sign in sign up
<<
Home , FHL2

Supplemental materials for Estrogen alpha mutations in breast cancer cells cause expression changes through constant activity and through secondary effects Spencer Arnesen, Zannel Blanchard, Michelle M Williams, Kristofer C Berrett, Zheqi Li, Steffi Oesterreich, Jennifer K Richer, and Jason Gertz

Supplemental Figure S1. Generation and validation of wildtype and mutant ER breast cancer lines. (a) Schematic of a CRISPR-mediated epitope tagging strategy that we used to generate multiple heterozygous FLAG- tagged α (ER) wildtype (WT) or mutant Y537S or D538G clones in T-47D and MCF-7 cell lines. (b) Immunoblots show expression of FLAG, ER and GAPDH, in T-47D and MCF-7 parental, FLAG-tagged WT, Y537S, and D538G ER clones. (c) qPCR analysis of known ER target validating ligand-independent gene regulation by D538G and Y537S ER mutants compared to parental and epitope tagged WT clones in T-47D cells and MCF-7 cells. E2 treatments are for 8 hours, bars indicate average ± SEM, Student’s two sample t-test, *p<0.05, **p<0.01, ***p<0.001.

Supplemental Figure S2. MCF-7 Y537S and D538G ER mutations exhibit a mutation-specific profile. (a) Principal component analysis of MCF-7 RNA-seq data displays the relationships between WT (blue), Y537S (yellow), and D538G (red) MCF-7 clones. (b) Heatmap shows expression of ligand-independent and mutant- specific shared and allele-specific genes identified from MCF-7 RNA-seq analysis. (c) Examples of ligand- independent (CISH) and mutant-specific (DEF6) gene expression changes are shown. Graphs show average normalized RNA-seq counts. Error bars show standard deviation for two clones for each genotype and each treatment. (d) ITGA6 and TLR5 are examples of mutant-specific genes shared across both cell lines (T-47D and MCF-7) for D538G and Y537S mutations, respectively. (e) enriched terms are shown for MCF-7 Y537S- and D538G-specific differentially regulated genes with Fisher’s exact test p-values.

Supplemental Figure S3. array analysis identifies that are differentially expressed in mutant clones compared to WT clones. (a) Heatmap shows levels of proteins that are expressed at significantly higher or lower levels in both Y537S and D538G T-47D mutant clones compared to T-47D WT clones. T-test p-values less than 0.05. (b) Examples of gene expression levels corresponding to protein changes highlighted in (a) are shown. Graphs show average normalized RNA-seq counts. Error bars show standard deviation for two clones for each genotype and each treatment.

Supplemental Figure S4. Gene expression analysis of RNA-seq data from three independent groups reveals consistent mutant-specific gene expression patterns in T-47D clones. (a) Principle component analyses of T- 47D (top) and MCF-7 (bottom) mutant and WT clones from three groups shows that the variability between groups exceeds the variability between clones from the same group. (b) Heatmap displays levels of consistent mutant- specific genes. Heatmap columns indicate group of origin, sample type, and treatment for each sample. (c) Examples of genes exhibiting consistent mutant-specific gene expression in T-47D clones are shown. Y-axis shows normalized RNA-seq counts from DESeq2; x-axis groups gene expression by lab of origin and ESR1 mutational status. (d) Significantly enriched gene ontology terms for Y537S-specific and D538G-specific gene sets from the T- 47D multi-lab comparison.

Supplemental Figure S5. Constant activity of ER explains over one-third of MCF-7 mutant-specific genes. (a) Principle component analysis of RNA-seq data exhibits the relationships between MCF-7 ER mutant clones and WT clones with short- or long-term E2 treatment. Mutational status is indicated by color and E2 treatment length by shape of symbol. (b) Heatmap shows levels of all MCF-7 mutant-specific genes separated by expression pattern of long-term E2-treatment in WT clones (top: genes regulated by long-term E2 treatment; bottom: genes not regulated by long-term E2 treatment). Mutational status is indicated by color bar and legend. E2 treatment time is indicated above the heatmap. (c) Plot shows the percent of mutant-specific genes regulated by prolonged ER activation in WT clones. (d) Examples of genes that are regulated by long-term E2 treatment (PIM3) and that are differentially regulated by mutation only (TPD52) are shown.

Supplemental Figure S6. Limited changes in ER’s genomic binding are observed in MCF-7 mutants compared to WT and these changes may explain a small portion of mutant-specific gene expression. (a) Heatmap shows ChIP-seq signal of constant and mutant-specific ERBS in MCF-7 WT and mutant clones with addition of DMSO or E2. (b) Example locus of ligand-independent (constant) ER binding is shown. Arrow indicates the TSS of the FHL2 gene. All tracks are normalized to the same scale. (c) Heatmap shows ChIP-seq signal of mutant-enriched or depleted sites only. (d) Cumulative distribution plots show the distance from MCF-7 mutant- specific genes to MCF-7 mutant-enriched and -depleted ERBS. Line colors indicate up- or down-regulated mutant- specific genes (red and blue) or all other genes (black).

Supplemental Figure S7. ER mutant cells exhibit large-scale alterations in chromatin accessibility across models from different groups. (a) Heatmap shows ATAC-seq signal of mutant-enriched and -depleted chromatin accessibility sites from T-47D Y537S and D538G mutant and WT clones from two groups. Differential chromatin accessibility regions are split by those shared across both mutations and those specific to one mutation. Group, treatment, and mutational status are indicated by the header bars and legend. (b) Graphs show the percent of mutant-enriched or -depleted accessible chromatin regions that also exhibit ER binding. (c) Enrichment is shown for DNA binding motifs at T-47D mutant-enriched accessible chromatin regions from two groups. Regions queried were TSS-distal and lacked ERBS. Identified motifs are shown (left) along with corresponding adjusted p-values (MEME-Suite E-value) for each mutation.

Supplemental Figure S8. Number of mutant-specific genes that contain either a nearby differential ERBS or ATAC-seq site. (a) Cumulative distribution graphs show the distance from T-47D D558G mutant-specific genes to D538G mutant-depleted or -enriched accessible chromatin. Line colors indicate up- (red) or down-regulated (blue) mutant-specific genes or all other genes (black). p-values from Wilcoxon tests can be found in supplemental Table S1. (b) Venn diagrams show overlap of genes containing at least one ERBS within 100 kb of their TSS (green) with genes containing at least one increased chromatin accessibility site within 100 kb of their TSS (purple).

Supplemental Table S3. Association between regulatory regions and mutant-specific genes.

Difference of Differential % genes harboring a site within 100kb of TSS (p- significant group regulatory regions value) over background T-47D Y537S- Y537S up-regulated Y537S down- All other

specific sites genes regulated genes genes ER binding enriched 15.15% (2.08e-30) 6.71% (0.008) 6.90% 8.25% ER binding depleted 9.81% (0.99) 22.66% (2.89e-23) 12.39% 10.26% 6.4% (up) Constant ERBS 70.8% (1.06e-14) 79.9% (9.95e-68) 64.4% 15.5% (down) ATAC enriched 32.25% (2.6e-85) 13.93% (0.981) 15.01% 17.24% ATAC depleted 18.72% (1) 37.76% (3.06e-34) 22.5% 15.28% T-47D D538G- D538G up-regulated D538G down- All other

specific sites genes regulated genes ER binding enriched 0.99 (1.75e-32) 0.27 (1) 0.67% 0.32% ER binding depleted 0.95 (1) 2.60 (8.96e-34) 1.30% 1.30% 9% (up) Constant ERBS 55.6% (1.91e-41) 59.6% (1.59e-71) 46.6% 13% (down) ATAC enriched 22.85% (1.89e-58) 12.53% (1) 13.12% 9.73% ATAC depleted 7.86% (1) 28.89% (6.7e-87) 11.84% 18.05% MCF-7 Y537S- Y537S up-regulated Y537S down- All other

specific sites genes regulated genes ER binding enriched 18.62% (8.81e-52) 3.96% (1) 5.42% 13.20% ER binding depleted 16.64% (0.33) 28.50% (3.62e-33) 1 4.71 % 1 3.79 % 18.8% (up) Constant ERBS 85.2% (2.32e-78) 74.8% (2.44e-16) 66.4% 8.4% (down) MCF-7 D538G- MCF-7 D538G up- MCF-7 D538G All other

specific sites regulated down-regulated genes ER binding enriched 2.00% (1.27e-9) 0.66% (0.802) 0.70% 1.30% ER binding depleted 9.31% (0.131) 13.91% (4.22e-11) 8.50% 5.41% 18.5% (up) Constant ERBS 84.9% (2.32e-93) 77.9% (2.75e-23) 66.4% 11.5% (down)

Supplemental Table S4. Y537S gblock used for template amplification to generate Y537S mutant clones and qPCR primers used

Name Sequence gBlock (IDT) with Y537S mutation in red CTTGAACTGCTTTACTCATTTAAAATACCCA CTCCTGCTTGGCTGAATATCTCATGTTGTCT TTTTAGAAGCTTTGGCGATCCTATTTGAATG CATTTAGGTCCTATTGGAGGGGAATAGGAT CTCATTTGAGGCCACGGAGGTCCATGGAAG TCACCTGCATAGCAAATACCCTGAAAGTGG CTGCAGGGAGAGTGTGAGGGTGGGACCGC CCTGGTAGGAGGTGGAAAATGAAAAACACA CGGCCATGAGTTCCAGATTAGGGCTTCTGA AAGCCCTCAGCTTTCCCAGCTCCCATCCTA AAGTGGGTCTTTAAACAGGAAGAAAGAAAG ATTGCTAAGTGTCTTTGGAGTTCCTCTTCCT TCCCCTTCTAGGGATTTCAGCACTCCTGGG GCTCGGGTTGGCTCTAAAGTAGTCCTTTCT GTGTCTTCCCACCTACAGTAACAAAGGCAT GGAGCATCTGTACAGCATGAAGTGCAAGA ACGTGGTGCCCCTCTCTGACCTGCTGCTG GAGATGCTGGACGCCCACCGCCTACATGC GCCCACTAGCCGTGGAGGGGCATCCGTG GAGGAGACGGACCAAAGCCACTTGGCCA CTGCGGGCTCTACTTCATCGCATTCCTTG CAAAAGTATTACATCACGGGGGAGGCAGA GGGTTTCCCTGCCACGGTCTGA CISH_qPCR_F TGCCAGAAGGCACGTTCTTAG CISH_qPCR_R GCCACGAGTGGTTTTCACTG PGR_qPCR_F ACCCGCCCTATCTCAACTACC PGR_qPCR_R AGGACACCATAATGACAGCCT SUSD3_qPCR_F GGTCCCAGCTGAAAGATGAG SUSD3_qPCR_R GCTCACGGGTTTGTTGAAGT CTCF_qPCR_F ACCTGTTCCTGTGACTGTACC CTCF_qPCR_R ATGGGTTCACTTTCCGCAAGG