(FHL2) Deficiency Aggravates Cholestatic Liver Injury

cells

Article Four-And-A-Half LIM-Domain Protein 2 (FHL2) Deﬁciency Aggravates Cholestatic Liver Injury

Judith Sommer 1, Christoph Dorn 2 , Erwin Gäbele 3, Frauke Bataille 4, Kim Freese 1, Tatjana Seitz 1, Wolfgang E. Thasler 5, Reinhard Büttner 6, Ralf Weiskirchen 7 , Anja Bosserhoﬀ 1,8 and Claus Hellerbrand 1,8,*

1 Institute of Biochemistry, Emil-Fischer-Zentrum, Friedrich-Alexander University Erlangen-Nürnberg, Fahrstr. 17, D-91054 Erlangen, Germany; [email protected] (J.S.); [email protected] (K.F.); [email protected] (T.S.); anja.bosserhoﬀ@fau.de (A.B.) 2 Institute of Pharmacy, University Regensburg, D-93053 Regensburg, Germany; [email protected] 3 Department of Internal Medicine I, University Hospital Regensburg, D-93053 Regensburg, Germany; [email protected] 4 Institute of Pathology, University Regensburg, D-93049 Regensburg, Germany; [email protected] 5 Hepacult GmbH, D-82152 Planegg/Martinsried, Germany; [email protected] 6 Institute of Pathology, University Hospital Cologne, D-50937 Cologne, Germany; [email protected] 7 Institute of Molecular Pathobiochemistry, Experimental Gene Therapy and Clinical Chemistry, RWTH University Hospital Aachen, D-52074 Aachen, Germany; [email protected] 8 Comprehensive Cancer Center (CCC) Erlangen-EMN, D-91054 Erlangen, Germany * Correspondence: [email protected]; Tel.: +49-9131-85-24644; Fax: +49-9131-85-22485

Received: 21 December 2019; Accepted: 16 January 2020; Published: 19 January 2020

Abstract: Cholestasis occurs in different clinical circumstances and leads to severe hepatic disorders. The four-and-a-half LIM-domain protein 2 (FHL2) is a scaffolding protein that modulates multiple signal transduction pathways in a tissue- and cell context-specific manner. In this study, we aimed to gain insight into the function of FHL2 in cholestatic liver injury. FHL2 expression was significantly increased in the bile duct ligation (BDL) model in mice. In Fhl2-deficient (Fhl2-ko) mice, BDL caused a more severe portal and parenchymal inflammation, extended portal fibrosis, higher serum transaminase levels, and higher pro-inflammatory and pro-fibrogenic gene expression compared to wild type (wt) mice. FHL2 depletion in HepG2 cells with siRNA resulted in a higher expression of the bile acid transporter Na+-taurocholate cotransporting polypeptide (NTCP) gene. Furthermore, FHL2-depleted HepG2 cells showed higher expression of markers for oxidative stress, lower B-cell lymphoma 2 (Bcl2) expression, and higher Bcl2-associated X protein (BAX) expression after stimulation with deoxycholic acid (DCA). In hepatic stellate cells (HSCs), FHL2 depletion caused an increased expression of TGF-β and several pro-fibrogenic matrix metalloproteinases. In summary, our study shows that deficiency in FHL2 aggravates cholestatic liver injury and suggests FHL2-mediated effects on bile acid metabolisms and HSCs as potential mechanisms for pronounced hepatocellular injury and fibrosis.

Keywords: four-and-a-half LIM-domain protein 2; FHL2; cholestatic liver injury; bile acids

1. Introduction Fibrosis is a highly conserved protective response to tissue injury. It is an essential biological mechanism for the maintenance of structural and functional tissue integrity. Additionally, hepatic ﬁbrosis can be considered as a wound-healing response to liver injury. It reﬂects a balance between

Cells 2020, 9, 248; doi:10.3390/cells9010248 www.mdpi.com/journal/cells Cells 2020, 9, 248 2 of 12 liver repair and scar formation. Pathological fibrosis corresponds to impaired wound healing [1]. The liver usually regenerates after an acute liver injury, but, if the injury persists, the liver reacts with progressive inflammatory response and fibrogenesis. The progressive and uncontrolled accumulation of extracellular matrix (ECM) proteins eventually leads to liver cirrhosis and hepatic failure. Furthermore, liver cirrhosis is a major risk factor for the development of hepatocellular cancer (HCC) [2,3]. Therefore, hepatic fibrosis is the most important pathophysiological factor that determines the morbidity and mortality of patients with chronic liver disease [4,5]. Unfortunately, no effective anti-fibrogenic therapy has been established thus far. Accordingly, there is a high medical need to improve our understanding of pathogenic mechanisms underlying hepatic fibrogenesis in order to identify new targets and to develop therapeutic strategies to inhibit hepatic fibrosis in patients with chronic liver disease. The four-and-a-half LIM-domain protein 2 (FHL2), also known as SLIM3 or DRAL, is the second member of the four-and-a-half LIM-domain protein family [6]. LIM proteins mediate protein–protein interactions, and FHL2 has also been described to interact with more than 50 different proteins that are involved in different signaling pathways [7]. Consequently, FHL2 has been shown to play important roles in various biological mechanisms, including cell proliferation, apoptosis, and transformation [7,8]. FHL2 is ubiquitously expressed, but it exerts tissue- and cell context-specific functions that are often opposing. For example, FHL2 inhibits the migration of dendritic cells, but it induces the migration of fibroblasts [9]. FHL2 has also been shown to affect different steps of wound healing [9]. The deletion of the Fhl2 gene in mice has been found to result in impaired wound healing in the skin, the intestine or ischemic muscle tissues [10–13]. So far, little information exists regarding the role of FHL2 in the liver and chronic liver diseases. Cholestatic liver injury is a pathophysiological situation that is relevant for a variety of diseases such primary biliary cholangitis, primary biliary sclerosis, and drug-induced hepatotoxicity. Cholestasis leads to hepatocellular injury and subsequent inflammation and fibrosis. Still, the molecular mechanisms and interplay between different pathological effects and cell types that lead to disease progression are only incompletely understood. The aim of this study was to analyze the role of FHL2 in cholestatic liver injury with a focus on hepatocellular damage and fibrosis.

2. Materials and Methods

2.1. Cells and Cell Culture The hepatoma cell line HepG2 (ATCC HB-8065) and the human hepatic stellate cell line LX-2 were cultured as described in [14]. The isolation and culture of primary human hepatic stellate cells (HSCs) was performed as described in [15]. Human liver tissue for cell isolation was obtained from the charitable, state-controlled Human Tissue and Cell Research (HTCR) foundation [16] with informed patient’s consent.

2.2. FHL2 Depletion with siRNA-Pools Transfection with FHL2 siRNA-pools was performed as described in [17] by using the Lipofectamine RNAimax transfection reagent (Life Technologies, Darmstadt, Germany) and siRNA-pools against human FHL2 mRNA (functionally verified by siTOOLs Biotech GmbH, Planegg, Germany). Si-pools are complex pools of defined siRNAs that are directed against the target gene, leading to a robust knockdown, while off-target effects are believed to be significantly reduced [18]. At 72 h after transfection, cells were further analyzed. For stimulation experiments, HepG2 cells were treated with deoxycholic acid (DCA) (Sigma-Aldrich, Steinheim, Germany) for 24 h at indicated concentrations. Cytotoxic effects were monitored by the analysis of lactate dehydrogenase (LDH) release into the supernatant by using the Pierce LDH cytotoxicity assay kit (Thermo Fisher Scientific, Waltham, MA, USA). Cells 2020, 9, 248 3 of 12

2.3. Animals and Bile Duct Ligation Male Fhl2-ko mice [13,19] and wild type (wt) littermates aged 10–12 weeks were kept under controlled standard conditions. The mice were fed with a standard laboratory diet and had access to water ad libitum. Bile duct ligation (BDL) and sham operations (control animals) were performed as described (n = 5 animals/group) [20]. The animal studies were approved by the Committee for Animal Health and Care of the local government (54-2531.1-28/05) and conformed to international guidelines on the ethical use of animals. After 2 weeks, animals were sacrificed, and blood samples were collected. Liver tissue samples were either fixed in 5% formalin or snap-frozen in liquid nitrogen and stored at 80 C until subsequent analyses. − ◦ 2.4. Quantitative Real-Time-PCR Analysis RNA isolation from liver tissues and reverse transcription were performed as described in [21]. Quantitative real-time PCR was performed by applying LightCycler technology (Roche Diagnostics, Mannheim, Germany) while using specific sets of primers, as listed in Table1. For the detection of the human NTCP, p47phox and TGF-β genes, QuantiTect Primer Assays (Qiagen, Hilden, Germany) were used. For normalization, the amplification of cDNA derived from 18S rRNA was used.

Table 1. Primer sequences for quantitative real-time PCR.

Gene Forward (50-30) Reverse (50-30) 18S TCTGTGATGCCCTTAGATGTCC CCATCCAATCGGTAGTAGCG Human α-SMA CGTGGCTATTCCTTCGTTAC TGCCAGCAGACTCCATCC BAX GGCCCACCAGCTCTGAGCAGA GCCACGTGGGCGTCCCAAAGT BCL2 GCGGATTTGAATCTCTTTCTC CACTAAACTGACTCCAGCTG BSEP TGCCCAGAATGGCCCTACA CCAGCATTGCCCTGAAACCA COL1A1 CGGCTCCTGCTCCTCTT GGGGCAGTTCTTGGTCTC CYP7A1 CCATAAGGTGTTGTGCCACGG TCCGTGAGGGAATTCAAGGCA FHL2 GAAACTCACTGGTGGACAAGC GTGGCAGATGAAGCAGGTCT MMP1 TCACCAAGGTCTCTGAGGGTCAAGC GGATGCCATCAATGTCATCCTGAGC MMP2 GCTGGGAGCATGGCGATGGATACC GGACAGAAGCCGTACTTGCCATCC MMP3 TGCTGTTTTTGAAGAATTTGGGTT CAATTCACAGAGACTTAGGTGAAGA MMP9 TGCCTTTGGACACGCACG CCTGGTTCAACTCACTCCGGG MMP10 GGGGGAAGACAGATATGGGT CTGTTCAGTGCAATTCAAAAGC MMP13 TACCAGACTTCACGATGGCATTGCTG AAAGTGGCTTTTGCCGGTGTAGGTG MMP14 GGAACCCTGTAGCTTTGTGTCTGTC TCTCTACCCTCAACAAGATTAGATTCC MRP2 TCACATGTCCATCCACTGTTTCA TGCTCAAAACAAGTGGCAGG Mouse α-sma CCAGCCATCTTTCATTGGGAT CCCCTGACAGGACGTTGTTA Col1a1 CTGTTCCAGGCAATCCACGA ATCAGCTGGAGTTTCCGTGC Fhl2 ACTGCCTGACCTGCTTCTGT TTGCCTGGTTATGAAAGAAAA Hmox-1 CACGCATATACCCGCTACCT CCAGAGTGTTCATTCGAGCA Il-1 TGCCACCTTTTGACAGTGATG AAGGTCCACGGGAAAGACAC Mcp-1 TGCAGGTCCCTGTCATGCTTC TGGACCCATTCCTTCTTGGGG Mmp1 CTTGGCCACTCCCTAGGTCT AGGGCTGGGTCACACTTCTC Mmp2 ATGGACAGCCCTGCAAGTTC CAGTGGACATAGCGGTCTCG Mmp9 GTCCAGACCAAGGGTACAGC CTGTCGGCTGTGGTTCAGTT Pai-1 ATGGGGCCGTGGAACAAGAA AGGCGTGTCAGCTCGTCTAC Tgf-β CATTGCTGTCCCGTGCAGAG CAGGCGTATCAGTGGGGGTC Tnf CCCTCACACTCAGATCATCTTCT GCTACGACGTGGGCTACAG

2.5. Protein Analysis Protein extraction from liver tissues, protein extraction from cells, and analysis by Western blotting were performed as described in [17] by applying mouse monoclonal anti-FHL2 (HycultBiotech, Uden, The Netherlands; HM2136, 1:300), rabbit monoclonal anti-alpha-smooth muscle actin (α-SMA) (Abcam, Cambridge, United Kingdom; ab32575, 1:1000), rabbit monoclonal anti-B-cell lymphoma 2 (BCL2) (Epitomics, Burlingame, CA, USA; #1017, 1:1000), rabbit polyclonal anti-metalloproteinase 13 Cells 2020, 9, 248 4 of 12

(anti-MMP13) (Abcam, Cambridge, United Kingdom; ab39012, 1:1000), rabbit polyclonal anti-MMP14 (Chemicon, Burlington, MA, USA; AB815, 1:1000) and mouse monoclonal anti-actin (ACTB; Merck Millipore, Billerica, MA, USA; MAB1501, 1:10,000) antibodies.

2.6. (Immono)Histological Analysis For hematoxylin and eosin (HE) staining, Sirius Red/Fast Green staining and immunohistological analysis, formalin-fixed and paraffin-embedded tissue blocks were sectioned at a standard thickness of 5 µm, deparaffinized with xylene, and stained as described previously [22] by applying the following antibodies: rabbit monoclonal anti-α-SMA (Abcam, Cambridge, United Kingdom; ab32575, 1:300) and rabbit polyclonal anti-CD3 (Sigma-Aldrich, St. Louis, MO, USA; C7930, 1:1000). Sirius Red/Fast Green staining was performed as described previously [23]. Microscopical images were taken with an OlympusTM CKX41 microscope with the ALTRA 20 Soft Imaging SystemTM and CellA software version 2.6 (Olympus Soft Imaging Solutions GmbH, Münster, Germany). IrfanViewTM software version 4.36 (Irfan Skiljan, Jajce, Bosnia) was used in order to process images.

2.7. Statistical Analysis Values are presented as mean SEM. Student’s unpaired t-test or, when appropriate, a two-way ± ANOVA test with the Sidak correction were used for comparison between groups, and a p-value < 0.05 was considered statistically signiﬁcant. All analyses were performed at least in triplicates. Calculations were performed by applying the statistical computer package GraphPad Prism version 6.01 for Windows (GraphPad Software, San Diego, CA, USA).

3. Results

3.1. Fhl2 Deficiency Aggravates Hepatocellular Injury and Inflammation in Cholestatic Liver Injury The experimental obstruction of the extrahepatic biliary system initiated a pathological cascade of events that led to cholestasis-induced hepatocellular injury and inflammation, which resulted in a strong fibrogenic reaction. Initially, we analyzed hepatic Fhl2 expression two weeks after the surgical ligation of the common bile duct in mice and observed a markedly increased upregulation as compared to sham-operated control mice (Figure1A). Subsequently, we applied this model of bile duct ligation (BDL) to male Fhl2-deficient (Fhl2-ko) and wt littermates. The sham-operated Fhl2-ko and wt mice served as controls. In response to BDL, the wt mice showed some inflammatory infiltration and few distinct necrotic areas (Figure1B). In contrast, large necrotic areas and pronounced parenchymal inflammation appeared in Fhl2-ko mice with BDL in the histological analysis (Figure1B). Fitting this, the BDL-induced increase of alanine aminotransferase (ALT) levels was significantly higher in the Fhl2-deficient mice compared to the wt mice (Figure1C). In contrast, serum bilirubin levels were markedly increased in both the wt and Fhl2-deficient mice and to a similar extent (Figure1D). Furthermore, the hepatic expression of heme oxygenase 1 (Hmox-1), a marker of oxidative stress, was markedly increased in response to BDL (Figure1E). The BDL-induced Hmox-1 expression levels tended to be higher in the Fhl2-deficient mice compared to the wt mice, further indicating that there was more pronounced hepatocellular injury in the Fhl2-deficient mice. The chemokine monocyte chemotactic protein 1 (Mcp-1) is produced at sites with oxidative stress and attracts inflammatory cells [24]. Fitting this, the BDL-induced expression levels of Mcp-1 were significantly higher in the Fhl2-deficient mice compared to the wt mice (Figure1F), and CD3-immunohistochemical staining revealed a strong lymphocytic infiltration in the Fhl2-deficient BDL mice but only a few CD3-positive cells in the liver tissue of the wt-mice with BDL (Figure1G). Moreover, the BDL-induced expression levels of the pro-inflammatory cytokines Il-1 and Tnf were significantly higher in the Fhl2-deficient mice compared to the wt mice (Figure1H,I). Cells 2020, 9, 248 5 of 12

In summary, Fhl2 deﬁciency in mice promoted hepatocellular injury and inﬂammation in the BDL modelCells 2020 of, 9 cholestatic, x FOR PEER liver REVIEW injury. 5 of 12

AB C DE 20 150 15 8 * 15 * 6 100 10 [mg/dl] [wt CTR set 1] set [wt CTR [U/l]

[wt CTR set 1] set CTR [wt 10 4 mRNA ALT 50 5 mRNA 5 2 Bilirubin wt BDL Fhl2ko BDL Fhl2

0 0 0 Hmox-1 0 CTR BDL wt Fhl2ko wt Fhl2ko wt Fhl2ko wt Fhl2ko wt Fhl2 ko wt Fhl2 ko CTR BDL CTR BDL CTR BDL

FHI150 G 20 40 * * * 15 100 30 [wt CTR set 1] set CTR [wt [wt CTR set 1] [wt CTR [wt CTR set 1] set [wt CTR 10 20

mRNA 50 mRNA mRNA mRNA mRNA 5 10 wt BDL Fhl2ko BDL Il-1 Tnf

Mcp-1 0 0 0 wt Fhl2ko wt Fhl2ko wt Fhl2ko wt Fhl2ko wt Fhl2ko wt Fhl2ko CTR BDL CTR BDL CTR BDL FigureFigure 1.1. Fhl2Fhl2 expressionexpression andand eeffectffect ofof Fhl2Fhl2 deficiencydeficiency onon hepatocellularhepatocellular injuryinjury andand inflammationinflammation inin thethe mousemouse modelmodel ofof bilebile ductduct ligationligation (BDL).(BDL). Fhl2Fhl2-deficient-deficient ((Fhl2Fhl2--ko)ko) andand wildwild typetype (wt)(wt) micemice werewere eithereither bilebile duct duct ligated ligated (BDL) (BDL or) or sham-operated sham-operated (CTR). (CTR). (A )(Fhl2A) Fhl2mRNA mRNA levels levels in wt in BDL wt BDL andCTR and miceCTR analyzed by qRT-PCR. (B) Representative hematoxylin and eosin stainings of liver tissue samples (20 mice analyzed by qRT-PCR. (B) Representative hematoxylin and eosin stainings of liver tissue× magnification).samples (20× magnification). (C) ALT (alanine (C) ALT aminotransferase) (alanine aminotransferase) and (D) bilirubin and serum(D) bilirubin levels. serum (E) Hmox-1 levels.and (E) (Hmox-1F) Mcp-1 andmRNA (F) expressionMcp-1 mRNA levels expression in liver tissue levels analyzed in liver by qRT-PCR.tissue analyzed (G) Immunohistochemical by qRT-PCR. (G) CD3 staining of liver tissue samples (20 magnification). (H) Il-1 and (I) Tnf mRNA expression levels Immunohistochemical CD3 staining of× liver tissue samples (20× magnification). (H) Il-1 and (I) Tnf inmRNA liver tissueexpression analyzed levels by in qRT-PCR. liver tissue (*: analyzedp < 0.05). by qRT-PCR. (*: p < 0.05). 3.2. Fhl2 Deficiency Aggravates Hepatic Fibrosis in the Mouse Model of Bile Duct Ligation 3.2. Fhl2 Deficiency Aggravates Hepatic Fibrosis in the Mouse Model of Bile Duct Ligation Activated hepatic stellate cells are a major cellular source of MCP-1 in injured livers [15]. In line Activated hepatic stellate cells are a major cellular source of MCP-1 in injured livers [15]. In line with this, the expression of α-smooth muscle actin (α-sma), a marker for HSC activation, was upregulated with this, the expression of α-smooth muscle actin (α-sma), a marker for HSC activation, was in response to BDL, with significantly higher expression levels in the Fhl2-deficient mice than the wt upregulated in response to BDL, with significantly higher expression levels in the Fhl2-deficient mice mice (Figure2A). An immunohistochemical analysis confirmed strong α-sma staining in the liver tissue than the wt mice (Figure 2A). An immunohistochemical analysis confirmed strong α-sma staining in of the Fhl2-ko mice with BDL, while the few α-sma positive cells in the wt-mice with BDL were mainly the liver tissue of the Fhl2-ko mice with BDL, while the few α-sma positive cells in the wt-mice with located around the periportal fields (Figure2B). Furthermore, the expression of transforming growth BDL were mainly located around the periportal fields (Figure 2B). Furthermore, the expression of factor-β (Tgf-β), the most prominent pro-fibrogenic cytokine in liver fibrosis, was significantly higher in transforming growth factor-β (Tgf-β), the most prominent pro-fibrogenic cytokine in liver fibrosis, the livers of Fhl2-deficient compared to the wt mice that were exposed to BDL (Figure2C). Fitting this, was significantly higher in the livers of Fhl2-deficient compared to the wt mice that were exposed to the Fhl2-ko mice with BDL showed significantly higher expression levels of Collagen type 1 α I(Col1a1) BDL (Figure 2C). Fitting this, the Fhl2-ko mice with BDL showed significantly higher expression as compared to the wt mice with BDL (Figure2D). Sirius Red staining confirmed enhanced extracellular levels of Collagen type 1 α I (Col1a1) as compared to the wt mice with BDL (Figure 2D). Sirius Red matrix deposition in the Fhl2-ko-BDL mice compared to the wt-BDL mice (Figure2E). Additionally, the staining confirmed enhanced extracellular matrix deposition in the Fhl2-ko-BDL mice compared to expression levels of the matrix metalloproteinases (Mmp) 1 and 2 was markedly increased in response the wt-BDL mice (Figure 2E). Additionally, the expression levels of the matrix metalloproteinases to BDL, with a high variation in expression levels in the Fhl2-deficient and wt animals (Figure2F,G). In (Mmp) 1 and 2 was markedly increased in response to BDL, with a high variation in expression levels contrast, the expression of Mmp9 was only slightly higher in the wt mice with BDL compared to the in the Fhl2-deficient and wt animals (Figure 2F,G). In contrast, the expression of Mmp9 was only sham-operated littermates (Figure2H). However, in the Fhl2-ko mice, BDL caused a marked increase of slightly higher in the wt mice with BDL compared to the sham-operated littermates (Figure 2H). hepatic Mmp9 expression. On the contrary, the expression of plasminogen activator inhibitor 1 (Pai-1) However, in the Fhl2-ko mice, BDL caused a marked increase of hepatic Mmp9 expression. On the was manifestly increased in both the Fhl2-ko and wt mice with BDL (Figure2I). contrary, the expression of plasminogen activator inhibitor 1 (Pai-1) was manifestly increased in both Still and, in summary, these data clearly indicate that mice with Fhl2 deficiency were more prone the Fhl2-ko and wt mice with BDL (Figure 2I). to hepatic fibrosis in the BDL model. Still and, in summary, these data clearly indicate that mice with Fhl2 deficiency were more prone to hepatic fibrosis in the BDL model.

CellsCells 20202020,, 99,, x 248 FOR PEER REVIEW 66 of of 12 12

25 C 5 A B * 20 * 4

15 3 [wt CTR set 1] set [wt CTR [wt CTR set 1] set [wt CTR

10 2 mRNA mRNA mRNA mRNA

β 1 5 wt BDL Fhl2ko BDL -sma α Tgf- 0 0 ko ko wt Fhl2ko wt Fhl2ko wt Fhl2 wt Fhl2 CTR BDL CTR BDL D 150 E F 20

* 15 100 [wt CTR set 1] set CTR [wt [wt CTR set 1] set CTR [wt 10

mRNA 50 mRNA 5 wt BDL Fhl2ko BDL Mmp1

Col1a1 0 0 wt Fhl2ko wt Fhl2ko wt Fhl2ko wt Fhl2ko CTR BDL CTR BDL 6 50 80 GH* I 40 60 4 30

[wt CTR set 1] set CTR [wt 40 [wt CTR set 1] set CTR [wt [wt CTR set 1] set [wt CTR 20 2 mRNA mRNA mRNA mRNA 20 10 Mmp2 Pai-1

0 Mmp9 0 0 wt Fhl2ko wt Fhl2ko wt Fhl2ko wt Fhl2ko wt Fhl2ko wt Fhl2ko CTR BDL CTR BDL CTR BDL Figure 2. Effect of Fhl2 deficiency on hepatic fibrosis in the mouse model of bile duct ligation (BDL). FigureFhl2-deficient 2. Effect (Fhl2 of Fhl2-ko) deficiency and wild typeon hepatic (wt) mice fibrosis were in either the mouse subjected model to BDL of bile or wereduct ligation sham-operated (BDL). Fhl2(CTR).-deficient (A) Hepatic (Fhl2-αko)-sma andmRNA wild type expression (wt) mice levels. were (B either) Immunohistochemical subjected to BDL orα -smawere stainingsham-operated of liver (CTR).tissue sections(A) Hepatic (20 αmagnification).-sma mRNA expression Hepatic (C levels.) Tgf-β (andB) Immunohistochemical (D) Col1a1 mRNA expression α-sma staining levels. (E of) Siriusliver × tissueRed/Fast sections Green (20× staining magnification). of liver tissue Hepatic sections (C) (20Tgf-β magnification).and (D) Col1a1 HepaticmRNA expression (F) Mmp1,( levels.G) Mmp2 (E) , × Sirius(H) Mmp9 Red/Fast, and (GreenI) Pai-1 stainingmRNA expressionof liver tissue levels sections in liver (20× tissue magnification). analyzed by qRT-PCR.Hepatic ( (*:F) pMmp1< 0.05)., (G) Mmp2, (H) Mmp9, and (I) Pai-1 mRNA expression levels in liver tissue analyzed by qRT-PCR. (*: p < 0.05). 3.3. FHL2 Depletion Promotes Bile Acid-Induced Hepatocellular Injury In Vitro 3.3. FHL2To gain Depletion further Promotes insight Bile into Acid the-Induced mechanism Hepatocellular by which Injury FHL2 In Vitro affects hepatocellular injury in the BDL-inducedTo gain further model insight of into chronic the mechanism cholestasis, by we which wanted FHL2 to analyze affects hepatocellular whether FHL2 injury affected in the the BDL-inducedcellular response model of hepatocytesof chronic cholestasis, to bile acids wein wanted vitro. to To analyze achieve whether this, we FHL2 used theaffected well-established the cellular responsehuman hepatoma of hepatocytes cell line to HepG2 bile acids and in si-pool vitro. technologyTo achieve forthis, specific we used FHL2 the suppression well-established (Figure human3A,B). hepatomaSubsequently, cell cellsline wereHepG2 treated and withsi-pool two technology different concentrations for specific FHL2 of deoxycholic suppression acid (Figure (DCA) for3A,B). 24 h. Subsequently,DCA exposition cells did were not atreatedffect FHL2 with expression two differen levelst concentrations (Figure3E). Furthermore,of deoxycholic we acid did (DCA) not observe for 24 h.cytotoxic DCA exposition effects under did not these affect experimental FHL2 expression conditions levels (Figure (Figure3C,D). 3E). Furthermore, However and we interestingly, did not observe the cytotoxichighest dose effects of DCAunder induced these experimental a marked induction conditions of (Figure neutrophil 3C,D). cytosolic However factor and 1 interestingly, (p47phox) in the the highestFHL2-depleted dose of cells,DCA whileinduced the a expression marked induction levels did of not neutrophil significantly cytosolic change factor in the 1 control (p47phox) transfected in the FHL2-depletedcells (Figure3F). cells, p47phox while is athe regulatory expression subunit levels of nicotinamidedid not significantly adenine dinucleotidechange in the phosphate control transfectedoxidases (NOXs) cells (Figure and a well-known 3F). p47phox marker is a regulato of oxidativery subunit stress inof hepatocytesnicotinamide [25 adenine]. Furthermore, dinucleotide it has phosphatebeen shown oxidases to be critically (NOXs) involved and ina well-known bile salt-induced marker apoptosis of oxidative [26]. Fitting stress this, in western hepatocytes blot analysis [25]. Furthermore,revealed lower it expressionhas been shown of B-cell to lymphomabe critically 2 involved (BCL2) in in FHL2-depleted bile salt-induced cells apoptosis that further [26]. decreased Fitting this,in response western to blot DCA analysis stimulation revealed (Figure lower3 G).expression In contrast, of B-cell the mRNA lymphoma expression 2 (BCL2 of) in Bcl2-associated FHL2-depleted X cellsprotein that (BAX further) increased decreased in DCA-treated in response cellsto DCA with stimulation FHL2 suppression, (Figure while3G). In the contrast, expression the levelsmRNA of expressionthis key factor of Bcl2-associated of intrinsic apoptosis X protein did (BAX not) change increased in controlin DCA-treated cells. (Figure cells 3withH). TheseFHL2 datasuppression, suggest whilethat FHL2 the expression protected HepG2levels of cells this from key bilefactor acid-induced of intrinsic oxidative apoptosis stress did not and change apoptosis. in control cells. (Figure 3H). These data suggest that FHL2 protected HepG2 cells from bile acid-induced oxidative stress and apoptosis.

Cells 2020, 9, x 248 FOR PEER REVIEW 7 of 12 Cells 2020, 9, x FOR PEER REVIEW 7 of 12

1.5 siCtr-CTR siFHL2-CTR A C D 1.5 1.5 siCtr-CTR siFHL2-CTR siCtr A * C D 1.5 siCtrsiFHL2 1.0 * siFHL2 [s iCtr s et 1] 1.0 1.0 [s iCtr s et 1] 1.0 mRNA

0.5 set 1] [siCtr-CTR mRNA 0.5 siFHL2-DCA set 1] [siCtr-CTR siCtr-DCA 0.5

FHL2 siFHL2-DCA 0.0 siCtr-DCA 0.5

FHL2 0.0 siCtr siFHL2 siCtr siFHL2 B FHL2 release LDH 0.0

B FHL2 release LDH 0.0 CTR DCA DCA actin CTR100µM DCA 200µMDCA actin 100µM 200µM

EF1.5 3 G H 2.0 siCtr 1.5 3 * EFsiFHL2 siCtr G H 2.0 siCtr * siCtr siFHL2 * DCA DCA siFHL2 * siFHL2 * siCtr siCtr * siFHL2 CTR 100DCA µM 200DCA µM 1.5 1.0 2 siFHL2 * * siCtrCTR siFHL2 siCtr100 siFHL2µM siCtr200 siFHL2µM 1.5

1.0 1] set [siCtr-CTR 2

* set 1] [siCtr-CTR siCtr siFHL2 siCtr siFHL2siCtr siFHL2 1.0 [siCtr-CTR set 1] set [siCtr-CTR [siCtr-CTR set 1] set [siCtr-CTR

* BCL2 set 1] [siCtr-CTR 1.0 mRNA mRNA

[siCtr-CTR set 1] set [siCtr-CTR 0.5

BCL2 mRNA 1 actin

0.5 mRNA 0.5 mRNA 1 actin mRNA 0.5 mRNA BAX

0.0 BAX

FHL2 0 0.0 p47phox 0.0

FHL2 CTR DCA DCA 0 0.0 p47phox CTR DCA DCA CTR DCA DCA CTR100µM DCA 200µMDCA CTR100µM DCA 200µMDCA CTR100µM DCA 200µMDCA 100µM 200µM 100µM 200µM 100µM 200µM Figure 3. Effect of FHL2 depletion on bile acid-induced hepatocellular injury in vitro. (A,B) FHL2 Figure 3. Effect of FHL2 depletion on bile acid-induced hepatocellular injury in vitro.(A,B) FHL2 FiguremRNA 3.and Effect protein of FHL2 expression depletion in HepG2 on bile cells acid-induced transfected hepatocellular with si-pools injuryagainst in FHL2 vitro. (siFHL2) (A,B) FHL2 and mRNA and protein expression in HepG2 cells transfected with si-pools against FHL2 (siFHL2) mRNAsi-control-pools and protein (siCtr). expression (C) Representative in HepG2 cells microscopical transfected with imag si-poolses 72 againsth after FHL2 transfection (siFHL2) (10Xand and si-control-pools (siCtr). (C) Representative microscopical images 72 h after transfection (10X si-control-poolsmagnification). (D(siCtr).) Quantification (C) Representative of lactate dehydrogenasmicroscopicale (LDH)images release 72 h intoafter the transfection supernatant. (10X (E) magnification). (D) Quantification of lactate dehydrogenase (LDH) release into the supernatant. magnification).FHL2, (F) p47phox (D,) and Quantification (H) BAX mRNA, of lactate and dehydrogenas (G) B-cell lymphomae (LDH) 2 release (BCL2) into protein the supernatant.expression after (E) (E) FHL2,(F) p47phox, and (H) BAX mRNA, and (G) B-cell lymphoma 2 (BCL2) protein expression after FHL2treatment, (F) p47phoxwith deoxycholic, and (H) BAX acid mRNA,(DCA) for and 24 ( Gh )and B-cell control lymphoma cells (CTR). 2 (BCL2) (*: p protein< 0.05). expression after treatmenttreatment with with deoxycholic deoxycholic acid (DCA) for 24 h and control cells (CTR). (*: p < 0.05).0.05). 3.4. FHL2 FHL2 Depletion Depletion Affects Affects Expression of Key Enzymes of Bile Acid Metabolism 3.4. FHL2 Depletion Affects Expression of Key Enzymes of Bile Acid Metabolism Cytochrome P450 7A1 (CYP7A1) is the key enzyme of bile acid synthesis. Its expression levels Cytochrome P450 7A1 (CYP7A1) is the key enzyme of bile acid synthesis. Its expression levels were slightlyslightly reduced reduced in thein the DCA-treated DCA-treated control contro cells,l whilecells, thewhile FHL2-depleted the FHL2-depleted cells showed cellsincreased showed were slightly reduced in the DCA-treated control cells, while the FHL2-depleted cells showed increasedexpression expression levels in response levels in to response the highest to the DCA highest dose (FigureDCA dose4A). Interestingly,(Figure 4A). Interestingly, Na +-taurocholate Na+- increased expression levels in response to the highest DCA dose (Figure 4A). Interestingly, Na+- taurocholatecotransporting cotransporting polypeptide (polypeptideNTCP), the major(NTCP transporter), the major for transporter bile acid uptake, for bile was acid already, uptake, under was taurocholate cotransporting polypeptide (NTCP), the major transporter for bile acid uptake, was already,basal conditions, under basal significantly conditions, higher significantly expressed in higher FHL2-depleted expressed compared in FHL2-depleted to control cells compared (Figure4 B).to already, under basal conditions, significantly higher expressed in FHL2-depleted compared to controlIn response cells to(Figure DCA 4B). stimulation, In responseNTCP to DCAexpression stimulation, levels declinedNTCP expression but remained levels higherdeclined in but the control cells (Figure 4B). In response to DCA stimulation, NTCP expression levels declined but remainedFHL2-depleted higher cells in the (Figure FHL2-depleted4B). cells (Figure 4B). remained higher in the FHL2-depleted cells (Figure 4B).

ACD1.5 B 3 15 3 siCtr siCtr siCtr siCtr 1.5 3 15 3 ACDsiFHL2 B siFHL2 siFHL2 siFHL2 siCtr * * siCtr siCtr siCtr siFHL2 siFHL2 siFHL2 siFHL2 * * 1.0 2 10 2 1.0 2 10 2 [siCtr-CTR set 1] set [siCtr-CTR [siCtr-CTR set 1] set [siCtr-CTR

[siCtr-CTR set 1] [siCtr-CTR * 1] set [siCtr-CTR [siCtr-CTR set 1] set [siCtr-CTR [siCtr-CTR set 1] set [siCtr-CTR

[siCtr-CTR set 1] [siCtr-CTR * 1] set [siCtr-CTR 0.5 1 5 1 mRNA 1 0.5 5 mRNA 1 mRNA mRNA mRNA mRNA mRNA mRNA

0.0 0 0 MRP2 0 CYP7A1 NTCP BSEP 0.0 0 0 MRP2 0 CYP7A1 CTR DCA DCA NTCP CTR DCA DCA BSEP CTR DCA DCA CTR DCA DCA CTR100µM DCA 200µMDCA CTR100µM DCA 200µMDCA CTR100µM DCA 200µMDCA CTR100µM DCA 200µMDCA 100µM 200µM 100µM 200µM 100µM 200µM 100µM 200µM Figure 4. EEffectﬀect ofof FHL2FHL2 depletion depletion on on bile bile acid acid metabolism. metabolism. HepG2 HepG2 cells cells were were transfected transfected with with si-pools si- Figurepoolsagainst against 4. FHL2 Effect (siFHL2)FHL2 of FHL2 (siFHL2) and depletion si-control-pools and si-con ontrol-poolsbile (siCtr).acid meta Analysis(siCtr).bolism. Analysis of HepG2 (A) CYP7A1 ofcells (A )were,( CYP7A1B) NTCP transfected, ,((BC) )NTCPBSEP with,, and (si-C) poolsBSEP(D) MRP2 , againstand mRNA(D )FHL2 MRP2 expression (siFHL2) mRNA afterexpressionand si-c treatmentontrol-pools after with treatment deoxycholic(siCtr). with Analysis deoxycholic acid (DCA)of (A) acid forCYP7A1 24 (DCA) h and, (B for) control NTCP 24 h, cellsand(C) BSEPcontrol(CTR)., and (*:cellsp (

Cells 2020, 9, 248 8 of 12

In contrast, the expression levels of bile salt export pump (BSEP) and multidrug Cells 2020, 9, x FOR PEER REVIEW 8 of 12 resistance-associated protein 2 (MRP2) did not differ between the FHL2-depleted and control cells (FigureMoreover,4C,D). the exposition to DCA caused a marked induction of the expression of these major bile saltMoreover, export transporters, the exposition but to this DCA induction caused awas marked similar induction in the FHL2-depleted of the expression and of control these majorcells. Together,bile salt export these transporters,data indicate butthat thisthe inductionelevated sy wasnthesis similar and inuptake the FHL2-depleted of bile acids in and FHL2-depleted control cells. cellsTogether, may be these a potential data indicate cause thatfor enhanced the elevated hepatocellular synthesis and injury uptake in cholestasis. of bile acids in FHL2-depleted cells may be a potential cause for enhanced hepatocellular injury in cholestasis. 3.5. FHL2 Depletion Promotes Pro-Fibrogenic Gene Expression in Hepatic Stellate Cells 3.5. FHL2 Depletion Promotes Pro-Fibrogenic Gene Expression in Hepatic Stellate Cells Besides hepatocellular injury and inflammation, enhanced fibrosis was the most prominent Besides hepatocellular injury and inflammation, enhanced fibrosis was the most prominent pathological feature of the Fhl2-ko mice in the BDL model compared to the wt mice. The activation pathological feature of the Fhl2-ko mice in the BDL model compared to the wt mice. The activation of hepatic stellate cells (HSCs) is the key event of hepatic fibrosis [2,3]. Here, we found that FHL2 of hepatic stellate cells (HSCs) is the key event of hepatic fibrosis [2,3]. Here, we found that FHL2 expression was increased in primary human HSCs during in vitro activation (Figure 5A). expression was increased in primary human HSCs during in vitro activation (Figure5A).

A B D E 15 1.5 1.5 siCtr siFHL2 * 1.0 1] set [siCtr 1.0 * 1] set [siCtr 10 [d3 set1] [d3 0.5 mRNA 0.5 mRNA

mRNA 5 * 0.0 0.0 FHL2 siCtr siFHL2 a-SMA siCtr siFHL2 F FHL2 C a-SMA 0 FHL2 d3 d7 d13 ac tin actin G HI JKLM 1.5 1.5 2.0 2.0 1.5 1.5 1.5 * * * 1.5 1.5 1.0 1.0 1.0 1.0 1.0 [siCtr set 1] set [siCtr [siCtr set 1] set [siCtr [siCtr set 1] set [siCtr [siCtr set 1] set [siCtr 1] set [siCtr 1] set [siCtr set 1] [siCtr 1.0 1.0 mRNA mRNA mRNA 0.5 0.5 mRNA mRNA mRNA 0.5 mRNA 0.5 0.5 0.5 0.5 MMP1 MMP3 MMP2 MMP9 TGF-ß MMP10 COL1A1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 siCtr siFHL 2 siCtr siFHL2 siCtr siFHL2 siCtr siFHL2 siCtr siFHL2 siCtr siFHL2 siCtr siFHL2 NOPQ 2.0 2.0 siCtr siFHL2 siCtr siFHL2 pro-MMP14 * * 1.5 MMP13 1.5

[siCtr set 1] set [siCtr actin 1] set [siCtr active MMP14 actin 1.0 1.0 mRNA mRNA

0.5 0.5 MMP13 MMP14

0.0 0.0 siCtr siFHL2 siCtr siFHL2 Figure 5. Figure 5. EffectEffect of FHL2 of FHL2 depletion depletion on pro-fibrogenic on pro-fibrogenic gene expression gene expression in hepatic in hepaticstellate cells stellate in vitro. cells in vitro.(A) FHL2 mRNA expression during activation of primary human hepatic stellate cells (A) FHL2 mRNA expression during activation of primary human hepatic stellate cells (HSCs). (B,C) (HSCs). (B,C) FHL2 mRNA and protein expression in LX-2 cells transfected with si-pools against FHL2 mRNA and protein expression in LX-2 cells transfected with si-pools against FHL2 (siFHL2) FHL2 (siFHL2) and si-control-pools (siCtr). (D) Representative microscopical images 72 h after and si-control-pools (siCtr). (D) Representative microscopical images 72 h after transfection (10× transfection (10 magnification). (E,F) α-SMA mRNA and protein expression. (G) COL1A1,(H) TGF-β, magnification). ×(E,F) α-SMA mRNA and protein expression. (G) COL1A1, (H) TGF-β, (I) MMP1, (J) (I) MMP1,(J) MMP3,(K) MMP2,(L) MMP9 and (M) MMP10 mRNA expression and (N,O) MMP13 MMP3, (K) MMP2, (L) MMP9 and (M) MMP10 mRNA expression and (N,O) MMP13 and (P,Q) and (P,Q) MMP14 mRNA and protein expression 72 h after transfection. (*: p < 0.05). MMP14 mRNA and protein expression 72 h after transfection. (*: p < 0.05). To further assess whether the pro-fibrogenic effects of FHL2 deficiency in the BDL model were To further assess whether the pro-fibrogenic effects of FHL2 deficiency in the BDL model were also mediated via direct effects in HSCs, we depleted FHL2 in the human HSC line LX-2 by applying also mediated via direct effects in HSCs, we depleted FHL2 in the human HSC line LX-2 by applying si-pool technology. Control cells were transfected with unspecific control si-pools (Figure 5B,C). A microscopical analysis revealed no differences between the FHL2-depleted and control HSCs (Figure

Cells 2020, 9, 248 9 of 12 si-pool technology. Control cells were transfected with unspecific control si-pools (Figure5B,C). A microscopical analysis revealed no differences between the FHL2-depleted and control HSCs (Figure5D); additionally, α-SMA mRNA and protein levels (Figure5E,F), as well as COL1A1 mRNA expression, were not affected by FHL2 depletion (Figure5G). In contrast, TGF-β levels were slightly but significantly higher in the FHL2-depleted cells compared to the control cells (Figure5H). Furthermore, the mRNA expression of several metalloproteinases, including MMP1, MMP3, MMP13 and MMP14, was higher in FHL2-depleted cells (Figure5I–N,P). A western blot analysis of MMP13 and MMP14 revealed that these differences were even more pronounced on the protein level (Figure5O,Q). In summary, these data indicate that FHL2 depletion also has direct pro-fibrogenic effects in HSCs in vitro.

4. Discussion In this study, we aimed to analyze the function of FHL2 in cholestatic liver injury. In murine studies, we used the BDL model, a well-established model to mimic cholestatic liver injury and fibrosis. In this model, the Fhl2-deficient mice revealed a significantly enhanced manifestation of pathological progression. A histological analysis and serum transaminase levels showed significantly enhanced hepatocellular damage. In a previous study, liver histology and serum transaminase levels did not differ between the Fhl2-deficient and wt mice in the model of chronic toxic liver injury with carbon tetrachloride (CCl4)[19]. This indicates that Fhl2 deficiency does not uniformly enhance the vulnerability of hepatocytes for (toxic) injury. Still, it has to be noted that here, as well as in the previous study that applied the CCl4 model, only male mice have been assessed. A study by Govoni et al. found that the female Fhl2-ko mice revealed a lower bone mineral content and bone mineral density compared to their male littermates [27]. Further studies need to evaluate whether there are also gender-specific differences in regard to Fhl2 and (cholestatic) liver injury. Despite the effect on bone density, the Fhl2-ko mice have shown no obvious abnormalities, suggesting a high capacity for the fine-tuning adjustment and functional redundancy of Fhl2 under physiological conditions [9]. Additionally, here and as already described in previous studies [19], the Fhl2-ko control or sham-operated mice did not show any hepatologic abnormalities, and after BDL, a macroscopic analysis did not show pathological alterations besides the liver (data not shown). Still, it has to be considered that the complete Fhl2-ko in the mice may have also affected further organs or (patho)physiological mechanisms that contributed to the observed enhanced hepatocellular injury, inflammation and fibrosis in the BDL model. Bile acids are significantly elevated after BDL and are majorly involved in cholestatic liver injury [28,29]. This prompted us to further assess the role of FHL2 in bile acid metabolism. We found that, under basal conditions, the FHL2-depleted hepatoma cells showed significantly higher NTCP expression levels compared to the control cells; additionally, upon bile acid stimulation, the expression of this major transporter for uptake of bile acids into hepatocytes remained significantly higher in the FHL2-depleted cells. Moreover, the FHL2-depleted cells showed a higher CYP7A1 expression upon bile acid stimulation. CYP7A1 is the rate-limiting enzyme in bile acid synthesis. In combination, these findings indicate enhanced bile acid levels as potential reason for the more pronounced hepatocellular injury of the Fhl2-deficient mice in the BDL model. To the best of our knowledge, no previous studies have assessed the role of FHL2 in bile acid metabolism. Only one study described the impact of FHL2 on cholesterol metabolism in vascular smooth muscle cells [30]. Kurakula et al. observed that cholesterol synthesis and liver X receptor (LXR) pathways are altered in the absence of FHL2, functionally resulting in an attenuated cholesterol efflux [30]. Next to enhanced hepatocellular injury, FHL2 deficiency caused a markedly enhanced expression of pro-inflammatory genes, paralleled by enhanced fibrogenesis in the BDL model. These pathological processes are closely intertwined, and it is difficult to dissect whether the enhanced fibrosis was Cells 2020, 9, 248 10 of 12 indirectly caused by the more pronounced injury and inflammation or whether FHL2 also directly impacts hepatic fibrosis and HSCs. To get further insight into this question, we compared HSCs with and without FHL2 depletion. In line with a previous study that showed an impact of FHL2 on TGF-β expression [31], we observed a slightly but significantly enhanced expression of this strong pro-fibrogenic cytokine in FHL2-depleted HSCs. Moreover, the expression of several MMPs was enhanced in the FHL2-depleted HSCs. These ECM-modulating enzymes are known to promote hepatic fibrogenesis as well as multiple aspects of liver inflammation [32,33]. Together, these data suggest that the lack of FHL2 in HSCs contributed to the enhanced fibrogenesis of the Fhl2-ko mice in the BDL model. Moreover, it has to be considered that further parenchymal and non-parenchymal liver cells, as well as infiltrating immune cells, are involved in cholestatic liver injury [34]. Considering the pleiotropic role of FHL2, it appears likely that FHL2 also impacts cholestatic liver injury via its effect on these other cell types. For example, Dahan et al. found that the knockdown of FHL2 in macrophages impaired lipopolysaccharide-induced NF-κB activity [35]. Furthermore, FHL2 cannot be generally considered as beneficial. Rather, it has shown not only tissue- and cell context-specific functions but also often opposing functions. Thus, Nouët et al. described enhanced apoptosis and hepatocarcinogenesis upon Fhl2 overexpression in the liver of Fhl2 transgenic mice [36]. However, another study found delayed hepatocyte regeneration following partial hepatectomy in Fhl2-ko mice [35]. Our study has shown that a deficiency in FHL2 aggravates cholestatic liver injury, further underscoring the important role of FHL2 in liver homeostasis.

Author Contributions: J.S., C.D., E.G., T.S. and K.F. performed the experiments. J.S., C.D., F.B. and C.H. analyzed the data. W.E.T., R.B., R.W. and A.B. provided material and methods. J.S., C.D., E.G. and C.H. designed the project. J.S. and C.H. wrote the manuscript; All authors have read and agreed to the published version of the manuscript. Funding: This work was supported by grants from the German Research Association (DFG) to CH (HE2458/15 and HE2458/18) and by the Human Tissue and Cell Research (HTCR) Foundation, a non-profit foundation regulated by German civil law, which facilitates research with human tissues and cells through the provision of an ethical and legal framework for sample collection. Acknowledgments: The authors are indebted to Jennifer Czekalla and Rudolf Jung for excellent technical assistance. Conflicts of Interest: All contributing authors declare no conflict of interests.

References

1. Pellicoro, A.; Ramachandran, P.; Iredale, J.P.; Fallowfield, J.A. Liver fibrosis and repair: Immune regulation of wound healing in a solid organ. Nat. Rev. Immunol. 2014, 14, 181–194. [CrossRef][PubMed] 2. Lee, Y.A.; Wallace, M.C.; Friedman, S.L. Pathobiology of liver fibrosis: A translational success story. Gut 2015, 64, 830–841. [CrossRef][PubMed] 3. Koyama, Y.; Brenner, D.A. Liver inflammation and fibrosis. J. Clin. Investig. 2017, 127, 55–64. [CrossRef] [PubMed] 4. Ekstedt, M.; Hagstrom, H.; Nasr, P.; Fredrikson, M.; Stal, P.; Kechagias, S.; Hultcrantz, R. Fibrosis stage is the strongest predictor for disease-specific mortality in NAFLD after up to 33 years of follow-up. Hepatology 2015, 61, 1547–1554. [CrossRef] 5. Angulo, P.; Kleiner, D.E.; Dam-Larsen, S.; Adams, L.A.; Bjornsson, E.S.; Charatcharoenwitthaya, P.; Mills, P.R.; Keach, J.C.; Lafferty, H.D.; Stahler, A.; et al. Liver Fibrosis, but No Other Histologic Features, Is Associated With Long-term Outcomes of Patients With Nonalcoholic Fatty Liver Disease. Gastroenterology 2015, 149, 389–397. [CrossRef] 6. Tran, M.K.; Kurakula, K.; Koenis, D.S.; de Vries, C.J. Protein-protein interactions of the LIM-only protein FHL2 and functional implication of the interactions relevant in cardiovascular disease. Biochim. Biophys. Acta 2016, 1863, 219–228. [CrossRef] 7. Johannessen, M.; Moller, S.; Hansen, T.; Moens, U.; Van Ghelue, M. The multifunctional roles of the four-and-a-half-LIM only protein FHL2. Cell Mol. Life Sci. 2006, 63, 268–284. [CrossRef] Cells 2020, 9, 248 11 of 12

8. Verset, L.; Feys, L.; Trepant, A.L.; De Wever, O.; Demetter, P. FHL2: A scaffold protein of carcinogenesis, tumour-stroma interactions and treatment response. Histol. Histopathol. 2016, 31, 469–478. [CrossRef] 9. Wixler, V. The role of FHL2 in wound healing and inflammation. FASEB J. 2019, 33, 7799–7809. [CrossRef] 10. Huang, P.H.; Chen, C.Y.; Lin, C.P.; Wang, C.H.; Tsai, H.Y.; Lo, W.Y.; Leu, H.B.; Chen, J.W.; Lin, S.J.; Chu, P.H. Deletion of FHL2 gene impaired ischemia-induced blood flow recovery by modulating circulating proangiogenic cells. Arterioscler. Thromb. Vasc. Biol. 2013, 33, 709–717. [CrossRef] 11. Kirfel, J.; Pantelis, D.; Kabba, M.; Kahl, P.; Roper, A.; Kalff, J.C.; Buettner, R. Impaired intestinal wound healing in Fhl2-deficient mice is due to disturbed collagen metabolism. Exp. Cell Res. 2008, 314, 3684–3691. [CrossRef][PubMed] 12. Goltz, D.; Hittetiya, K.; Gevensleben, H.; Kirfel, J.; Diehl, L.; Meyer, R.; Buttner, R. Loss of the LIM-only protein Fhl2 impairs inflammatory reaction and scar formation after cardiac ischemia leading to better hemodynamic performance. Life Sci. 2016, 151, 348–358. [CrossRef][PubMed] 13. Wixler, V.; Hirner, S.; Muller, J.M.; Gullotti, L.; Will, C.; Kirfel, J.; Gunther, T.; Schneider, H.; Bosserhoff, A.; Schorle, H.; et al. Deficiency in the LIM-only protein Fhl2 impairs skin wound healing. J. Cell Biol. 2007, 177, 163–172. [CrossRef][PubMed] 14. Amann, T.; Maegdefrau, U.; Hartmann, A.; Agaimy, A.; Marienhagen, J.; Weiss, T.S.; Stoeltzing, O.; Warnecke, C.; Scholmerich, J.; Oefner, P.J.; et al. GLUT1 expression is increased in hepatocellular carcinoma and promotes tumorigenesis. Am. J. Pathol. 2009, 174, 1544–1552. [CrossRef][PubMed] 15. Muhlbauer, M.; Bosserhoff, A.K.; Hartmann, A.; Thasler, W.E.; Weiss, T.S.; Herfarth, H.; Lock, G.; Scholmerich, J.; Hellerbrand, C. A novel MCP-1 gene polymorphism is associated with hepatic MCP-1 expression and severity of HCV-related liver disease. Gastroenterology 2003, 125, 1085–1093. [CrossRef] 16. Thasler, W.E.; Weiss, T.S.; Schillhorn, K.; Stoll, P.T.; Irrgang, B.; Jauch, K.W. Charitable State-Controlled Foundation Human Tissue and Cell Research: Ethic and Legal Aspects in the Supply of Surgically Removed Human Tissue For Research in the Academic and Commercial Sector in Germany. Cell Tissue Bank. 2003, 4, 49–56. [CrossRef] 17. Mahli, A.; Seitz, T.; Beckroge, T.; Freese, K.; Thasler, W.E.; Benkert, M.; Dietrich, P.; Weiskirchen, R.; Bosserhoff, A.; Hellerbrand, C. Bone Morphogenetic Protein-8B Expression is Induced in Steatotic Hepatocytes and Promotes Hepatic Steatosis and Inflammation In Vitro. Cells 2019, 8, 457. [CrossRef] 18. Hannus, M.; Beitzinger, M.; Engelmann, J.C.; Weickert, M.T.; Spang, R.; Hannus, S.; Meister, G. siPools: Highly complex but accurately defined siRNA pools eliminate off-target effects. Nucleic Acids Res. 2014, 42, 8049–8061. [CrossRef][PubMed] 19. Huss, S.; Stellmacher, C.; Goltz, D.; Khlistunova, I.; Adam, A.C.; Trebicka, J.; Kirfel, J.; Buttner, R.; Weiskirchen, R. Deficiency in four and one half LIM domain protein 2 (FHL2) aggravates liver fibrosis in mice. BMC Gastroenterol. 2013, 13, 8. [CrossRef][PubMed] 20. Gabele, E.; Muhlbauer, M.; Dorn, C.; Weiss, T.S.; Froh, M.; Schnabl, B.; Wiest, R.; Scholmerich, J.; Obermeier, F.; Hellerbrand, C. Role of TLR9 in hepatic stellate cells and experimental liver fibrosis. Biochem. Biophys. Res. Commun. 2008, 376, 271–276. [CrossRef] 21. Sommer, J.; Mahli, A.; Freese, K.; Schiergens, T.S.; Kuecuekoktay, F.S.; Teufel, A.; Thasler, W.E.; Muller, M.; Bosserhoff, A.K.; Hellerbrand, C. Analysis of molecular mechanisms of 5-fluorouracil-induced steatosis and inflammation in vitro and in mice. Oncotarget 2017, 8, 13059–13072. [CrossRef][PubMed] 22. Dorn, C.; Engelmann, J.C.; Saugspier, M.; Koch, A.; Hartmann, A.; Muller, M.; Spang, R.; Bosserhoff, A.; Hellerbrand, C. Increased expression of c-Jun in nonalcoholic fatty liver disease. Lab. Investig. 2014, 94, 394–408. [CrossRef][PubMed] 23. Arndt, S.; Wacker, E.; Dorn, C.; Koch, A.; Saugspier, M.; Thasler, W.E.; Hartmann, A.; Bosserhoff, A.K.; Hellerbrand, C. Enhanced expression of BMP6 inhibits hepatic fibrosis in non-alcoholic fatty liver disease. Gut 2015, 64, 973–981. [CrossRef][PubMed] 24. Deshmane, S.L.; Kremlev, S.; Amini, S.; Sawaya, B.E. Monocyte chemoattractant protein-1 (MCP-1): An overview. J. Interferon Cytokine Res. 2009, 29, 313–326. [CrossRef][PubMed] 25. Garcia-Ruiz, I.; Solis-Munoz, P.; Fernandez-Moreira, D.; Munoz-Yague, T.; Solis-Herruzo, J.A. In vitro treatment of HepG2 cells with saturated fatty acids reproduces mitochondrial dysfunction found in nonalcoholic steatohepatitis. Dis. Model Mech. 2015, 8, 183–191. [CrossRef] 26. Reinehr, R.; Becker, S.; Keitel, V.; Eberle, A.; Grether-Beck, S.; Haussinger, D. Bile salt-induced apoptosis involves NADPH oxidase isoform activation. Gastroenterology 2005, 129, 2009–2031. [CrossRef] Cells 2020, 9, 248 12 of 12

27. Govoni, K.E.; Baylink, D.J.; Chen, J.; Mohan, S. Disruption of four-and-a-half LIM 2 decreases bone mineral content and bone mineral density in femur and tibia bones of female mice. Calcif. Tissue Int. 2006, 79, 112–117. [CrossRef] 28. Cai, S.Y.; Ouyang, X.; Chen, Y.; Soroka, C.J.; Wang, J.; Mennone, A.; Wang, Y.; Mehal, W.Z.; Jain, D.; Boyer, J.L. Bile acids initiate cholestatic liver injury by triggering a hepatocyte-specific inflammatory response. JCI Insight 2017, 2, e90780. [CrossRef] 29. Zhang, Y.; Hong, J.Y.; Rockwell, C.E.; Copple, B.L.; Jaeschke, H.; Klaassen, C.D. Effect of bile duct ligation on bile acid composition in mouse serum and liver. Liver Int. 2012, 32, 58–69. [CrossRef] 30. Kurakula, K.; Sommer, D.; Sokolovic, M.; Moerland, P.D.; Scheij, S.; van Loenen, P.B.; Koenis, D.S.; Zelcer, N.; van Tiel, C.M.; de Vries, C.J. LIM-only protein FHL2 is a positive regulator of liver X receptors in smooth muscle cells involved in lipid homeostasis. Mol. Cell Biol. 2015, 35, 52–62. [CrossRef] 31. Dahan, J.; Levillayer, F.; Xia, T.; Nouet, Y.; Werts, C.; Fanton d’Andon, M.; Adib-Conquy, M.; Cassard-Doulcier, A.M.; Khanna, V.; Chen, J.; et al. LIM-Only Protein FHL2 Is a Negative Regulator of Transforming Growth Factor beta1 Expression. Mol. Cell Biol. 2017, 37, e00636-16. [CrossRef][PubMed] 32. Naim, A.; Pan, Q.; Baig, M.S. Matrix Metalloproteinases (MMPs) in Liver Diseases. J. Clin. Exp. Hepatol. 2017, 7, 367–372. [CrossRef][PubMed] 33. Roderfeld, M. Matrix metalloproteinase functions in hepatic injury and fibrosis. Matrix Biol. 2018, 68, 452–462. [CrossRef] 34. Kosters, A.; Karpen, S.J. The role of inflammation in cholestasis: Clinical and basic aspects. Semin. Liver Dis. 2010, 30, 186–194. [CrossRef] 35. Dahan, J.; Nouet, Y.; Jouvion, G.; Levillayer, F.; Adib-Conquy, M.; Cassard-Doulcier, A.M.; Tebbi, A.; Blanc, F.; Remy, L.; Chen, J.; et al. LIM-only protein FHL2 activates NF-kappaB signaling in the control of liver regeneration and hepatocarcinogenesis. Mol. Cell Biol. 2013, 33, 3299–3308. [CrossRef][PubMed] 36. Nouet, Y.; Dahan, J.; Labalette, C.; Levillayer, F.; Julien, B.; Jouvion, G.; Cairo, S.; Vives, F.L.; Ribeiro, A.; Huerre, M.; et al. The four and a half LIM-only protein 2 regulates liver homeostasis and contributes to carcinogenesis. J. Hepatol. 2012, 57, 1029–1036. [CrossRef][PubMed]

© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).