAGE:6961353 Danio rerio 1e-66 BC067631.1 1489 5 2 down 24 Both batches Clone DKEYP-113D7 in link grp 19 Danio rerio 1e-26 BX323079.7 1490 5 2 down 24 Both batches NSS 1491 5 2 down 24 Both batches Glutathione S-transferase pi mRNA Danio rerio 1e-62 AF285098.1 1492 5 2 down 24 Both batches NSS 1493 5 1 down 24/48 Both batches cDNA clone IMAGE:4786889 Danio rerio 2e-67 BC059613.1 1494 5 1 down 24/48 Both batches Elongation factor-1 alpha Carassius auratus 3e-11 AB056104.1 1495 5 4 up 24/48 Both batches Proteasome subunit beta 7 Danio rerio e-145 AF155581.1 1496a 5 13 down 24 Both batches NSS 1496b 5 13 down 24 Both batches Clone BUSM1-258D18 in link grp 9 Danio rerio e-133 AL772356.2 1497 5 13 up 24/48 Both batches cDNA FLJ 39554 Homo sapiens 1.7 AK096873.4 1498 5 13 down 24/48 Both batches BAC clone RP11-27M15 from 2 Homo sapiens 1.7 AC124862.4 1499 5 13 up 24/48 Both batches 40S ribosomal protein S4 Pagrus major 0.006 AY19074.1 1500 5 13 down 24/48 Both batches NSS 1501 5 13 down 24 Both batches NSS 1502 5 13 up 24/48 Both batches NSS 1503 5 13 up 48 Both batches 3 BAC RP11-576M8 Homo sapiens 0.42 AC107311.8 1504 5 13 down 24/48 Both batches NSS 1505 5 13 down 24/48 Both batches BAC clone RP23-237H9 from chr 5 Mus musculus 6.0 AC126271.4 1506 5 13 down 24/48 Both batches NSS 1507 5 13 down 24 Both batches NSS 1508 5 13 up 48 Both batches NSS 1509 5 11 down 24 Both batches NSS 1510 5 11 down 24 Both batches Clone RP11-486B10 on chr. 1 Homo sapiens 1.6 AL445933.32
202 Seq Anc Arp Response Level expression Identity Species E-value Accession no. 1511 5 11 down 24/48 Both batches NSS 1512 5 11 down 24/48 Both batches NSS 1513 5 10 up 24/48 Both batches NSS 1514 5 10 Up 24/48 Both batches NSS 1515 5 10 up 24/48 Both batches NSS 1516 5 10 up 24/48 Both batches NSS 1517 5 10 up 24/48 Both batches Clone CH211-165I22 in link grp 1 Danio rerio 1e-50 AL929509.15 1518 5 10 up 24/48 Both batches Aldolase B mRNA Danio rerio 8e-21 AF533646.1 1519 5 10 down 24/48 Both batches Clone RP24-388P13, chr. 1 Mus musculus 0.38 AC101915.7 1520 5 10 down 24/48 Both batches Clone CH211-208M1 Danio rerio 0.63 AL928668.7 1521 5 10 up 24/48 24-higher Chr 3 clone RP11-696A14 Homo sapiens 6.6 AC113171.3 1522 5 10 up 24/48 Both batches NSS 1523 5 10 down 24/48 Both batches NSS 1524 5 10 up 24/48 Both batches NSS 1525 5 10 up 24/48 Both batches Guanine nucleotide binding protein beta Danio rerio 2e-36 AY423038.1 polypeptide 2-like 1 1526 5 10 up 24/48 Both batches NSS 1527 5 10 up 24/48 Both batches NSS 1528 5 10 up 24/48 Both batches NSS 1529 5 10 down 24/48 Both batches NSS 1530 5 10 down 24/48 Both batches NSS 1531 5 10 down 24/48 Both batches Clone CH211-237N17 in link grp 3 Danio rerio 0.39 BX470190.5 1532 5 10 up 24 Both batches NSS 1533 5 7 up 24/48 Both batches Aldolase B mRNA Danio rerio E<0.000 AF533646.1 1534 5 7 up 24/48 Both batches Aldolase B mRNA Danio rerio e-164 AF533646.1 1535 5 7 down 24/48 Both batches Clone CH211-146M5 Danio rerio 5e-50 BX005193.17 1536 5 7 down 24/48 Both batches NSS 1537 5 7 down 24/48 Both batches NSS 1538 5 7 up 24 Both batches NSS
203 Seq Anc Arp Response Level expression Identity Species E-value Accession no. 1539 5 7 down 24/48 Both batches NSS 1540 5 7 up 24/48 Both batches SEC61 gamma Danio rerio 8e-49 AY258259.1 1541 5 7 down 24/48 Both batches Hypothetical LOC299073 Rattus norvegicus 0.44 XM_216716.1 1542 5 7 down 24/48 Both batches NSS 1543 5 7 down 24/48 Both batches NSS 1544a 5 7 up 24 Both batches NSS 1544b 5 7 up 24 Both batches Zgc:56139 Danio rerio 2e-06 BC045939.1 1545 5 7 up 24/48 48-higher Ribosomal protein S15 Danio rerio 7e-12 NM_001001819.1 1546 5 7 down 24/48 Both batches NSS 1547 5 7 up 24/48 Both batches Clone RP1-256G22 on chr 6 Homo sapiens 6.0 AL022097.1 1548 5 13 down 24 Both batches Clone DKEY-25E12 in link grp 20 Danio rerio 0.42 BX537272.5 1549 5 13 up 24 24-specific BAC clone RP24-409M22 on chr. 12 Mus musculus 1.7 AC132269.3 1550 5 13 down 24 24-specific Clone BUSM1-258D18 in link grp 9, Danio rerio e-120 AL772356.2 titin? 1551 5 11 down 24 Both batches Chr 3 genomic DNA Lotus corniculatus 1.6 AP006666.1 1552 5 11 down 24 Both batches NSS 1553a 5 10 Down Both batches Slow muscle myosin heavy chain Danio rerio e-137 AF425742.1 1553b 5 10 Down Both batches Heat shock protein 90-beta mRNA Danio rerio 2e-31 AF042108.1 1553c 5 10 Down Both batches Clone RK057A3G0S aldolase B fructose Danio rerio 1e-47 AY394965.11 bisphosphate 1554 5 10 up 48 Both batches Aldolase B Danio rerio e-157 AF533646.1 1555a 5 10 up 24/48 Both batches NSS 1555b 5 10 up 24/48 Both batches Heat shock protein 90-beta Danio rerio 1e-32 AF042108.1 1556a 5 10 up 48 Both batches Eukaryotic translation initiation factor Danio rerio 1e-93 BC057465.1 subunit 8 1556b 5 10 up 48 Both batches Heat shock protein 90-beta Danio rerio 2e-46 AF042108.1 1557 5 10 Up 24/48 Both batches Heat shock protein 90-beta Danio rerio 2e-46 AF042108.1 1558 5 10 up 24/48 Both batches Isocitrate dehydrogenase 2 Danio rerio 5e-10 BC063967.1 1559 5 10 up 24/48 Both batches Ribosomal protein L32 Epinephelus coioides 4e-66 AF450502.1
204 Seq Anc Arp Response Level expression Identity Species E-value Accession no. 1560 5 10 down 24/48 Both batches Clone RP24-388P13, chr 1 Mus musculus 0.45 AC101915.7 1561 5 10 down 24/48 Both batches Chr 11 clone RP11-665E10 Homo sapiens 0.43 AP000676.6 1562 5 10 up 24/48 24-higher NSS 1563 5 7 up 24 Both batches NSS 1564 5 7 up 24/48 Both batches NSS 1565 5 7 up 24/48 Both batches NSS 1566 5 7 up 24 Both batches NSS 1567 5 7 up 24 24-specific NSS 1568 5 7 up 24 24-specific NSS 1569 5 7 up 24 Both batches NSS 1570 5 7 down 24/48 Both batches NSS 1571 5 7 down 24/48 Both batches NSS 1572 5 7 up 24 Both batches NSS 1573a 5 7 up 24/48 24-higher NSS 1573b 5 7 up 24/48 24-higher Zgc:56139 Danio rerio 2e-06 BC045939.1 1574 6 4 down 24/48 Both batches Clone CH211-273J2 Danio rerio 0.11 AL935276.16 1575 6 4 down 24/48 Both batches NSS 1576 6 3 down 24 Both batches Finished DNA, clone ChEST67p2 Gallus gallus 0.40 BX930999.2 1577 6 3 down 24/48 Both batches Clone RP23-68I8, chr 8 Mus musculus 0.37 AC1008931.13 1578 6 1 down 24/48 Both batches NSS 1579 6 1 down 24/48 Both batches Clone BUSM1-71F1 in link grp 9 Danio rerio 3e-48 BX248311.6 1580 6 4 down 24 Both batches NSS 1581 6 4 down 48 48-specific NSS 1582a 6 4 down 48 48-higher Desmin Acipenser baeri 4e-04 AJ493265.1 1582b 6 4 down 48 48-higher NSS 1583 6 4 down 24/48 Both batches Clone BUSM1-258D18 in link grp 9, Danio rerio 3e-94 AL772356.2 titin? 1584 6 4 up 48 Both batches Zgc:77755 Danio rerio 1e-81 BC065447.1 1585 6 2 down 24/48 Both batches BAC clone CH251-228G2 from Y Pan troglodytes 6.5 AC146231.3
205 Seq Anc Arp Response Level expression Identity Species E-value Accession no. 1586 6 19 down 24/48 Both batches Clone XXyac-155B6 on chr 1 Homo sapiens 6.5 BX842679.19 1587 6 19 up 48 Both batches NSS 1588 6 13 up 48 48-higher Myosin, heavy polypeptide 2, fast Danio rerio e-171 BC071279.1 muscle specific 1589 6 13 up 24/48 Both batches 40S ribosomal protein S4 mRNA Ictalurus punctatus 4e-78 AF402812.1 1590 6 13 up 24/48 48-higher BAC clone RP24-80G20, chr 3 Mus musculus 6.2 AC126932.4 1591 6 13 up 24 Both batches Clone DKEY-57C15 in link grp 22 Danio rerio 4e-04 BX511034.1 1592 6 13 up 48 Both batches Clone CH211-158M24 in link grp 5 Danio rerio 7e-46 BX510649.12 1593 6 13 up 48 Both batches Genomic DNA Brachyrhizobium 7.0 AP005961.1 japonicum 1594 6 13 up 24/48 Both batches NSS 1595 6 13 down 24 Both batches NSS
1596 6 13 up 48 Both batches Tau-crystallin (alpha-enolase-like protein, Ctenopharyngodon 0.002 AF544976.1 mRNA idella 1597 6 13 down 24 Both batches NSS 1598 6 13 up 24 48-higher 1q domain containing 1 Mus musculus 1.6 BC025636.1 1599 6 13 up 48 48-specific Bad reaction 1600 6 13 up 48 Both batches Clone RP1-274L14 on chr 6 Homo sapiens 1.6 AL133347.28 1601 6 13 up 24/48 Both batches NSS 1602 6 13 up 48 Both batches Clone RP23-48J18 on chr X Mus musculus 6.1 AL713894.12 1603 6 13 up 24/48 Both batches NSS 1604 6 13 up 24/48 Both batches BAC clone RP11-185K15 from Y Homo sapiens 5.8 AC017020.4 1605 6 13 down 24/48 Both batches NSS 1606 6 13 up 48 48-specific NSS 1607 6 13 up 48 Both batches NSS 1608 6 8 down 48 48-specific cDNA clone MGC:66406 Danio rerio 6e-56 BC055643.1 1609 6 8 down 24/48 Both batches NSS 1610 6 8 down 24/48 Both batches NSS
206 Seq Anc Arp Response Level expression Identity Species E-value Accession no. 1611 6 8 down 24/48 Both batches NSS 1612 6 8 down 24/48 Both batches NSS 1613 6 7 up 24 Both batches NSS 1614 6 7 up 24/48 Both batches SEC61 gamma Harpagifer antarcticus 1e-50 AY258259.1 1615 6 7 down 24 Both batches NSS 1616 6 7 up 24/48 Both batches NSS 1617 6 7 down 24 Both batches Clone DKEY-31J3 in link grp 14 Danio rerio 2e-21 BX571981.5 1618 6 7 down 24/48 Both batches NSS 1619 6 7 down 24/48 Both batches NSS 1620 6 7 down 24 24-specific NSS 1621 6 7 up 24/48 Both batches NSS 1622 6 7 down 24 Both batches NSS 1623 6 7 up 24 Both batches NSS 1624 6 7 down 24 Both batches Pre B-cell leukemia transcription factor Danio rerio 8e-18 BC066446.1 1a mRNA 1625 6 7 up 24/48 Both batches Ribosomal protein S15 mRNA Danio rerio 2e-24 NM_001001819.1 1626 6 7 up 24 Both batches Ribosomal protein S15 mRNA Danio rerio 3e-23 NM_001001819.1 1627 6 7 up 24 Both batches NSS 1628 6 7 down 24 Both batches NSS 1629 6 7 down 24/48 Both batches Clone BUSM1-258D18 in link grp 9 Danio rerio 0.006 AL772356.2 1630 6 7 down 24/48 Both batches NSS 1631 6 19 up 24 Both batches NSS 1632 6 19 up 48 48-specific NSS 1633 6 19 down 24/48 Both batches NSS 1634 6 13 up 48 48-specific Myosin, heavy polypeptide 2, fast muscle Danio rerio 7e-68 BC071279.1 specific 1635 6 13 down 24/48 Both batches PAK1 interacting protein 1 Danio rerio 9e-15 AY391445.1 1636 6 13 up 48 Both batches NSS 1637 6 13 up 48 Both batches Chr 5 clone CTD-2024P10 Homo sapiens 1.8 AC025754.4
207 Seq Anc Arp Response Level expression Identity Species E-value Accession no. 1638 6 13 up 48 Both batches Wu:fi38g05 Danio rerio 1e-25 BC044194.1 1639 6 13 up 48 48-higher Myosin, heavy polypeptide 2, fast muscle Danio rerio E<0.000 BC071279.1 specific 1640a 6 13 up 24/48 Both batches Receptor for activated protein kinase C Oreochromis e-105 AY342000.1 mossambicus 1640b 6 13 up 24/48 Both batches Clone RP11-439K20 on chr 20 Homo sapiens 7.2 AL121818.23 1641 6 13 up 48 Both batches Guanine nucleotide binding protein beta Danio rerio 1e-04 AY423038.1 polypeptide 2-like 1 down 24 Both batches 1642 6 13 up 24/48 Both batches 40S ribosomal protein S4 Ictalurus punctatus 5e-81 AF402812.1 1643 6 13 up 24 Both batches Elastase A precursor mRNA Gadus morhua 0.002 U57055.1 down 48 Both batches 1644 6 13 up 48 Both batches Clone CH211-158M24 Danio rerio 5e-94 BX510649.12 1645 6 13 up 48 Both batches Chr 5 clone RP23-405011 Mus musculus 1.7 AC1134910.5 down 24 Both batches 1646 6 13 up 48 Both batches Ubiquitin-like 1(sentrin) activating Danio rerio 2e-25 BC055614.1 enzyme E1B 1647 6 13 up 24 Both batches 3 BAC RP11-576MB Homo sapiens 0.42 AC107311.8 1648 6 8 down 24 24-specific NSS 1649b 6 7 down 24 Both batches 3D7 chr 10 section 5/7 Plasmodium falciparum 8.5 AE014833.1 1650 6 7 up 24 Both batches NSS 1651 6 7 up 24 Both batches NSS 1652 6 7 up 24 24-specific NSS 1653 6 7 up 24/48 Both batches SEC61 gamma Harpagifer antarcticus 5e-41 AY258259.1 1654 6 7 down 24/48 Both batches Clone DKEY-30016 in link grp 16 Danio rerio 6.3 BX248517.10
208 Table 40: Two hundred and sixty-one copper candidate bands with clear sequence data. Seq=sequence number, Anc=anchor primer, Arp=arbitrary primer, response=gene expression response to stressor with “up” denoting up-regulation, “down” denoting down-regulation and “variable” indicating variation in band expression, conc dep=concentration dependence and shows the specific copper concentration associated with the gene expression response, identity=BLAST match, species=species with homologous gene, E-value=expect value of BLAST match and Accession no.=GenBank accession number of homologous gene. If there was no BLAST match for the gene, it was designated as having “no significant similarity” (NSS) in the identity column.
No. Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 1 1 1 6 variable 50 ug high Eukaryotic translation elongation factor 1 Danio rerio e-169 NM_173263.13 gamma 2 3 1 6 up - Troponin T3a, skeletal, fast Danio rerio 3e-23 BC053304.1 3 4 1 6 Up - Complement C3 mRNA Ctenopharyngodon 4e-45 AY374472.1 idella 4 5 1 6 variable - Isolate MOLR19 cytochrome b gene Luxilus chrysocephalus 7e-55 AF117167.1 5 7 2 7 Down - ribosomal protein S15 Danio rerio 1e-04 NM_001001819.1 6 10b 2 2 down - MRNA from chymotrypsin B precursor Gadus morhua 1e-04 AJ242521.1 7 11 2 2 up 200 high Genomic DNA from clone (titin?) Danio rerio 2e-09 AL772356.2 8 17 2 6 down - Eukaryotic translation elongation factor Danio rerio <0.001 NM_173263.1 9 18 2 6 Down - Eukaryotic translation elongation factor Danio rerio <0.001 NM_173263.1 10 21 2 2 Down - Chymotrypsin b precursor Gadus morhua 3e-06 AJ242521.1 11 23 2 6 Down - Ribosomal protein L18 Ictalurus punctatus 4e-33 AF401572.1 12 24 2 18 down 200-low Ribosomal protein L21 Ictalurus punctatus 6e-62 AF401575.1 13 27 2 18 Down 125/200-low zgc:77877 Danio rerio 4e-35 NM_213011.1 14 28 2 18 Up - chromosome 11 Mus musculus 7.7 AL663090.15 15 29 2 17 Down - clone DKEY-52K20 Danio rerio 2e-22 BX649372.4 16 31 2 15 up - Fast skeletal muscle myosin light chain 3 Cyprinus carpio 1e-97 D85141.1 17 32 2 15 up 125/200-high 40 S ribosomal protein S3A Danio rerio 4e-57 NM_200059.1 18 40 2 17 Down 200-low Creatine kinase M2-CK Cyprinus carpio e-107 AF055289.1 19 41 2 17 Down - clone DKEY-52K20 Danio rerio 8e-34 BX649372.4 20 42 2 17 down - clone DKEY-52K20 Danio rerio 3e-30 BX649372.4
209 No. Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 21 45 2 15 Up - 40S ribosomal protein S4 mRNA Ictalurus punctatus 2e-50 AF402812.1 22 46 2 15 up 200-high Cytochrome b mitochondrial Pimephales notatus e-125 U66606.1 23 61 3 3 Down 200-low proteasome (prosome, macropain) subunit Danio rerio 7e-34 NM_131151.1 24 64 3 3 Down 125/200-low Thymosin, beta 4, X chromosome Mus musculus 8e-09 NM_021278.1 25 66 3 6 down 125/200-low Eukaryotic translation elongation factor 1 Danio rerio <0.001 NM_173263.1 gamma mRNA 26 72 3 6 Down 125/200-low zgc:92720 Danio rerio 7e-65 NM_001002586.1 27 73 3 3 Variable - 60S ribosomal protein L12 Danio rerio 1e-99 AY648813.1 28 75 3 6 Down 200-low Mitochondrial DNA Carassius carassius 5e-84 AY714387.1 29 90 3 16 Up - Fast muscle troponin T isoform TnnT3b Danio rerio 5e-34 AF425741.1 30 91 3 16 Up - Fast muscle troponin T isoform TnnT3b Danio rerio 1e-28 AF425741.1 31 93 3 16 variable - Fast muscle troponin T isoform TnnT3b Danio rerio 4e-32 AF425741.1 32 94 3 Fast muscle troponin TnnT3b Danio rerio 1e-13 AF425741.1 33 98 3 16 Up 200-high Ribosomal protein L26 mRNA Ictalurus punctatus e-164 AF401580.1 34 99 3 16 Up 125/200-high ribosomal protein L27 Ictalurus punctatus e-122 AF401581.1 35 100 3 16 Up 200-high Ribosomal protein L27 Ictalurus punctatus e-108 AF401581.1 36 102 3 15 Down - CPB mRNA for carboxypeptidase B Paralichthys olivaceus 2e-09 AB099302.1 37 103 3 15 Down - CPB mRNA for carboxypeptidase B Paralichthys olivaceus 2e-21 AB099302.1 38 105 3 15 Down - NADH ubiquinone oxidoreductase subunit Semilabea prochilus E=0.011 AF068331.1 4L (ND4L) 39 106 3 14 down 200-low clone CH211-246M6 Danio rerio 2.4 BX649296.3 40 107 3 14 variable - 40S ribosomal protein S4 Ictalurus punctatus 5e-75 AF402812.1 41 109 4 20 down 125/200-low clone IMAGE:6961467 Danio rerio e-180 BC067637.1 42 110 4 20 up - Ribosomal protein L7 Danio rerio <0.0001 NM_213644.1 43 111 4 20 down proportional Ribosomal protein L7 Danio rerio e-165 NM_213644.1 44 112 4 20 variable 50-low clone DKEY-77A20 Danio rerio 4e-26 BX000358.11 45 113 4 20 up - Keratin 4 (krt4) mRNA Danio rerio 1e-26 NM_131509.1 46 115 4 20 up 200-high clone CH211-10C6 Danio rerio 7e-19 BX000536.7 47 118 4 3 up 50/125-high Type I keratin mRNA Danio rerio 2e-37 AF174137.1
210 No. Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 48 121 4 3 up 125/200-high Transforming acidic coiled-containing Rattus norvegicus 3e-21 NM_001004415.1 protein 2 (TACC2) 49 129 4 2 down 125/200-low Beta-actin 1 Danio rerio 1e-85 BC063950.1 50 131 4 2 Down 125/200-low Ribosomal protein L21 Ictalurus punctatus 2e-64 AF401575 51 132 4 2 Down 125/200-low Type II cytokeratin (ckii) mRNA Danio rerio 1e-07 NM_131156.1 52 133 4 2 down 125/200-low Aldolase B mRNA Danio rerio 9e-24 NM_194367.3 53 134 4 20 up 200-high CPB mRNA for carboxypeptidase B Paralichthys olivaceus 0.006 AB099302.1 54 136 4 20 Down - Ribosomal protein L7 mRNA Danio rerio e-164 NM_213644.1 55 137a 4 20 Down - Protocadherin-9 (PCDH9) Homo sapiens 2e-07 NM_020403.3 56 138 4 20 up 200-high Seq from chromosome 18 Homo sapiens 6.5 AC103814.2 57 142 4 20 up 200-high Cytochrome c oxidase subunit III gene; Oncorhynchus nerka 5e-38 AF294832.1 t-RNA-Gly gene; NADH dehydrogenase subunit 3 58 146 4 9 Up 200-high Parvalbumin isoform 1d mRNA Danio rerio 2e-77 AF467914.1 59 149 4 9 Down - NSS 60 150 4 9 Down proportional NADH dehydrogenase subunit 2 Cyprinella gibbsi 2e-22 AF111219.1 61 151 4 9 Down 125/200-low Dnase gamma gene Mus musculus 6.7 AY024355.1 62 152 4 9 Down - Mitochondrial Chanos chanos 1.8 AB054133.1 63 154 4 3 Up - Type I keratin Danio rerio 5e-35 AF174137.1 64 163 4 2 Up 125/200-high creatine kinase M2-CK Cyprinus carpio 4e-85 AF055289.1 65 164 4 2 Up 125/200-high clone CH211-158M24 Danio rerio 0.62 BX510649.12 66 166 4 2 variable 50-high, 125/2clone CH211-13 Danio rerio 8.7 BX119902.4 67 168 4 2 up - Sequence from clone (titin?) Danio rerio 1e-35 AL772356.2 68 170 4 2 Down 125/200-low clone IMAGE:7046318 Danio rerio 6e-47 BC076035.1 69 171 4 2 down 125/200-low Ribosomal protein L5b Ictalurus punctatus 1e-16 AF401557 70 180 4 15 Up - NADH dehydrogenase subunit 2 Cyprinella gibbsi 2e-80 AF111219.1 71 181 4 15 Up - Ribosomal protein L7a mRNA Ictalurus punctatus 5e-35 AF401560.1 72 182b 4 15 up 125/200-high NADH dehydrogenase subunit 2 Cyprinella gibbsi e-120 AF111219.1 73 182c 4 15 up 125/200-high NADH dehydrogenase subunit 2 Cyprinella gibbsi 2e-86 AF111219.1
211 No. Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 74 183 4 15 up - NADH dehydrogenase subunit 2 Cyprinella gibbsi 3e-85 AF111219.1 75 184a 4 15 down 125/200-low clone RP71-47G15 Danio rerio 5e-44 BX465189.9 76 184b 4 15 down 125/200-low clone DKEY-13 Danio rerio 2e-09 BX842240.3 77 184c 4 15 down 125/200-low clone DKEY-202N14 Danio rerio 3e-11 BX322550.7 78 185 4 15 up - clone DKEY-13I15 Danio rerio 1e-14 BX842240.3 79 186 4 15 up - clone DKEY-13I15 Danio rerio 2e-09 BX842240.3 80 188 4 15 variable - NADH dehydrogenase subunit 2 (ND2) Cyprinella gibbsi 4e-88 AF111219.1 81 189 4 15 up - NADH dehydrogenase subunit 2 (ND2) Cyprinella gibbsi 1e-91 AF111219.1 82 193 4 10 Down 200-low Chymotrypsinogen B1 Danio rerio 1e-17 BC055574.1 83 194 4 10 down 125/200-low Chymotrypsinogen B1 Danio rerio 1e-17 BC055574.1 84 195 4 6 Up - clone DKEY-27P3 Danio rerio 7e-53 BX005320.4 85 197 4 6 up 125/200-high clone MGC:66406 IMAGE:5915478 Danio rerio 2e-86 BC055643.1 86 198 4 15 variable - NADH dehydrogenase subunit 2 Cyprinella gibbsi e-121 AF111219.1 87 199 4 15 variable 50-high PAC clone RP4-725G10 Homo sapiens 1.9 AC006970.6 88 200a 4 15 up 125/200-high PAC clone RP4-725G10 Homo sapiens 2.1 AC006970.6 89 202 4 15 Up 200-high clone CH211-233H19 Danio rerio 2e-68 BX248397.7 90 204 4 15 Down 125/200-low similar to neuronal transmembrane protein Gallus gallus 3e-05 XM_420266.1 Slitrk4 91 209 4 15 down 125/200- zgc:56717 Danio rerio 1e-04 NM_200968.1 low 92 230 4 10 down - clone CH211-10K1 Danio rerio 2e-09 BX324205.5 93 231 4 10 down - 12q22 BAC RPCI11-256L6 Homo sapiens 2.0 AC007298.17 94 233 4 10 down - clone CH211-197B6 Danio rerio 2.0 AL935324.8 95 239 4 6 up 200-high BAC clone RP11-44D21 Homo sapiens 0.14 AC108866.5 96 247 4 6 up - zgc:91930 Danio rerio 6e-47 BC080261.1 97 251 4 6 up proportional clone CH211-231L18 Danio rerio 0.58 AL732635.7 98 256 5 10 down 200-low NADH dehydrogenase subunit 2 Cyprinella gibbsi e-120 AF111219.1 99 257b 5 10 down 200-low Chymotrypsinogen B1 Danio rerio 4e-17 NM_212618.1 100 259 5 10 down 200-low Aldolase B mRNA Danio rerio 3e-92 AF533646.1
212 No. Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 101 263 5 10 up - Guanine nucleotide binding protein Danio rerio 5e-35 AY423038.1 102 269 5 5 up - Aldolase B Danio rerio <0.001 AF533646.1 103 270 5 5 up - Anionic trypsin Oncorhynchus keta 2e-80 AB091439.1 104 271 5 5 up - Proteasome subunit beta 7 Danio rerio 1e-32 AF155581.1 105 273 5 5 up 125/200-high LIM domain binding 3 like Danio rerio 4e-05 NM_199858.2 106 276 5 5 up - Mitochondrial DNA Carassius auratus 1e-79 AY771781.1 107 277 5 5 up 125/200-high cytochrome oxidase subunit II Hemibarbus maculatus 5e-57 AY704455.1 108 280 5 5 up - cosmid C54E4 Caenorhabditis elegans 0.035 AF038609.2 109 281 5 5 up - clone RP71-30I22 in linkage group 8 Danio rerio 2e-37 AL590148.8 110 282 5 5 up 125/200-high clone RP71-30I22 in linkage group 8 Danio rerio 6e-41 AL590148.8 111 283 5 5 variable 50/125-high Chymotrypsinogen B1 Danio rerio 6e-31 NM_212618.1 112 289 5 3 Down proportional Alpha-amylase mRNA Lates calcarifer 2e-46 AF416651.1 113 290 5 3 up 125/200-high BAC clone RP11-533K12 from 4 Homo sapiens 1.9 AC095063.2 114 291 5 3 Down - chromosome 11q clone:RP11-617B3 Homo sapiens 0.56 AP003043.2 115 292 5 3 Down - NADH ubiquinone oxidoreductase subunit Distoechodon 4e-20 AF036179.1 4L; other genes tumirostris 116 297a 5 1 up 200-high Fast muscle troponin I Danio rerio e-127 AF425744.1 117 297b 5 1 up 200-high clone BUSM1-71F1 in linkage group 9 Danio rerio 3e-98 BX248311.6 118 297c 5 1 up 200-high Elongation factor 1-alpha mRNA Cyprinus carpio 2e-65 AF485331.1 119 299 5 1 down 125/200-low clone CH211-69M14 in linkage group 20 Danio rerio 0.13 AL929030.7 120 305a 5 5 variable 125-low Aldolase B mRNA Danio rerio <0.0001 AF533646.1 121 305b 5 5 variable 125-low Proteasome subunit beta 7 Danio rerio 1e-63 AF155581.1 122 305c 5 5 variable 125-low Mitochondrial DNA Carassius auratus 5e-72 AY714387.1 123 306 5 5 down 125/200-low Anionic trypsin Oncorhynchus keta 3e-80 AB091439.1 124 307 5 5 down 125/200-low Anionic trypsin Oncorhynchus keta 2e-80 AB091439.1 125 310 5 5 Up 200-high Several genes (#281) Danio rerio 8e-21 AL590148.8 126 311 5 5 up 200-high Several genes (#281) Danio rerio 6e-34 AL590148.8 127 313b 5 3 Up 125/200-high Mitochondrial DNA Carassius auratus 4e-82 AY714387.1 128 318 5 3 up - clone RP23-373N5 on chromosome 4 Mus musculus 9.0 AL928597.19
213 No. Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 129 320 5 3 Up 200-high NADH ubiquinone oxidoreductase subunits Distoechodon 5e-32 AF036179.1 4L and 4 tumirostris 130 322 5 1 up 50-high Fast muscle troponin I mRNA Danio rerio e-133 AF425744.1 131 323 5 1 down 125/200-low Elongation factor 1-alpha Cyprinus carpio 1e-48 AF485331.1 132 324 5 1 variable 50-high clone CH211-69M14 in linkage group 20 Danio rerio 0.15 AL929030.7 133 327 5 5 Down 125/200-low cytochrome oxidase subunit II Hemibarbus maculatus 7e-49 AY704455.1 134 328 5 5 Down 125/200-low 3D7 chromosome 11 section 2 of 8 Plasmodium falciparum 0.55 AE014837.1 135 330 5 5 down 125/200-low chymotrypsinogen B1 Danio rerio 8e-24 NM_212618.1 136 332 5 18 up 200-high zgc:103433 Danio rerio 0.15 BC083377.1 137 338 5 18 Up - zgc:76904 Danio rerio 1e-51 NM_207101.1 138 341 5 18 std - Ribosomal protein L21 Ictalurus punctatus 2e-43 AF401575.1 139 347 5 17 Up - clone DKEY-52K20 in linkage group 2 Danio rerio 9e-34 BX649372.5 140 348 5 17 Up - clone DKEY-52K20 in linkage group 2 Danio rerio 5e-29 BX649372.5 141 354 5 17 down proportional basic helix-loop-helix transcription factor Danio rerio 4e-05 AJ510221.1 142 357 5 17 Up 125/200-high clone DKEY-16I5 in linkage group 12 Danio rerio 0.009 BX649366.5 143 358 5 17 up 125/200-high clone DKEY-16I5 in linkage group 12 Danio rerio 0.009 BX649366.5 144 359 5 17 down - clone DKEYP-82D1 in linkage group 2 Danio rerio 2.2 BX510333.14 145 360 5 17 up 200-high clone RP11-157N3 on chromosome 1 Homo sapiens 2.2 AL662904.4 146 361 5 17 up 200-high clone DKEY-16L23 in linkage group 2 Danio rerio 0.56 BX294132.11 147 363 5 17 down - ribosomal protein S25 Danio rerio 4e-08 NM_200815.1 148 372 5 16 up 125/200-high Synaptotagmin 1 Rattus rattus 1e-69 AJ617615.1 149 377 5 16 up 125/200-high Chromosome 8q23 Homo sapiens 2.3 AP002982.2 150 378 5 16 down 200-low Cytochrome c oxidase subunit III gene Carassius auratus 2e-65 AY219843.1 151 381 5 16 Down - ATPase, Na/K transporting, beta 1a Danio rerio 3e-33 NM_131668.3 polypeptide mRNA 152 383 5 16 up - Translation initiation factor 2 mRNA Danio rerio 7e-19 AY648723.1 153 386 5 16 Up 200-high clone 132124R Lycopersicon 2.1 BT013465.1 esculentum 154 387 5 16 up 200-high clone RP11-261P24 on chromosome 13 Homo sapiens 0.53 AL161896.16
214 No. Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 155 389 5 16 down - clone RP71-8L21 in linkage group 1 Danio rerio 5e-32 BX537132.7 156 390 5 16 up 200-high NSS 157 399 5 15 up 200-high Cytochrome b gene Pimephales notatus e-111 U66606.1 158 400 5 15 down 125/200-low Mitochondrial DNA Carassius carassius 2e-99 AY714387.1 159 402 5 15 up 125/200-high proteasome (prosome, macropain) 26S Homo sapiens 2e-31 NM_002810.1 subunit 160 408 5 15 Down - acidic (leucine-rich) nuclear phosphoprotein Danio rerio 5e-60 NM_212603.1 32 family, member B 161 409 5 15 down - acidic (leucine-rich) nuclear phosphoprotein Danio rerio 5e-60 NM_212603.1 32 family, member B 162 412 5 15 Down proportional peptidylprolyl isomerase A (cyclophilin A) Danio rerio 0.14 NM_212758.1 163 413 5 15 down proportional peptidylprolyl isomerase A (cyclophilin A) Danio rerio 1e-08 NM_212758.1 164 428 5 18 up - zgc:66097 Danio rerio 2e-06 BC074055.1 165 431 5 18 up 125/200-high BAC clone RP11-16J22 from 2 Homo sapiens 0.010 AC104776.5 166 434 5 18 up - zgc:76904 Danio rerio 6e-93 NM_207101.1 167 436 5 17 Up - ubiquinol-cytochrome c reductase core I Oncorhynchus mykiss 2e-37 AF465782.1 protein 168 438 5 17 up - clone CH211-273N7 in linkage group 18 Danio rerio 0.002 BX548245.14 169 439 5 17 Down 1225/200-low CCAAT/enhancer binding protein (C/EBP), Danio rerio 5e-97 NM_131884.2 beta 170 440 5 17 down 125/200-low CCAAT/enhancer binding protein (C/EBP), Danio rerio 5e-97 NM_131884.2 beta 171 442 5 16 up 125/200-high NRRL Y-1140 Kluyveromyces lactis 2.3 XM_454249.1 172 443 5 16 up 125/200-high synaptotagmin 1 (Syt 1) Rattus rattus 6e-72 AJ617615.1 173 447 5 16 down - ribosomal protein L4 Danio rerio 4e-79 BC067580.1 174 451b 6 5 Down 200-low proteasome subunit beta 7 Danio rerio 1e-62 AF155581.1 175 452a 6 5 Down 200-low proteasome subunit beta 7 Danio rerio 5e-69 AF155581.1 176 453 6 5 Up 200-high clone DKEY-259L18 in linkage group 23 Danio rerio 1e-45 BX571850.7 177 454 6 5 Down proportional profilin 2 like Danio rerio 5e-29 NM_201466.2
215 No. Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 178 456 6 5 Up 200-high titin Danio rerio 3e-17 AY081167.1 179 461 6 5 Down 200-low 3D7 chromosome 11, section 2/8 Plasmodium falciparum 0.56 AE014837.1 180 465 6 3 variable 50/125-high fast skeletal myosin heavy chain 4 (mhc4) Danio rerio <0.0001 AY333450.1 181 467 6 3 down 200-low ribosomal protein L4 Danio rerio e-178 BC049520.1 182 468 6 3 down - 40S ribosomal protein S5 (rpS5) Danio rerio <0.0001 BC059443.1 183 469 6 3 Down - chromosome 8, clone RP11-960H2 Homo sapiens 0.14 AC107934.3 184 470 6 3 down - 60S ribosomal protein L12 Danio rerio e-114 AY648813.1 185 471 6 3 down proportional 60S ribosomal protein L12 Danio rerio e-119 AY648813.1 186 474 6 3 Up 200-high fast skeletal muscle myosin heavy Danio rerio e-100 AF180893.1 polypeptide 1 (myhz1) 187 475 6 3 up 200-high fast skeletal muscle myosin heavy Danio rerio 2e-98 AF180893.1 polypeptide 1 (myhz1) 188 476 6 3 Down 200-low EF-1a mRNA for elongation factor 1a Oreochromis niloticus 4e-04 AB075952.1 189 477 6 3 down 200-low 4 BAC CH230-55N7 Rattus norvegicus 8.9 AC125643.3 190 478 6 3 Down - NSS 191 479 6 3 Down - NSS 192 481 6 3 down 200-low survival motor neuron domain containing 1 Danio rerio 2e-52 NM_212601.1 (smndc1), 193 482 6 1 Up 125/200-high fast muscle troponin I Danio rerio e-130 AF425744.1 194 483 6 1 Up 125/200-high clone DKEYP-67D2 in linkage group 9 Danio rerio e-102 BX640499.5 195 484 6 1 Up 125/200-high clone DKEYP-67D2 in linkage group 9 Danio rerio e-102 BX640499.5 196 485 6 1 up - troponin T3a, skeletal, fast Danio rerio 2e-78 NM_131565.1 197 486 6 1 Down proportional fast muscle troponin T isoform TnnT3b Danio rerio 1e-76 AF425741.1 198 487 6 1 Down 200-low elongation factor 1-alpha Cyprinus carpio e-135 AF485331.1 199 490 6 1 Down 200-low heat shock cognate 70 kDa protein Carassius auratus 3e-98 AY195744.1 200 492 6 1 Down 200-low actinin, alpha 2 (ACTN2) Danio rerio 4e-14 AY391405.1 201 493 6 1 Down 200-low actinin, alpha 2 (ACTN2) Danio rerio 7e-13 AY391405.1 202 494 6 1 Down 200-low heat shock cognate 70 kDa protein Carassius auratus e-100 AY195744.1 203 495 6 1 Down 200-low heat shock cognate 70 kDa protein Carassius auratus 8e-96 AY195744.1
216 No. Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 204 496 6 1 Down proportional actinin, alpha 2 (ACTN2) Danio rerio 0.002 AY391405.1 205 497 6 1 Down - actinin, alpha 2 (ACTN2) Danio rerio 0.57 AY391405.1 206 498 6 1 Down 125/200-low fast muscle troponin I Danio rerio e-132 AF425744.1 207 499a 6 1 Down proportional fast muscle troponin I Danio rerio e-127 AF425744.1 208 499b 6 1 Down - clone DKEYP-67D2 in linkage group 9 Danio rerio e-102 BX640499.5 209 500 6 6 down 125/200-low fast muscle troponin T isoform TnnT3b Danio rerio e-128 AF425741.1 210 501 6 6 up proportional troponin T3a, skeletal fast Danio rerio 3e-51 BC053304.1 211 502 6 6 down 200-low mitochondrial DNA Carassius auratus 2e-83 AY714387.1 212 503 6 6 down - ribosomal RNA gene Ralstonia solanacearum 7e-56 AF012418.1 213 506 6 5 up 200-high titin Danio rerio 9e-31 AY081167.1 214 507 6 5 up 200-high titin Danio rerio 0.006 AY081167.1 215 512 6 5 down 200-low cosmid C54E4 Caenorhabditis elegans 0.035 AF038609.2 216 517 6 5 Up clone RP71-30I22 in linkage group 8 Danio rerio 3e-24 AL590148.8 217 519 6 5 up 200-high section 5 of 21 Pseudomonas putida 3e-48 AE016778.1 KT2440 218 529 6 3 up 200-high zgc:86706 Danio rerio 4e-11 NM_001002068.1 219 530 6 3 up 200-high fast skeletal muscle myosin heavy Danio rerio 4e-91 AF180893.1 polypeptide 1 (myhz1) 220 537 6 1 down 125/200-low elongation factor 1-alpha Cyprinus carpio e-180 AF485331.1 221 538 6 1 up 200-high troponin T3a, skeletal, fast muscle Danio rerio 1e-66 NM_131565.1 222 542 6 1 Up proportional ribosomal protein S5 (rps5) Danio rerio 6e-16 NM_173232.1 223 543 6 1 up 200-high ribosomal protein S5 (rps5) Danio rerio 1e-17 NM_173232.1 224 545 6 1 down 200-low myosin, heavy polypeptide 2, fast muscle Danio rerio 4e-57 NM_152982.2 specific 225 546 6 1 down 200-low actinin, alpha 2 (ACTN2) Danio rerio 4e-11 AY391405.1 226 552 6 19 Up 125/200-high clone CH211-271B14 in linkage group 5 Danio rerio 4e-08 BX247876.6 227 553 6 19 Up 125/200-high clone DKEYP-73D8 in linkage group 2 Danio rerio 0.002 BX323559.11 228 556 6 19 Up proportional alpha-tropomyosin (tpma) Danio rerio 2e-37 AF180892.1 229 558 6 17 down 200-low clone DKEY-52K20 in linkage group 2 Danio rerio 1e-32 BX649372.5
217 No. Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 230 561 6 17 Up 125/200-high zgc:92575 Danio rerio e-100 BC085674.1 231 562 6 17 up 200-high clone DKEY-16I5 in linkage group 12 Danio rerio 3e-12 BX649366.5 232 565 6 17 Up 125/200-high brefeldin A-inhibited guanine Homo sapiens 3e-20 AB209324.1 nucleotide-exchange protein 1 (BIG1) 233 566 6 17 up 125/200-high chromosome 8, clone RP11-413C18 Homo sapiens 0.13 AC009634.9 234 568 6 17 up - ribosomal protein S25 Danio rerio 7e-25 NM_200815.1 235 569 6 17 up 200-high fast muscle troponin I Danio rerio 0.13 AF425744.1 236 578 6 16 Down proportional eukaryotic translation initiation factor 2 Danio rerio 8e-34 AY648723.1 gamma 237 579 6 16 Down proportional NADH dehydrogenase subunit I gene Ctenogobiops feroculus 9e-06 AF391435.1 238 590 6 15 down - ribosomal protein S3A Danio rerio 2e-53 NM_200059.1 239 603c 6 19 down - zgc:63682 Danio rerio 6e-16 NM_200906.1 240 607 6 19 Down - guanine nucleotide binding protein Danio rerio <0.0001 AY423038.1 (G protein), beta polypeptide 2-lie 1 241 609 6 19 Down - zgc:77263 Danio rerio <0.0001 NM_199820.2 242 610 6 19 variable 50-low BAC clone RP23-3H23 from X Mus musculus 2.2 AC098729.3 243 611 6 19 variable 50-low 82 BAC clone Gm_ISb001_091_F11 Glycine max cv Williams 0.14 AF541963.1 244 614 6 19 up 125/200-high zgc:63682 Danio rerio 1e-07 NM_200906.1 245 615 6 19 variable 50/125-high ribosomal protein L37a Ictalurus punctatus 3e-70 AF401594.1 246 616 6 19 up 200-high clone CH211-271B14 in linkage group 5 Danio rerio 9e-09 BX247876.6 247 617 6 19 up 200-high clone DKEYP-73D8 in linkage group 2 Danio rerio 0.002 BX323559.11 248 618 6 19 variable 50/125-high skeletal muscle actin mutant mRNA Cyprinus carpio 2e-47 AY395871.1 249 619 6 19 down proportional skeletal muscle alpha-actin Cyprinus carpio 7e-53 D50028.1 250 625 6 17 down 200-low HCM2081 gene Homo sapiens 0.15 AY405009.1 251 627 6 17 Down 200-low cDNA clone IMAGE:7395709 Danio rerio 6e-84 BC092811.1 252 629a 6 17 Down 200-low cDNA clone IMAGE:7395709 Danio rerio 4e-85 BC092811.1 253 630a 6 17 Down 200-low cDNA clone IMAGE:7395709 Danio rerio 4e-85 BC092811.1 254 630b 6 17 Down 200-low similar to ATP synthase H+ transporting Xenopus laevis 2e-06 BC048772.1
218 No. Seq Anc Arp Response Conc dep Identity Species E-value Accession no. mitochondrial FO complex subunit b, isoform 1 255 633 6 17 Up 200-high zgc:92575 Danio rerio 1e-72 BC085674.1 256 634 6 17 up 200-high zgc:92575 Danio rerio 1e-85 BC085674.1 257 640 6 15 down 125/200-low mRNA for stathmin Gallus gallus 2e-28 NM_001001858.1 258 642 6 15 up 200-high mRNA for stathmin Gallus gallus 3e-33 NM_001001858.1 259 648 6 15 variable 50/125-high translation elongation factor 2 Danio rerio 4e-45 AY391422.1 260 649 6 15 down 200-low mitochondrial DNA Carassius carassius 3e-95 AY714387.1 261 654 6 15 down 200-low ribosomal protein S3A Danio rerio 2e-74 NM_200059.1
219 Table 41: One hundred and sixty-eight zinc candidate genes with clear sequence data. Seq=sequence number, Anc=anchor primer, Arp=arbitrary primer, response=gene expression response to stressor with “up” denoting up-regulation, “down” denoting down-regulation and “variable” indicating variation in band expression, conc dep=concentration dependence and shows the specific copper concentration associated with the gene expression response, identity=BLAST match, species=species with homologous gene, E-value=expect value of BLAST match and Accession no.=GenBank accession number of homologous gene. If there was no BLAST match for the gene, it was designated as having “no significant similarity” (NSS) in the identity column.
No. Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 1 656 1 5 down - Chr. 3 cosmid c645 Schizosaccharomyces 0.57 AL049498.1 ponibe 2 662 1 1 up 4/6/900 S6 ribosomal protein Pagrus major e-115 AY190727.1 3 663 1 1 up 4/6/900 keratin Carassius auratus e-131 L09744.1 4 664 1 1 up 4/6/900 zgc:55941 Danio rerio 3e-83 BC065885.1 5 665 1 1 up 6/900 full-length cDNA Tetraodon nigroviridis e-137 CR703467.2 6 668 1 1 up 4/6/900 myosin, heavy polypeptide 2, fast muscle Danio rerio <0.0001 NM_152982.2 specific 7 672 1 3 up - 60S ribosomal protein L12 Danio rerio e-124 AY648813.1 8 674 1 3 up 6/900 survival motor neuron domain containing 1 Danio rerio 4e-79 BC067338.1 9 677 1 3 up 6/900 Seq. from clone RP11-280L17 chr. 9 Homo sapiens 2.2 AL449344.5 10 679 1 3 up - Chr. 2L section 68 of 83 Drosophila melanogaster 0.52 AE003659.2 11 691 1 8 up - ribosomal protein S11 Danio rerio e-167 NM_213377.1 12 692 1 8 up - Myosin light chain 2 Engraulis japonicus 3e-52 AB042053.1 13 695 1 8 up - Myosin light chain 2 Engraulis japonicus 2e-50 AB042053.1 14 699 1 9 up 900 mitochondrial ATP synthase alpha-subunit Cyprinus carpio 1e-35 AB042437.1 15 704 1 8 up - Cytochrome c oxidase subunit I Notropis photogenis 4e-17 AY116187.1 16 708 1 7 up - zgc:56334 Danio rerio 3e-18 NM_199568.1 17 717 1 9 up - BAC clone RP11-445N10 from 2 Homo sapiens 8.8 AC079923.5 18 718 1 13 Down - zgc:92237 Danio rerio <0.0001 NM_001003728.1 19 719 1 13 Down - zgc:66457 Danio rerio 4e-67 BC079529.1 20 722 1 13 Down 900 Skeletal alpha actin Cyprinus carpio 4e-36 D50028.1
220 No. Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 21 725a 1 12 down 600/900 zgc:92237 Danio rerio 7e-93 NM_001003728.1 22 725b 1 12 down 600/900 Ribosomal protein L37 Ictalurus punctatus 6e-25 AF401593.1 23 726 1 12 up - Alpha-tropomyosin Danio rerio <0.0001 NM_131105.2 24 727b 1 12 Up - zgc:92237 Danio rerio 3e-77 NM_001003728.1 25 728b 1 12 Down 4/6/900 zgc:92237 Danio rerio 5e-88 NM_001003728.1 26 729b 1 12 up - zgc:92237 Danio rerio 4e-82 NM_001003728.1 27 731a 1 11 Up - zgc:92237 Danio rerio 1e-84 NM_001003728.1 28 732 1 11 Up Proportional zgc:91970 Danio rerio 1e-17 BC076550.1 29 736 1 11 Up - Eukaryotic translation elongation factor 1 Danio rerio e-126 AY099512.1 gamma 30 738 1 11 up - BAC clone RP24-169N11 from chr. 17 Mus musculus 8.2 AC122422.4 31 743 1 13 Down - cDNA clone cieg052g21 Ciona intestinalis 0.14 AK115429.1 32 745 1 13 Up - Alpha tropomyosin Danio rerio 1e-17 AF180892.1 33 748 1 12 Down 600/900 clone DKEYP-78B1 in linkage group 24 Danio rerio 9e-43 BX322785.6 34 750 1 12 Down 900 Ran-binding protein 7 Danio rerio 0.002 AY286403.1 35 752 1 11 Up 900 Eukaryotic translation elongation factor 1 Danio rerio e-119 AY099512.1 gamma 36 756b 2 19 Variable Skeletal alpha actin Cyprinus carpio 1e-51 D50028.1 37 756c 2 19 Variable Alpha-tropomyosin Danio rerio 4e-39 AF180892.1 38 757 2 19 down - Ribosomal protein L37a Ictalurus punctatus 9e-74 AF401594.1 39 759 2 19 up - eukaryotic translation initiation factor 3 Danio rerio 9e-40 AY648835.1 subunit 4 40 766 2 16 up 4/6/900 Alpha-tropomyosin Danio rerio 5e-38 AF180892.1 41 770b 2 16 up - Alpha-tropomyosin Danio rerio 5e-38 AF180892.1 42 771 2 16 up - BUSM1-258D18 in link grp 9 (titin?) Danio rerio 1e-94 AL772356.2 43 773a 2 19 Up - clone CH211-73B10 in linkage group 20 Danio rerio 0.002 CR388421.11 44 773b 2 19 Up - Alpha-tropomyosin Danio rerio 1e-38 AF180892.1 45 774 2 19 Up - Alpha-tropomyosin Danio rerio 6e-38 AF180892.1
221 No. Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 46 777 2 19 up - eukaryotic translation initiation factor 3 Danio rerio 8e-37 AY648835.1 subunit 4 47 778 2 19 down - elastase 2 Danio rerio 4e-11 BC042328.1 48 779 2 17 up 6/900 Alpha-tropomyosin Danio rerio 3e-33 AF180892.1 49 780 2 17 up - Alpha-tropomyosin Danio rerio 2e-37 AF180892.1 50 783 2 17 Up - Alpha-tropomyosin Danio rerio 1e-38 AF180892.1 51 784 2 17 Up - clone DKEY-16I5 in linkage group 12 Danio rerio 8e-25 BX649366.5 52 785 2 17 Up - clone IMAGE:7395709 Danio rerio 1e-66 BC092811.1 53 786 2 17 Up - Beta-fructofuranoside and Lycopersicon 8.7 AY173050.1 beta-fructofuranosidase genes esculentum 54 788 2 16 Up 4/6/900 Alpha-tropomyosin Danio rerio 6e-38 AF180892.1 55 790 2 16 Down 6/900 ribosomal protein L27 Danio rerio <0.0001 BC045965.1 56 792 2 16 Down 6/900 ribosomal protein L27 Danio rerio e-124 BC045965.1 57 795 2 5 Up 6/900 40S ribosomal protein S15 Danio rerio e-151 NM_001001819.1 58 799 2 3 Up 900 clone IMAGE:7158960 Danio rerio e-107 BC095863.1 59 802 2 1 Down Proportional 14kDa apolipoprotein Ctenopharyngodon 4e-97 AY445924.1 idella 60 803 2 1 Down Proportional Fast muscle troponin I mRNA Danio rerio e-133 AF425744.1 61 804 2 1 Down Proportional Elongation factor 1-alpha mRNA Cyprinus carpio e-146 AF485331.1 62 805 2 1 Down Proportional Troponin T3a, skeletal, fast Danio rerio 4e-48 NM_131565.1 63 812b 2 5 Up 6/900 Titin Danio rerio 5e-35 AY081167.1 64 817 2 1 Down 6/900 14kDa apolipoprotein Ctenopharyngodon 3e-92 AY445924.1 idella 65 819 2 1 Down 6/900 Elongation factor 1-alpha mRNA Cyprinus carpio e-174 AF485331.1 66 822 2 1 Down 4/6/900 Ribosomal protein S24 Danio rerio e-107 BC081494.1 67 826 2 3 Up - clone IMAGE:7158960 Danio rerio e-101 BC095863.1 68 831 2 12 up - ribosomal protein S21 Danio rerio 1e-44 BC071475.1 69 832 2 13 Down - Ribosomal protein L37 mRNA Ictalurus punctatus 2e-34 AF401593.1 70 855 2 13 down 4/6/900 Ribosomal protein L9 mRNA Danio rerio <0.0001 BC090911.1
222 No. Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 71 857 2 12 up - Clone BUSM1-167C3 in link grp 9 Danio rerio 3e-58 AL714003.6 72 858 2 12 down - NSS 73 861 2 11 down - clone MGC:112501 IMAGE:7413132 Danio rerio 3e-36 BC095836.1 74 862 2 11 down - carboxypeptidase B1 Danio rerio 6e-41 BC067637.1 75 866a 3 5 up 6/900 ribosomal protein S15 Danio rerio <0.0001 BC081516.1 76 867a 3 5 up 6/900 Proteasome subunit beta 7 Danio rerio 3e-70 AF155581.1 77 874 3 5 up 4/6/900 Titin Danio rerio 8e-40 AY081167.1 78 877 3 3 down 2/900 Thymosin, beta 4, X chr. Mus musculus 5e-10 NM_021278.1 79 881 3 1 up - Elongation factor 1-alpha mRNA Cyprinus carpio 1e-17 AF485331.1 80 885 3 5 up 200-high Proteasome subunit beta 7 mRNA Danio rerio 7e-68 AF155581.1 81 886 3 5 down - zgc:73293 Danio rerio 1e-60 BC059619.1 82 888 3 5 down 900 selenophosphate synthetase 2 Danio rerio 1e-47 BC081590.1 83 892 3 3 down - Nucleolar protein 5A, mRNA Danio rerio 1e-29 BC090915.1 84 894 3 3 down - mRNA for beta-thymosin Oncorhynchus mykiss 3e-15 AJ250180.1 85 895 3 3 down - mRNA for beta-thymosin Oncorhynchus mykiss 2e-13 AJ250180.1 86 896 3 3 down - mRNA for beta-thymosin Oncorhynchus mykiss 2e-16 AJ250180.1 87 898a 3 1 Down 6/900 S6 ribosomal protein Pagrus major e-102 AY190727.1 88 899 3 1 down 6/900 cytochrome c oxidase subunit II (COXII) Sarda sarda 2e-28 AY971771.1 gene 89 900 3 19 Up 400-higher Alpha tropomyosin Danio rerio 6e-87 BC062870.1 90 903 3 17 up - ubiquinol-cytochrome c reductase core I Oncorhynchus mykiss 1e-32 AF465782.1 protein 91 912 3 15 up Proportional Cytochrome b gene Pimephales notatus e-136 U66606.1 92 917 3 19 variable - clone RP71-86I11 in linkage group 9 Danio rerio 1e-08 BX640500.10 93 918 3 19 down 900 Skeletal alpha-actin Cyprinus carpio 1e-57 AY395870.1 94 919a 3 19 down 6/900 Skeletal alpha-actin Cyprinus carpio 4e-51 AY395870.1 95 920 3 17 down 4/6/900 clone IMAGE:7395709 Danio rerio 8e-99 BC092811.1 96 921 3 17 down 4/6/900 Chr 5 clone CTC-254B4 Homo sapiens 0.57 AC022103.5 97 923 3 17 down 900 Chr 8 clone CTD-224208 Homo sapiens 9.4 AC104376.6
223 No. Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 98 924 3 15 down 900 carboxypeptidase B1 Danio rerio 1e-51 BC067637.1 99 930 3 14 down 900 zgc:65840 Danio rerio 0.13 BC058848.1 100 934 3 12 Up - zgc:92237 Danio rerio e-101 NM_001003728.1 101 935 3 12 up - zgc:92237 Danio rerio 2e-96 NM_001003728.1 102 956 4 12 Up - clone DKEY-81L13 in linkage group 5 Danio rerio 2.2 CR932980.11 103 966 4 11 Up - 12q BAC RP11-916013 Homo sapiens 0.54 AC078873.22 104 968a 4 19 up 6/900 clone CH211-10K1 in linkage group 14 Danio rerio 9e-06 BX324205.5 105 968b 4 19 up 6/900 Ribosomal protein L3 mRNA Danio rerio <0.0001 NM_001001590.1 106 969a 4 19 down 4/6/900 Skeletal alpha actin Cyprinus carpio 2e-59 D50028.1 107 970 4 19 down 900 Chymotrypsinogen B1 Danio rerio e-126 BC055574.1 108 971a 4 12 Down 4/6/900 Skeletal alpha actin Cyprinus carpio 6e-41 D50028.1 109 971b 4 12 Down 4/6/900 Forkhead protein FKHR Danio rerio e-173 AF114262.1 110 977c 4 11 Down 4/6/900 clone DKEY-225F5 in linkage group 3 Danio rerio 3e-12 BX682558.6 111 977d 4 11 Down 4/6/900 clone CH211-10K1 in linkage group 14 Danio rerio 2e-09 BX324205.5 112 979 4 17 up 6/900 zgc:103640 Danio rerio e-100 BC085570.1 113 985 4 15 up Proportional chromosome UNK clone CH261-77K20 Gallus gallus 0.57 AC147644.3 114 986 4 15 Up 4/6/900 PAC clone RP4-725G10 from 7 Homo sapiens 2.2 AC006970.6 115 989 4 15 Up 4/6/900 clone CH211-1O14 in linkage group 5 Danio rerio 1e-66 BX530075.7 116 994 4 14 down Proportional sarcoendoplasmic reticulum calcium ATPase Danio rerio 2e-37 AY737278.1 117 999 4 17 down - cDNA clone IMAGE:7395709 Danio rerio 2e-93 BC092811.1 118 1000 4 17 up - clone IMAGE:7395709 Danio rerio 1e-66 BC092811.1 119 1002 4 15 down 6/900 NADH dehydrogenase subunit 2 gene Hybopsis winchelli 2e-87 AF111233.1 120 1004 4 14 down 900 sarcoendoplasmic reticulum calcium ATPase Danio rerio 4e-48 AY737278.1 121 1007 5 5 Up - ATP synthase, H+ transporting Danio rerio 3e-64 BC045894.1 mitochondrial FO complex, subunit c 122 1009 5 5 Up - clone mth2-46e9 Medicago truncatula 0.54 AC148406.12 123 1017 5 1 up 6/900 Fast muscle troponin T isoform TnnT3b Danio rerio 9e-77 AF425741.1 124 1021a 5 5 up 4/6/900 Aldolase B Danio rerio <0.0001 AF533646.1 125 1021b 5 5 up 4/6/900 Proteasome subunit beta 7 Danio rerio 1e-53 AF155581.1
224 No. Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 126 1022 5 5 up - zgc:66382 Danio rerio e-158 BC055625.1 127 1026 5 5 up 4/6/900 Proteasome subunit beta 7 Danio rerio 1e-50 AF155581.1 128 1029 5 3 down Proportional zgc:77877 Danio rerio <0.0001 BC054669.1 129 1038 5 16 down - clone IMAGE:7083922 Danio rerio 5e-69 BC076226.1 130 1048 5 15 up Proportional 40S ribosomal protein S3a Danio rerio 1e-72 AY648734.1 131 1049 5 14 down 4/6/900 cytochrome oxidase subunit I Gobiocypris rarus e-121 AY899292.1 132 1056 5 15 up - NADH dehydrogenase subunit 2 Hybopsis winchelli e-121 AF111233.1 133 1057a 5 15 up 4/6/900 mRNA for cathepsin L preprotein Cyprinus carpio e-135 AB128161.1 134 1057b 5 15 up 4/6/900 Cytochrome b gene Pimephales notatus e-133 U66606.1 135 1058 5 15 down 900 Stathmin Gallus gallus 7e-34 NM_001001858.1 136 1062 5 14 up 900 BAC clone RP23-297M4 from 5 Mus musculus 0.11 AC125183.4 137 1063 5 14 up 6/900 ribosomal protein S3A Danio rerio 7e-80 BC059543.1 138 1064a 6 5 Down - Proteasome subunit beta 7 Danio rerio 1e-56 AF155581.1 139 1064c 6 5 Down - Titin mRNA Danio rerio 3e-36 AY081167.1 140 1067 6 5 up Proportional clone mth2-46e9 Medicago truncatula 0.40 AC148406.12 141 1075a 6 1 up Proportional Fast muscle troponin I mRNA Danio rerio e-131 AF425744.1 142 1075b 6 1 up Proportional projectin Procambarus clarkii 0.41 AB055927.1 143 1076b 6 1 down - fast myosin heavy chain 4 Danio rerio 7e-80 AY921650.1 144 1080 6 1 down - Heat shock cognate 70kDa Carassius auratus 5e-93 AY195744.1 145 1081 6 1 down 900 fast myosin heavy chain 4 Danio rerio 3e-57 AY921650.1 146 1089 6 5 Up 4/6/900 Proteasome subunit beta7 (PSMB7) Danio rerio 7e-34 AF155581.1 147 1090 6 5 up 4/6/900 Titin mRNA Danio rerio 1e-19 AY081167.1 148 1092 6 5 Up - Titin mRNA Danio rerio 2e-25 AY081167.1 149 1093 6 5 up - Titin mRNA Danio rerio 1e-41 AY081167.1 150 1100 6 1 Up - Fast muscle troponin I mRNA Danio rerio e-129 AF425744.1 151 1101 6 1 up 6/900 Fast muscle troponin I mRNA Danio rerio e-106 AF425744.1 152 1102 6 1 up 2/400 projectin Procambarus clarkii 0.42 AB055927.1 153 1104 6 1 up - Troponin T3a, fast skeletal muscle Danio rerio 4e-66 BC053304.1 154 1105 6 1 up 6/900 Fast skeletal muscle troponin T Danio rerio 1e-63 AF180889.
225 No. Seq Anc Arp Response Conc dep Identity Species E-value Accession no. 155 1107 6 1 down 900 Fast muscle troponin T isoform TnnT3b Danio rerio 3e-54 AF425741.1 156 1109 6 10 Up - Heat shock protein 90-beta Danio rerio 7e-43 AF042108.1 157 1111 6 unknown - zgc:66165 Danio rerio 0.027 BC054654.1 158 1112 6 unknown - Isocitrate dehydrogenase 2 (NADP+) Danio rerio e-109 BC063967.1 159 1114 6 unknown - Slow muscle myosin heavy chain Danio rerio e-140 AF425742.1 160 1119 6 unknown - PAC clone RP4-733B9 from 7 Homo sapiens 0.43 AC005532.2 161 1128a 6 unknown - trafficking protein particle complex 6b Danio rerio 2e-33 BC083391.1 162 1129 6 unknown - FLJ22626-like mRNA Danio rerio 8e-52 AY648738.1 163 1135 6 unknown - NSS 164 1149 6 10 Up 4/6/900 slow myosin heavy chain 1 Danio rerio <0.0001 AY921649.1 165 1150 6 10 Up - Heat shock protein 90-beta Danio rerio 3e-42 AF042108.1 166 1158 6 15 Up 4/6/900 Selenoprotein T 1b (sept 1b), mRNA Danio rerio 6e-07 NM_178292.3 167 1159 6 15 Up 4/6/900 BAC clone RP24-512P7 from chr. 8 Mus musculus 0.45 AC134323.3 168 1160 6 15 Up 4/6/900 PAC clone RP4-733B9 from 7 Homo sapiens 0.43 AC005532.2
226 Table 42: A One hundred and sixty-eight candidate bands identified from the thermal stress experiment with clear sequence data. Seq=sequence number, Anc=anchor primer, Arp=arbitrary primer, response=gene expression response to stressor with “up” denoting up- regulation, “down” denoting down-regulation and “variable” indicating variation in expression of the band, level=time period at which gene expression response was observed, expression=specificity of time interval at which gene itself was expressed, identity=BLAST match, species=species with homologous gene, E-value=expect value of BLAST match and Accession no.=GenBank accession number of homologous gene. If there was no BLAST match for the gene, it was designated as having “no significant similarity” (NSS) in the identity column. No. Seq Anc Arp Response Level expression Identity Species E-value Accession no. 1 1162 1 7 Up 48 hr 48-specific Translationally-controlled tumor Labeo rohita 3e-80 AY028419.2 protein 2 1166 1 7 up 24/48 Both batches eukaryotic translation initiation Danio rerio 1e-51 AY648723.1 factor 2 gamma 3 1168 1 7 up 48 48-specific ribosomal protein S15 Danio rerio 1e-35 BC076221.1 4 1169 1 5 down 24/48 Both batches Titin Danio rerio 3e-36 AY081167.1 5 1177 1 1 -- 24-higher mitochondrial DNA Carassius auratus 5e-60 AB111951.1 6 1181a 1 5 up 24 24-higher ATP synthase H+ transporting Danio rerio e-112 BC045894.1 mitochondrial FO complex, subunit c 7 1184 1 5 down 24/28 Both batches Titin Danio rerio 1e-20 AY081167.1 8 1190 1 1 up 24 24-specific Ribosomal protein L3 Danio rerio 9e-06 BC091460.1 9 1195 1 7 up 48 48-specific Translationally-controlled tumor Labeo rohita 1e-79 AY028419.2 protein 10 1197 1 5 up 24 24-specific ribosomal protein L18a Danio rerio e-103 BC049045.1 11 1198 1 5 Up 24 24-specific ribosomal protein L18a Danio rerio e-111 BC049045.1 12 1199a 1 5 Up 24 Both batches ribosomal protein L18a Danio rerio e-100 BC049045.1 13 1202 1 3 up 48 48-specific ribosomal protein L18a Danio rerio 2e-99 BC049045.1 14 1203 1 3 up 24/48 Both batches clone DKEY-218L8 in linkage Danio rerio 2e-47 CR631129.10 group 19 15 1204 1 3 down 24 Both batches ribosomal protein L18a Danio rerio e-111 BC049045.1 16 1211b 1 15 -- 48-specific Cytochrome b gene Pimephales notatus e-123 U66606.1 17 1211c 1 15 -- 48-specific clone DKEY-218L8 in linkage Danio rerio 6e-47 CR631129.10 group 19
227 No. Seq Anc Arp Response Level expression Identity Species E-value Accession no. 18 1214 1 15 up 24 24-specific Carboxypeptidase B Paralichthys olivaceus 1e-22 AB099302.1 19 1217 1 15 up 24 24-higher ribosomal protein S3A Danio rerio 3e-48 BC059543.1 20 1219 1 15 up 24 24-specific 2-peptidylprolyl isomerase A Danio rerio 8e-09 AY391452.1 21 1226 1 10 up 48 Both batches Desmin Danio rerio 3e-92 BC092715.1 22 1229 1 10 up 24 Both batches zgc:92237 Danio rerio e-106 NM_001003728.1 23 1232 1 10 up 24 Both batches clone RP23-186F24 on chromosome Mus musculus 5.3 AL669965.13 4 24 1236 1 2 down 24 24-specific Keratin 18 Danio rerio 4e-14 BC065848.1 25 1244 1 2 up 48 48-higher Clone RK053A1H09 Danio rerio 6e-10 AY394955.1 voltage-dependent anion channel 2 26 1250a 1 15 up 24 Both batches Fast skeletal myosin light chain 3 Cyprinus carpio e-143 D85141.1 27 1252 1 14 down 48 Both batches Chr 1 genomic DNA Lotus corniculatus 0.12 AP006107.1 28 1256a 1 15 down 24/48 48-higher Seq from clone RP71-34G2 in link Danio rerio 1e-19 AL928906.4 grp 7 29 1256b 1 15 down 24/48 48-higher Cytochrome b gene Pimephales notatus e-137 U66606.1 30 1256c 1 15 down 24/48 48-higher Seq from clone CH211-255F4 in Danio rerio 2e-40 AL954741.9 link grp 22 31 1258a 1 15 down 24/48 48-higher Seq from clone RP11-192G4 on chr 1 Homo sapiens 0.1 AL356059.27 32 1258b 1 15 down 24/48 48-higher Seq from clone CH211-133L21 in Danio rerio 1e-10 BX323873.9 link grp 19 33 1260b 1 15 up 24 Both batches 16S ribosomal gene Aphanius dispar dispar 2e-27 AF449330.1 34 1263a 1 10 down 24/48 Both batches Eukaryotic translation initiation Danio rerio 3e-51 BC057465.1 factor3,subunit 8 35 1263b 1 10 down 24/48 Both batches Seq from clone CH211-133L21 in Danio rerio 6e-12 BX323873.9 link grp 19 36 1265 1 10 down 24 Both batches Collagen, type I, alpha 3 Danio rerio E<0.000 NM_201478.1
37 1273 2 3 down 48 48-specific Seq from clone BUSM1-249N21 in Danio rerio 2e-49 AL732421.9 link grp 9, similar to titin
228 No. Seq Anc Arp Response Level expression Identity Species E-value Accession no. 38 1280 2 1 up 24/48 Both batches 12S ribosomal gene Luxilus chrysocephalus E<0.000 AY216540.1 39 1281 2 1 down 48 Both batches Elongation factor-1 alpha Cyprinus carpio 5e-35 AF485331.1 40 1282 3 11 up 24/48 Both batches Zgc:55564 Danio rerio e-114 BC045386.1 41 1285b 3 11 up 24/48 Both batches Translation elongation factor 1 Danio rerio e-117 AY099512.1 gamma 42 1287 3 11 up 24/48 Both batches Translation elongation factor 1 Danio rerio e-119 AY099512.1 gamma 43 1288 3 11 down 24 24-specific Translation elongation factor 1 Danio rerio e-119 AY099512.1 gamma 44 1299 3 10 Up 24 Both batches Intermediate filament protein type II Carassius auratus 1e-96 M87773.1 keratin 45 1300a 3 10 down 24/48 Both batches Intermediate filament protein type II Carassius auratus 4e-69 M87773.1 keratin 46 1300b 3 10 down 24/48 Both batches Genomic DNA from clone Danio rerio 5e-93 BC065473.1 47 1301a 3 10 up 24/48 Both batches Ribosomal protein L32 Epinephalus coioides 2e-89 AF450502.1 48 1305 3 10 down 24 24-specific Seq from clone DKEY-104N21 in Danio rerio 2e-24 BX323874.4 link grp 16 49 1306 3 10 Down 24 Both batches Seq from clone CH211-51F10 in Danio rerio 8e-21 BX510994.6 link grp 19 50 1307 3 10 up 24 24-specific NSS 51 1311a 3 4 down 24/48 Both batches Crystallin, beta A1 Xenopus laevis 5e-04 BC053794.1 52 1311b 3 4 down 24/48 Both batches Zgc:77704 Danio rerio 1e-32 BC063972.1 53 1312b 3 4 up 24/48 Both batches Ribosomal protein L13 Danio rerio e-139 AY561516.1 54 1313 3 4 down 24/48 Both batches Myosin light chain 2 Danio rerio e-117 AY057074.1 55 1314 3 4 up 48 Both batches Seq from clone CH211-207E14 in Danio rerio 9e-18 AL954678.8 link grp 9 56 1325 3 2 -- 48-higher Seq from clone DKEY-53H9 Danio rerio 0.44 AL929596.11 57 1327 3 2 Up 24 both batches Type I cytokeratin Danio rerio 1e-22 AF084461 58 1331 3 2 up 24/48 Both batches Zgc:56171 Danio rerio e-101 BC045965.1
229 No. Seq Anc Arp Response Level expression Identity Species E-value Accession no. 59 1335 3 2 up 48 Both batches ATPase Na+/K+ transporting Danio rerio 4e-41 BC045283.1 alpha1a.1 polypeptide 60 1340 3 10 up 48 Both batches Glutamic acid decarboxylase isoform 6Carassius auratus 7e-40 AF149834.1 61 1340 down 24 Both batches 62 1347b 3 11 down 24 Both batches Seq from clone DKEY-243E1 in Danio rerio 6e-16 BX005423.9 link grp 8 63 1347c 3 11 down 24 Both batches 3D7 chr. 10 section 5 of 7 Plasmodium falciparum 0.44 AE014833.1 64 1348 3 11 up 24 Both batches cDNA clone seq Danio rerio 3e-91 BC065887.1 65 1349 3 11 up 24 Both batches Seq from clone DKEYP-84F11 in Danio rerio 2e-06 BX890617.13 link grp 19 down 48 Both batches 66 1352 3 11 up 48 48-specific RK058A2C12 eukaryotic translation Danio rerio e-118 AY394968.1 elongation factor 1 gamma 67 1354 3 11 up 48 Both batches BAC clone RP24-315E7 on chr 6 Mus musculus 1.7 AC122468.3 68 1356 3 10 down 24 Both batches Seq from clone DKEY-31N5 Danio rerio 2e-80 AL929222.6 69 1357 3 10 up 24/48 Both batches Desmin Danio rerio e-128 U47113.2 70 1358 3 10 up 24/48 Both batches Intermediate filament protein type II Carassius auratus e-115 M87773.1 keratin 71 1360 3 10 Up 24/48 Both batches Heat shock protein 90-beta Danio rerio 7e-40 AF042108.1 72 1361 3 10 up 24/48 48-higher Ribosomal protein L32 Epinephelus coiodes 3e-91 AF042108.1 73 1368 3 4 Variable Both batches proteasome (prosome, macropain) Danio rerio E<0.000 BC049471.11 26S subunit, ATPase, 1 74 1369 3 4 variable Both batches zgc:64156 Danio rerio e-136 BC057434.1 75 1370 3 4 down 24/48 Both batches Zgc:77704 Danio rerio 1e-44 BC063972.1 76 1371 3 4 up 24/48 Both batches Ribosomal protein L13 Danio rerio e-140 AY561516.1 77 1379b 3 7 down 48 48-specific SEC61 gamma Harpagifer antarcticus 7e-34 AY258259.1 78 1383 3 5 up 24/48 Both batches Heat shock cognate 70kDa protein Carassius auratus E<0.000 AY195744.1 gibelio 79 1384 3 5 up 24/48 Both batches BAC clone RP24-171F12 on chr. 7 Mus musculus 7.1 AC127683.10
230 No. Seq Anc Arp Response Level expression Identity Species E-value Accession no. 80 1386 3 5 up 24/48 Both batches ATPase Na/K transporting alpha1a.1 Danio rerio 1e-47 BC045283.1 polypeptide 81 1389b 3 7 up 48 48-specific mRNA for growth hormone Ctenopharyngodon 7e-34 X60474.1 idellus 82 1396 3 7 up 24/48 Both batches SEC61 gamma Harpagifer antarcticus 3e-42 AY258259.1 83 1397 3 5 up 24/48 Both batches Heat shock cognate 70kDa protein Carassius auratus E<0.000 AY195744.1 gibelio 84 1398 3 5 up 24/48 Both batches Proteasome subunit beta 7 Danio rerio 5e-26 AF155581.1 85 1399 3 5 down 48 Both batches Clone CH211-247B3 in link grp 19 Danio rerio 7.4 BX322540.5 86 1400 3 5 up 24 Both batches Proteasome subunit beta 7 Danio rerio 2e-59 AF155581.1 87 1401 3 5 up 24/48 Both batches Proteasome subunit beta 7 Danio rerio 6e-50 AF155581.1 88 1404b 3 3 down 24 24-specific SEC61 gamma Harpagifer antarcticus 2e-37 AY258259.1 89 1407 3 3 up 24 Both batches Intermediate filament protein type II Carassius auratus 6e-16 M87773.1 keratin 90 1418 4 13 up 24/48 Both batches Ribosomal protein L9 Danio rerio e-108 AY141976.1 91 1419 4 13 up 24/48 24-higher Clone CH211-132M19 in link grp 21 Danio rerio 8e-06 BX510931.8 92 1420 4 13 up 24/48 Both batches IP4/PIP3 binding protein-like protein Lapemis hardwicki 0.45 AF165226.1 mRNA 93 1422 4 13 up 24/48 Both batches Skeletal alpha-actin Cyprinus carpio 8e-83 D50028.1 94 1424 4 16 -- 24 24-specific Clone R2151A2B11 muscle cofilin 2 Danio rerio 2e-40 AY398324.1 95 1425 4 13 up 24 24-specific Heat shock protein 90 alpha Cyprinus carpio e-140 AF170295.2 96 1427 4 13 up 24/48 24-higher Clone CH211-132M19 in link grp 21 Danio rerio 5e-04 BX510931.8 97 1428 4 13 up 24 24-specific Clone CH211-132M19 in link grp 21 Danio rerio 8e-06 BX510931.8 98 1429 4 4 up 24/48 Both batches Cosmid F58F6 Caenorhabditis elegans 0.48 AF036699.2 99 1436 4 2 down 24/48 Both batches Myosin regulatory light chain Cyprinus carpio E<0.000 AB037014.1 100 1437 4 2 up 24/48 Both batches Complement C3 mRNA Ctenopharyngodon 1e-93 AY374472.1 idella 101 1444 4 2 down 24/48 Both batches 12 PAC RP23-454B23 Homo sapiens 0.49 AC005845.1 102 1445 4 2 down 24/48 Both batches NBRP Xenopus laevis 2e-06 BP687865.1
231 No. Seq Anc Arp Response Level expression Identity Species E-value Accession no. 103 1446 4 1 up 24/48 Both batches Heat chock cognate 70kDa Carassius auratus E<0.000 AY195744.1 gibelio 104 1448 4 1 up 48 Both batches Elongation factor-1-alpha mRNA Cyprinus carpio 8e-43 AF485331.1 105 1450 4 1 up 48 Both batches Keratin 18 Danio rerio 4e-91 BC065848.1 106 1451a 4 4 up 48 Both batches Chymotrypsinogen B1 Danio rerio 1e-14 BC055574.1 107 1451b 4 4 up 48 Both batches Clone CH211-10K1 in link grp 14 Danio rerio 3e-11 BX324205.5 108 1452 4 4 -- 48-specific Clone DKEYP-113D7 in link grp 19 Danio rerio 8e-43 BX323079.1 109 1453 4 4 up 24/48 Both batches Cosmid F58F6 Caenorhabditis elegans 0.49 AF036699.2 110 1458 5 3 down 24/48 Both batches cDNA clone IMAGE:6961353 Danio rerio 2e-46 BC067631.1 111 1463 5 2 down 24/48 Both batches Glutathione S-transferase pi mRNA Danio rerio 2e-70 AF285098.1 112 1464 5 2 up 48 Both batches Complement C3 mRNA Ctenopharyngodon 2e-83 AY374472.1 idella 113 1469a 5 1 down 24/48 Both batches Fast muscle troponin I mRNA Danio rerio e-121 AF425744.1 114 1469b 5 1 down 24/48 Both batches Elongation factor 1-alpha Cyprinus carpio 3e-79 AF485331.1 115 1474 5 4 down 24 Both batches Zgc:56380 Danio rerio e-136 NM_200951.2 116 1484 5 4 down 24 Both batches TW-183 section ¼ Chlamydophila 6.6 AE017157.1 pneumoniae 117 1485 5 3 down 48 Both batches Adenosyl homocysteinase Medicago trunculata 0.11 AY224188.1 118 1487 5 3 Down 48 Both batches clone IMAGE:6961353 Danio rerio 9e-58 BC067631.1 119 1488 5 3 down 48 Both batches clone IMAGE:6961353 Danio rerio 1e-66 BC067631.1 120 1489 5 2 down 24 Both batches Clone DKEYP-113D7 in link grp 19 Danio rerio 1e-26 BX323079.7 121 1491 5 2 down 24 Both batches Glutathione S-transferase pi mRNA Danio rerio 1e-62 AF285098.1 122 1493 5 1 down 24/48 Both batches cDNA clone IMAGE:4786889 Danio rerio 2e-67 BC059613.1 123 1495 5 4 up 24/48 Both batches Proteasome subunit beta 7 Danio rerio e-145 AF155581.1 124 1496b 5 13 down 24 Both batches Clone BUSM1-258D18 in link grp 9 Danio rerio e-133 AL772356.2 125 1503 5 13 up 48 Both batches 3 BAC RP11-576M8 Homo sapiens 0.42 AC107311.8 126 1517 5 10 up 24/48 Both batches Clone CH211-165I22 in link grp 1 Danio rerio 1e-50 AL929509.15 127 1519 5 10 down 24/48 Both batches Clone RP24-388P13, chr. 1 Mus musculus 0.38 AC101915.7
232 No. Seq Anc Arp Response Level expression Identity Species E-value Accession no. 128 1525 5 10 up 24/48 Both batches Guanine nucleotide binding protein Danio rerio 2e-36 AY423038.1 beta polypeptide 2-like 1 129 1531 5 10 down 24/48 Both batches Clone CH211-237N17 in link grp 3 Danio rerio 0.39 BX470190.5 130 1533 5 7 up 24/48 Both batches Aldolase B mRNA Danio rerio E<0.000 AF533646.1 131 1534 5 7 up 24/48 Both batches Aldolase B mRNA Danio rerio e-164 AF533646.1 132 1535 5 7 down 24/48 Both batches Clone CH211-146M5 Danio rerio 5e-50 BX005193.17 133 1540 5 7 up 24/48 Both batches SEC61 gamma Danio rerio 8e-49 AY258259.1 134 1541 5 7 down 24/48 Both batches Hypothetical LOC299073 Rattus norvegicus 0.44 XM_216716.1 135 1544b 5 7 up 24 Both batches Zgc:56139 Danio rerio 2e-06 BC045939.1 136 1548 5 13 down 24 Both batches Clone DKEY-25E12 in link grp 20 Danio rerio 0.42 BX537272.5 137 1549 5 13 up 24 24-specific BAC clone RP24-409M22 on chr. 12 Mus musculus 1.7 AC132269.3 138 1550 5 13 down 24 24-specific Clone BUSM1-258D18 in link grp 9 Danio rerio e-120 AL772356.2 139 1553a 5 10 Down Both batches Slow muscle myosin heavy chain Danio rerio e-137 AF425742.1 140 1553b 5 10 Down Both batches Heat shock protein 90-beta mRNA Danio rerio 2e-31 AF042108.1 141 1554 5 10 up 48 Both batches Aldolase B Danio rerio e-157 AF533646.1 142 1555b 5 10 up 24/48 Both batches Heat shock protein 90-beta Danio rerio 1e-32 AF042108.1 143 1556a 5 10 up 48 Both batches Eukaryotic translation initiation Danio rerio 1e-93 BC057465.1 factor subunit 8 144 1556b 5 10 up 48 Both batches Heat shock protein 90-beta Danio rerio 2e-46 AF042108.1 145 1557 5 10 Up 24/48 Both batches Heat shock protein 90-beta Danio rerio 2e-46 AF042108.1 146 1559 5 10 up 24/48 Both batches Ribosomal protein L32 Epinephelus coioides 4e-66 AF450502.1 147 1560 5 10 down 24/48 Both batches Clone RP24-388P13, chr 1 Mus musculus 0.45 AC101915.7 148 1561 5 10 down 24/48 Both batches Chr 11 clone RP11-665E10 Homo sapiens 0.43 AP000676.6 149 1573b 5 7 up 24/48 24-higher Zgc:56139 Danio rerio 2e-06 BC045939.1 150 1574 6 4 down 24/48 Both batches Clone CH211-273J2 Danio rerio 0.11 AL935276.16 151 1576 6 3 down 24 Both batches Finished DNA, clone ChEST67p2 Gallus gallus 0.40 BX930999.2 152 1579 6 1 down 24/48 Both batches Clone BUSM1-71F1 in link grp 9 Danio rerio 3e-48 BX248311.6 153 1583 6 4 down 24/48 Both batches Clone BUSM1-258D18 in link grp 9, t Danio rerio 3e-94 AL772356.2 154 1584 6 4 up 48 Both batches Zgc:77755 Danio rerio 1e-81 BC065447.1
233 No. Seq Anc Arp Response Level expression Identity Species E-value Accession no. 155 1588 6 13 up 48 48-higher Myosin, heavy polypeptide 2, fast Danio rerio e-171 BC071279.1 muscle specific 156 1589 6 13 up 24/48 Both batches 40S ribosomal protein S4 mRNA Ictalurus punctatus 4e-78 AF402812.1 157 1608 6 8 down 48 48-specific cDNA clone MGC:66406 Danio rerio 6e-56 BC055643.1 158 1614 6 7 up 24/48 Both batches SEC61 gamma Harpagifer antarcticus 1e-50 AY258259.1 159 1617 6 7 down 24 Both batches Clone DKEY-31J3 in link grp 14 Danio rerio 2e-21 BX571981.5 160 1625 6 7 up 24/48 Both batches Ribosomal protein S15 mRNA Danio rerio 2e-24 NM_001001819.1 161 1626 6 7 up 24 Both batches Ribosomal protein S15 mRNA Danio rerio 3e-23 NM_001001819.1 162 1639 6 13 up 48 48-higher Myosin, heavy polypeptide 2, fast Danio rerio E<0.000 BC071279.1 muscle specific 163 1640a 6 13 up 24/48 Both batches Receptor for activated protein kinase Oreochromis e-105 AY342000.1 C mossambicus down 24 Both batches 164 1642 6 13 up 24/48 Both batches 40S ribosomal protein S4 Ictalurus punctatus 5e-81 AF402812.1 165 1643 6 13 up 24 Both batches Elastase A precursor mRNA Gadus morhua 0.002 U57055.1 down 48 Both batches 166 1645 6 13 up 48 Both batches Chr 5 clone RP23-405011 Mus musculus 1.7 AC1134910.5 down 24 Both batches 167 1647 6 13 up 24 Both batches 3 BAC RP11-576MB Homo sapiens 0.42 AC107311.8 168 1653 6 7 up 24/48 Both batches SEC61 gamma Harpagifer antarcticus 5e-41 AY258259.1
234
Table 43: Twenty-three candidate bands from differential display analysis chosen for real-time PCR analysis. The observed gene expression response is stated with each different stressor. An expression response of “ambiguous” refers to bands that were observed to be up-regulated in some gels and down-regulated in others. “Up” refers to those bands whose intensity was more than that of controls, while “down” refers to bands whose intensity was less than those of controls.
Sequence No. and Accession no. Gene expression response to Gene Identity copper zinc Thermal stress QPCR1: aldolase B NM_194367.3 ambiguous Up Up (Danio rerio) QPCR2: skeletal α-actin D50028.1 down down Up (Cyprinus carpio) QPCR3: α-tropomyosin NM_131105 up Up -- (Danio rerio) QPCR4: β-thymosin NM_021278.1 down down -- (Mus musculus) QPCR5: AB099302.1 down down Up (24 hr) carboxypeptidase B (Paralichthys olivaceus) QPCR6: NM_212618.1 down down Up (48 hr) chymotrypsinogen B1 (Danio rerio) QPCR7: cytochrome c AF294832.1 down up -- oxidase subunit III (Oncorhynchus nerka) QPCR8: cytochrome b U66606.1 up up down (Pimephales notatus) QPCR9: elongation AF485331.1 down down down factor-1 α (Cyprinus carpio) QPCR10: eukaryotic NM_173263.13 down up Up translation elongation factor γ (Danio rerio) QPCR11: guanine AY423038.1 up -- Up nucleotide-binding protein (Danio rerio) QPCR12: fast muscle AY333450.1 ambiguous down -- specific heavy myosin chain 4 (Danio rerio) QPCR13: isocitrate BC063967.1 -- down Up dehydrogenase 2 (Danio rerio)
235 Sequence No. and Accession no. Gene expression response to Gene Identity copper zinc Thermal stress QPCR14: 60S ribosomal AY648813.1 down down -- protein L12 (Danio rerio) QPCR15: ribosomal AF401581.1 down down -- protein L27 (Ictalurus punctatus) QPCR16: proteasome NM_002810.1 up up ambiguous 26S subunit (Homo sapiens) QPCR17: proteasome AF155581.1 ambiguous up Up subunit 7 beta (Danio rerio) QPCR18: survival motor NM_212601.1 ambiguous up -- neuron domain containing 1 (Danio rerio) QPCR19: stathmin NM_00100185 ambiguous down -- (Gallus gallus) 8.1 QPCR20: Troponin T3a, BC053304.1 up ambiguous -- fast, skeletal muscle (Danio rerio) QPCR21: titin (Danio AY081167.1 up up down rerio) QPCR22: Troponin AF425741.1 ambiguous ambiguous Up (24 hr) TnnT3b (Danio rerio) QPCR23: Fast muscle AF425744.1 ambiguous up down troponin I (Danio rerio)
236 Table 44: Genes that were identified in all three stress experiments from the differential display analysis.
No. Gene Identity and Species Annotation Remarks 1 ATP synthase H+ BC045894.1 Down-regulated by 200 µg/L transporting mitochondrial Cu, up-regulated by zinc and FO complex, subunit c 24-hr thermal stress (Danio rerio) 2 ATPase, Na+/K+ NM_131668.3 Down-regulated by copper, up- transporting, beta 1a regulated by zinc and thermal polypeptide mRNA (Danio stress rerio) 3 Eukaryotic translation AY391422.1 Up-regulated by 50 and 125 elongation factor 2 (Danio µg/L Cu, 600 and 900 µg/L Zn rerio) and 24-hr thermal stress 4 Heat shock protein 90-beta NM_131310.1 Down-regulated only in 200 (Danio rerio) µg/L Cu, up-regulated by zinc and thermal stress 5 heat shock cognate 70 kDa AY195744.1 Down-regulated only in 200 protein (Carassius auratus) µg/L Cu, up-regulated by zinc and thermal stress 6 Myosin, heavy polypeptide NM_152982.2 Down-regulated only in 200 2, fast muscle specific µg/L Cu, up-regulated by 400, (Danio rerio) 600 and 900 µg/L Zn, up- regulated by 48-hr thermal stress 7 NADH dehydrogenase AF111233.1 Showed both up- and down- subunit 2 (Hybopsis regulation with copper and winchelli) zinc, down-regulated by thermal stress 8 ribosomal protein L18a BC049045.1 Down-regulated by copper, 600 (Danio rerio) and 900 µg/L zinc; upregulated by thermal stress 9 Ribosomal protein L3 BC091460.1 Down-regulated by copper, up- (Danio rerio) regulated by 600 and 900 µg/L zinc; upregulated by thermal stress 10 Ribosomal protein S15 NM_001001819.1 Down-regulated by copper; up- (Danio rerio) regulated by 600, 900 µg/L zinc and by thermal stress 11 ribosomal protein S3A BC059543.1 Down-regulated by copper (Danio rerio) (200 µg/L) ; up-regulated by 600, 900 µg/L zinc and by thermal stress 12 40S ribosomal protein S4 AF402812.1 Up-regulated by copper, zinc (Ictalurus punctatus) and thermal stress
237 Table 45: Genes only identified in the differential display analysis of samples from copper experiment A. If concentration is not specified, the expression response refers to all copper-treated samples. No. Gene Identity and Species Annotation Gene Expression Response 1 actinin, alpha 2 (ACTN2) AY391405.1 Proportionally down-regulated (Danio rerio) 2 Alpha-amylase mRNA AF416651.1 Proportionally down-regulated (Lates calcarifer) 3 Anionic trypsin AB091439.1 Down-regulated by 125 and (Oncorhynchus keta) 200 µg/L Cu 4 Basic helix-loop-helix AJ510221.1 Proportionally down-regulated transcription factor (Danio rerio) 5 Beta-actin 1 (Danio rerio) BC063950.1 Down-regulated by 125 and 200 µg/L Cu 6 brefeldin A-inhibited AB209324.1 Up-regulated by 125 and 200 guanine nucleotide- µg/L Cu exchange protein 1 (BIG1) (Homo sapiens) 7 CCAAT/enhancer binding NM_131884.2 Down-regulated by 125 and protein (C/EBP), beta 200 µg/L Cu (Danio rerio) 8 Creatine kinase M2-CK AF055289.1 Up-regulated by 125 and 200 (Cyprinus carpio) µg/L Cu 9 Cytochrome oxidase subunit AY704455.1 Showed both up- and down- II (Hemibarbus maculatus) regulation by 125 and 200 µg/L Cu 10 DNase gamma gene (Mus AY024355.1 Down-regulated by 125 and musculus) 200 µg/L Cu 11 EF-1a mRNA for elongation AB075952.1 Down-regulated by 200 µg/L factor 1a (Oreochromis Cu niloticus) 12 Fast skeletal muscle myosin AF180893.1 Up-regulated by 200 µg/L Cu heavy polypeptide 1 (myhz1) (Danio rerio) 13 HCM2081 gene (Homo AY405009.1 Down-regulated by 200 µg/L sapiens) Cu 14 Keratin 4 (krt4) mRNA BC065848.1 Up-regulated (Danio rerio) 15 LIM domain binding 3 like NM_199858.2 Up-regulated by 125 and 200 (Danio rerio) µg/L Cu 16 NADH dehydrogenase AF391435.1 Proportionally down-regulated subunit I gene (Ctenogobiops feroculus) 17 NADH ubiquinone AF036179.1 Up-regulated by 200 µg/L Cu oxidoreductase subunits 4L
238 No. Gene Identity and Species Annotation Gene Expression Response and 4 (Distoechodon tumirostris) 18 Parvalbumin isoform 1d AF467914.1 Up-regulated by 200 µg/L Cu mRNA (Danio rerio) 19 Peptidylprolyl isomerase A NM_212758.1 Proportionally down-regulated (cyclophilin A) (Danio rerio) 20 Profilin 2 like (Danio rerio) NM_201466.2 Proportionally down-regulated 21 Protocadherin-9 (PCDH9) NM_020403.3 Down-regulated (Homo sapiens) 22 Ribosomal protein L21 AF401575 Down-regulated by 125 and (Ictalurus punctatus) 200 µg/L Cu 23 Ribosomal protein L26 AF401580.1 Up-regulated by 200 µg/L Cu mRNA (Ictalurus punctatus) 24 Ribosomal protein L4 BC049520.1 Down-regulated by 200 µg/L (Danio rerio) Cu 25 Ribosomal protein L5b AF401557 Down-regulated by 125 and (Ictalurus punctatus) 200 µg/L Cu 26 Ribosomal protein L7 NM_213644.1 Showed both up- and down- (Danio rerio) regulation 27 Ribosomal protein S25 NM_200815.1 Showed both up- and down- (Danio rerio) regulation 28 Ribosomal protein S5 (rps5) NM_173232.1 Proportionally up-regulated (Danio rerio) 29 Ribosomal RNA gene AF012418.1 Down-regulated (Ralstonia solanacearum) 30 Similar to neuronal XM_420266.1 Down-regulated by 125 and transmembrane protein 200 µg/L Cu Slitrk4 (Gallus gallus) 31 Synaptotagmin 1 (Rattus AJ617615.1 Up-regulated by 125 and 200 rattus) µg/L Cu 32 Transforming acidic coiled- NM_001004415.1 Up-regulated by 125 and 200 containing protein 2 µg/L Cu (TACC2) (Rattus norvegicus) 33 Translation initiation factor AY648723.1 Up-regulated 2 mRNA (Danio rerio) 34 Type I keratin (Danio rerio) AF174137.1 Up-regulated 35 Type II cytokeratin (ckii) NM_131156.1 Down-regulated by 125 and mRNA (Danio rerio) 200 µg/L Cu
239 Table 46: Genes only identified in the differential display analysis of samples from zinc experiment A. If concentration is not specified, the expression response refers to all zinc-treated samples. No. Gene Identity and Species Annotation Gene Expression Response 1 14kDa apolipoprotein AY445924.1 Proportionally down-regulated (Ctenopharyngodon idella) 2 Beta-fructofuranoside and AY173050.1 Up-regulated beta-fructofuranosidase genes (Lycopersicon esculentum) 3 Cytochrome c oxidase AY971771.1 Down-regulated by 600 and subunit II (COXII) gene 900 µg/L Zn (Sarda sarda) 4 Elastase 2 (Danio rerio) BC042328.1 Down-regulated 5 Eukaryotic translation AY648835.1 Up-regulated initiation factor 3 subunit 4 (Danio rerio) 6 Fast skeletal muscle AF180889.1 Up-regulated by 600 and 900 troponin T (Danio rerio) µg/L Zn 7 Forkhead protein FKHR AF114262.1 Down-regulated by 400, 600 (Danio rerio) and 900 µg/L Zn 8 Mitochondrial ATP synthase AB042437.1 Up-regulated by 900 µg/L Zn alpha-subunit (Cyprinus carpio) 9 mRNA for cathepsin L AB128161.1 Up-regulated by 400, 600 and preprotein (Cyprinus carpio) 900 µg/L Zn 10 Nucleolar protein 5A, BC090915.1 Down-regulated mRNA (Danio rerio) 11 Projectin (Procambarus AB055927.1 Proportionally up-regulated clarkia) 12 Ran-binding protein 7 AY286403.1 Down-regulated by 900 µg/L (Danio rerio) Zn 13 Ribosomal protein S21 BC071475.1 Up-regulated (Danio rerio) 14 Ribosomal protein S24 BC081494.1 Down-regulated by 400, 600 (Danio rerio) and 900 µg/L Zn 15 Sarcoendoplasmic reticulum AY737278.1 Proportionally down-regulated calcium ATPase (serca) (Danio rerio) 16 Selenophosphate synthetase BC081590.1 Down-regulated by 900 µg/L 2 (Danio rerio) Zn 17 Selenoprotein T 1b (sept NM_178292.3 Up-regulated by 400, 600 and 1b), mRNA (Danio rerio) 900 µg/L Zn
240 Table 47: Genes only identified in the differential display analysis of samples from thermal stress experiment A. If time period is not specified, the expression response refers to gene expression response in both the 24- and 48-hr time period. No. Gene Identity and Species Annotation Response 1 16S ribosomal gene AF449330.1 Up-regulated at 24 hours (Aphanius dispar dispar) 2 2-peptidylprolyl isomerase AY391452.1 Up-regulated at 24 hours A (Danio rerio) 3 Adenosyl homocysteinase AY224188.1 Down-regulated at 48 hours (Medicago trunculata) 4 Clone RK053A1H09 AY394955.1 Up-regulated at 48 hours voltage-dependent anion channel 2 (Danio rerio) 5 Collagen, type I, alpha 3 NM_201478.1 Down-regulated at 24 hours (Danio rerio) 6 Elastase A precursor mRNA U57055.1 Up-regulated at 24 hours (Gadus morhua) 7 Eukaryotic translation BC057465.1 Down-regulated initiation factor 3,subunit 8 (Danio rerio) 8 Glutamic acid AF149834.1 Up-regulated at 48 hours decarboxylase isoform 65 (Carassius auratus) 9 Glutathione S-transferase pi AF285098.1 Down-regulated mRNA (Danio rerio) 10 Intermediate filament M87773.1 Showed both up- and down- protein type II keratin regulation (Carassius auratus) 11 IP4/PIP3 binding protein- AF165226.1 Up-regulated like protein mRNA (Lapemis hardwicki) 12 Keratin 18 (Danio rerio) BC065848.1 Showed both up- and down- regulation 13 mRNA for growth hormone X60474.1 Up-regulated at 48 hours (Ctenopharyngodon idellus) 14 Receptor for activated AY342000.1 Up-regulated protein kinase C (Oreochromis mossambicus) 15 Ribosomal protein L13 AY561516.1 Up-regulated (Danio rerio) 16 Ribosomal protein L32 AF042108.1 Up-regulated (Epinephelus coiodes) 17 SEC61 gamma (Harpagifer AY258259.1 Up-regulated antarcticus) 18 Type I cytokeratin (Danio AF084461 Up-regulated at 24 hours rerio)
241 Table 48: Reaction efficiencies calculated for primer pairs of genes analyzed by real- time PCR. Volume of primers used for group A cDNA samples was 2 µl each and that for group B cDNA samples 3 µl each. The concentration of MgCl2 in each reaction was 3.0 mM.
Sequence no. and Gene Identity PolyA RT primer Random nonamer RT (group B samples) primer (group A samples) Slope Efficiency Slope Efficiency 18S (internal standard) -- -- -4.054 76.469 BMV (exogenous standard) -3.469 94.208 -- -- QPCR1: aldolase B (Danio rerio) -3.542 91.569 -2.859 123.754 QPCR2: skeletal α-actin (Cyprinus -3.169 106.803 -3.198 105.444 carpio) QPCR3: α-tropomyosin (Danio rerio) -3.342 99.169 -2.842 124.835 QPCR4: β-thymosin (Mus musculus) -3.646 88.049 -2.986 116.220 QPCR5: carboxypeptidase B -2.948 118.380 -3.413 96.334 (Paralichthys olivaceus) QPCR6: chymotrypsinogen B1 -3.611 92.672 -3.213 104.755 (Danio rerio) QPCR7: cytochrome c oxidase -3.607 89.338 -3.080 111.191 subunit III (Oncorhynchus nerka) QPCR8: cytochrome b (Pimephales -3.611 89.204 -3.084 110.986 notatus) QPCR9: elongation factor-1 α -3.125 108.978 -3.323 99.955 (Cyprinus carpio) QPCR10: eukaryotic translation -3.362 98.354 -2.640 139.214 elongation factor γ (Danio rerio) QPCR11: guanine nucleotide-binding -3.227 104.119 -3.185 106.049 protein (Danio rerio) QPCR12: fast muscle specific heavy -3.488 93.507 -3.171 106.708 myosin chain 4 (Danio rerio) QPCR13: isocitrate dehydrogenase 2 -3.376 97.791 -3.035 113.544 (Danio rerio) QPCR14: 60S ribosomal protein L12 -3.687 86.733 -3.340 99.251 (Danio rerio) QPCR15: ribosomal protein L27 -3.446 95.070 -3.653 87.822 (Ictalurus punctatus) QPCR16: proteasome 26S subunit -3.522 92.278 -2.993 115.830 (Homo sapiens) QPCR17: proteasome subunit 7 beta -3.292 101.264 -3.178 106.378 (Danio rerio) QPCR18: survival motor neuron -3.577 90.354 -3.345 99.046 domain containing 1 (Danio rerio) QPCR19: stathmin (Gallus gallus) -3.245 103.313 -3.384 97.473 QPCR20: Troponin T3a, fast, skeletal -3.221 104.391 -3.048 112.855
242 Sequence no. and Gene Identity PolyA RT primer Random nonamer RT (group B samples) primer (group A samples) Slope Efficiency Slope Efficiency muscle (Danio rerio) QPCR21: titin (Danio rerio) -3.140 108.195 -3.271 102.170 QPCR22: Troponin TnnT3b (Danio -3.295 101.136 -2.914 120.379 rerio) QPCR23: Fast muscle troponin I -3.230 103.984 -3.170 106.755 (Danio rerio)
243
Table 49: Real-time PCR results of the twenty-three selected genes for copper A samples. 18S rRNA was the endogenous standard for calculating the change in gene expression. Fold-change was measured in the 200 µg/L Cu-treated groups and was compared to expression in control group samples.
Sequence No. And Gene Differential Real-time PCR Fold Change Identity Display Gel Response Response QPCR1: aldolase B (Danio ambiguous downregulated 1.7811 rerio) QPCR2: skeletal α-actin downregulated upregulated 1.6384 (Cyprinus carpio) QPCR3: α-tropomyosin upregulated upregulated 1.2137 (Danio rerio) QPCR4: β-thymosin (Mus downregulated upregulated 1.4820 musculus) QPCR5: carboxypeptidase downregulated downregulated 2.5152 B (Paralichthys olivaceus) QPCR6: chymotrypsinogen downregulated upregulated 1.0992 B1 (Danio rerio) QPCR7: cytochrome c downregulated downregulated 2.3732 oxidase subunit III (Oncorhynchus nerka) QPCR8: cytochrome b upregulated upregulated 3.6854 (Pimephales notatus) QPCR9: elongation factor-1 downregulated downregulated 1.8528 α (Cyprinus carpio) QPCR10: eukaryotic downregulated upregulated 1.0353 translation elongation factor γ (Danio rerio) QPCR11: guanine upregulated upregulated 1.1557 nucleotide-binding protein (Danio rerio) QPCR12: fast muscle ambiguous upregulated 3.1195 specific heavy myosin chain 4 (Danio rerio) QPCR13: isocitrate -- downregulated 2.2630 dehydrogenase 2 (Danio rerio) QPCR14: 60S ribosomal downregulated downregulated 2.9322 protein L12 (Danio rerio) QPCR15: ribosomal protein downregulated downregulated 5.1275 L27 (Ictalurus punctatus) QPCR16: proteasome 26S upregulated upregulated 2.4478 subunit (Homo sapiens)
244 Sequence No. And Gene Differential Real-time PCR Fold Change Identity Display Gel Response Response QPCR17: proteasome ambiguous upregulated 1.4068 subunit 7 beta (Danio rerio) QPCR18: survival motor ambiguous upregulated 1.9653 neuron domain containing 1 (Danio rerio) QPCR19: stathmin (Gallus ambiguous upregulated 1.7183 gallus) QPCR20: Troponin T3a, upregulated upregulated 2.1607 fast, skeletal muscle (Danio rerio) QPCR21: titin (Danio rerio) upregulated upregulated 11.5951 QPCR22: Troponin TnnT3b ambiguous downregulated 1.1321 (Danio rerio) QPCR23: Fast muscle ambiguous upregulated 2.8985 troponin I (Danio rerio)
245 Table 50: Real-time PCR results of the twenty-three selected genes for zinc A samples. 18S rRNA was the endogenous standard for calculating the change in gene expression. Fold-change was measured in the 900 µg/L Zn-treated groups and was compared to expression in control group samples.
Sequence no. and Gene Differential Real-time PCR Fold Change Identity Display Response Response QPCR1: aldolase B (Danio Upregulated upregulated 1.5441 rerio) QPCR2: skeletal α-actin downregulated upregulated 1.1110 (Cyprinus carpio) QPCR3: α-tropomyosin Upregulated upregulated 1.5895 (Danio rerio) QPCR4: β-thymosin (Mus downregulated upregulated 1.1137 musculus) QPCR5: carboxypeptidase downregulated downregulated 1.6493 B (Paralichthys olivaceus) QPCR6: chymotrypsinogen downregulated downregulated 1.2980 B1 (Danio rerio) QPCR7: cytochrome c upregulated upregulated 1.4176 oxidase subunit III (Oncorhynchus nerka) QPCR8: cytochrome b upregulated upregulated 1.2061 (Pimephales notatus) QPCR9: elongation factor-1 downregulated upregulated 1.4260 α (Cyprinus carpio) QPCR10: eukaryotic upregulated downregulated 1.0899 translation elongation factor γ (Danio rerio) QPCR11: guanine -- downregulated 1.0836 nucleotide-binding protein (Danio rerio) QPCR12: fast muscle downregulated upregulated 1.2217 specific heavy myosin chain 4 (Danio rerio) QPCR13: isocitrate downregulated upregulated 1.8099 dehydrogenase 2 (Danio rerio) QPCR14: 60S ribosomal downregulated upregulated 1.2041 protein L12 (Danio rerio) QPCR15: ribosomal protein downregulated upregulated 1.4442 L27 (Ictalurus punctatus) QPCR16: proteasome 26S upregulated upregulated 1.4115 subunit (Homo sapiens)
246 Sequence no. and Gene Differential Real-time PCR Fold Change Identity Display Response Response QPCR17: proteasome upregulated upregulated 2.0655 subunit 7 beta (Danio rerio) QPCR18: survival motor upregulated upregulated 1.1881 neuron domain containing 1 (Danio rerio) QPCR19: stathmin (Gallus downregulated upregulated 1.0008 gallus) QPCR20: Troponin T3a, ambiguous upregulated 1.4216 fast, skeletal muscle (Danio rerio) QPCR21: titin (Danio rerio) upregulated upregulated 1.5872 QPCR22: Troponin TnnT3b unchanged upregulated 1.1004 (Danio rerio) QPCR23: Fast muscle ambiguous upregulated 1.5403 troponin I (Danio rerio)
247
Table 51: Real-time PCR results of the twenty-three selected genes for thermal stress A samples. 18S rRNA was the endogenous standard for calculating the change in gene expression. Fold-change was measured in the 36ºC group compared to control group samples.
Sequence no. and Gene Differential Real-time PCR Fold Change Identity Display Response Response QPCR1: aldolase B (Danio Upregulated downregulated 1.4175 rerio) QPCR2: skeletal α-actin Upregulated downregulated 1.5034 (Cyprinus carpio) QPCR3: α-tropomyosin -- downregulated 1.4249 (Danio rerio) QPCR4: β-thymosin (Mus -- downregulated 1.4223 musculus) QPCR5: carboxypeptidase Upregulated (24 hr) downregulated 1.5062 B (Paralichthys olivaceus) QPCR6: chymotrypsinogen Upregulated (48 hr) downregulated 1.6174 B1 (Danio rerio) QPCR7: cytochrome c -- downregulated 1.1032 oxidase subunit III (Oncorhynchus nerka) QPCR8: cytochrome b downregulated downregulated 1.5861 (Pimephales notatus) QPCR9: elongation factor-1 downregulated downregulated 1.0017 α (Cyprinus carpio) QPCR10: eukaryotic Upregulated downregulated 1.0524 translation elongation factor γ (Danio rerio) QPCR11: guanine Upregulated downregulated 1.0407 nucleotide-binding protein (Danio rerio) QPCR12: fast muscle -- downregulated 1.9143 specific heavy myosin chain 4 (Danio rerio) QPCR13: isocitrate Upregulated downregulated 1.6571 dehydrogenase 2 (Danio rerio) QPCR14: 60S ribosomal -- downregulated 1.0716 protein L12 (Danio rerio) QPCR15: ribosomal protein -- downregulated 1.5231 L27 (Ictalurus punctatus) QPCR16: proteasome 26S ambiguous downregulated 2.2267 subunit (Homo sapiens)
248 Sequence no. and Gene Differential Real-time PCR Fold Change Identity Display Response Response QPCR17: proteasome Upregulated upregulated 1.0958 subunit 7 beta (Danio rerio) QPCR18: survival motor -- downregulated 1.0647 neuron domain containing 1 (Danio rerio) QPCR19: stathmin (Gallus -- downregulated 1.5373 gallus) QPCR20: Troponin T3a, -- downregulated 2.3048 fast, skeletal muscle (Danio rerio) QPCR21: titin (Danio rerio) downregulated downregulated 3.3418 QPCR22: Troponin TnnT3b Upregulated (24 hr) upregulated 1.0528 (Danio rerio) QPCR23: Fast muscle downregulated downregulated 2.7839 troponin I (Danio rerio)
249
Table 52: Real-time PCR results of the twenty-three selected genes in terms of fold- change in gene expression for group B copper samples. BMV was used as the reference gene in the relative quantification method. Fold-change was measured in the 200 µg/L Cu-treated groups compared to expression levels within the control group samples. Results of the one-way ANOVA on ∆CT values (df=9) are also stated. P-values < 0.05 reflect significant fold-changes in gene expression compared to controls. Sequence No. And Gene Real-time PCR Fold Change F-ratio p-value Identity Response QPCR1: aldolase B (Danio downregulated 1.1586 1.277 0.291 rerio) QPCR2: skeletal α-actin downregulated 1.0820 0.291 0.604 (Cyprinus carpio) QPCR3: α-tropomyosin downregulated 1.0094 0.098 0.763 (Danio rerio) QPCR4: β-thymosin (Mus downregulated 1.2685 3.695 0.091 musculus) QPCR5: carboxypeptidase downregulated 1.6757 6.828 0.031 B (Paralichthys olivaceus) QPCR6: chymotrypsinogen downregulated 1.2584 1.569 0.246 B1 (Danio rerio) QPCR7: cytochrome c downregulated 1.2905 2.118 0.184 oxidase subunit III (Oncorhynchus nerka) QPCR8: cytochrome b upregulated 1.0020 0.189 0.675 (Pimephales notatus) QPCR9: elongation factor-1 downregulated 1.4019 1.943 0.201 α (Cyprinus carpio) QPCR10: eukaryotic downregulated 1.3300 2.347 0.164 translation elongation factor γ (Danio rerio) QPCR11: guanine downregulated 1.5582 4.877 0.058 nucleotide-binding protein (Danio rerio) QPCR12: fast muscle downregulated 1.1688 1.085 0.328 specific heavy myosin chain 4 (Danio rerio) QPCR13: isocitrate downregulated 1.5802 3.202 0.111 dehydrogenase 2 (Danio rerio) QPCR14: 60S ribosomal downregulated 1.6481 6.835 0.031 protein L12 (Danio rerio) QPCR15: ribosomal protein downregulated 1.1669 1.368 0.276 L27 (Ictalurus punctatus)
250 Sequence No. And Gene Real-time PCR Fold Change F-ratio p-value Identity Response QPCR16: proteasome 26S downregulated 1.0685 1.968 0.198 subunit (Homo sapiens) QPCR17: proteasome downregulated 1.2301 0.006 0.942 subunit 7 beta (Danio rerio) QPCR18: survival motor downregulated 1.8221 7.099 0.029 neuron domain containing 1 (Danio rerio) QPCR19: stathmin (Gallus downregulated 1.7809 4.757 0.061 gallus) QPCR20: Troponin T3a, upregulated 1.0628 0.069 0.800 fast, skeletal muscle (Danio rerio) QPCR21: titin (Danio rerio) downregulated 2.2275 16.675 0.004 QPCR22: Troponin TnnT3b downregulated 1.3251 1.887 0.207 (Danio rerio) QPCR23: Fast muscle downregulated 1.1201 0.354 0.568 troponin I (Danio rerio)
251 Table 53: Real-time PCR results of twenty-three selected genes for group B zinc samples. BMV was used as the reference gene. Fold-change was measured in the 800 µg/L Zn-treated groups and was compared to expression levels within the control group samples. Results of the one-way ANOVA on ∆CT values (df=9) are also stated. P-values < 0.05 reflect significant fold-changes in gene expression compared to controls. Sequence No. And Gene Real-time PCR Fold Change F- p-value Identity Response ratio QPCR1: aldolase B downregulated 2.7561 8.823 0.018 (Danio rerio) QPCR2: skeletal α-actin downregulated 1.8863 3.123 0.115 (Cyprinus carpio) QPCR3: α-tropomyosin downregulated 2.1764 6.863 0.031 (Danio rerio) QPCR4: β-thymosin (Mus downregulated 1.2667 1.612 0.240 musculus) QPCR5: carboxypeptidase downregulated 3.9030 21.110 0.002 B (Paralichthys olivaceus) QPCR6: downregulated 3.0356 16.071 0.004 chymotrypsinogen B1 (Danio rerio) QPCR7: cytochrome c downregulated 1.7910 2.299 0.168 oxidase subunit III (Oncorhynchus nerka) QPCR8: cytochrome b downregulated 1.1242 0.556 0.477 (Pimephales notatus) QPCR9: elongation factor- downregulated 1.3550 3.207 0.111 1 α (Cyprinus carpio) QPCR10: eukaryotic downregulated 2.9702 9.220 0.016 translation elongation factor γ (Danio rerio) QPCR11: guanine downregulated 3.2980 11.203 0.010 nucleotide-binding protein (Danio rerio) QPCR12: fast muscle downregulated 2.9773 9.926 0.014 specific heavy myosin chain 4 (Danio rerio) QPCR13: isocitrate downregulated 1.7673 1.695 0.229 dehydrogenase 2 (Danio rerio) QPCR14: 60S ribosomal upregulated 1.0299 0.878 0.376 protein L12 (Danio rerio) QPCR15: ribosomal downregulated 2.3560 5.679 0.044 protein L27 (Ictalurus punctatus)
252 Sequence No. And Gene Real-time PCR Fold Change F- p-value Identity Response ratio QPCR16: proteasome 26S downregulated 1.3459 1.060 0.333 subunit (Homo sapiens) QPCR17: proteasome downregulated 1.9574 3.566 0.096 subunit 7 beta (Danio rerio) QPCR18: survival motor downregulated 4.4454 9.894 0.014 neuron domain containing 1 (Danio rerio) QPCR19: stathmin downregulated 5.5780 11.157 0.010 (Gallus gallus) QPCR20: Troponin T3a, downregulated 4.1357 9.424 0.015 fast, skeletal muscle (Danio rerio) QPCR21: titin (Danio downregulated 4.9509 7.613 0.025 rerio) QPCR22: Troponin downregulated 4.7176 12.411 0.008 TnnT3b (Danio rerio) QPCR23: Fast muscle downregulated 4.8193 11.725 0.009 troponin I (Danio rerio)
253 Table 54: Real-time PCR results of twenty-three selected genes for group B thermal stress samples. BMV was used as the reference gene. Fold-change in gene expression was measured in the 36ºC heat-treated groups and was compared to expression levels in control group samples. Results of the one-way ANOVA on ∆CT values (df=9) are also stated. P-values < 0.05 reflect significant fold-changes in gene expression compared to controls. Sequence No. And Gene Real-time PCR Fold Change F-ratio p- Identity Response value QPCR1: aldolase B (Danio downregulated 2.1352 14.019 0.010 rerio) QPCR2: skeletal α-actin downregulated 2.3165 11.935 0.009 (Cyprinus carpio) QPCR3: α-tropomyosin downregulated 6.0690 17.629 0.003 (Danio rerio) QPCR4: β-thymosin (Mus downregulated 1.0905 2.231 0.174 musculus) QPCR5: carboxypeptidase B downregulated 1.0964 2.003 0.200 (Paralichthys olivaceus) QPCR6: chymotrypsinogen downregulated 1.4475 0.707 0.428 B1 (Danio rerio) QPCR7: cytochrome c downregulated 3.2155 2.555 0.149 oxidase subunit III (Oncorhynchus nerka) QPCR8: cytochrome b downregulated 1.9799 0.943 0.360 (Pimephales notatus) QPCR9: elongation factor-1 downregulated 2.7090 2.668 0.141 α (Cyprinus carpio) QPCR10: eukaryotic downregulated 2.5810 3.986 0.081 translation elongation factor γ (Danio rerio) QPCR11: guanine downregulated 2.6888 4.455 0.068 nucleotide-binding protein (Danio rerio) QPCR12: fast muscle downregulated 2.1594 2.923 0.126 specific heavy myosin chain 4 (Danio rerio) QPCR13: isocitrate downregulated 2.6939 4.588 0.065 dehydrogenase 2 (Danio rerio) QPCR14: 60S ribosomal downregulated 2.3936 3.685 0.091 protein L12 (Danio rerio) QPCR15: ribosomal protein downregulated 2.6631 3.765 0.088 L27 (Ictalurus punctatus) QPCR16: proteasome 26S downregulated 2.4361 3.933 0.083 subunit (Homo sapiens)
254 Sequence No. And Gene Real-time PCR Fold Change F-ratio p- Identity Response value QPCR17: proteasome downregulated 2.4763 3.201 0.111 subunit 7 beta (Danio rerio) QPCR18: survival motor downregulated 3.0175 4.276 0.072 neuron domain containing 1 (Danio rerio) QPCR19: stathmin (Gallus downregulated 1.9035 2.538 0.150 gallus) QPCR20: Troponin T3a, downregulated 4.1625 9.698 0.014 fast, skeletal muscle (Danio rerio) QPCR21: titin (Danio rerio) upregulated 1.3735 1.083 0.333 QPCR22: Troponin TnnT3b upregulated 3.1172 0.000 0.997 (Danio rerio) QPCR23: Fast muscle downregulated 2.4253 3.357 0.104 troponin I (Danio rerio)
255
Table 55: A summary table comparing gene expression changes in twenty-three genes in experiments A and B when copper, zinc and elevated temperature were used to stress fathead minnow larvae. Double asterisks indicate statistically significant changes in fold-change expression (experiment B). Only 1.7 and higher fold-change differences were considered informative for this summary. Up arrows (↑) denote up-regulation, down arrows (↓) denote down-regulation and dashes (-) indicate no change in gene expression.
Sequence No. and Gene Identity Accession no. Gene expression response in 200 µg/L copper 900 and 800 µg/L 48-hr thermal zinc stress at 36ºC A B A B A B QPCR1: aldolase B (Danio rerio) NM_194367.3 ↓ - - ↓** - ↓** QPCR2: skeletal α-actin (Cyprinus carpio) D50028.1 - - - ↓ - ↓**
QPCR3: α-tropomyosin (Danio rerio) NM_131105 - - - ↓** - ↓**
QPCR4: β-thymosin (Mus musculus) NM_021278.1 ------
QPCR5: carboxypeptidase B (Paralichthys AB099302.1 ↓ ↓** ↓ ↓** - - olivaceus) QPCR6: chymotrypsinogen B1 (Danio rerio) NM_212618.1 - - - ↓** - -
QPCR7: cytochrome c oxidase subunit III AF294832.1 ↓ - - ↓ - ↓ (Oncorhynchus nerka) QPCR8: cytochrome b (Pimephales notatus) U66606.1 ↑ - - - - ↓
QPCR9: elongation factor-1 α (Cyprinus carpio) AF485331.1 ↓ - - - - ↓
QPCR10: eukaryotic translation elongation NM_173263.13 - - - ↓** - ↓ factor γ (Danio rerio)
256 Sequence No. and Gene Identity Accession no. Gene expression response in 200 µg/L copper 900 and 800 µg/L 48-hr thermal zinc stress at 36ºC A B A B A B QPCR11: guanine nucleotide-binding protein AY423038.1 - - - ↓** - ↓ (Danio rerio) QPCR12: fast muscle specific heavy myosin AY333450.1 ↑ - - ↓** ↓ ↓ chain 4 (Danio rerio) QPCR13: isocitrate dehydrogenase 2 (Danio BC063967.1 ↓ - ↑ ↓ ↓ ↓ rerio) QPCR14: 60S ribosomal protein L12 (Danio AY648813.1 ↓ ↓** - - - ↓ rerio) QPCR15: ribosomal protein L27 (Ictalurus AF401581.1 ↓ - - ↓** - ↓ punctatus) QPCR16: proteasome 26S subunit (Homo NM_002810.1 ↑ - - - ↓ ↓ sapiens) QPCR17: proteasome subunit 7 beta (Danio AF155581.1 - - ↑ ↓ - ↓ rerio) QPCR18: survival motor neuron domain NM_212601.1 ↑ ↓** - ↓** - ↓ containing 1 (Danio rerio) QPCR19: stathmin (Gallus gallus) NM_00100185 ↑ ↓ - ↓** - ↓ 8.1 QPCR20: Troponin T3a, fast, skeletal muscle BC053304.1 ↑ - - ↓** ↓ ↓** (Danio rerio) QPCR21: titin (Danio rerio) AY081167.1 ↑ ↓** - ↓** ↓ - QPCR22: Troponin TnnT3b (Danio rerio) AF425741.1 - - - ↓** - ↑
QPCR23: Fast muscle troponin I (Danio rerio) AF425744.1 ↑ - - ↓** ↓ ↓
257 Table 56: Fold-change gene expression of 23 genes using experiment B samples normalized with total RNA.
Sequence No. And Gene Fold-change in gene expression Identity 200 µg/L 800 µg/L zinc 36ºC thermal copper stress QPCR1: aldolase B (Danio 0.8565 0.6796 0.7186 rerio) QPCR2: skeletal α-actin 0.9171 0.9930 0.6623 (Cyprinus carpio) QPCR3: α-tropomyosin (Danio 0.9831 0.8606 0.3041 rerio) QPCR4: β-thymosin (Mus 0.8602 1.2997 0.5393 musculus) QPCR5: carboxypeptidase B 0.6511 0.4218 0.6704 (Paralichthys olivaceus) QPCR6: chymotrypsinogen B1 0.6493 0.5424 1.0641 (Danio rerio) QPCR7: cytochrome c oxidase 0.6331 0.8929 0.4007 subunit III (Oncorhynchus nerka) QPCR8: cytochrome b 0.8188 1.4224 0.6507 (Pimephales notatus) QPCR9: elongation factor-1 α 0.6935 1.1801 0.4756 (Cyprinus carpio) QPCR10: eukaryotic translation 0.7310 0.9049 0.5962 elongation factor γ (Danio rerio) QPCR11: guanine nucleotide- 0.6240 0.8149 0.5723 binding protein (Danio rerio) QPCR12: fast muscle specific 0.8519 0.9027 0.7126 heavy myosin chain 4 (Danio rerio) QPCR13: isocitrate 0.6301 0.5194 0.5497 dehydrogenase 2 (Danio rerio) QPCR14: 60S ribosomal protein 0.6041 0.9454 0.6187 L12 (Danio rerio) QPCR15: ribosomal protein 0.6164 1.1704 0.5561 L27 (Ictalurus punctatus) QPCR16: proteasome 26S 0.6732 2.049 0.5533 subunit (Homo sapiens) QPCR17: proteasome subunit 7 0.5847 1.4087 0.5443 beta (Danio rerio) QPCR18: survival motor neuron 0.5931 1.0036 0.4467 domain containing 1 (Danio rerio)
258 Sequence No. And Gene Fold-change in gene expression Identity 200 µg/L 800 µg/L zinc 36ºC thermal copper stress QPCR19: stathmin (Gallus 0.6068 0.7998 0.6947 gallus) QPCR20: Troponin T3a, fast, 1.1486 1.0787 0.3177 skeletal muscle (Danio rerio) QPCR21: titin (Danio rerio) 0.4708 0.8358 0.5804 QPCR22: Troponin TnnT3b 0.7914 0.8771 1.3172 (Danio rerio) QPCR23: Fast muscle troponin 0.9362 0.8586 0.5452 I (Danio rerio)
259
Figure 3: A formaldehyde-agarose gel with RNA samples from thermal stress experiment A. The two bands seen in each lane are the 28S and 18S rRNA. The band closest to the loading well is the 28S band, while the lower band farther away from the loading well is the 18S rRNA band. The samples (left to right) are the two 24-hour control replicates (C1 and C2), two 24-hour experimental replicates (11 and 12), two 48-hour control replicates (C3 and C4) and the two 48-hour experimental replicates (21 and 22).
260
1.2
1
0.8
0.6
0.4
0.2 Average amount of RNA recovered per fish per in recovered ug/ul 0 0 µg/L Cu 50 µg/L Cu 125 µg/L Cu 200 µg/L Cu Copper Treatment (Experiment A)
Figure 4: RNA recovery per fish in µg/µl from Copper Experiment A. There were two replicates within each group. Error bars represent standard errors of means.
261 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 Average amount of RNA recoverd per fish in ug/ul 0 0 µg/L Cu 200 µg/L Cu Copper Treatment (Experiment B)
Figure 5: RNA recovery per fish in µg/µl from Copper Experiment B. The mean RNA concentration was measured in five control replicates and five 200 µg/L copper-treated biological replicates. Error bars represent standard errors of means.
262 5 4.5 4 3.5 3 2.5 2 1.5 1 0.5 Average amount of RNA of amount Average
recovered per fish in ug/ul 0 0 µg/L Zn 200 µg/L 400 µg/L 600 µg/L 900 µg/L Zn Zn Zn Zn Zinc Treatment (Experiment A)
Figure 6: RNA recovery per fish in µg/µl from Zinc Experiment A. Each group had two replicates. Error bars represent standard errors of means.
263 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 Average amount of RNA recoverd per fish in ug/ul 0 0 µg/L Zn 800 µg/L Zn Zinc Treatment (Experiment B)
Figure 7: RNA recovery per fish in µg/µl from Zinc Experiment B. The mean RNA concentration was measured in five control replicates and five 800 µg/L zinc-treated biological replicates. Error bars represent standard errors of means.
264 2.5
2
1.5
1 fish in ug/ul in fish 0.5
0
Amount recovered of RNA per 24-hr control 24-hr thermal 48-hr control 48-hr thermal stress stress Thermal Stress Treatment (Experiment A)
Figure 8: RNA recovery per fish in µg/µl from Thermal Stress Experiment A. There were two replicates in each group. Error bars represent standard errors of means.
265 1.4 1.2 1 0.8 0.6 0.4 0.2 Average amount of RNA of amount Average recoverd per fish in ug/ul in fish per recoverd 0 48-hr control at 25ºC 48-hr stress at 36ºC Thermal Stress Treatment (Experiment B)
Figure 9: RNA recovery per fish in µg/µl from the 48-hour Thermal Stress Experiment B at 36ºC. The mean RNA concentration was measured in five control replicates and five stressed biological replicates at 36ºC. Error bars represent standard errors of means.
266
267 Figure 10: A differential display gel picture captured by a fluorescence scanner, with a virtual grid superimposed on it. The samples run here were from copper experiment A. The anchor primer used for the reverse transcription reaction was anchor primer 6. From left to right, the eight samples in the first group were amplified with arbitrary primer 6, those in the second group with arbitrary primer 5, those in the third group with arbitrary primer 3 and the samples in the last group with arbitrary primer 1. Within each arbitrary primer group, the samples pipetted into the wells from left to right include two replicates of the 200 µg/L Cu treatment (32 and 31), two replicates of the 125 µg/L Cu treatment (22 and 21), two replicates of the 50 µg/L Cu treatment (12 and 11) and two replicates of the control group (C2 and C1). Bands that exhibited a visually detectable change in intensity were numbered and excised using sterile, disposable scalpels. Band 1 is observed in both the control samples and the 50 µg/L Cu treatment, but is absent in the 125 µg/L and 200 µg/L Cu treatments. It was therefore designated as being downregulated by higher concentrations of copper. It was also classified as being dose-dependent since the 50 µg/L Cu treatment samples still showed that band. Band 2 is more intense in all the copper-treated samples, but is less intense in the two control replicates. It was therefore designated as being upregulated by copper and not dose-dependent. Band 13 is less intense in the 200 µg/L Cu samples, but is of equivalent intensity in the control, 50 µg/L Cu and 125 µg/L Cu samples. It was designated as being downregulated only by the 200 µg/L Cu treatment and hence considered a dose- dependent candidate gene. Band 39 is absent from the control samples, is light in the 50 µg/L and 125 µg/L samples and is very intense in the 200 µg/L samples. It was considered dose-dependent and also proportionately upregulated by copper with increasing concentration.
268 GENE ONTOLOGY
0.35
0.3
0.25
0.2 Copper Zinc Heat PERCENT 0.15
0.1
0.05
0 Mitochondrion / Ribosome / Metabolism Regulation / Contractile ECM / Other Protein Turnover Respiration Protein Signal Proteins Tissue Proteins / Chaperones Synthesis Transduction
Figure 11: A gene ontology showing a distribution of functional genes affected by copper, zinc and heat stress.
269 3.5
3
2.5
2
1.5
1 Fluorescence 0.5
0 1 4 7 10 13 16 19 22 25 28 31 34 37 40 43 46 -0.5 Cycle Number
Figure 12: A representative real-time polymerase chain reaction amplification curve for the sequence QPCR4:carboxypeptidase B in one of the control samples from copper experiment B. The increase in fluorescence is generated from the increasing amount of SYBR Green dye being incorporated in double-stranded amplicons. The threshold cycle (CT) value calculated from this data was 18.21.
270 0.25
0.2
0.15
0.1
0.05
Derivative Fluorescence Data 0
.8 8 8 7 6 .3 7 4 0 5. 7. 9. 1. 85 6. 8. 9 64 69.3 73.5 7 7 7 8 83 8 8 Temperature in Degrees Celsius
Figure 13: A representative melting curve for the sequence QPCR4:carboxypeptidase B for a control sample from copper experiment B. The sharp peak at approximately 80ºC indicates that the amplicon generated had the expected Tm for this sequence (refer to table 9). The absence of any other peak indicates that only one amplicon’s signal contributed to the fluorescence detected in the polymerase chain reaction.
271
APPENDIX 1: Sequences of 23 genes obtained from differential display that were also quantified using real-time PCR.
SEQUENCE QPCR1 (305a): Aldolase B (Dano rerio)-NM_194367.3
CGANGGATGGTGCTGACTTTGCCAAGTGGCGTTGTGTACTTANGATCTCT GACAGCTGCCCCTCTGCTCTCGCAATANCTGAAAACGCTAACGTTCTTGN CAGATATGCCAGCATTTGCCAACAGAATGGCTTGGTTCCCATTGTANAGC CCGAGATCCTCCCAGACGGAGATCATGATCTGCNACGGTGCCAGTACNCC ACTGAGAAGGTCCTGGCGGCTGNGTANAANGCCCTCTCTGACCACCACGT GTATCTGGAGGGAACTCTGCTCAAACCAAACATGGTCACTGCTGGACACT CCTGCACCANGAAGNACACCCCTCTGGAGGTTGCCATGGCAACAGTCACT GCTCTCANACGCACCGTCCCAGCTGCTGTGCCAGGCATCTGCTTCCTCTC TGGTGGCCAAAGTGAGGAGGAGGCCTCTGTGAATCTGAATGCCATGAACC AGCTTCCCCTGCACAGACCCTGGAAGCTGAGCTTCTCTTATGGCCGTGCT CTCCAGGCCTCGGCTCTTTCTGCATGGAANGGACAGGCAGCGAACAAGAA GGCTGGGACAGGATGCTTNCGTCACACGTGCCAAGATCAATAGTCTTGCA TCAAAAGGGAATACAAGCCCCTCAAGGCCAGGCTGAACAATCATCCCAAC AGTCCCTTCTTTACCCGCCAGNTATGGTCTACTNAAACTCAAAAACAAAA NAACACCACTTTNTTTTGGAACTTTNNAAAAAGGAANATGCCTGGGANCT GTTTTGGGGATTTANN
SEQUENCE QPCR2 (918): skeletal α-actin (Cyprinus carpio)-D50028.1
TCNGCACCATGAAGATCAAGATGATTGCCCCTCCTGAGCGTAAGTACTCT GTCTGGATCGGTGGCTCCATCCTGGCTTCCCTCTCCACCTTCCAGCAGAT GTGGATCAGCAAAGACGAGTACGAGGAGGCCGGACCCTCCATTGTCCACA GGAAGTGCTTCTAAACCCCTCCTCTTCTCGTTCTCTTCTGTCCTGGACTC TACTTATAGTCTTTACACCATGTCACGTCTTGTGTTTGTACTTCAAGTCC CTCTGTACAACAATTCAAGTCTACAGCCACAATAAATTGTTCAATAAATA CATTTACATATTTCCAAAAAAAAAAAAGCCCTNTAGGGGNGTCGTATTNA AA
272
SEQUENCE QPCR3 (726): α-tropomyosin (Danio rerio)-NM_131105
NAGNGCGTGCTGAGCTCATGAGGGCAGTGCTCTGAGCTGGAGGAGGAGTT GAAACTGTGACCACACCATGAAGTCTCTGGAGGCCCAGGCTGAGAAGTAC TCCGCTAAGGAGGACAAATATGAGGAGGAGATCAAGGTCTTGACTGACAA GCTGAAGGAGGCTGAGACTCGTGCTGAGTTCGCTGAGAGATCAGTCGCCA AGCTTGAGAAGACCATTGATGATCTGGAGGATGAATTGTATGCTCAGAAA CTCAAGTACAAAGCCATCAGCGAGGAGCTGGACCACGCTCTCAACGACAT GACCTCCATTTAAATTTTTTACATCTCATCTCTGGCTCCGGGCACCATCT GAGCGGCATCTTCTTCATTTTCTTCCATGTTTCTGTCTTTTTCTCTGTTG CCGCCTTCTCCATCACACTATTCTCAGTGGGGATGGAGCACTCAGCACTA TAGTCCTATCACTTGTACAGAAATTTTTTGCTTTCTGTAAAATAAAACTT CCTCCCATCTCAAAAAAAAAANGCCCTAANGGGGGTNNTNTNNAAANNNN
SEQUENCE QPCR4 (877): β-thymosin (Mus musculus)-NM_021278.1
GCACTGTCTGACANGCCAATCTCGAGGAGTGACCAGCTTTGACAAACCAG CTGAAGAAACAGAAACTCAGGAGAAAAATCCTTTGCCGTCAAAAGAAACC ATTGAACAGGAGAAGCAGGCGGGCTCGTCATGAAACTCGTTCTCCACTCT TCTATGCACTGTACATTCCACATTGCCTTCTTTTTCACGTCTTTTCGCTG TTTAACTTTTAACGGAAAAATATGACCTAAGTCGCATTGTGATTGGACAA CCAAAAAAAAAAAANCCCTNTNGGGGGNCGTNTTNNAAN
SEQUENCE QPCR5 (1214): carboxypeptidase B (Paralichthys olivaceus)- AB099302.1
CCCCGCTGCTGGTGGCTCTGATGACTGGGCTTATGACCTGGGTGTGAAAG TATTCATACNCCTTTGAGCTGCGCGACGAAGGACGCTACGGGTTCCTGCT GCCCGAGTCCCAGATCCAGCCCACTTGTGAGGAGACCATGCTGGCTGTCA NATACATCGCTAGCCATGTGCTCAACAACCTGTACTGAGAGGGAGCTGTC TGGGAGAAAGCCTTGTGAATACAGGGTTGGAATGTGGCTATGCATTCTTT GACATCNAATCATTGCAAATCTCAGNATACCTNNNGNTNTNTAGCGCTAT ATCTCTCAAAAAAAAAAACCCNTTANNGGGTNTTNTTTNACAA
273
SEQUENCE QPCR6 (1014): chymotrypsinogen B1 (Danio rerio)-NM_212618.1
GACTTGCTGGCTCACTGGNAATGTCAGGACCTTTTCACNGTGTCGTCCTG GGTGAGNATGATCGTTCCTCGAACGCTGAGGCCATTCAGACCATGAACTG TTGANATGGTTTTCAAGCACCCTAACTACAACAGCTTCACCATCAACAAC GACATCCTCCTGATCAGCTGGCCTCTCCTGCTCAGATCAACACTCATGTG TCTCCCGTGTGTCTCGCTGAAACCACTGACGACTTCCCTGGAGGCATGAA GTGTGTGACCTCTGGATGGGGTCTGACCAGGTACAATGCCGCTGATACCC CTCCCCTGCTCCAGCANGGCCGCTCTGCCCCTGCTGACCAATGATGACTG CAAAGCGTTACTGGGGAACCAACATCACTGATCTGATGATCTGTGCCGGA GCCTCTGGTGCCTCATCTTGCATGGNGAGATTCTGGTGGTCCTTTGGTCT GTGAGAAGAATGGAGTCTGGACTCTTGTTGGTATCGTGTCCTGGGGAANT AGCACCTGCTCAACCAGCTCGNCTGGTGTGTANCGCCCGTGTTCACCAAA CTCCGTGCCTGGGTNGACCAGACCATTGCTGCTAACTAAAGGCNCAANGG TTATCCAGNAGTTTGNTGCTCNTAATGTTCTTCATAAAGTTTCCTTNNAA AAAAAAAAAACCCTTTNNNGNNTCNAATTANAANNNNNNNNNNNTNANTG CTNTTAAANNATTTNTNNNAATCNTTTCTATCTNTTNNNCACCATTNTAT TANNCATTGTANTTNNNNNCNATTNTTTATNNATTTNNNATTTNTCANTC TATNAA
SEQUENCE QPCR7 (1177): cytochrome c oxidase subunit III (Oncorhynchus nerka)-AF294832.1
TCAGAATGGAATTTATGAAGCACCTTTTACANTTGCAGACGGAGTATACG GCTCAACATTCTTTGTCGCTACAGGTTTCCATGGNATTGCATGTCATTAT TGGCTCNACCTTCTTAGCCGTCTGCCTTATCCGCCAAATTCAATACCACT TCACATCTGAACATCACTTCGGCTTCGAAGCCGCTGCATGATACTGACAC TTTGTAGACGTAGTATGANTATTCCTTTACGTATCNATTTACTGATGAGG CTCAAAAAAAAAAANNCCCTNNNGGGGGTCNNATNANAN
SEQUENCE QPCR8 (1256b): cytochrome b (Pimephales notatus)-U66606.1
GGNNNCCCCTACTTCTCTTAAAAGATCTCCTCGGCTTTGTTCTGATGCTG CTAGCCCTAACNTNCCTCACCCTATTCGCCCCCAGTCTTCTNGGCGACCC AGAAAACTTCACCCCAGCAAACCCACTGGTTACTCCGCCACATATTCAAC CCGAGTGATATTTCCTGTTTGCCTACGCTATTCTGCGATCTATTCCAAAC AAACTAGGAGGGGTCCTAGCACTGCTATTTAGCATTCTAGTACTCTTTGT AGTCCCGATTTTACATACCTCAAAGCAACGAGGACTAACTTTCCGACCAA TCACTCAATTCTTATTCTGAACCCTAGTGGCAGATATAATTATTTTAACA TGAATTGGGGGTATACCTGTAGAACACCCATATGTTATCATTGGCCAAGT AGCCTCAATTCTATACTTTGCATTATTCCTTCTTCTTGCCCCACTTGCAG GATGAGCAGAGAATAAAGCATTGAAATGAGCTCAAAAAAAAAAAGCCCTT NNNGGGGNGCCTNTTTNNAA
274
SEQUENCE QPCR9 (537): elongation factor-1 α (Cyprinus carpio)-AF485331.1
GNGNCCCAGGCTCTTAATCTGGAGANGCTGCCATTGTTGACATGATCCCT GGCAGCCCATGTGTGTGGAGAGCTTCTCTACCTACCCCCCTCTTGGTCGC TTTGCTGTGCGTGACATGAGGCAGACCGTTGCTGTTGGTGTCATCAAGAG CGTTGAGAAGAAAGCTGCTGGCTCTGGCAAGGTCACCAAGTCTGCACAGA AGGCTGCCAAGACCAAGTGAATTCCCCTCNATCANGCTGTTCCAAAGGTT GTGGTATGTTCTGCCCAACCTCCTGGAATATCTCTAAACCTGGGCACTCT ACTTANGGACTGGCTAATGCTGATTAAAACTCATCGGAAAAATTTTCGCA GGAAAGGAAAACNACTTGGATTANGTGTGGCTTTATTGATTGACTGATAG TGCCTCTTTCAGTTATTAAATNTGCTTTGAAATGGTTTAGAACTGCACCT GTTGCCACAGTANAATTTGGAAAGAAGCTGCTGAATAAACTAATAANGGT ATTAAAAATCGGAAAAAAAAAAACNCCCTANAGGGGGTCTTATAACAANN
SEQUENCE QPCR10 (17): eukaryotic translation elongation factor γ (Danio rerio)- NM_173263.13
GGACCCCNTGACTGTGGCATTGCCTTACTTCTGGGATCACTTTGATCGTG AGGGCTTCTCAATCTGGTACGCTGAGTACCGCTTCCCTGAAGAGCTGTCC ATGACCTTCATGAGCTGTAATCTTATCACAGGAATGTTCCAACGACTTGA CAAACTACGCAAGAATGCCTTTGCCAGTGTCATCCTCTTCGGTGCAAACA ACGACAGTTGTATCTCTGGTATCTGGGTCTTCAGAGGCCAGGACCTTGCA TTTCCTCTGAGTGATGATTGGCAGATTGACTATGAGTCCTACACTTGGCG CAAGTTGGATGTGGACAGCGAAGAATGCAAGACCATGGTGAAGGAATACT TTGCATGGGAGGGTGAATTCAAACATGTAGGCAAAGCTTTCAACCAGGGC AAGGTTTTCAAGTGAGAACATCTTGCGCCCAGTATTTATCAACATCAGTA TCAATGGACATGACATTTGTTTGAGAACCCCATGTACAAGGCTTTGACCT GTGGTGGAAGGAAGACTTGANTNNAACATNACACTTTTTNTCACAATCCN AAAAAAANCNACCCCCATCNCNGNNCCNCNNTCNCCNNCNNCCNCCCNCT CNTCCCNCCCCCCTCNCACCNCTNCNCNCNNCCCANCCNAACNCNCTNCC NCCNNCACNNNANTNCCCNNNCCCCNNANCNCCCNCNNNNNNCCCNANAC CTCNCCNNCTNCNNCCNCCNCCTCNANNACAACTNCNCNNCCCCCCCNAC NCNCCTNCNNANNACCANCCACCCCNCCACNACNNCNCCTCNNNCNNNTN NTCCNATCNNCNTCACNCCCCTNCTCCCNCTCCCTCNCNCNACNACCNTC CTCACNACANCCCCCACNTCCNCCCNCCNNANTNNCCNCNATANACNNCA NCCNCACCANNTNCCCCCCNCCCCCNNNCNTCACNCTCCTCCCTNCCCCT NNCCCCCCTCG
275
SEQUENCE QPCR11 (607): guanine nucleotide-binding protein (Danio rerio)- AY423038.1
TTGCTCTGGGAAGCACCCTGCGGCTGTGGGATCTGACAACTGGCACTACA ACCCGCCGTTTTGTTGGACACACCAAGGATGTTCTGAGCGTGGCCTTCTC TGCTGACAACCGTCAGATTGTGTCTGGATCCAGAGACAAGACCATCAAGC TGTGGAACACCCTGGGAGTCTGCAAGTACACCATCCAGGATGACAGCCAC ACTGAGTGGGTTTCATGCGTGCGTTTCTCTCCCAATAGCAGCAACCCCAT TATTGTGTCCTGCGGGTGGGATAAAATGGTCAAGGTATGGAATCTTGCTA ACTGCAAGCTGAAGACCAACCACATTGGCCACACTGGATACCTGAACACA GTGACCGTGTCTCCTGATGGATCTCTGTGTGCCTCCGGTGGAAAGGATGG GCAGGCCATGCTATGGGACCTGAATGAAGGCAAGCACCTTTACACCCTGG ATGGTGGGGACACCATCAACGCCCTTTGCTTCAGCCCTAACCGCTACTGG CTGTGTGCCGCCACTGGAACCCAGCATCAAGATCTGGGATCTGGAGGGCA GATCATAGTTGATGAGCTGAGGCAGGACATCATCACCACAACAGCAAGGC TGAGCCACCTCAGTGCACTTCTCTGGCCTGGTCTGCTGATGGACAGACTC TCTTTGCTGGCTANCCTGACANCTGATCANANTGTGGCAGGNGACCTTTG GAACNAAATAAAACCNTTTCTAATGCNTGAATAAAGTTTTAAAGGAAAAA AAAACCNTNNTGGGNTCTTTTNAAANNNNNNNNNNNNNNNNNNNNNNNNN NNNNNN
SEQUENCE QPCR12 (465): fast muscle specific heavy myosin chain 4 (Danio rerio)- AY333450.1
GTCCTTGAATCCATGCNGGGCACTCTGGACTCTGAAGTCNGGAGCAGGAA TGATGCCCTGANAATCAATGAAGAAGATGGAGGGAGACCTTAATGAGATG GAGATTCAGTTGAGTCACGCCAATCGCCAGGCTGCTGAGGCCCAGAAACA GCTCAGGAATGTTCAGGGTCAACTCAAGGATGCCCAACTGCANCTTGATG ATGCCCAGAGAGGACAGGAAGACATGAAGGAGCANGTCGCCATGGTGGAG CGCAGAAACGCTCTGATGCAGTCTGAGATTGANGAGCTGAGAGCTGCTCT GGAGCAGACAGAGAGAGGCCGCAAAGTGGCTGAACAAGAGTTGGTGGACG CCAGTGAGCGTTGTGGGCTGCTGCACTCTCAGAACACNAGTCTCCTGAAC ACCAAGAAGAANCTTGAGGCNGACCTTGTTCAGATCCAGAGTGAAGTTGA TGACACTGTACAGGAAGCCAGAAATGCTNANGGAGAAGGCCAAGAANGCC ATCACTGATGCTGCNATGATGCCCAAAAACCTGAAAAAGGACNGGACCCN GNTCTCCCTTGAAAAATGANAAGAATNTGAGNCCCCGTGANGNCCTNCNC CCGTCTGGATAGGTTGAAATNTGNCCTNGAGGGAAGAAAAAAACCCCTCA TTNGGNCCTTTTTNANCNNNNNNNNNNNNNNNNNNNNNNNCCCTNCCCCT CTNCCTNCNCNCCT
276
SEQUENCE QPCR13 (1112): isocitrate dehydrogenase 2 (Danio rerio)-BC063967.1
CTCTGAACGGGTGTGCGTGGAGACTGTGGAGAGCGGCGTGATGACCATGG ATCTGGCTGGCTGNATTCAGGGTCTTGCCGACTGTNAGCTGAACGAGCAT TGCGTCCACACCACAGACTTCTTGGATGCCNTCNAGACAAACCTAGACAA GGCACTGGGCAAATGAAGGACAACGGGGCCCGGACACGGTGGAGAGTGTC TTTTTGTACCTCATTTTTAACTTAAAGGTCATAAATACCACATAATGTAT GAAGGGAGGAGTATTAAAAACATAGTTATGTTCCTAGCTTTTCTGTTAGT GAATNCTGCTGATGGGTCATCCCATCTCTTCCTACACCTCCAGGGGTCTA TTTTTTTAAGATGAAGTACTGTATGTCAGATGCTGTATAATACCACAGGA GAAAAGAAAAGGAGAAAGCGCANGAGCCACATGAAAAACCCTCTAATAAA TCCGTCACCTGGAAAAAAAAAAAANCCNTNTGGGGGGGCCGTATNANAAN
SEQUENCE QPCR14 (672): 60S ribosomal protein L12 (Danio rerio)-AY648813.1
TTGCANGCTCCGGTGACTGGAAGGGCCTGCGAATCACTGGTGAAGCTGAC CATCCTGAACAGGCAAGCAGCGATTGAGGTGGTGCCATCAGCCTCTGCCC TCATCATCAAGGCCCTGAAGGAACCTCCCCGTGACAGGAAGAAGGTCAAG AACATTAAGCACTCTGGAAGCGTCACTTTCGATGAGATCGTCAACGTTGC CCGTATCATGAGGCCACGCTCTATTGCCAGGGAACTTTCTGGTACCATCA AGGAGATTCTTGGCACAGCTCAGTCTGTGGGCTGCACCATTGATGGTCGC CCTCCCCATGATGTCATTGATGACATCAACAGTGGCAAAATTGAGTGCCC ATCTGAGTAAAAAAAAAAAAAAAAAANGGGGGGGNAAAAAAAAAANTTTT TTTGNAAAAGCCCAAAAAAAAAAACCCCCTTTGGGGGGNGTNTTTNNAAA AN
SEQUENCE QPCR15 (790): ribosomal protein L27 (Ictalurus punctatus)- AF401581.1
TGNCTGAGCCCTCAGATGGGCAAGTTTATGAAACCTGGCAGGTGGTGATG GTCCTGGCTGGACGTTATGCTGGCCGCAAGGCTGTGATTGTTAAGAACAT TGATGATGGCACCACAGACCGTCCTTACAGCCACGCTCTGGTCGCAGGCA TCGATCGTTATCCTCGTAAAGTCACCGCAACCATGGGCAAGAAGAAGGTT GCCAAAAGGTCCAAGATCAAGGCCTTTGTGAAGGTGTTCAACTACAACCA CCTCATGCCAACCAGATACTCNGTTGACATTCCTCTGGACAAAACTGTTG TCAACAAGGATGTTTTCAGGGATCCTGCTCTGAAGCGCAAAGCCAGGAGA GAGGCCAAGGTTAAGTTTGAGGAGAGGTACAAGACAGGCAAGAACAAATG GTTCTTCCAGAAGCTTCGATTCTAATCTTTCATTGGTTTCACAAATAAAT CTGTAAAAATCGCAAAAAAAAAAAANCCCTNTANGGNGTCCGTNTTNCAA N
277 SEQUENCE QPCR16 (1368): proteasome 26S subunit (Homo sapiens)- NM_002810.1
TTGGAGGTCTGGATAACCAGATTCAAGAGATCAAGGAGTCTGTGGAGCTT CCCCTCACACATCCAGAGTATTATGAAGAGATGGGAATAAAGCCACCCAA AGGAGTTATTCTGTACGGTGCACCGGGAACAGGCAAGACTCTTCTGGCAA AAGCAGTGGCGAACCAGACGTCTGCCACCTTCCTGAGGGTGGTGGGCTCA GAGCTTATTCAGAAATACCTGGGAGACGGTCCAAAACTTGTGCGAGAGCT CTTCAGAGTGGCTGAGGAACANGCTCCATCAATCGTTTTCATAGACGAGA TCGACGCTATTGGCACAAAGAGGTATGACTCAAATTCTGGAGGAGAGCGG GAGATCCAGAGAACAATGTTGGAGCTGCTAAACCAACTGGACGGATTCGA CTCCCGCGGAGATGTCAAAGTCATCATGGCTACTAATAGGATAGAGACTC TTGACCCAGCTCTCATTAGACCAGGTAGANTTGATCGTAAAATTGAGTTC CCACTGCCGGATGAGAAGACCAAGCGCAGAATCTTTCAGATNCCCCCCAG CAGGATGACCGTAGCCGATGACGTGACTTTGGATGAACTCATCCTGGCTA AAGAAGACCTCTCGGGNGCTGACTCAAGGCCATTTGCNCAGAGGCAGGGC TANTGGCTCTGAGGGANCGGANANTGAAGTTCCTATGAGACTNCAGAAGT CTAAGANACGTCNTGTCANNAGCNGNGGGACCCCGAGGCCNCCCTTTANA NTCATTTTCNGCTTACCCTTTTTNTNTANACTNNTNCCGAGNANCATCGT TGNCNTNGCCCAACCATTAA
SEQUENCE QPCR17 (1495): proteasome subunit 7 beta (Danio rerio)-AF155581.1
CNACTGGGATGCCCCNGATCATCTCCTCTATCTGGAGCTCCATGCTCTGT CCACCGGCCGTGTCCCGCGTGTCGCCACCGCANACCGCATGCTCAAACAG ATGCTCTTCAGGTATCAGGGTTATATTGGTGCTGCGTTGGTTCTCGGAGG GGTTGACTGCAACGGTCCACACTTGTACAGCATCTATCCTCANGGATCAA CAGACAAACTACCCTATGTCACAATGGGTTCTGGATCTCTGGCAGCAATG GCAGTCTTTGAGGATCGCTACAGGCCCAACATGGAGGAGGATGAGGCCAA GCTTCTGGTGCGGGATGCAATAGCGGCTGGTATCTTTAATGACCTGGGCT CAGGAAGCAACATTGACCTGTGTGTGATCACCAAGGGGCAGGTGGACTAC CTGAGACCTCATGACGTGGCCAACAANAAGGGTGTCAGAACCGGAAGCTA CAAGTACAAGCATGGAACCACCGCGGTTCTGACGAAGGCTGTGACTCCTC TGAACCTAGAGGTGGTAGAGGAAAAGTGTGCACACCATGGACACCTCCTG ANGAGACACAATCCACCACATTTTGATCTGTTTGTTTTCCCTANCTGTTA TGTGGNGATTTAGTCATTTTTCATTATTTCCAATAAAAAANTTGTGAGTT GAAAAAAAAAACCCTATTGGGGGTCNATTANAAN
278
SEQUENCE QPCR18 (674): survival motor neuron domain containing 1 (Danio rerio)-NM_212601.1
GGANTTGCTGGCCCCTGGAGCCNGGACGGACAGTTGTATGAGGCGGAAAT TGAAGANTTTNTCAGCGAGAATGGCACTGCAGCCATCACCTTCGCTGGCT ATGGTAACGCAGAGGTGTTGCCACTTCATGTGCTCAAAGAAGTGGAGGAG GGCAGGAGCAGGGAAGAGAAAGATGGAAAGCCTAAATCCAAAAAAGAGCT GCTGGCNGAACAGAGGGAATATNAGAAGAAAAAAGCCCAGAAGAAGGTGC TGCNCATGAAAGAGCTGGAGCNAGAGAGAGAAGTTCAGAAGTCCAAGTGG CAGCAGTTTAACAATAAAGCCTATTCCAAAAAAAAAAANCCCTTTTGTGG GTCNTTTTNCANAAN
SEQUENCE QPCR19 (1058): stathmin (Gallus gallus)-NM_001001858.1
GCTCNCCCAGAANAGGAGGTATCTCTGGATGAGATCCAGAAAAAGCTGGA TGCAGCAGAGGAGAGACGCAAGAACCACGAGGCAGAGGTCCTGAAGCATT TGGCTGAGAAACGAGAGCATGAGAAGGAGGTCCTTCAGAAAGCAATGGAG GAGAACAACAACTTCAGCAAGATGGCAGAGGAGAAGCTCAACCAGAAAAT GGAAGCCAACAAAGAAAACCGCACAGCACGCATGGCAGCTATGAACGAGA AATTCAAAGAGAAGGACAAGAAGCTTGAAGAGGTACGAAAGAACAAAGAA ACAAAAGAGGGGGGCGAGGATGAAAACTAAGTTTCCTCTCTCATTTTCCT TTTCATTTAGGGTATAGTGTTGGGTTTTTTAATGTATCCAAAGATTTATT TTTTGTTCCATTAAATGGCCTGTTTTCCATGTTTGGATCCATGTACTTGC CACTTTTTTATTAAGGGGTTTTGGGGGAAAGCTGGTCCACAACATTTCAT CACCGTGTGTATTCAGTTGTGTCTTTTATCATCCCCCTCTAACCTGTAGA TTTGTCTAGTTGCAGCTCTATAGCATTTAAAATGAGCAGTGTTTTACTGA TAGGGATGCATGCCTGTGTTATGCATAGGTCTAATATATACTTGGGATAT GGCATTGNGCNCCTGTTCCCTTGTATGTCAGTACTGCCATCCTTNGAGCT NATAAAGTTGCCAGTTGTTTGTNTGGGAAAAAAAAACCCTTTNGGGGGCN TNTNCAANN
279 SEQUENCE QPCR20 (538): troponin T3a, fast, skeletal muscle (Danio rerio)- BC053304.1
CCCAAAGGTGGCAAAACGACGAGAGAGAGAGAAGAANAGATCCTGGCTGA CAGACGCAAGCCACTCAACGTCGACCATCTCAACGAGGACAAACTGAAAG ATAAAGCACAGGAGCTGTTTGAATGGATAAAGACCCTGGAATCTGAGAAG TTTGAACACACAGAGAGGTTGAAGAGACAGAAGTATGAGATTACTACACT GCGCAAGAGAGTGGAGGAGCTTGGCAAATTCAGCAAGAAGGGTGCCGGCG CTCGTCGCAGAAAGTAAGTGCGTCGTCCTGCAGACCAAGACCTCCACAAT GATGATGGACAAGATCCACCCCCACTCTGTGCTGACTGCACAGGGACTAG TTGTTGATCAACCCACTCTTCATCGTCTTGGACTGTAGTTTAATTCCTTT ATATGTCATGTAAATAAAGTGTGACTTANGGCCTTAGTACTACTTGTTCT TATTGAAACATCAATAAAATCGTTGTTTTTGGAAAAAAAAAAANNCCCTA TTNGGGGTCNTATTACAANN
SEQUENCE QPCR21 (1093): titin (Danio rerio)-AY081167.1
TGTGTCTCATCNGGCTTGTCTGTGAGACGAGGTGAAGAGATCCGATTGGA TGCCAACATCTCTGGATTTCCTTACCCACAAATTACATGGATGAGAAACA ATTCAACCATTTGGCCAGAGCCACTGAAGAAGAGACCAGAAAGGCCCATT AAAAAGAAGAAAGAGAAAGAAAAAGAAAAGGAGGAAAAGAAAGAGGCAG ATGCCGAAAAGAAAGAGGTAGATGCCGAAAAGAAAGAGGTAGATGCCGAAA AGAAAGAGGCAGATGCAGAAAAGAAGGTGGAAGACAAAGAGGCCAAGGAG GAGGACAAGGCAAAGAAGGAAGAAGAAAAGGCCCCTNTANTGNGCCCTAT TNCAANTCNTNTTCCAN
SEQUENCE QPCR22 (500): troponin TnnT3b (Danio rerio)-AF425741.1
ACAGCTGAGGAGAAAGCTAAAGAGCTGTGGGACTGGTTGTACCAGCTGGA AGCTGAGAAGTTTGAGCACCTCGAGAAACTCAAGAGGCAGAAGTATGAGG TTACAACCCAGCGTCAGAGAGTGGAGGAGCTCAGTAAATACTCCAAGAAG GGTGCTGCTGCTCGCCGCAGAAAGTAAGCGTTCATGGAGAAACCTACACT TGTGGTCAAGACATGTCTGTTGCCTGCGTCTCCGAGCTATGCCTTCATTC AGCAGGCATCTCTGATCCCATCCACCATTTGCATTTTATCAGAGGCTATC AAAGGCGGTCTACCACCACCGGTGTGACATTAACACTGTCCGGTCTTAGC GGTAGTTGTAGTAGGATCTTCCCCTCTTAAGACGCTATGTCTTTAGGTTC TCACCTTCCGTTTTTGTAAATAATGTTTGGCTCGCCAGCTTTATCTGTTG CATCTGGCAGTTCAATAAAATATTCTTCAAGACGGAAAAAAAAAAAANCC CTNNAGGGGGNCNTNTTAAAANN
280 SEQUENCE QPCR23 (498): fast muscle troponin I (Danio rerio)-AF425744.1
AAGTGGTTCCTCTTCTTCTCATTAGGGTGAAAACACACTAAACCACCAAG ATGTCAGAAAAAAAGATGACCTCCAGCCGCAGGCATCATTTGAAGAGCCT GGTGCTCTCCATCGCCTTCAATCTGCTGGAAGCGGAAGCCAAGCAGGCGG TTATTGATAAGGAGAACTACATGAGTGAACACTGCCCTGCTCTGGATCTG CCTGGATCCCAGCAAGAGCTGCAGGAACTGTGCAAGAAACTGCACCAACA GATCGACACTATTGATGAGGAGAGATACGACTTGGAGGCCAAGGTTTCCA AGGCAAACAAGGAGATTGAGGATCTGAAGCTCAAGGTGGTCGACCTCATT GGCAAGTTCAAGAAACCCGCGTTGAAGAAAGTGCGCATGTCTGCCGATCA GATGCTTGGGGCTCTTCTGGGCTCCAAACACAAGGTGTCCATGGATCTGA GAGCCAACCTGAAACAAGTCAAGAAGGAGGTCAAGGAAGAGTCTGTAGAA CAAGTCGGCGACTGGCGTAAGAACGTTGAGGACAAGGCTGGTATGGGCGG CAGGAAAAAGATGTTTGAGTCCGAGGCTTAAGATGTATTCNTTTTTTGTT CNCCCAAATGTCTTAAATTTTCTCTGCCAAACTCCGTTCTATCCTGTGAG CCCTCCCGTTCAAATAAAAAGTNTTTTTTCNGGGAAAAAAAAAAACCCTT TTTGGNCCNTTTTNAAANCNCCNCCCCCCCCCTNNCNNCCCCCNTCTCCC CCCCCCTCNCCCNCNCCNCCCCNCNNTNCCCTCCCCCCNCTNCTCCNCCT CNNCTCCCCCCCCCNCCCCCCCNCCCCNCNCCNCNCNCCCCNCCNTTTNT CTTNNTCTCTACTCNCNTTNTCNCT
281 APPENDIX 2
Title: Identification of copper-responsive genes in an early life stage of the fathead
minnow Pimephales promelas
Authors: Solange S. Lewis and Stephen J. Keller
Affiliation: Department of Biological Sciences, University of Cincinnati, Cincinnati, OH
45221, USA.
ABSTRACT
Fathead minnow (Pimephales promelas) larvae less than 24 h post-hatch were
used to study the effects of copper on gene expression changes with the intent of
ascribing a possible mechanism for its toxicity at this life stage. Fish larvae were exposed to copper concentrations of 50 µg/L, 125 µg/L and 200 µg/L for 48 hours. mRNA from survivors was screened using differential display. A total of 654 copper-responsive
differentially expressed cDNA fragments were collected. Database sequence searches
found homology for 253 of 261 cDNAs over 200 bps long with clear sequence reads. One hundred and sixty-one cDNAs had homology to NCBI genes of known function, of which 77 were unique. The most abundant category of functional genes were involved in protein synthesis/translational machinery, followed by those encoding components of cell structure/contractile proteins, metabolism, signal transduction, chaperones, cell division and glycolysis. Twenty-two putative dose-responsive candidate genes were measured for expression changes using real-time reverse transcription-PCR. Verification for
282 differential gene expression using real-time PCR was obtained for eleven candidate
genes. Transcripts identified as titin, cytochrome b, fast muscle specific heavy myosin
chain 4, fast muscle troponin I, proteasome 26S subunit and troponin T3a were induced
over two-fold. cDNAs identified as ribosomal protein L27 and 60S ribosomal protein
L12 were repressed approximately three-fold. In comparison to other transcriptional
studies of stress, the copper candidate cDNAs identified from fathead minnow larvae were similar in gene ontology to those affected by hypoxia stress in both embryonic and adult fish species.
Key words: fathead minnow; differential display; real-time PCR; copper; larvae
INTRODUCTION
Copper is an essential cofactor of hemocyanin, cytochrome oxidase, tyrosinase,
laccase and ceruloplasmin [1]. In excess, it becomes toxic to living organisms and its
salts are frequently used as aquatic herbicides, algicides, fungicides and bacteriocides [2,
3]. Mining activity for this valuable metal increased in the latter half of the twentieth
century with 307 million metric tons being produced after 1980 thus increasing copper
pollution worldwide [1]. Water pollution by copper is chiefly associated with mining
activities, fertilizer production, municipal and industrial sewage, materials released from
brake pads in road runoff and owing to its use as a biocide in antifoulant paints [1, 3, 4].
In water, copper is easily bound to particulate and organic matter, but a small proportion
does remain in soluble form and this is especially toxic to fish. Soluble copper
283 concentrations range from 0.5-2.0 µg/L in uncontaminated freshwater and can reach 2000
µg/L in contaminated waters close to mines [1].
Among metals, copper is second most toxic to fish after mercury with typical 96 h
LC50s ranging from 0.017-1.0 mg/L for most freshwater fish species [1]. In toxicity tests,
96 h median tolerance limit (TLm) to adult fathead minnows for copper was found to be
between 430-470 µg/L, while concentrations as low as 11-33 µg/L affected reproduction,
growth and spawning [2]. The effects of copper toxicity have been characterized to some
extent in adult fish. Copper precipitates mucus secretions from gills ultimately resulting
in asphyxiation [5, 6, 7]. Besides the gills, many other organs including the liver, kidneys
and sensory organs are damaged by copper exposure [8, 9]. Over long periods of copper
exposure, the liver and kidneys accumulate this metal whereas muscles contain relatively
low levels of it [6]. If copper concentrations are acute, gills tend to be the site of copper
accumulation as well as the primary target organs for toxicity. The mechanism of copper toxicity in adult fish, therefore, is primarily through gill tissue damage, leading to a negative effect on respiratory gas exchange [8, 10]. Reduced oxygen supply leads to acidosis, a switch to anaerobic metabolism and accumulation of lactic acid [10]. Gill damage leads to a decrease in ionoregulation and this may inhibit the diffusion of ammonia out of the gills, especially in freshwater fish that do not have an active ammonium exchange mechanism [10]. Fish plasma ammonia levels are known to
increase in response to copper exposure and several known physiological responses
follow. Ammonia may increase the rate of glycolysis, deplete stored glycogen but also
inhibit anaerobic respiration by specifically inhibiting the enzyme pyruvate
284 dehydrogenase that catalyzes the intermediate step between glycolysis and the citric acid
cycle [10]. Elevated ammonia levels may also have an effect on neuromuscular
coordination by substituting ammonium ions for potassium thereby causing neuron
depolarization, which in turn results in weaker signals for muscle contraction [10].
While the mechanism of copper toxicity in adult fish has been studied, the physiological response to copper in fish larvae remains unknown except for the characterization of developmental abnormalities associated with long-term exposure. The
96 h LC50 value for copper was 250 µg/L in larval fathead minnows [11]. Chronic exposure to copper concentrations greater than 338 µg/L to fathead minnow eggs and larvae resulted in decreased growth rates and a high incidence of developmental abnormalities such as failure of eyes to emerge from enclosed tissue, deformed maxillary bones and mandibles, malformed lower jaws, misshapen fins reduced in size, kyphosis, lordosis, scoliosis and eye defects in orientation, defective lenses and microphthalmia
[11]. The epithelial layer of the skin is the site for respiratory gas exchange in larval fish
because the gills are not fully formed at the newly hatched developmental stage [12, 13].
Larval fish do have a liver, but kidneys are not developed [13]. If the mechanism of
copper toxicity in larvae is similar to that of adult fish and respiratory exchange or
ionoregulation is affected, then either hypoxic stress, ammonia stress, or both, should be
the physiological consequences of copper exposure.
Different life stages of the fathead minnow Pimephales promelas are routinely
used to evaluate the potential hazard posed by environmental pollutants to freshwater fish
285 in North America [14]. The early post-hatch larval stage is considered one of the most sensitive to environmental stress due to the loss of the protective chorionic layer of the egg and its developmental immaturity [15, 16, 17]. We attempted to understand the effect of copper on the transcriptional activity within fathead minnow larvae with the purpose of gaining an insight into the physiological changes induced by this inorganic chemical in such an early life stage of a fish species.
Many studies have successfully utilized transcriptional profiles to identify specific
biomarker genes that responded to toxicants in a variety of organisms [18, 19]. In this
study, differential display was used to identify candidate genes that showed a putative
response to copper. Differential display is a technique that can be used without prior
knowledge of an organism’s genome and hence was ideal for working with the
uncharacterized genome of the fathead minnow. The expression of a subset of twenty-
two genes was measured using the more sensitive real-time RT-PCR technique to
validate the expression changes detected by differential display. The purpose of this study
was to characterize copper-induced transcriptional changes in fish larvae and compare the
expression profile to those from other stress studies in fish. If the mechanism of copper
toxicity in fish larvae is similar to that in adults, then hypoxia may be one of the
consequences of copper exposure. We hypothesized that if copper exposure produces
hypoxic stress in larvae, then the copper-affected transcriptional activity would be similar
to that characterized for hypoxia in other fish. To this end, less than 24 h post-hatch
fathead minnow larvae were exposed to copper for 48 hours and analyzed to identify
differentially expressed transcripts.
286 MATERIALS AND METHODS
Exposure to copper
Between 100-250 fathead minnow larvae less than 24 h post-hatch were exposed to copper concentrations of 0 µg/L, 50 µg/L, 125 µg/L and 200 µg/L in moderately hard reconstituted water [14] in a 48 h static renewal test with water changes after 24 h using criteria described in [14]. There were 25 larvae in each test container. Dead larvae were removed from the test chambers during the water changes and at the conclusion of the test. Larvae were not fed either before or during the copper exposure because they were still able to live on the contents of their yolk sacs. Water chemistry at the start and conclusion of the experiment was measured in terms of pH, dissolved oxygen, conductivity and temperature. Copper concentrations and sample sizes in each treatment were expected to provide approximately 100 surviving larvae from each group. Survivors from each treatment were collected immediately following exposure, separated into two biological duplicates in tubes and RNA was isolated from pooled fish within an hour.
RNA isolation
Approximately 50 fish larvae were pooled within a tube and homogenized in Tri-
Reagent LS (MRC Inc., Cincinnati, OH, USA) following the manufacturer’s protocol with an additional alcohol precipitation step. Isolated RNA was treated with DNase I
(Ambion, Austin, TX). All RNA samples were assessed on a spectrophotometer to ensure
287 that the 260/280 nm ratios were above 1.8. All RNA samples were also analyzed on a
1.5% formaldehyde-agarose gel to ensure that they were undegraded by checking the integrity of the 28S and 18S bands of rRNA. Samples were distributed into aliquots and stored at -80ºC until used for differential display or real-time PCR.
Differential display
Differential display on two biological replicates from each of the treatment groups was performed using the fluoroDD HIEROGLYPH mRNA Profile Kit System for
Differential Display (Beckman Coulter Inc., Fullerton, CA, USA) following the manufacturer’s protocols. Total RNA (0.1 µg/µl) from each sample was converted to cDNA using T7-tagged anchored oligo-dT primers 1-6, SuperScript II reverse transcriptase and dinucleotide triphosphates (dNTPs). Polymerase chain reactions (PCRs) were performed with the same anchored oligo-dT primers labeled with a fluorescent dye, an M13-tagged 5’ random primer and dNTPs. PCRs were first heated at 95ºC for 2 min, followed by 4 cycles of 92ºC for 15 s, 50ºC for 30 s and 72ºC for 2 min. This was followed by 30 cycles of 92ºC for 15 s, 60ºC for 30 s and 72ºC for 2 min. There was a further extension step at 72ºC for 7 min. The PCR products were concentrated in a thermal cycler by uncapping tubes and heating at 95ºC for 3:45 min followed by a gradual cooling step to 4ºC. The cDNA products were electrophoresed on 5.6% denaturing urea polyacrylamide gels twice, once at 2700 V for 2.5 h and again at 3000 V for 5 h for resolution of bands over 500 bp in length. Gels were scanned on a
GenomyxLT Fluorescent Imaging Scanner. Replicate bands that appeared to be
288 differentially expressed under copper exposure, as inspected visually, were selected for further analysis. These candidate bands were scraped from urea-free dried gels and reamplified by PCR using T7 and M13 primers. The reamplified products were run on a
1.5% agarose gel to isolate bands by cutting them from the gel. The reamplified cDNAs were purified using the MinElute kit (Qiagen Inc., Valencia, CA, USA) and sequenced using T7 primer. Sequenced products were purified using Performa DTR gel filtration cartridges (Edge BioSystems, Gaithersburg, MD, USA). Database searches were performed to determine the identity of candidate genes using the BLASTN tool [20].
Sequence quality was considered high if the nucleotide reads were over 200 bps long and were evidently the result of a single reamplified product. BLAST matches of query sequences were considered good if the corresponding E-value was less that 10-4. An E- value or expect value is calculated from three scores - the bit score, the length of the query sequence and the size of the database. The bit score measures the similarity between the query sequence and the hit sequence. The higher the bit score, the lower the
E-value. Conversely, the larger the size of the database and shorter the query sequence, the larger will be the E-value. An E-value close to 1.0 represents a hit by coincidence rather than biological significance.
Validation of differentially expressed cDNA fragments using real-time PCR
Real-time PCR (Opticon 2, MJ Research/Bio-Rad Laboratories, Waltham, MA,
USA) was used to validate differential expression of 22 candidate genes in 200 µg/L copper-treated samples (n = 2) compared to those in the control group (n = 2). These
289 candidates were arbitrarily selected because they appeared to have a dose-response
associated with copper as assessed by differential display, and, were also identified by the
same technique in response to zinc and thermal stress (unpublished data). The 22 selected
cDNAs were identified as aldolase B, skeletal α-actin, α-tropomyosin, β-thymosin,
carboxypeptidase B, chymotrypsinogen B1, cytochrome c oxidase subunit III,
cytochrome b, elongation factor-1 α, eukaryotic translation elongation factor γ, guanine
nucleotide-binding protein, fast muscle specific heavy myosin chain 4, proteasome 26S
subunit, proteasome subunit 7 beta, 60S ribosomal protein L12, ribosomal protein L27,
stathmin, survival motor neuron domain containing 1, titin, fast skeletal muscle troponin
T3a, troponin TnnT3b and fast muscle troponin I. Primers for these sequences were
designed using the Primer Express v2.0 software (Applied Biosystems, Foster City, CA,
USA) and are shown in Table 1.
The endogenous standard used to normalize gene expression data was 18S rRNA.
The universal primers and competimer for 18S rRNA were obtained from the
QuantumRNA 18S Internal Standards Kit (Ambion Inc., Austin, TX, USA). Total RNA
(1-2 µg) from each sample of pooled fish larvae was reverse transcribed with MMLV-
RT, 10 mM dNTPs and 30 µM random nonamers from the ProtoScript First Strand cDNA Synthesis Kit (New England BioLabs, Beverly, MA, USA). A diluted 1:5 solution of the RT reaction was used to perform real-time PCR using the Platinum SYBR Green qPCR SuperMix-UDG kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions along with the following additives in 25 µl of the reaction
mix: 0.01% Tween 20, 0.025% DMSO and 0.1% glycerol. The concentration of each
290 primer used was 4 µM. For reactions with 18S, 4 µl of 3:7 primer:competimer mixture
were used in each 25 µl reaction. The PCR reaction had two initial steps of 50ºC for 2
min and 95ºC for 10 min, followed by 45 cycles of 95ºC for 30 s, 57ºC for 60 s and 72ºC
for 30 s. The cycle threshold (Ct) was determined using an excitation wavelength of 470
to 505 nm and emission wavelength of 523 to 543 nm. The 45 cycles were followed by a
melting curve analysis from 65ºC to 92ºC with a fluorescence reading every 0.2ºC rise in temperature to ensure that a single product was formed in the reaction and that the melting temperature of the amplicon corresponded to its expected G/C content. The
relative quantification method (2-ΔΔCt) was used to calculate fold-change in gene expression [21] using the actual reaction efficiency values for each primer pair. A fold change of 1.0 represents no change of a treated sample relative to an untreated sample
[21]. Significant differences between real-time PCR ΔCt values of a gene from control and copper-treated fish were determined using a simple t-test with α = 0.05.
RESULTS
Survival of fish exposed to copper
Percentage survivorship of fish ranged from 56% to 100% from all treatments
(Table 2). Mortality was proportionate to the copper concentration used and no fish died in the control group, indicating that no additional stress other than copper was contributing to lethality. Recovery of larvae from copper stress was limited to the time necessary for fish collection (approximately one hour). There were no major differences
291 in water chemistry between different treatment groups (Table 3). In all experimental
containers, the pH of the water used was between 8.02-8.23, dissolved oxygen had a
range of 7.6-8.3 mg/L, conductivity was between 298-320 µmhos and temperature was between 24-25ºC throughout the 48 h experiment.
Identification of copper-responsive genes by differential display
Gene expression between control fish and copper-exposed fish for three doses
was compared by differential display using two biological replicates within each
treatment. It is usually recommended that two independent samples from the same
treatment group be run in a differential display gel to minimize the collection of false
positives [22, 23]. A portion of a representative gel (Figure 1) shows duplicate bands in lanes loaded with DNA recovered from the 200 µg/L copper treatment. These duplicate
bands are darker in intensity compared to other bands in the same row, as observed
visually. Therefore, the bands were denoted as up-regulated by the 200 µg/L copper
treatment in fathead minnow larvae. In the row below, band intensity of DNA is lighter in
samples from the higher copper-treated larvae and hence the band recovered from this row would have been denoted as a down-regulation candidate. There was little variation in band intensity across two biological replicates as assessed by visual observation in all
2197 rows of bands revealed by differential display using different primer combinations
(Figure 2). Fewer than 1% of the 2197 cDNAs showed band intensity variation, that is, either both duplicate bands within a treatment were dark or both were light relative to another treatment group. Of the 2197 bands, a total of 654 copper-responsive
292 differentially expressed cDNA fragments were collected and sequenced. Copper-
responsive candidate bands were selected for further analysis only if there was an
identical change in band intensity in both biological duplicates within a treatment group.
Some candidate bands showed visually observable intensity changes in all copper-treated groups relative to controls, while other candidates showed band intensity changes only in cDNA samples from fish exposed to higher doses of copper. If the candidate bands showed intensity changes in RNA replicates at the highest dosage (bands were either lighter or darker relative to controls), they were designated as “dose-responsive”. Of the
654 copper-responsive candidate bands collected, 261 fragments yielded clear sequence data. Ninety-two differentially expressed bands were homologous to database ESTs
(expressed sequence tags) of unknown function, of which 67 were unique. Sixteen genes contributed to the redundant bands among cDNAs of undetermined function. Eight bands did not have homology to NCBI database sequences. One hundred and sixty-one bands had homology to database genes of known function, of which 77 unique genes were identified. This was due to band redundancy contributed by 38 genes, a common problem in differential display [24]. The 77 differential display-derived candidate bands that responded to copper, had high quality sequences and BLAST matches to functional genes are shown in Table 4. The directional changes in gene expression (up- or down-regulated)
for an identified band were not always consistent when a gene was identified multiple
times by different primers on different gels. In Table 4, these bands are listed as
“ambiguous” in their expression response to copper. Of the 38 genes that contributed to
redundant bands, 19 had consistent expression changes and 19 were “ambiguous” in
expression.
293 We constructed a gene ontology for the 77 copper-responsive genes that shows
35% of the cDNAs categorized as protein expression/synthesis genes, 25% as cell
structure genes, 24% as metabolism genes, 10% as cell signaling genes, 4% as
chaperones/defense proteins, 1% as cell division/communication genes and 1% as
glycolysis genes (Figure 3). We also constructed an ontology for 110 identified genes
from a hypoxia transcriptional study with zebrafish embryos that characterized the expression of 138 hypoxia-affected genes [25]. This was done for comparison purposes of the functional gene groups affected by copper and hypoxia stress (Figure 3). ESTs of undetermined function were ignored from gene ontologies.
Validation of copper-induced altered gene expression using real-time PCR
It is necessary to validate observed gene expression changes in differential display
using an alternative, more sensitive technique because differential display is error-prone
and generates false positives, redundant bands, band contamination, inconsistent band
intensity and is biased towards abundant mRNA transcripts [24]. One such alternative
technique is real-time PCR using gene-specific primers. Twenty-two of the dose-
responsive copper candidate genes were arbitrarily selected from 77 identified cDNAs for
validation of expression using real-time PCR. To verify the gene expression of these 22
selected genes, gene specific primers were used on cDNA derived from total RNA
samples reverse transcribed with random nonamers. The same samples were used for
both differential display and real-time PCR. Real-time PCR was performed on 200 µg/L
copper-treated samples (n = 2) and control samples (n = 2). The calculated fold-change
294 differences for all 22 genes tested are shown in Table 5. Out of the 15 genes whose
expression was clearly characterized in differential display, 11 were validated by real-
time PCR for directional change in expression. Two genes, eukaryotic translation
elongation factor gamma and chymotrypsinogen B1, did not have over a 1.1-fold change
difference to be considered informative. A 1.0-fold difference indicates no change in
expression and therefore genes that had fold-changes less than 1.1 were considered
unaffected by the copper treatment [21]. The two genes skeletal α-actin and β-thymosin
had opposite directional changes in gene expression in real-time PCR compared to
differential display. When the fold-change criterion is raised to 1.7, a value commonly
used in microarray data [26, 27], 9 genes had the same directional change in expression
in both real-time PCR and differential display. Using a t-test on ΔCt values, one gene
proteasome subunit 7 beta had significant change in expression between the 200 µg/L copper-treated and control fish. Seven genes had ambiguous expression changes from differential display, that is, bands identified as the same gene showed up-regulation in some gels and down-regulation in others. However, the band intensity across replicate samples on a single gel was identical. The expression of six of these ambiguously expressed genes was characterized using real-time PCR. In copper-exposed fish larvae, the glycolysis gene aldolase B was found to be repressed. Genes encoding contractile proteins such as fast muscle specific myosin heavy chain 4, troponin T3a , fast muscle
troponin I and titin were all induced by copper exposure. Among mitochondrial genes,
cytochrome c oxidase subunit III was repressed while cytochrome b was induced. All the
genes encoding translational machinery/protein expression proteins were down-regulated
by copper and included elongation factor-1 α, 60S ribosomal protein L12 and ribosomal
295 protein L27. Proteasome 26S was induced 2.45-fold, carboxypeptidase B was repressed
2.52-fold, survival motor neuron domain containing 1 was induced 1.96-fold and stathmin induced 1.72-fold in response to copper exposure.
DISCUSSION
In this study, we investigated differential gene expression in fathead minnow larvae to ascertain the possible physiological effects of copper toxicity in an early life stage. Six hundred and fifty-four differentially expressed candidate bands were collected from gels wherein these bands showed differential changes in intensity in both biological duplicates of a treatment group compared to controls or other treatment groups of different copper dosage. After choosing only high quality sequence data and searching for homologies in the NCBI database, the number of copper-affected cDNAs was reduced to 144 unique genes (homologous to either functional genes or ESTs of undetermined function) out of 261. Eight novel sequences that did not have homology to
NCBI entries were obtained for the fathead minnow. Sixty-two of 77 high quality sequences, identified as functional genes, were not previously reported for the fathead minnow. Therefore, differential display was equally effective as various other techniques for identification of candidate cDNA fragments that responded to some physiological stimulus. Many cDNA fragments, produced either with the same primer combination or with one of the primers being changed, were identified as the same gene using the
BLASTN tool. Redundant bands comprised approximately 45% of the total number of clear cDNA sequences from differential display. Some of these redundant bands showed
296 induction on one gel and repression on another, the expression of which was designated
as “ambiguous”. Nineteen of the 77 cDNAs homologous to functional genes had
ambiguous gene expression. At this time, we are unable to resolve whether the
redundancies were due to the reverse transcription reaction, low stringency PCR favoring
the amplification of abundant transcripts, or, because of limitations in the NCBI database
to distinguish similar cDNAs from a gene family.
Some of the candidate genes obtained from differential display were validated
using real-time PCR, with 11 out of 13 cDNAs showing similar directional changes in
gene expression using both techniques. When differential display band expression was
consistent and 1.7 used as a fold-change cutoff for real-time PCR assays, there was 100%
agreement of differential display and real-time PCR-derived expression for nine genes.
One gene, proteasome subunit 7 beta, showed a statistically significant gene expression change between copper-treated and control fish; however, the induction was only 1.4-fold in copper-treated fish. Because of small sample size, the statistical analyses performed lack power. Even though fold-change calculations for some gene assays were high, statistical significance was not obtained for the gene expression changes because variance between sample means was high.
The real-time PCR validation technique could be improved by using a better
endogenous standard that could be reverse transcribed with polyT primers instead of
random nonamers. There is less sensitivity in quantifying gene expression changes when
random nonamer primers are used instead of polyT primers because several types of
297 RNA compete for random primers. PolyT primers, on the other hand, bind to mRNA
alone and therefore the quantification of gene expression is expected to be more accurate when these primers are used for reverse transcription. The real-time PCR analysis could be much improved if the sample size were increased. While two biological replicates were adequate for differential display, more replicates are needed to infer statistically significant gene expression changes from real-time PCR data. However, real-time PCR analyses on the two biological duplicates did allow us to validate directional changes in gene expression observed in differential display, especially for the genes that did not have ambiguous expression. Because of the strong agreement of real-time PCR results with differential display-derived candidate bands of consistent expression, candidate genes could potentially show expression changes in response to copper.
Typical biomarker genes or proteins proposed for copper exposure in fish include
metallothionein, heat shock proteins and cortisol [28, 29, 30]. Of these, only heat shock
cognate 70 kDa gene was identified in our study using larval fathead minnows. However,
the heat shock cognate 70 kDa gene showed repression in copper-exposed larvae,
whereas it is known to be induced in adult fathead minnows [29]. Because copper is
known to damage the respiratory surface and affect osmoregulation in adult fish, it was
expected that a gene encoding an ion exchange protein, ATPase Na/K transporting beta
1a polypeptide, would be repressed by copper [31]. Metallothionein is a liver protein that
sequesters excess metals and plays a protective role against their toxicity in living
organisms [3, 32]. Metallothionein was not identified in our differential display study,
either because it was already present in large amounts or was not induced by copper. In
298 zebrafish embryos, metallothionein transcripts are abundant and thought to be contributed
maternally because they play a very important role in development [32]. Because copper
is known to cause detrimental physiological changes in fish, it was expected that genes
involved in energy-generating pathways would be shut down. Therefore, ATP production
is expected to go down, implying that the activities of the citric acid cycle would be
reduced. Based on the expression pattern observed in differential display, some genes
encoding citric acid cycle components were up-regulated while others were down-
regulated. Therefore, there may be some disruption in the functioning of the citric acid
cycle. Most of the genes affected by copper were involved in protein translation activities
with many of these being down-regulated. These down-regulated genes included 40S
ribosomal protein S5, 60S ribosomal protein L12, basic helix-loop-helix transcription factor, CCAAT/enhancer binding protein, EF-1a mRNA for elongation factor 1a, elongation factor 1-alpha, eukaryotic translation initiation factor 2 gamma, eukaryotic translation elongation factor 1 gamma, ribosomal protein L18, ribosomal protein L21, ribosomal protein L27, ribosomal protein L4, ribosomal protein L5b, ribosomal protein
S15 and ribosomal RNA gene (Table 4). Repression of protein synthesis may be consistent with a decrease in ATP production or may represent an energy-conserving strategy of copper-stressed fish.
Many of the genes identified as contractile proteins showed a trend for being up-
regulated by copper exposure (differential display) with the candidate gene identified as
titin being induced over 11-fold in real-time PCR (Tables 4 and 5). The contractile
protein genes alpha-tropomyosin, fast skeletal muscle myosin heavy polypeptide 1, fast
299 skeletal muscle myosin light chain 3, parvalbumin isoform 1d, and troponin T3a were all
induced in response to copper (Table 4). Our real-time PCR study measured an up-
regulation of four contractile protein/cell structure genes after 48 hours copper exposure,
including fast muscle specific heavy myosin chain 4, troponin T3a, titin and troponin I.
While myogenesis is a dominant activity in early developmental stages of fish [33],
copper appears to induce contractile protein transcription either because muscle tissue
had been depleted early on in the copper stress response or because copper up-regulates
cell structure genes. The former seems more probable than the latter, probably implying a
struggle for survival under adverse environmental conditions. An increase in myogenesis
probably would trigger an increase in the energy demand from growing tissue. An
important implication of copper-induced differential gene expression for muscle protein
genes is that a putative increase or decrease in the synthesis of one protein disturbing the
myogenesis program may explain the muscular and cytoskeletal abnormalities frequently
observed in young fish stressed by pollutants [34, 35, 36]. When copper-responsive expression of muscle protein genes is compared with patterns observed in hypoxia, copper seems to up-regulate many muscle genes while hypoxia repressed them [25, 37]
Some genes assayed using real-time PCR bands have not been previously
reported as stress-responsive. Proteasome subunit 7 beta was found to be significantly
induced by copper in real-time PCR, but showed ambiguous expression in differential display. Two genes had relatively high fold-change differences and included proteasome
26S subunit and carboxypeptidase B. Proteasome 26S is a large protease complex that selectively degrades proteins by ubiquitination [38]. Proteasomes are known to operate in
300 the stress response by removing abnormal proteins and hence are needed by cells for
adapting to changing environments [38]. Therefore, it was not surprising that both
proteasome 26S subunit and proteasome subunit 7 beta were induced by copper-
exposure. Carboxypeptidase is a pancreatic protein-digesting metalloenzyme and showed
down-regulation by copper in this study. The liver, gall bladder and pancreas are formed
early on in fish development, with the intestine and rectum lined with columnar
epithelium [12]. Therefore, pancreatic enzymes should be expected to be present and
functional well before hatching. During the embryonic period, protein is the dominant
source of nutrition from the egg yolk and is used for tissue formation within the fish
embryo [39]. Protein utilization decreases only after hatching when lipids start being used
from the egg yolk instead [39]. If less carboxypeptidase in present, protein digestion may
be reduced thereby increasing the likelihood that copper-stressed larvae are probably
metabolizing lipids instead of proteins. The expression of the gene encoding
carboxypeptidase is affected by copper in other organisms. Carboxypeptidase A gene,
encoding a metallo-peptidase containing zinc, has been reported as being increased
almost 4-fold in expression in response to copper exposure in the earthworm Lumbricus
rubellus [40].
Most of the candidate genes identified as copper-responsive are not associated
with defense mechanisms for sequestering or removing copper from cells. Except for heat shock cognate 70 kDa gene, the majority of candidate genes are involved in regular cellular activities. Therefore, copper exposure affects genes of diverse functions. This pattern of genome-wide transcriptional change has also been observed in rainbow trout
301 exposed to zinc [41]. Genes encoding proteins with metal cofactors were affected by
copper, including the cytochromes and carboxypeptidase B. Most copper-responsive
candidate genes were expected to be active during the early development phase of the
fathead minnow. Therefore, copper exposure may have disturbed regular gene activities rather than inducing a specific transcriptional stress response pathway. This perturbation
of gene activity could account for the developmental abnormalities observed in copper-
exposed fathead minnow larvae that persist to later ages [11]. A disruption of myogenesis and skeletal formation would be potentially harmful to the survival of fish even if briefly exposed to high doses of copper. Muscle development in fish is crucial for evading predators, catching prey and for long periods of swimming. Rapid swimming is associated with fast or white muscle fibers, while long-term swimming is associated with slow or red muscle fibers. A change in the synthesis of fast muscles or slow muscles is therefore likely to have a negative effect on swimming ability in fish. The high proportion of translational machinery genes among the copper candidates probably indicates a reduction in developmental activity, thus slowing down growth during the larval stage. In general, copper-exposed larvae are sluggish and show a loss of balance, which is consistent with the repression of several genes.
To test our hypothesis as to whether copper stress would affect similar genes as
hypoxic stress, gene ontologies for both our transcriptional study and another hypoxia
study in zebrafish embryos (Figure 3) were compared. The functional categories of
copper- and hypoxia-affected genes do not reflect the ontologies for all identified fish
genes (www.tigr.org) and hence were not obtained in proportion to their representation
302 within the NCBI database. For example, contractile protein genes comprise
approximately 2% of the total number of genes in zebrafish as listed on the TIGR
database, while they comprise 25% of the 77 differentially expressed copper-responsive
candidate genes. Our copper gene ontology used 77 identified fragments and the hypoxia
gene ontology used 110 identified cDNAs [25]. A comparison between the two gene
ontologies shows both the similarities and differences in the affected genes associated
with copper and hypoxic stress. Thirty-five percent of copper-affected cDNAs were categorized as protein expression genes, 25% as cell structure genes and 24% as metabolism genes. In contrast to our study, 35% of hypoxia-affected genes were cell structure genes, 22% metabolism genes, 11% protein expression genes, 11 % glycolysis genes, 6% cell signaling genes, 5% cell division genes, 5% chaperone genes and 5% globin synthesis genes. In our copper study, no globin synthesis genes were identified as
being differentially expressed. Therefore, there is some overlap in genes affected by
copper and hypoxia, especially with cell structure, protein expression and metabolism
genes. The only up-regulated genes in the zebrafish hypoxia study were glycolysis and
chaperone genes. In our study, one glycolysis gene and chaperone genes were down-
regulated. Comparing exact expression profiles from our differential display study and
the microarray study with zebrafish is difficult because only a subset of genes was
validated in both studies. Of the 2197 differential display bands from our study, 144
unique copper candidate cDNAs were identified. Out of a 4512 cDNA microarray used to
study the hypoxic transcriptional response in embryonic zebrafish, 138 responsive
cDNAs were identified. When the 77 identified copper candidate genes were compared
with 110 identified genes from the zebrafish study, 13 genes were commonly identified
303 as aldolase B, alpha tropomyosin, ATPase sodium/potassium transporting beta 1a
polypeptide, beta actin I, creatine kinase M2-CK, cytochrome c oxidase subunit 3,
troponin I, heat shock cognate 70 kDa protein, NADH ubiquinone oxidoreductase
subunits 4L and 4, ribosomal protein L26, ribosomal protein L5b, skeletal alpha actin and
titin. If thirteen genes are commonly affected by both copper and hypoxia treatment out of approximately 2000 genes, then it implies that both types of stress may affect similar biochemical pathways in response to these stressors.
When validated cDNAs were compared to expression patterns for hypoxia stress,
copper appears to have a unique gene expression profile even though similar functional gene groups are affected by both stressors. In zebrafish embryos under hypoxic stress,
genes encoding the contractile proteins were all repressed [25]. In adult Gillichthys
mirabilis stressed by hypoxia, contractile protein genes were also repressed [37]. In our
study, many contractile protein genes were up-regulated strongly in response to copper
stress after 48 h. In the zebrafish hypoxia study, aldolase was up-regulated in response to
stress [25]. In our study, the gene putatively encoding aldolase was down-regulated. The
mRNAs that responded similarly to hypoxic stress and copper stress included those
identified as the mitochondrial gene cytochrome b, ribosomal proteins L12 and L27, and,
elongation factor-1 α. Genes encoding various ribosomal proteins and elongation factor 2
were repressed in hypoxia-stressed adult Gillichthys mirabilis, whereas cytochromes b
and c were induced [37]. The copper-responsive gene expression pattern in our real-time
PCR study did not exactly match the microarray expression patterns observed in both
hypoxia-stressed zebrafish embryos and adult Gillichthys mirabilis. However, it is
304 worthwhile to note that gene expression in this study was characterized after 48 hours of
copper exposure and no other time point. To compare step-by-step expression changes
more accurately, samples should be analyzed for gene expression at shorter time intervals
and preferably over a longer duration of copper exposure. Gene expression very likely
changes over time and hence the genes should be sampled over multiple time points to
obtain a clear picture of the transcriptional activity within the organism. In conclusion,
we can state that the copper-responsive candidate genes identified in this study were
perturbed or affected.
In summary, this study found several genes affected by copper stress in fish larvae
with the predominant groups of genes affected encoding protein synthesis and cell structure proteins. Eleven mRNA bands identified by differential display were validated using real-time PCR.
Because most copper candidate genes identified by differential display did not
play a role in cellular mechanisms for protection against metal toxicity, there are several
questions left unanswered by this study: (1) Is the transcriptional pattern produced in this
study consistent for copper exposure to fathead minnow larvae in independent
experiments?; (2) does epigenetics (DNA methylation, RNA interference or histone
acetylation that affect gene regulation and subsequently may determine which genes are
induced or repressed by an environmental factor) or genetic polymorphism play a role in
determining which genes are expressed during development and consequently which
genes will show a differential gene expression in response to copper?; (3) does
305 transcriptional change result in predicted protein synthesis alterations?; (4) how many differentially expressed copper candidate genes from this study are affected throughout the life of the fathead minnow? To answer some of the above questions, it would be worthwhile to establish the identity of all candidate genes by obtaining complete gene sequences. Once identity of the candidate genes is established, it would be helpful to distinguish alternatively spliced transcripts from single genes. Ideally, a cDNA array using the candidate genes should be produced to address these queries.
ACKNOWLEDGEMENTS
We acknowledge the contributions of J. Lazorchak, M. Smith, D. Lattier, C.
Tomlinson, R. Flick, D. Gordon, S. Jackson, R. Haugland, J. Deddens, S. Keely and J.
Stringer to this project. We thank M. Bagley, M. Miller and K. Petren for suggestions with this manuscript.
306 REFERENCES
1. Moore JW, Ramamoorthy S. 1984. Heavy Metals in Natural Waters, Applied
Monitoring and Impact Assessment. Springer-Verlag New York Inc., New
York, USA.
2. Mount DI. 1968. Chronic toxicity of copper to fathead minnows (Pimephales
promelas, Rafinesque). Water Res 2: 215-223.
3. Newman MC, Unger MA. 2003. Fundamentals of Ecotoxicology. Second
edition. Lewis Publishers, Boca Raton, FL, USA.
4. David, CPC. 2003. Establishing the impact of acid mine drainage through
metal bioaccumulation and taxa richness of benthic insects in a tropical Asian
stream (The Phillipines). Environ Toxicol Chem 22: 2952-2959.
5. Carpenter KE. 1927. The lethal action of soluble metallic salts on fishes.
British J Exp Biol 4: 378-390.
6. Stokes PM. 1979. Copper accumulations in freshwater biota. Pages 358-381
in Nriagu, J. O. (Ed.): Copper In the Environment, Part I. Ecological Cycling.
John Wiley & Sons, New York, USA.
7. Karan V, Vitorović S, Tutundžić V, Poleksić V. Functional enzymes activity
and gill histology of carp after copper sulfate exposure and recovery. Ecotox
Environ Saf 40: 49-55.
8. Baker JTP. 1969. Histological and microscopical observations on copper
poisoning in the winter flounder (Pseudopleuronectes americanus). J Fish Res
Board Can 26: 2785-2793.
307 9. Gardner GR, LaRoche G. 1973. Copper induced lesions in estuarine teleosts. J
Fish Res Board Can 30: 363-368.
10. Taylor EW, Beaumont MW, Butler PJ, Mair J, Mujallid MSI. 1996 Lethal and
sub-lethal effects of copper upon fish: a role for ammonia toxicity? Pages 85-
114 in Taylor EW (ed.): Toxicology of aquatic pollution: physiological,
cellular and molecular approaches. Cambridge University Press, New York,
NY, USA.
11. Scudder BC, Carter JL, Leland HV. 1988. Effects of copper on development
of the fathead minnow, Pimephales promelas Rafinesque. Aquat Toxicol 12:
107-124.
12. Blaxter JHS. 1988. Pattern and variety in development. Pages 1-58 in Hoar,
W. S., and D. J. Randall (eds.): Fish Physiology, volume XI, Part A.
Academic Press, San Diego, CA, USA.
13. Devlin EW, Brammer JD, Puyear RL, McKim JM. 1996. Prehatching
development of the fathead minnow Pimephales promelas Rafinesque.
USEPA publication EPA/600/R-96/079, Cincinnati, OH, USA.
14. Weber CI. 1993. Methods for measuring the acute toxicity of effluents and
receiving waters to freshwater and marine organisms (4th ed.). EPA/600/4-
90/027F, Cincinnati, OH, USA.
15. Kyle HM. 1926. The Biology of Fishes. The Macmillan Company, New York,
NY, USA.
16. McKim JM. 1977. Evaluation of tests with early life stages of fish for
predicting long-term toxicity. J Fish Res Board Can 34: 1148-1154.
308 17. McKim J M, Eaton JG, Holcombe GW. 1978. Metal toxicity to embryos and
larvae of eight species of freshwater fish-II: copper. Bull Environ Cont
Toxicol 19: 608-616.
18. Bartosiewicz M, Penn S, Buckpitt A. 2001. Applications of gene arrays in
environmental toxicology: fingerprints of gene regulation associated with
cadmium chloride, benzo(a)pyrene, and trichloroethylene. Environ Health
Persp 109: 71-74.
19. Denslow ND, Bowman CJ, Ferguson RJ, Lee HS, Hemmer MJ, Folmar LC.
2001. Induction of gene expression in sheepshead minnows (Cyprinodon
variegatus) treated with 17β-estradiol, diethylstilbestrol, or ethinylestradiol:
the use of mRNA fingerprints as an indicator of gene regulation. Gen Comp
Endocrinol 121: 250-260.
20. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman
DJ. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein
database search programs. Nucleic Acids Res 25: 3389-3402.
21. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data
∆∆C using real-time quantitative PCR and the 2- T method. Methods 25: 402-
408.
22. Liang P, Pardee AB.1992. Differential display of eukaryotic messenger RNA
by means of the polymerase chain reaction. Science 257: 967-971.
23. Sompayrac L, Jane S, Burn TC, Tenen DG, Danna KJ. 1995. Overcoming
limitations of the mRNA differential display technique. Nucleic Acids Res 23:
4738-4739.
309 24. Linskens, MHK, Feng J, Andrews WH, Enlow BE, Saati SM, Tonkin LA,
Funk WD, Villeponteau B. 1995. Cataloging altered gene expression in young
and senescent cells using enhanced differential display. Nucleic Acids Res 23:
3244-3251.
25. Ton C, Stamatiou D, Liew C-C. 2003. Gene expression profile of zebrafish
exposed to hypoxia during development. Physiol Genomics 13: 97-106.
26. Ton C, Stamatiou D, Dzau VJ, Liew C-C. 2002. Construction of a zebrafish
cDNA microarray: gene expression profiling of the zebrafish during
development. Biochem Biophys Res Comm 296: 1134-1142.
27. Tan F-L, Moravec CS, Li J, Apperson-Hansen C, McCarthy PM, Young JB,
Bond M. 2002. The gene expression fingerprint of human heart failure. PNAS
99: 11387-11392.
28. Donaldson EM, Dye HM. 1975. Corticosteroid concentrations in sockeye
salmon (Oncorhynchus nerka) exposed to low concentrations of copper. J
Fish Res Board Can 32: 533-539.
29. Sanders BM, Nguyen J, Martin LS, Howe SR, Coventry S. 1995. Induction
and subcellular localization of two major stress proteins in response to copper
in the fathead minnow Pimephales promelas. Comp Biochem Physiol 112C:
335-343.
30. Cheung APL, Lam THJ, Chan KM. 2004. Regulation of Tilapia
metallothionein gene expression by heavy metal ions. Mar Environ Res 58:
389-394.
310 31. Lauren DJ, McDonald DG. 1985. Effects of copper on branchial
ionoregulation in the Rainbow-Trout, Salmo gairdneri Richardson –
modulation by water hardness and pH. J Comp Phys B155: 635-644.
32. Chen WY, John JAC, Lin CH, Lin HF, Wu SC, Lin CH, Chang CY. 2004.
Expression of metallothionein gene during embryonic and early larval
development in zebrafish. Aquat Toxicol 69: 215-227.
33. Sarropoulou E, Kotoulas G, Power DM, Geisler R. 2005. Gene expression
profiling of gilthead sea bream during early development and detection of
stress-related genes by the application of cDNA microarray technology.
Physiol Genomics 23: 182-191.
34. Scudder BC. 1984. The Effect of Copper on the Development of the Fathead
Minnow Pimephales promelas Rafinesque. Master’s Thesis, California State
University, Hayward, CA, USA.
35. von Westernhagen H. 1988. Sublethal effects of pollutants on fish eggs and
larvae. Pages 253-346 in Hoar, W. S., and D. J. Randall (eds.): Fish
Physiology, Volume XIA. Academic Press, Inc., New York, NY, USA.
36. Colavecchia MV, Backus SM, Hodson PV, Parrott JL. 2004. Toxicity of oil
sands to early life stages of fathead minnows (Pimephales promelas). Environ
Toxicol Chem 23: 1709-1718.
37. Gracey AY, Troll JV, Somero GN. 2001. Hypoxia-induced gene expression
profiling in the euryoxic fish Gillichthys mirabilis. PNAS 98: 1993-1998.
38. Hilt W, Wolf DH. 1996. Proteasomes: destruction as a programme. Trends in
Biochem Sci 21: 96-102.
311 39. Blaxter JHS. 1969. Development: eggs and larvae. Pages 177-252 in W. S.
Hoar and D. J. Randall, editors. Fish Physiology, Volume III. Academic Press,
Inc., New York, NY, USA.
40. Stürzenbaum SR, Cater S, Morgan AJ, Kille P. 2001. Earthworm pre-
procarboxypeptidase: a copper responsive enzyme. Biometals 14: 85-94.
41. Hogstrand C, Balesaria S, Glover CN. 2002. Application of genomics and
proteomics for study of integrated response to zinc exposure in a non-model
fish species, the rainbow trout. Comp Biochem Physiol Part B 133: 523-535.
312 Table1: Primer sequences used for amplifying selected differential display bands using real-time PCR. mRNA Identity Forward Primer Reverse Primer (5’Æ 3’) (5’Æ 3’) aldolase B AGGCTGGGACAGGATGCT GCTTGTATTCCCTTTTGATGCAA Skeletal α-actin TGCCCCTCCTGAGCGTAAG TGGAGAGGGAAGCCAGGAT α-tropomyosin TTTTCTTCCATGTTTCTGTCTTTTTC TGCTCCATCCCCACTGAGA β-thymosin CCGTCAAAAGAAACCATTGAACA TGCATAGAAGAGTGGAGAACGAGTT carboxypeptidase B CGCTAGCCATGTGCTCAACA AACCCTGTATTCACAAGGCTTTCT chymotrypsinogen B1 TCTCCTGCTCAGATCAACACTCA CCAGGGAAGTCGTCAGTGGTT cytochrome c oxidase subunit III ACCTTCTTAGCCGTCTGCCTTA CATGCAGCGGCTTCGAA cytochrome b CAGAAAACTTCACCCCAGCAA ACAGGAAATATCACTCGGGTTGA elongation factor-1 α CCCTC ACGCTCTTGATGACACCAACAG TTGGTCGCTTTGCT eukaryotic translation elongation GCCAGGACCTTGCATTTCC TGCGCCAAGTGTAGGACTCA factor γ guanine nucleotide-binding protein GGTTTCATGCGTGCGTTTC CCACCCGCAGGACACAA fast muscle specific heavy myosin CAGAGAGAGGCCGCAAAGTG GAGTGCAGCAGCCCACAAC chain 4 60S ribosomal protein L12 CAGGCAAGCAGCGATTGAG TTCCTTCAGGGCCTTGATGA ribosomal protein L27 TGGTCCTGGCTGGACGTT TGCCATCATCAATGTTCTTAACAA proteasome 26S subunit CGGGAGATCCAGAGAACAATG CTCCGCGGGAGTCGAAT proteasome subunit 7 beta GCCCAACATGGAGGAGGAT AAGATACCAGCCGCTATTGCA survival motor neuron domain TCACCTTCGCTGGCTATGGT GCCCTCCTCCACTTCTTTGAG containing 1 stathmin CCAGAAAATGGAAGCCAACAA TTCTCTTTGAATTTCTCGTTCATAGC Troponin T3a, fast, skeletal muscle GGAGGAGCTTGGCAAATTCA CAGGACGACGCACTTACTTTCTG titin TGCCAACATCTCTGGATTTCC GCTCTGGCCAAATGGTTGA Troponin TnnT3b CCTTCATTCAGCAGGCATCTC CCGCCTTTGATAGCCTCTGAT Fast muscle troponin I GCCGCAGGCATCATTTG CCGCTTCCAGCAGATTGAA
313 Table 2: Survivorship of Pimephales promelas larvae to different copper treatments.
Copper Number of fish at Number of Percentage concentration the start of the survivors after 48 survivorship experiment hours 0 µg/L (control) 100 100 100% 50 µg/L 125 114 91.2% 125 µg/L 150 103 68.67% 200 µg/L 250 140 56%
314 Table 3: Water chemistry of control and test containers used in the copper experiment.
Copper Replicates pH Dissolved Conductivity Temperature concentration oxygen (mhos) (ºC) (mg/L) Initial Final Initial Final Initial Final Initial Final 0 µg/L 1-4 8.22 8.11 8.3 7.8 300 320 24.0 24.8 50 µg/L 1-5 8.23 8.11 8.2 7.7 300 315 24.1 24.7 125 µg/L 1-6 8.17 8.02 8.3 7.7 298 317 24.1 24.7 200 µg/L 1-10 8.16 8.09 8.2 7.6 299 312 24.3 25.0
315 Table 4: Copper-responsive differentially expressed fragments from fathead minnow larvae, primers used, putative identities, species from which genes were identified, E-values and Genbank accession numbers of homologous genes.
Anchor Arbitrary Expression Identity Species E-value Genbank primer primer accession no. 2 15 induced 40S ribosomal protein S4 mRNA Ictalurus punctatus 2.00E-50 AF402812.1 6 3 repressed 40S ribosomal protein S5 (rpS5) Danio rerio <0.0001 BC059443.1 6 3 repressed 60S ribosomal protein L12 Danio rerio e-119 AY648813.1 5 15 repressed acidic (leucine-rich) nuclear Danio rerio 5.00E-60 NM_212603.1 phosphoprotein 32 family,member B 6 1 repressed actinin, alpha 2 (ACTN2) Danio rerio 4.00E-14 AY391405.1 5 5 ambiguous Aldolase B Danio rerio <0.001 AF533646.1 5 3 repressed Alpha-amylase mRNA Lates calcarifer 2.00E-46 AF416651.1 6 19 induced alpha-tropomyosin (tpma) Danio rerio 2.00E-37 AF180892.1 5 5 ambiguous Anionic trypsin Oncorhynchus keta 3.00E-80 AB091439.1 5 16 repressed ATPase, Na/K transporting, beta 1a Danio rerio 3.00E-33 NM_131668.3 polypeptide mRNA 5 17 repressed basic helix-loop-helix transcription Danio rerio 4.00E-05 AJ510221.1 factor 4 2 repressed Beta-actin 1 Danio rerio 1.00E-85 BC063950.1 6 17 induced brefeldin A-inhibited guanine Homo sapiens 3.00E-20 AB209324.1 nucleotide-exchange protein 1 (BIG1) 5 17 repressed CCAAT/enhancer binding protein Danio rerio 5.00E-97 NM_131884.2 (C/EBP), beta 2 2 repressed Chymotrypsin b precursor Gadus morhua 3.00E-06 AJ242521.1 4 10 repressed Chymotrypsinogen B1 Danio rerio 1.00E-17 BC055574.1 1 6 induced Complement C3 mRNA Ctenopharyngodon 4.00E-45 AY374472.1 idella 3 15 repressed CPB mRNA for carboxypeptidase B Paralichthys 2.00E-09 AB099302.1
316 Anchor Arbitrary Expression Identity Species E-value Genbank primer primer accession no. olivaceus 2 17 ambiguous Creatine kinase M2-CK Cyprinus carpio e-107 AF055289.1 2 15 induced Cytochrome b mitochondrial Pimephales notatus e-125 U66606.1 5 16 repressed Cytochrome c oxidase subunit III Carassius auratus 2.00E-65 AY219843.1 gene 5 5 ambiguous cytochrome oxidase subunit II Hemibarbus 5.00E-57 AY704455.1 maculatus 6 3 repressed EF-1a mRNA for elongation factor Oreochromis 4.00E-04 AB075952.1 1a niloticus 6 1 repressed elongation factor 1-alpha Cyprinus carpio e-180 AF485331.1 3 6 repressed Eukaryotic translation elongation Danio rerio <0.0001 NM_173263.1 factor 1 gamma mRNA 6 16 repressed eukaryotic translation initiation Danio rerio 8.00E-34 AY648723.1 factor 2 gamma 5 1 ambiguous Fast muscle troponin I Danio rerio e-127 AF425744.1 3 16 ambiguous Fast muscle troponin T isoform Danio rerio 1.00E-28 AF425741.1 TnnT3b 6 3 induced fast skeletal muscle myosin heavy Danio rerio 2.00E-98 AF180893.1 polypeptide 1 (myhz1) 2 15 induced Fast skeletal muscle myosin light Cyprinus carpio 1.00E-97 D85141.1 chain 3 6 3 ambiguous fast skeletal myosin heavy chain 4 Danio rerio <0.0001 AY333450.1 (mhc4) 5 10 induced Guanine nucleotide binding protein Danio rerio 5.00E-35 AY423038.1 6 1 repressed heat shock cognate 70 kDa protein Carassius auratus e-100 AY195744.1 1 6 ambiguous Isolate MOLR19 cytochrome b gene Luxilus 7.00E-55 AF117167.1 chrysocephalus 4 20 induced Keratin 4 (krt4) mRNA Danio rerio 1.00E-26 NM_131509.1 5 5 induced LIM domain binding 3 like Danio rerio 4.00E-05 NM_199858.2
317 Anchor Arbitrary Expression Identity Species E-value Genbank primer primer accession no. 5 5 ambiguous Mitochondrial DNA Carassius auratus 1.00E-79 AY771781.1 6 15 ambiguous mRNA for stathmin Gallus gallus 2.00E-28 NM_001001858.1 6 1 repressed myosin, heavy polypeptide 2, fast Danio rerio 4.00E-57 NM_152982.2 muscle specific 4 15 induced NADH dehydrogenase subunit 2 Cyprinella gibbsi e-120 AF111219.1 6 16 repressed NADH dehydrogenase subunit I Ctenogobiops 9.00E-06 AF391435.1 gene feroculus 5 3 ambiguous NADH ubiquinone oxidoreductase Distoechodon 5.00E-32 AF036179.1 subunits 4L and 4 tumirostris 4 9 induced Parvalbumin isoform 1d mRNA Danio rerio 2.00E-77 AF467914.1 5 15 repressed peptidylprolyl isomerase A Danio rerio 1.00E-08 NM_212758.1 (cyclophilin A) 5 15 induced proteasome (prosome, macropain) Homo sapiens 2.00E-31 NM_002810.1 26S subunit 3 3 repressed proteasome (prosome, macropain) Danio rerio 7.00E-34 NM_131151.1 subunit 6 5 ambiguous proteasome subunit beta 7 Danio rerio 1.00E-62 AF155581.1 4 20 repressed Protocadherin-9 (PCDH9) Homo sapiens 2.00E-07 NM_020403.3 2 6 repressed Ribosomal protein L18 Ictalurus punctatus 4.00E-33 AF401572.1 4 2 repressed Ribosomal protein L21 Ictalurus punctatus 2.00E-64 AF401575 3 16 induced Ribosomal protein L26 mRNA Ictalurus punctatus e-164 AF401580.1 3 16 repressed ribosomal protein L27 Ictalurus punctatus e-122 AF401581.1 6 19 ambiguous ribosomal protein L37a Ictalurus punctatus 3.00E-70 AF401594.1 6 3 repressed ribosomal protein L4 Danio rerio e-178 BC049520.1 4 2 repressed Ribosomal protein L5b Ictalurus punctatus 1.00E-16 AF401557 4 20 ambiguous Ribosomal protein L7 Danio rerio <0.0001 NM_213644.1 4 15 Induced Ribosomal protein L7a mRNA Ictalurus punctatus 5.00E-35 AF401560.1 2 7 repressed ribosomal protein S15 Danio rerio 1.00E-04 NM_001001819.1 5 17 ambiguous ribosomal protein S25 Danio rerio 4.00E-08 NM_200815.1
318 Anchor Arbitrary Expression Identity Species E-value Genbank primer primer accession no. 6 15 ambiguous ribosomal protein S3A Danio rerio 2.00E-53 NM_200059.1 6 1 induced ribosomal protein S5 (rps5) Danio rerio 1.00E-17 NM_173232.1 6 6 repressed ribosomal RNA gene Ralstonia 7.00E-56 AF012418.1 solanacearum 6 17 repressed similar to ATP synthase H+ Xenopus laevis 2.00E-06 BC048772.1 transporting mitochondrial FO complex subunit b, isoform 1 4 15 repressed similar to neuronal transmembrane Gallus gallus 3.00E-05 XM_420266.1 protein Slitrk4 6 19 ambiguous skeletal muscle actin mutant mRNA Cyprinus carpio 2.00E-47 AY395871.1 6 19 repressed skeletal muscle alpha-actin Cyprinus carpio 7.00E-53 D50028.1 6 3 ambiguous survival motor neuron domain Danio rerio 2.00E-52 NM_212601.1 containing 1 (smndc1), 5 16 induced Synaptotagmin 1 Rattus rattus 1.00E-69 AJ617615.1 3 3 repressed Thymosin, beta 4, X chromosome Mus musculus 8.00E-09 NM_021278.1 6 5 induced titin Danio rerio 3.00E-17 AY081167.1 4 3 induced Transforming acidic coiled- Rattus norvegicus 3.00E-21 NM_001004415.1 containing protein 2 (TACC2) 6 15 ambiguous translation elongation factor 2 Danio rerio 4.00E-45 AY391422.1 5 16 induced Translation initiation factor 2 Danio rerio 7.00E-19 AY648723.1 mRNA 6 6 induced troponin T3a, skeletal fast Danio rerio 3.00E-51 BC053304.1 4 3 induced Type I keratin Danio rerio 5.00E-35 AF174137.1 4 2 repressed Type II cytokeratin (ckii) mRNA Danio rerio 1.00E-07 NM_131156.1 5 17 induced ubiquinol-cytochrome c reductase Oncorhynchus 2.00E-37 AF465782.1 core I protein mykiss
319 Table 5: Fold differences in RNA levels between copper-treated and control larvae.
mRNA identity Differential Real-time PCR Expression relative to Fold- display Gel response control (range) change Response aldolase B ambiguous† downregulated 0.561 (0.189-1.667) 1.781 skeletal α-actin downregulated upregulated 1.638 (1.083-2.478) 1.638 α-tropomyosin upregulated upregulated 1.214 (0.759-1.942) 1.214 β-thymosin downregulated upregulated 1.482 (0.855-2.568) 1.482 carboxypeptidase B downregulated downregulated 0.397 (0.097-5.512) 2.515 chymotrypsinogen B1 downregulated upregulated 1.099 (0.854-1.415) 1.099 cytochrome c oxidase downregulated downregulated 0.421 (0.122-1.459) 2.373 subunit III cytochrome b upregulated upregulated 3.685 (2.567-5.291) 3.685 elongation factor-1 α downregulated downregulated 0.539 (0.212-1.375) 1.853 eukaryotic translation downregulated upregulated 1.035 (0.908-1.180) 1.035 elongation factor γ guanine nucleotide- upregulated upregulated 1.155 (0.881-1.515) 1.155 binding protein fast muscle specific ambiguous† upregulated 3.119 (1.392-6.988) 3.119 heavy myosin chain 4 60S ribosomal protein downregulated downregulated 0.341 (0.182-2.538) 2.932 L12 ribosomal protein L27 downregulated downregulated 0.195 (0.078-3.551) 5.128 proteasome 26S upregulated upregulated 2.448 (1.708-3.507) 2.448 subunit proteasome subunit 7 ambiguous† upregulated 1.407* (0.977-2.024) 1.407 beta survival motor neuron ambiguous† upregulated 1.965 (1.224-3.155) 1.965 domain containing 1 stathmin ambiguous† upregulated 1.718 (1.161-2.542) 1.718 Troponin T3a, fast, upregulated upregulated 2.161 (1.519-3.073) 2.161 skeletal muscle titin upregulated upregulated 11.595 (5.566-24.153) 11.595 Troponin TnnT3b ambiguous† downregulated 0.883 (0.575-1.356) 1.132
Fast muscle troponin I ambiguous† upregulated 2.898 (1.887-4.451) 2.898 Gene expression differences were determined by dividing the estimated number of cDNA molecules from exposed fish by those of the control fish, with both values normalized to 18S rRNA. †Ambiguous expression changes in differential display refer to multiple bands identified as the same gene that showed induction in some gels and repression in others. * denotes statistically significant difference in a t-test done with ΔCt values using α = 0.05
320 up-regulated band in 200 µg/L Cu-treated fish
Figure 1: Portion of a representative differential display gel for copper-exposed fish. Differential display was performed using approximately 50 fish larvae in each duplicate RNA sample from each exposure group. The band indicated by the arrow denotes a band that was observed as up-regulated in one exposure group, but not equally induced in controls and other copper-exposed groups at lower dosage.
321 2197 bands generated by differential display
654 bands were copper-responsive
261 bands had clear sequences
161 bands matched functional genes
77 bands unique because of redundant sequences
22 bands selected for real-time PCR validation
9 bands confirmed for differential gene expression by copper
Figure 2: A flow-chart showing the selection process of bands from differential display
322 Gene ontology comparison of copper genes and hypoxia genes
40
35
30
25
copper genes 20 hypoxia genes percentage 15
10
5
0
n is n sis ion y lism s o ssio vi fense catio lycol l di ni G xpre l metab e ce n bin synthes i o tructure/motility e /commu s rot gl p ing Cell chaperones/de al gn si ll ce gene ontology
Figure 3: Ontology of copper-responsive genes from fathead minnows and hypoxia-responsive genes from zebrafish embryos (Ton et al., 2003)
323