Expression Profiling of Fibroblasts in Chronic and Acute Disease Models Reveals Novel Pathways in Kidney Fibrosis

BASIC RESEARCH www.jasn.org

Expression Proﬁling of Fibroblasts in Chronic and Acute Disease Models Reveals Novel Pathways in Kidney Fibrosis

Atsuko Y. Higashi,1 Bruce J. Aronow,2 and Gregory R. Dressler1

1Department of Pathology, University of Michigan, Ann Arbor, Michigan; and 2Department of Biomedical Informatics, Cincinnati Children’s Hospital Medical Center, Cincinnati, Ohio

ABSTRACT Background Renal interstitial fibrosis results from activation and proliferation of fibroblasts to myofibroblasts, secretion and accumulation of extracellular matrix, and displacement of normal renal tubules. In contrast to chronic renal disease, acute injury may be repaired, a process that includes a decrease in the number of myofibroblasts in the interstitium and degradation of the accumulated extracellular matrix, leaving little evidence of prior injury. Methods To investigate whether activated fibroblasts demonstrate changes in gene expression that cor- respond with regression after acute injury but are not observed in chronic models of fibrosis, we used microarrays to analyze gene expression patterns among fibroblast populations at different stages of injury or repair. We then mined the data for signaling pathways in fibroblasts corresponding to the acute pro- liferative, regression, and chronic phases of renal injury. Results We identified multiple gene clusters with changes that correlate with the three phases of renal injury, including changes in levels of receptors for the antifibrotic factor PGE2. In adult renal fibroblast cultures, PGE2 was able to upregulate many genes that are suppressed by the profibrotic cytokine TGF-b, whereas many PGE2-downregulated genes were activated by TGF-b. High levels of TGF-b suppressed expression of a subset of PG receptors in fibroblast cultures, making these cells resistant to any effects of PGE2. Conclusions Inherent gene expression changes in activated fibroblasts accompany the transition from AKI to repair and regeneration. In chronic models, however, activated fibroblasts are resistant to the antifibrotic effects of PGE2 due to suppression of a subset of PGE receptors.

J Am Soc Nephrol 30: 80–94, 2019. doi: https://doi.org/10.1681/ASN.2018060644

Fibrosis is a common pathology due to the activa- cytokines.4,5 Using definitive genetic cell lineage– tion of interstitial fibroblasts to myofibroblasts, the tracing methods, the origins of renal interstitial increased secretion and accumulation of extracel- fibroblasts and myofibroblasts have clearly been lular matrix (ECM), and the loss or perturbation of established in animal models of renal fibrosis.6 The tissue-specific epithelial, endothelial, and other cell lineages.1,2 In CKD, this expansion and deposition of ECM compromises renal function by displacing Received June 22, 2018. Accepted November 7, 2018. proximal and distal tubules, by increasing glomer- Published online ahead of print. Publication date available at ular mesangium to affect the filtration barrier, and www.jasn.org. by affecting the hemodynamics of the renal arteri- Correspondence: Prof. Gregory R. Dressler, Department of Pa- oles.3 Myofibroblast induction is also accompanied thology, University of Michigan, BSRB 2049, 109 Zina Pitcher by innate immune pathways, partly through the Drive, Ann Arbor, MI 48109. Email: [email protected] expression and secretion of immune-mediating Copyright © 2019 by the American Society of Nephrology

80 ISSN : 1046-6673/3001-80 J Am Soc Nephrol 30: 80–94, 2019 www.jasn.org BASIC RESEARCH best available data point to pericytes and perivascular fibroblastic Significance Statement cells, in addition to preexisting, resident interstitial fibroblasts, as the major sources of myofibroblasts in renal fibrosis models. Activation of fibroblasts to myofibroblasts is a key factor that drives Thus, to identify optimal therapeutic targets for CKD, it is es- renal interstitial fibrosis; regression of activated fibroblasts in the sential to understand both the intrinsic genomic programming interstitium is a key feature of repair, which can occur after acute fi injury but not in chronic renal disease. Using models of AKI and CKD of pericytes and interstitial, activated broblasts as well as their to study genes and signaling pathways that may mediate repair and responses to injury and genetic abnormalities. fibrosis regression, the authors found that activated fibroblasts Expansion of interstitial fibroblasts has been studied in AKI display changing gene expression patterns, including for PGE2 in human biopsy samples7 and in rodent models.8 AKI is the result receptors. These inherent changes accompany the transition from of renal ischemia or nephrotoxic injury and results in the death acute injury to repair, but differ from patterns observed after chronic injury. The authors also found that high levels of the profibrotic of proximal tubule epithelial cells primarily from the S2 and S3 cytokine TGF-b in cultured adult fibroblasts may inhibit PGE2’s segment of the nephron. However, these segments retain the abil- antifibrotic effects by suppressing a subset of PGE receptors, a ity to regenerate and repopulate the sites of injury if the degree of finding with potential implications for therapeutic strategies. injury is limited.9,10 Coincident with AKI is widespread activation and proliferation of interstitial fibroblasts. As AKI is repaired, the Michigan. Mice were housed in a specificpathogen–free fa- activation of interstitial myofibroblasts subsides and expansion cility with a 12-hour light/12-hour dark cycle and given free regresses, often leaving little evidence of residual fibrosis. How- access to food and water. ever, repeated bouts of AKI may alter the ability of activated in- For the UUO model, mice were anesthetized by isoflurane terstitial myofibroblast to regress, leading to irreversible inhalation.Throughamidlineabdominalincision,theleftureter interstitial fibrosis and a chronic renal disease state.11,12 Neverthe- was tied off at the level of the lower pole and themidureteral level less, after an initial bout of AKI the number of activated myofi- with fine suture materials (5–0 silk), then cut between the two broblasts decreases as injury is repaired, suggesting that these cells ligated points to induce a complete obstruction. Mice were al- have the ability to reversibly deactivate or undergo apoptosis and lowed to recover from anesthesia and were supplied food and removal by mechanisms that remain to be determined.13 water ad libitum until they were euthanized at 14 days after the In this report, we have begun to address inherent differences in surgery. For the acute tubular necrosis model, mice were in- renal interstitial fibroblasts after AKI and in chronic disease models. jected intraperitoneally with a single dose of 250 mg/kg FA in Using a folic acid (FA) model of AKI and the unilateral ureteral 0.15 M NaHCO . Mice were euthanized at 3, 7, and 14 days after obstruction model (UUO) of renal fibrosis in mice, we isolated 3 injury. Mice were put under constant observation for the first interstitial fibroblasts by fluorescence-activated cell sorting (FACS) 48 hours after injection. and determined gene expression changes with Affymetrix microarrays. We compared the transcriptome of fibroblasts from unin- juredkidneysandUUO-derivedfibroblasts, as well as fibroblasts Cell Sorting from different times after AKI. We hypothesized that there may be In brief, kidneys were minced and digested with 0.5 mg/ml Lib- specific genes and pathways that mediate the regression of erase DH (#05401054001; Roche) and 100 U/ml DNaseI fibroblasts after AKI that are not active in chronic models of fibro- (11284932001; Roche) in PBS solution supplemented with sis, such as the UUO model. The data show dynamic changes in the 10% FBS at 37°C for 30 minutes with triturate by P1000 tip every patterns of fibroblast gene expression in the acute and recovery 5 minutes, followed by centrifugation at 3003g for 5 minutes at phases that include WNT and TGF signaling pathways, fibroblast 4°C. The resulting pellet was resuspended in ice-cold PBS with growth factors, and genes involved in ECM deposition or turnover. 2 mM EDTA and was passed through a 70-mm cell strainer Furthermore, we show that suppression of the PG receptor Ptger3 (Falcon), then centrifuged at 3003g for 5 minutes at 4°C. The correlates with acutely injured fibroblasts but increases with re- pellet was incubated with 0.53 red blood cell lysis buffer covery. Strikingly, TGF-b–cultured kidney fibroblasts suppress (0.15 M NH4Cl, 14 mM NaHCO3, and 0.1 mM Na2 EDTA) expression of multiple PG receptors making cells recalcitrant to for 5 minutes on ice, to remove red blood cells, and centrifuged PGE2 signaling. Given the proposed antifibrotic effects of at 3003g for 5 minutes at 4°C. The single isolated kidney cells PGE2,14–16 these data suggest a novel mechanism for the regres- were stained with APC-conjugated anti-PDGFRa Antibodies sion of interstitial fibroblasts that is deregulated in a high–TGF-b (Ab) (#A18382; Life Technologies) and PE-Cyanine7–conju- environment. gated anti-CD11b Ab (#25–0112–81; eBioscience) and subjected to cell sorting using FACS Aria II cell sorter (BD Biosciences). FACS Aria II was also used for surface pattern analysis. The METHODS antibodies used for surface pattern are anti-PDGFRa,APC-Cy- anine7–conjugated anti-CD45 Ab (#103115; Biolegend), PE- Animals Cyanine7–conjugated anti-CD105 Ab (#120409; Biolegend), Mice were kept according to National Institutes of Health PE-conjugated anti-CD44 Ab (#103007; Biolegend), PE-con- guidelines and all procedures were approved by the University jugated anti-PDGFrb Ab (#136005; Biolegend), and PE-con- Committee on Use and Care of Animals at the University of jugated anti-CD31 Ab (#102507; Biolegend).

J Am Soc Nephrol 30: 80–94, 2019 Gene Expression Changes in Activated Kidney Fibroblasts 81 BASIC RESEARCH www.jasn.org

No injury FA3 FA7 FA14 U14 HE staining PDGFR  / Nuclei  SMA / Nuclei PDGFR  / Nuclei Collagen1 / Nuclei Fibronectin / Nuclei

Figure 1. Interstitial fibroblasts expand and regress after acute kidney injury (FA3–FA14) but not in the chronic obstruction model (U14). Representative sections of kidneys taken at the indicated times post-FA or -UUO or from uninjured controls are shown. Sections were stained with hematoxylin/eosin (HE) or with the indicated antibodies in color. Note the increase in PDGFra/b-andaSMA- positive cells, and the matrix proteins Col1 and fibronectin at FA3, FA7, and U14. Note the decreases in matrix and fibroblasts by FA14.

82 Journal of the American Society of Nephrology J Am Soc Nephrol 30: 80–94, 2019 www.jasn.org BASIC RESEARCH

Microarray Expression Analysis tissue-Tek O.C.T. compound (Sakura Finetek) and sectioned Total RNAwas extracted from FACS-sorted cells using TRIzol using a cryostat. Frozen sections (6 mm) were treated with reagent (Life Technologies) and purified by RNeasy Mini Kit 100% methanol for 20 minutes at 24°C and subsequently blocked (Qiagen). Microarray expression analysis was performed us- with 5% normal goat serum in PBS/0.05% Tween for 1 hour at ing three independent mice and carried out by the University room temperature. The following primary antibodies were used: of Michigan Comprehensive Cancer Center Affymetrix and anti-PDGFRa Ab (#14–1401–82; eBioscience), anti-PDGFRb Ab Microarray Core Facility using Mouse 4302.0 Affymetrix Gene (#14–1402; eBioscience), anti-fibronectin Ab (sc-9068; Santa Chip 3 expression arrays (Affymetrix), as described.17 Expres- Cruz), anti-laminin Ab (#L9393; Sigma-Aldrich), anti-collagen I sion values for each gene were calculated using the robust mul- Ab (#ab34710; Abcam), anti-CD31 Ab (#ab28364; abcam), Fluo- tiarray average method and fitted to weighted linear models in rescein-labeled Lotus Tetragonolobus Lectin (#FL-1321; Vector R using the Affymetrix package of Bioconductor.17,18 The Af- Labs), Cyanine3-conjugated anti–a-Smooth Muscle Actin Ab fymetrix datasets have been submitted to the Gene Expression (#C6198; Sigma-Aldrich), and anti-Gja1 Ab (sc-9059; Santa Omnibus (https://www.ncbi.nlm.nih.gov/geo/), accession Cruz). All images were taken on an Olympus IX71 epifluorescent number GSE121190. microscope. Morphometric analysis was carried out using ImageJ software. RNA Reverse Transcription and Quantitative Real-Time PCR Kidney Primary Fibroblast Culture Total RNA samples of FACS-sorted cells were reverse transcribed Tissue culture dishes were coated with 1% gelatin solution into cDNA using SuperScript III Reverse Transcription (Life before tissue explanting. Sections of kidney cortex were diced Technologies). cDNA templates were amplified with iTaq Uni- and digested in 0.05% trypsin/EDTA (Gibco) for 10 minutes at versal SYBR Green Supermix (Bio-Rad) on an Applied Biosys- 37°C. The kidney pieces were placed in gelatin-coated dishes tems 7500 Real-Time PCR System. The primers (59 to 39)used: and incubated in DMEM/F12 (Gibco) supplemented with mPDGFRa: forward, cattgaccctgttccagaggag, reverse, ggtggaac- 20% FBS, 13 ITS-X (Gibco), 13 Glutamax (Gibco), 13 tactggaacctgtc; mPtger3 (EP3): forward, gaaccagatcttggatccctgg, sodium pyruvate (Gibco), and 5 mM Y-27632 (Cayman reverse, cagggaaacaggtactgcaatg; mFGF9: forward, tcatttaga- Chemical) for 3 days. After 3 days, kidney pieces were gently gatcttccccaacg, reverse, gttcatgccgaggtagagtcc; mGja1:forward, removed and medium was changed. Culture medium was gtgccggcttcactttcattaag, reverse, gaaaatgaagagcaccgacagc; renewed twice weekly until the monolayer had covered ap- mGapdh: forward, ccagaacatcatccctgcatc, reverse, cctgcttcac- proximately 75% of the dish surface. For passage, cells were caccttcttga. The relative standard method was used to obtain dissociated with 0.05% trypsin/EDTA. Y-27632 was not added relative expression for each grouping comparison, where the to the medium after passage 5. Cells could be continuously amount of target was normalized to endogenous GAPDH. cultured for .36 passages. Forexpression analyses, cells were cultured in six-well plates Histology and Immunohistochemistry to confluency then shifted to a low-serum (0.05%) media for The kidneys were fixed in Carnoy solution, embedded in paraffin, 24 hours before addition of 10 ng/ml TGF-b or 1 mM PGE2 or and sections (6-mm thick) were stained with Hematoxylin and both factors. RNA was harvested with TRIzol after 48 hours Eosin for routine histologic examination. For immunofluo- in culture and analyzed by Affymetrix microarray gene chips rescent stainings, tissues from adult animals were frozen in as above.

40 60 35

30 30 50 25

40 20 20 15 Col1 (%area) SMA (%area) 30 10 PDGFr  (%area) 10 5 20 0 0 UN FA3 FA7 FA14 U14 UN FA3 FA7 FA14 U14 UN FA3 FA7 FA14 U14

Figure 2. Quantitative morphometry of interstitial area shows regression after AKI. Multiple random images were analyzed by calculating the total positive area of micrographs stained with the indicated antibodies. Scatter plots show data points with the mean and 1 SD indicated. Note the signiﬁcant decrease in interstitial ﬁbroblast area by FA14 treatment, whereas U14 remains high. SMA, Smooth Muscle Actin; UN, Uninjured.

J Am Soc Nephrol 30: 80–94, 2019 Gene Expression Changes in Activated Kidney Fibroblasts 83 BASIC RESEARCH www.jasn.org

A living (PI - ) CD11b (-) cells 250 FA3250 FA3

200 200

150 150 SSC-A (X 1,000) SSC-A (X 1,000)

SSC-A 100 100

50 50

102 103 104 105 102 103 104 105 660(20 (633)-A 660(20 (633)-A APC PDGFR-APC

250 250

200 200

150 150 SSC-A (X 1,000) SSC-A (X 1,000) 100 100

50 50

102 103 104 105 102 103 104 105

PDGFR PDGFR

In situ surface pattern B living (PI - ) cells C 90 35 80 30 70 25 60 20 50 15 40 30 10 %expression 20 %PDGFR  + cells 5 10 0 0 UN FA3 FA7 FA14 U14 CD45 CD31 CD44 PDGFR CD105

D SMA Fibronectin Laminin PDGFR  / Nuclei

CD31 LTA E 60 p=0.0016 50 40 30 20

PDGFR  / GAPDH 10 PDGFR  / Nuclei 0 input FACS

84 Journal of the American Society of Nephrology J Am Soc Nephrol 30: 80–94, 2019 www.jasn.org BASIC RESEARCH

RESULTS using FACS (Figure 3A). Uninjured control kidneys were par- ticularly challenging because very few PDGFra cells are ob- Expansion of PDGFra-Positive Cells in the Interstitium served in tissue sections. However, sufficient numbers of cells of Acute and Chronically Injured Kidneys could be isolated by FACS by pooling multiple uninjured adult In order to examine renal interstitial fibroblasts from both kidney preparations. We also tried PDGFrb antibodies for acutely injured and chronically injured kidneys, we used the separating cells, but the affinity was lower and gating could established FA nephrotoxicity model and the UUO model of not separate the positive cells as cleanly as anti-PDGFra.The fibrosis. To induce AKI, mice were injected with 250 mg/kg FA PDGFra-positive cells separated by FACS represent a popula- and kidneys were isolated at 3 days (FA3), 7 days (FA7), and tion ranging from approximately 2% in uninjured to .20% in 14 days (FA14) postinjection. The chronic injury was examined U14 kidneys (Figure 3B). The PDGFra-sorted population was in UUO kidneys 14 days after ligation of a single ureter (U14). also costained for endothelial cell markers (CD31), hemato- We initially confirmed kidney injury and expansion of fibro- poietic cells markers (CD45), and pericyte/mesenchymal stem blasts and myofibroblasts by histology and immunostaining cell markers (CD44, PDGFrb, and CD105) to ensure a specific for PDGFra,PDGFrb, smooth muscle actin (aSMA), colla- population (Figure 3C). These data indicate that our PDGFra+ gen1, and fibronectin (Figure 1). Representative images show population contains few endothelial and hematopoietic cells dilated renal tubules and significant expansion of fibroblasts but does overlap with pericytes. Immunostaining of kidney and ECM in FA-treated kidneys (FA3 and FA7). However, by sections, with the same antibody as used for FACS, also dem- FA14, the acute injury has resolved because the injured renal onstrates that the vast majority of PDGFra+ cells were local- tubules have regenerated and the interstitial expansion of ized within the interstitium and associated with ECM, as fibroblasts and myofibroblasts has regressed. Both PDGFra- marked by aSMA, fibronectin, and laminin (Figure 3D). positive cells and aSMA-positive cells are greatly reduced in However, PDGFra+ cells were distinct from CD31+ endothe- number at FA14, compared with FA3 or FA7. Staining for the lial cells or LTA+ proximal tubule epithelium (Figure 3D). ECM proteins collagen1 and fibronectin is also reduced by Total RNA was isolated from sorted cells and assayed for ex- FA14, although it remains stronger than in uninjured controls. pression of the PDGFra mRNA and compared with whole- In the U14 kidney sections, staining for aSMA, collagen1, and kidney RNA to assess the degree of enrichment for PDGFra PDGFra was more widespread than even in the FA3 or FA7 fibroblasts (Figure 3E). These data show a 50–100-fold in- kidneys. The immunostained micrographs were subject to crease for PDGFra expression, again indicating that a signifi- quantitative morphometry, whereby the stained area was calcu- cantly enriched population was obtained. lated on multiple independent images from different animals (Figure 2). These data confirm that there is a rapid expansion Gene Signatures of PDGFra-Positive Cells from Acute of interstitial fibroblasts and myofibroblasts in the acute in- and Chronically Injured Kidneys jury phase at 3 and 7 days post–FA injection that resolves by Total RNAs obtained from PDGFra-positive cells from FA3, 14 days upon recovery from injury. However, the chronic FA7, FA14, and U14 kidneys and from uninjured kidneys were UUO model continues to exhibit interstitial expansion of used to assess gene expression differences between any and all PDGFra-andaSMA-positive cells with no evidence for of the five samples to determine what unique signatures might regression. be expressed in the different populations. For each time point, samples were done in triplicate. The entire Affymetrix expres- Enrichment of PDGFra-Positive Cells by FACS sion dataset is available as an Excel file (Supplemental Table 1) In order to determine what inherent differences among the or can be accessed at https://www.ncbi.nlm.nih.gov/geo/ (ac- fibroblast populations could account for the regression of cells cession number GSE121190). A total of 2460 probe sets, rep- after acute injury, we isolated populations of PDGFra-positive resenting 1885 unique transcription units, showed statistically cells from the kidney cortex of both acute and chronic models significantdifferencesinexpressioninatleastoneofthe

Figure 3. PDGFra-positive cells can be sorted with purity and specificity from adult kidneys. (A) Representative flow cytometry plot for sorting PDGFRa-positive cells from whole adult kidney 3 days post-FA, using either a control (left panel) or anti-PDGFRa mAb (APA5, right panel). Cells in gated area were selected. (B) The percentage of PDGFRa-positive cells from whole kidneys sorted from each disease model and uninjured control kidneys (no injury, n=7; FA3, n=9, FA7, n=5; FA14, n=5; U14, n=4). (C) Flow cytometry analysis shows that PDGFRa-sorted cells include pericyte/MSC marker–positive cells (CD44, PDGFRb, and CD105), but not endothelial (CD31) and hematopoietic (CD45) cell populations (n=3). (D) Immunostaining demonstrates that anti-PDGFRa mAb (APA5) recognizes cells specifically confined to the tubulointerstitial compartment. In FA3 kidney, PDGFRa-positive (red) cells stain positive for aSMA, overlap with ECM (fibronectin and laminin), but do not costain with endothelial marker (CD31) and proximal tubular marker (LTL-lectin). (E) Quantitative RT-PCR analyses of PDGFRa mRNA from whole FA3-treated kidneys and PDGFRa-sorted cells show approximately 50-fold enrichment (n=3). SSC-A, Side scatter; UN, Uninjured.

J Am Soc Nephrol 30: 80–94, 2019 Gene Expression Changes in Activated Kidney Fibroblasts 85 BASIC RESEARCH www.jasn.org

Color Key cluster1: Translation 6 5 –5 5 4 3 Value 1 2 1 0 FA3 FA7 FA14 UUO UN

cluster 2: Ribosomes, ER, 6 2 5 4 3 2 1 0 FA3 FA7 FA14 UUO UN

cluster 3: ECM, Tgf- 14 12 3 10 8 6 4 2 0 FA3 FA7 FA14 UUO UN

cluster 4: ECM, development 7 6 4 5 4 3 2 1 5 0 FA3 FA7 FA14 UUO UN

cluster 5: Immunity, inflammation 8

6 0 FA3 FA7 FA14 UUO UN

cluster 6: Metabolism, transporters 1.2 1.0 0.8 0.6 0.4 0.2 0 FA3 FA7 FA14 UUO UN

cluster 7: Respiration, mitochondria 1.2 7 1.0 0.8 0.6 0.4 0.2 FA3 FA7 UUO FA14 UN 0 FA3 FA7 FA14 UUO UN

Figure 4. Gene expression changes in isolated fibroblasts after renal injury exhibit distinct clustering. The normalized relative expression values for 2640 Affymetrix probe sets that show statistically significant changes in at least one of the renal disease models were clustered. The graphs on the left show mean expression values for individual clusters (dots) with the 25th and 75th percentiles represented by the vertical lines. The complete dataset with gene names is available as a supplemental Excel file (Supplemental Table 2). ER, Endoplasmic reticulum; UN, Uninjured.

86 Journal of the American Society of Nephrology J Am Soc Nephrol 30: 80–94, 2019 www.jasn.org BASIC RESEARCH

Table 1. Pathway analyses of clustered gene sets clustered to group genes depending on their Cluster Pathways P Value # Genes Sourcea level of expression under the different condi- 1 Translation, ribosomal proteins tions (Figure 4). Gene expression changes RNA binding 9.6E2629of1632T showed seven distinct clusters as follows: Translation initiation 2.4E28 12 of 194 T cluster 1 genes were highest at FA3 and lowest rRNA processing 5.9E27 12 of 260 T in uninjured, cluster 2 genes were high in all Translation initiation 8.1E29 12 of 191 G injured kidneys, cluster 3 genes were high at rRNA processing 1.6E26 11 of 257 G FA3 and lower at FA7 and FA14 and high in Protein metabolism 1.1E2432of2061G the U14 kidneys, cluster 4 genes were highest 2 Ribosomes, translation, ER targeting in U14, cluster 5 genes were increased at FA7 2 Structural constituent of ribosome 6.4E 36 46 of 216 T and FA14 but low at FA3 and in U14 kidneys, 2 Translation 3.5E 50 54 of 165 T cluster 6 genes were highest at FA14 and in Translation termination 4.8E250 45 of 97 T uninjured kidneys, and cluster 7 genes were Translation elongation 8.6E250 45 of 98 T Translation 1.7E240 35 of 91 G low in all injured kidneys. We utilized both 19 ER targeting, membrane targeting 1.6E239 35 of 96 G ToppGene and Genomatix (www.genoma- Translation initiation 5.4E233 39 of 191 G tix.de) for gene ontology and pathway analyses Ribosome 1.8E236 35 of 119 G to determine specific themes for each cluster 3 ECM, collagens, integrins (Table 1). Clusters 1 and 2 are enriched for ECM organization 6.5E238 56 of 354 T genes involved in protein synthesis or mem- TGF-b 6.7E210 44 of 824 G brane targeting. Clusters 3 and 4 are enriched MMPs 2.1E26 21 of 331 G in genes for matrix synthesis, deposition, and 2 Integrin signaling 6.6E 13 15 of 70 G signaling. Cluster 5 highlights the inflamma- 2 ECM organization 5.5E 39 53 of 331 G tory response, whereas clusters 6 and 7 are Smad2 2.9E212 31 of 436 G enriched in genes for metabolisms, cellular 4 ECM, development Regulation of development 1.7E214 60 of 1893 T respiration, and transporters. ECM 2.0E218 33 of 444 T Weexamined candidate genes associated ECM 3.4E215 29 of 530 G with signaling pathways, ECM secretion, or Smad signaling 1.3E27 20 of 491 G transcription, or previously implicated in TGF-b 8.2E27 25 of 824 G fibrosis (Figure 5). Receptors for the profi- 5 Immunity, inflammatory response brotic cytokine TGF-b were up slightly at Antigen processing and presentation 2.1E211 10 of 94 T FA3 and U14, but lower at FA14. Most Defense response 3.8E211 30 of 1651 T strikingly, the TGF-b–induced gene was fl 2 Immune, in ammatory response 1.9E 22 34 of 549 T up 15-fold at FA3 and continued to increase 2 Innate immune system 8.8E 518of1459G despite a reduction of PDGFra-positive Immune response 7.1E2 925of2042G cells by FA14. For WNT ligands, Wnt5a in- 6 Metabolism, transporters, kidney disease Transmembrane transporters 1.4E219 81 of 1014 T creased seven-fold by FA3 and declined by Organic acid metabolic process 3.0E230 104 of 1131 T FA14, whereas Wnt4 peaked at FA7 in the Acidosis 2.5E212 50 of 475 T acute model. WNT inhibitors Dkk3 and Metabolic pathways 1.1E223 109 of 1272 T Frzb also peaked at FA3 in the acute model Kidney disease 1.3E215 53 of 569 T with even higher levels in the chronic model Metabolism 6.6E220 126 of 2100 G at U14, whereas the inhibitor Dkk2 was TCA cycle 1.1E213 27 of 169 G down 3–4-fold at FA3. These data suggest Transmembrane transporters 2.6E221 68 of 1034 G that Wnt4 may be more specific to the res- 2 Renal tissue 2.7E 49 122 of 1247 G olution phase after AKI and that dynamic 2 Metabolic disease 3.6E 14 71 of 903 G changes in WNT inhibitors could modulate 7 Respiration, mitochondria signaling. Other signaling effectors that in- Cellular respiration 1.1E27 16 of 178 T Response to hypoxia 2.5E27 14 of 143 T creased during the acute phase include TCA cycle 6.4E26 14 of 171 T Bmp1 and Vegfd, whereas Bmp7 was re- Cellular respiration 3.2E27 14 of 168 G duced at FA3 and FA7. The tumor suppressor ER, Endoplasmic reticulum; MMPs, Matrix metalloproteinase; rRNA, Ribosomal RNA; TCA, Pten, a phosphatidylinositol phosphatase, tricarboxylic acid. also increases four-fold at FA3 and declines a T, ToppGene; G, Genomatix. by FA14, but remains high in the U14 kidneys. As expected, almost all collagen chains samples. The differential gene expression dataset is available showed differential expression, which increased at FA3 and as a single Excel file (Supplemental Table 2). These genes were declined slowly thereafter, but remained high in the U14

J Am Soc Nephrol 30: 80–94, 2019 Gene Expression Changes in Activated Kidney Fibroblasts 87 BASIC RESEARCH www.jasn.org

WNT Signaling TGF- Signaling Other Signaling 32 32.00 8.00 16 16.00 8 4.00 4 8.00 2.00 2 4.00 1 1.00 0.5 2.00 0.25 1.00 0.50 0.125 0.50 0.25 UN FA3 FA7 FA14 U14 UN FA3 FA7 FA14 U14 UN FA3 FA7 FA14 U14 Wnt5a Wnt4 Dkk3 Tgfbi Tgfb1i1 Tgfbr1 Vegfd Pten Bmpr1a Frzb Dkk2 Sfrp1 Tgfb2 Tgfbr2 Tgfbr3 Bmp7 Bmp1 Pdgfra

Collagens MMPs TIMPs 128.00 16 64.00 64.00 32.00 8 32.00 16.00 16.00 4 8.00 8.00 4.00 4.00 2 2.00 2.00 1.00 1 1.00 0.50 0.50 0.5 0.25 UN FA3 FA7 FA14 U14 UN FA3 FA7 FA14 U14 UN FA3 FA7 FA14 U14 Col4a2 Col6a1 Col1a2 Mmp3 Mmp19 Mmp14 Timp1 Timp2 Timp3 Col6a2 Col1a1 Col5a1 Mmp11 Mmp2 Mmp12 Col4a1 Col3a1

Integrins Transcription Factors Fibrosis Related 16 32.00 16 8 16.00 8 4 4 8.00 2 2 4.00 1 1 2.00 0.5 0.25 0.5 1.00 0.125 0.25 0.50 0.0625 0.125 0.25 UN FA3 FA7 FA14 U14 UN FA3 FA7 FA14 U14 UN FA3 FA7 FA14 U14 Itgb5 Itga9 Itgb2 Tcf12 Tfap2b Runx2 Fgf1 Fgf2 Ptger3 Itga6 Itga4 Itga8 Stat3 Runx1 Hoxa10 Fgf9 Kl Tcf21 Hoxd11

Figure 5. Expression profiles of selected genes and pathways exhibit dynamic changes. Normalized RNA expression levels from PDGFra-selected fibroblasts isolated from uninjured (UN) kidneys; or AKI kidneys at 3, 7, or 14 days post-FA; or kidneys 4 days post- UUO. RNAs were assayed with Affymetrix microarrays in triplicate from three independent sorted samples, with data points representing the mean. Expression levels are relative to UN and graphed on a log2 scale. Signaling pathways include TGF-b–related, WNT-related, and other ligands or receptors. ECM genes include the collagen family, the matrix metalloproteinase (MMPs), and the tissue inhibitors of MMPs (TIMPs). samples. The matrix metalloproteases that are involved in (HoxD11 and HoxA10) are also upregulated 2–3-fold in the matrix turnover showed different patterns, with Mmp3 in- acute phase and decline back to uninjured levels by FA14. creasingrapidlyatFA3andthendeclining,butwithMmp12 Of genes associated with fibrosis, the Fgf2 but not Fgf1 showing maximum levels at FA14. Again, this suggests that expression increased strongly at FA3, whereas Fgf1 and Fgf9 Mmp12 may be involved primarily in the degradation of ma- declined in the AKI model, suggesting that Fgf2 is a primary trix that accumulates as a result of injury. Integrins also show driver of fibroblast proliferation. Among the objectives of the dynamic changes, with Itgb5 and Itga9 strongly induced at screen were to examine the expression levels of potential anti- FA3, FA7, and U14, whereas Itgb2 peaks at FA14 and is low at fibrotic genes during the recovery phase after acute injury. U14. Again, these data suggest that Itgb2 may be associated with PGs are lipid compounds with hormone-like activity, of the regression of fibroblasts. Of transcription factors, the Tcf21 which PGE2 has been implicated in tissue repair and ECM gene is the most highly upregulated in AKI and declines in the degradation.15,16 Thus, PGE2 has been implicated as an anti- resolution phase at FA14. Similarly, kidney-specific Hox genes fibrotic factor.5,14 We noted that one of its receptors, Ptger3,

88 Journal of the American Society of Nephrology J Am Soc Nephrol 30: 80–94, 2019 www.jasn.org BASIC RESEARCH

fi b A Ptger3/ Gapdh B Fgf9/ Gapdh the levels of the pro brotic factor TGF- 1in p=0.0029 p=0.0024 whole-tissue RNA from kidneys isolated before and after injury, which increased p=0.010 p=0.0031 at FA3 and FA7, decreased by FA14, but 1.4 1.4 was .20-fold higher in U14 compared with uninjured (Figure 6D). 1.2 1.2 1.0 1.0 Effects of TGF-b and PGE2 on 0.8 0.8 Cultured Kidney Fibroblasts 0.6 0.6 To examine and compare the effects of profi fi 0.4 0.4 brotic and potential anti brotic agents, we cultured immortalized adult kidney fi- 0.2 0.2 broblasts with PGE2, TGF-b, or both compounds for 48 hours and measured gene UN FA3 FA7 FA14 U14 UN FA3 FA7 FA14 U14 expression profiles with Affymetrix microarrays (Supplemental Tables 3–5). PGE2 C Gja1/ Gapdh D treatment resulted in .1000 genes with p=0.017 TGF1/Gapdh statistically significant altered expression 30 p=0.031 values; approximately 514 genes were up- 40 regulated and 508 genes were downregulated two-fold or more (Figure 7). TGF-b 35 20 also greatly altered gene expression pat- 30 terns in adult fibroblast cultures with 25 .2500 genes affected (Figure 7). Analyses 20 of the TGF-b–regulated gene set show great 15 10 similarity (P,3.8E243) to the response 10 seen in mouse embryo fibroblasts (MEFs) 5 in Gene Set Enrichment Analysis M2445 0 (PLASRI_TGFB_TARGETS_10HR_UP), 20 UN FA3 FA7 FA14 U14 UN FA3 FA7 FA14 U14 as reported by Plasari et al. (Table 2). Sig- nificant overlap is also seen with genes fi – Figure 6. Quantitative RT-PCR for selected genes con rms expression changes. (A C) downregulated by TGF-b in kidney fibro- a Total RNA samples from PDGFR -sorted cells were analyzed by quantitative RT-PCR for blasts and MEFs. Conversely, the gene set the indicated genes to confirm Affymetrix array expression differences. Note decline of upregulated by PGE2 overlaps with genes Ptger3 in the early acute phase (FA3) and its increase during the recovery phase (FA7, b FA14). The gap junction protein Gja1, expressed in fibroblasts, shows an expression suppressed by TGF- in MEFs, whereas the pattern opposite that of Ptger or Fgf9, with maximum levels in the chronic UUO model gene set downregulated by PGE2 is most (U14). (D) Total RNA was isolated from whole kidneys at the indicated times postinjury similar to genes upregulated by TGF-b. andassayedforTGF-b1 by quantitative RT-PCR. The y axis is relative RNA levels in Within our datasets, of the 1139 genes arbitrary units. downregulated with TGF-b, approximately 166 were upregulated by PGE2, a highly significant number of overlapping was down more than three-fold at FA3 and began to increase genes some of which are associated with TGF-b signaling by FA7 and FA14, whereas the U14 samples remained low. The (Smad), Wnt signaling (b-catenin), and extracellular matrix Klotho gene has also been implicated in renal disease20,21 and remodeling. Similarly, 96 genes that are upregulated by TGF-b its expression was also strongly reduced at FA3 and U14 but were also downregulated by PGE2 and correlated with matrix approached normal levels by FA14. We confirmed by quanti- metalloproteinase, Hif1a, as well as TGF-b pathways. The list tative RT-PCR that expression levels of the PGE2 receptor of overlapping genes can be found in Supplemental Table 6. Ptger3 were low in acutely injured fibroblasts at FA3, but be- Given that PGE2 and TGF-b may have opposite effects on gan to increase at FA7 and FA14, while remaining low in the gene expression in fibroblasts and the progression of fibrosis, UUO model (Figure 6). Similarly, we independently con- we also examined whether PGE2 could counter the effects of firmed the reduction of Fgf9 and the marked increase in TGF-b by comparing cells cultured with TGF-b to those cul- Gja1, a gap junction protein highly expressed in U14 kidneys tured with TGF-b and PGE2 together. Surprisingly, there were (Figure 6, B and C). These data suggest that the antifibrotic few changes in gene expression between these two sets after activities of PGE2 may be limited in the UUO model due to a 48 hours in culture (Figure 7). For both genes that were up- specific decrease in Ptger3 receptor expression. We also examined regulated by PGE2 (Figure 7D) and genes downregulated by

J Am Soc Nephrol 30: 80–94, 2019 Gene Expression Changes in Activated Kidney Fibroblasts 89 BASIC RESEARCH www.jasn.org

A D F TGF vs. Control (>2x) - 1245 up, 1139 down 450 PGE2 vs. Control (>2x) - 514 up, 508 down 400 Ptger3 TGF/PGE2 vs. TGF (>2x) - 2 up, 11 down 160 350 140 300 120 B 250 100 TGF PGE2 200 80 973 166 348 down up 150 60 100 40 Common elements - 166 (p < 1E-18)

RNA expression (rel. units) 50 20

Pathway Analyses #Genes P value 0 RNA expression (rel. units) 0 Con. PGE2 TGF T+P Con. PGE2 TGF T+P Smad 11 2E-3 B-catenin 13 3E-3 WNT signaing 8 4E-4 Pi3K/AKT 4 3E-3 E G ECM organization 7 4E-3 600 Ptger4 350 500 300 C 400 250 TGF PGE2 200 up 1149 96 412 down 300 150 200 Common elements - 96 (P < 1E-17) 100 100 Pathway Analyses #Genes P value 50 RNA expression (rel. units) RNA expression (rel. units) MMPs 11 5E-7 0 0 Hif1a 8 2E-5 Con. PGE2 TGF T+P Con. PGE2 TGF T+P TGF-b 10 6E-3 Smad 8 2E-3

Figure 7. TGF-b suppresses the effects of PGE2 on adult renal fibroblast gene expression. (A) The number of genes up- or downregulated by TGF-b or PGE2 is compared with untreated cells after 48 hours in culture. However, TGF-b treatment alone abrogates almost all of the effects of PGE2 treatment. The complete datasets are in Supplemental Tables 3–5. (B) Pathway analyses of the 166 genes that are downregulated by TGF-b and upregulated by PGE2. (C) Pathway analyses of 96 genes that are upregulated by TGF-b and downregulated by PGE2 in adult kidney fibroblasts. (D) Median expression values of genes upregulated two-fold by PGE2 (2) with vertical lines representing the 75th and 25th percentiles. Note that TGF-b treatment suppresses any increase by PGE2 on average gene expression values (T+P). (E) Median expression values of genes downregulated two-fold by PGE2 (2) with vertical lines representing the 75th and 25th percentiles. Note that TGF-b treatment suppresses any decrease by PGE2 (T+P) on average gene expression values. (F) Relative RNA expression levels of the PGE2 receptor Ptger3 in adult kidney fibroblasts after treatment with PGE2, TGF-b, or both factors (T+P) compared with controls. (G) Similar analyses as in (F) but for the PGE2 receptor Ptger4.

PGE2 (Figure 7E), TGFb inhibited the effects of added PGE2, more lamellipodia, and more compact, dense monolayers suggesting that PGE2 had little effect on gene expression when (Figure 8, A and B), suggesting that more cells can be com- present in a high–TGF-b environment, as seen in the U14 pacted into the interstitial space. This increased density is also kidneys. Given that TGF-b appeared to suppress almost all observed in vivo when kidney sections were stained with anti- of the effects of PGE2, we examined the level of PG receptor PDGFra (Figure 8, C and D). We next examined adult kidney expression in fibroblasts before and after treatment with fac- fibroblasts (AKF) from the U14 kidneys and from uninjured tors (Figure 7, D and E). Strikingly, TGF-b suppressed the kidneys to determine whether the ability to respond to PGE2 expression of PG receptors Ptger3 and Ptger4, although there was a stable trait in cultured cells. When treated with TGF-b, was no effect on Ptger1 or Ptger2. These data suggest that AKF cells suppressed both Ptger3 and Ptger4, whereas the U14 TGF-b suppression of a subset of PG receptors and presum- fibroblasts had virtually no Ptger3 expression and significantly ably subsequent downstream signaling contribute to drive the less Ptger4, compared with AKFs (Figure 8E). We then asked profibrotic phenotype of activated fibroblasts in chronically whether the U14 fibroblasts could respond to PGE2 by assay- injured kidneys and inhibit the antifibrotic effects of PG. ing for two responsive genes identified in the AKFs (see Sup- Totest whether fibroblasts isolated from healthy or diseased plemental Table 4). Sox9 is significantly upregulated, whereas kidneys showed differences in their morphology and ability to Ccl2 is suppressed by PGE2 in AKFs (Figure 8F). In the U14 respond to PGE2, we examined primary fibroblasts in culture fibroblasts, baseline expression of Sox9 is approximately 60% (Figure 8). Interestingly, cells isolated from U14 kidneys of AKF levels and there is no response to PGE2. Ccl2 expres- showed different morphology in culture, with less cytoplasm, sion is downregulated by PGE2 in AKFs and is also suppressed

90 Journal of the American Society of Nephrology J Am Soc Nephrol 30: 80–94, 2019 www.jasn.org BASIC RESEARCH

Table 2. Pathway analyses of gene expression in response to TGFb or PGE2 Gene Cluster Pathways P Value # Genes Sourcea TGF-b: Genes upregulated Genes upregulated in MEFs by TGFb 3.8E243 71 of 199 T Hif1a transcription 2.1E214 25 of 65 T Glucose metabolism 2.9E210 23 of 81 T Hif1a 1.6E211 21 of 67 G Carbohydrate metabolism 1.9E28 39 of 276 G TGF-b: Genes downregulated Genes downregulated in MEFs by TGFb 1.4E243 77 of 244 T Cell adhesion 2.1E221 176 of 1530 T Cell migration 2,6E220 155 of 1300 T ECM and associated proteins 7.2E214 119 of 1028 T ECM organization 5.7E27 37 of 298 G Cell invasion 6.0E29 76 of 845 G PGE2: Genes upregulated Genes downregulated in MEFs by TGFb 4.3E237 51 of 244 T Proteinaceous ECM 1.2E27 28 of 379 T Smad-related signaling 2.1E24 25 of 491 G ECM components 3.4E26 12 of 120 G PGE2: Genes downregulated Genes upregulated in MEFs by TGFb 1.8E269 71 of 199 T Regulation of cell death 4.6E218 100 of 1650 T Smad signaling 2.9E26 31 of 491 G Matrix metalloproteases 1.3E25 23 of 331 G Fibrosis 6.4E211 25 of 268 G aT, ToppGene; G, Genomatix. by TGF-b alone, whereas in U14 fibroblasts, PGE2 again has populations of interstitial fibroblasts from uninjured kidneys no effect on Ccl2 expression. These data suggest that the in- with fibroblasts isolated from acutely injured and chronically ability to respond to PGE2 is a direct result of low levels of injured kidneys. Given that expression values were derived Ptger3 and/or Ptger4 and that this is an innate property of from relatively pure populations of PDFGra-positive cells fibrotic PDGFra+ cells. and were normalized, these differences in gene expression do not reflect differences in cell number; rather, they must represent inherent differences in gene expression levels per DISCUSSION cell. These data allow clustering of gene sets that correlate with Wound healing is a natural response after injury and inflam- critical steps in the progression or resolution of fibrosis. mation such that damaged cells and tissues can be repaired. Among these are genes in cluster 3, which are high in the early Essential for repair is the activation of fibroblasts to myofibro- acute phase of AKI, but decline to near normal levels after 14 blasts, driven in part by profibrotic cytokines such as TGF-b. days,andyetremainhighintheUUOmodeloffibrosis. Many This results in increased secretion of ECM proteins, which cluster 3 genes are associated with ECM organization and promote rigidity and form a scaffold for tissue repair.5 In synthesis or signaling from the ECM to cells through integrins. the kidney, much of the current literature addressing the tissue Thus, reduced ECM expression and integrin signaling within repair and regeneration after AKI has focused on the renal fibroblasts correlate with the resolution phase of the fibrotic epithelium. However, dramatic changes in the numbers of in- response after AKI. Similarly, genes associated with the interstitial activated fibroblasts, myofibroblasts, and immune flammatory response in cluster 5 are upregulated in the res- cells are observed after AKI, even at sites far removed from olution phase, suggesting that PDGFra-positive fibroblasts localized injury. Yet, by 2–4 weeks post-AKI in mouse models, can regulate the immune response that may be necessary for this expansion of interstitial cells is no longer observed be- clearing activated fibroblasts and help to degrade the associ- cause the numbers of aSMA- and PDGFra-positive fibroblasts ated ECM. have regressed nearly to uninjured levels. We proposed that Among critical signaling pathways, dynamic changes in there are inherent gene expression differences in fibroblasts WNT components can be seen in the acute injury phase and that correlate with active proliferation during the acute injury during recovery. WNT5a and Wnt4 are increased at 3 and phase when compared with fibroblasts that are regressing dur- 7 days post-AKI and decline by 14 days, whereas the WNT ing the repair process. In this report, we compared inhibitor Dkk2 is down more than five-fold 3 days post-AKI.

J Am Soc Nephrol 30: 80–94, 2019 Gene Expression Changes in Activated Kidney Fibroblasts 91 BASIC RESEARCH www.jasn.org

A B C D

PDGFR/Hoechst

E F AKF U14 8 1.2 AKF Sox9 Sox9 AKF+T 7 1.2 1.0 U14 Ccl2 Ccl2 U14+T 6 1.0 0.8 5 0.8 0.6 4 0.6 3 0.4 2 0.4 0.2 0.2 mRNA levels (Rel. units)

mRNA levels (Rel. units) 1 0 0 0 Ptger3 Ptger4 cont. PGE2 , T+P cont. PGE2

Figure 8. Activated fibroblasts from fibrotic kidneys exhibit alterations in PGE2 responses. Fibroblast from control adult kidneys (AKF) or from fibrotic kidneys were isolated by FACS and cultured as primary cell lines. Morphologies of PDGRa+ fibroblasts in primary cultures from (A) control AKFs or (B) U14 fibroblasts show higher densities of cells with less cytoplasm and more lamellipodia in U14 cell cultures. (C) Densities of PDGFRa+ cells from (C) control and (D) FA14 kidney sections are shown. Insets in (C and D) are higher magnifications. (E) Quantitative RT-PCR for PG receptors Ptger3 and Ptger4 in AKFs and U14-isolated fibroblasts cultured with or without TGF-b (T). (F) Sensitivity to PGE2 (1 mM) in control AKFs and U14 fibroblasts as measured by two PGE2-responsive genes, Sox9 and Ccl2. Cont., control media; Rel., relative; T+P, TGF-b and PGE2.

Consistent with our data, genetic fibroblast-specificablation fibrosis, low levels of PGE2 correlate with enhanced fibro- of b-catenin, the canonical WNTsignaling effector, results in sis.31,32 However, in our adult fibroblast cultures, these anti- less injury and inflammation after renal ischemia, suggesting fibrotic effects of PGE2 are diminished, likely because the that increased WNTsignaling in activated fibroblasts inhibits receptors Ptger3 and Ptger4 are significantly downregulated tubular repair and promotes immune cell infiltration.23 by TGF-b. In the presence of TGF-b, PGE2 has little effect on Many of these pathways have previously been identified in the transcriptional program of adult kidney fibroblasts in cell animal models of renal injury and fibrosis using other meth- culture. In the absence of TGF-b, PGE2 activates many genes ods, such as sophisticated genetic labeling of different cell that are suppressed by TGF-b alone, whereas many genes populations,24,25 demonstrating that FACS for PDGFra+ downregulated by PGE2 are activated by TGF-b. These recip- cells is a viable alternative to genetic lineage markers for rocal effects on potential target genes could explain in part the fibroblasts. antifibrotic effects of PGE2. However, those effects are likely A novel finding among fibroblasts isolated from the acute diminished, because a high concentration of TGF-b sup- phase 3 days after AKI was the reduction of PG receptor Ptger3. presses expression of PGE2 receptors in fibroblasts. In cul- During the recovery phase, Ptger3 levels increased but re- tured fibroblasts isolated from UUO kidneys after 14 days, mained low in the chronic UUO model at 14 days. In lung the expression of Ptger3 and 4 remains low, which strongly fibrosis models, PGE2 is thought to promote repair in part by attenuates any response to PGE2. This would suggest that inhibition of fibroblast proliferation,26 migration,27 and/or there may be stable silencing mechanisms in activated fibro- differentiation into myofibroblasts.28 The suppression of fi- blasts derived from high–TGF-b environments. broblast activation by PGE2 is thought to occur primarily In summary, our data point to inherent differences in gene through the cAMP and protein kinase A pathways.26,28–30 expression patterns among PDGFra-positive fibroblasts iso- In samples isolated from patients with idiopathic pulmonary lated from different phases of renal injury. These changes

92 Journal of the American Society of Nephrology J Am Soc Nephrol 30: 80–94, 2019 www.jasn.org BASIC RESEARCH result in activation of profibrotic pathways and suppression REFERENCES of antifibrotic pathways early after injury. Recovery from the acute phase correlates with regression of activated fibroblasts 1. Kaissling B, Le Hir M: The renal cortical interstitium: Morphological and and a shift in gene expression toward a resolution phase that functional aspects. Histochem Cell Biol 130: 247–262, 2008 2. Leaf IA, Duffield JS: What can target kidney fibrosis? Nephrol Dial includes proteins involved in ECM remodeling and promo- – fl Transplant 32[Suppl 1]: i89 i97, 2017 tion of an in ammatory response, processes not observed in 3. Rockey DC, Bell PD, Hill JA: Fibrosis--a common pathway to organ in- the chronic fibrosis model. With respect to potential antifi- jury and failure. NEnglJMed372: 1138–1149, 2015 brotic factors such as PG, our data also demonstrate that it is 4. Leaf IA, Nakagawa S, Johnson BG, Cha JJ, Mittelsteadt K, Guckian KM, important to consider the context and the level of receptor et al.: Pericyte MyD88 and IRAK4 control inflammatory and fibrotic – expression before pursuing any therapeutic strategies on the responses to tissue injury. JClinInvest127: 321 334, 2017 5. Gerarduzzi C, Di Battista JA: Myofibroblast repair mechanisms post-in- basis of secreted factors or hormone-like small molecules. flammatory response: A fibrotic perspective. Inflamm Res 66: 451–465, The data also point to the potential for combining anti– 2017 TGF-b strategies with PG and/or their downstream targets. 6. Humphreys BD, Lin SL, Kobayashi A, Hudson TE, Nowlin BT, Bonventre JV, et al.: Fate tracing reveals the pericyte and not epithelial origin of myofibroblasts in kidney fibrosis. Am J Pathol 176: 85–97, 2010 7. Moyses Neto M, Costa RS, Volpini RA, Garcia TM, Rodrigues FF, Coimbra TM: Interstitial alterations in renal cortex in acute tubular ne- ACKNOWLEDGMENTS crosis (ATN) post-renal transplantation and in patients with ATN not related to renal transplant. Clin Transplant 18: 156–165, 2004 Wethank the University of Michigan Flow Cytometry Core Facility for 8. Vincent IS, Okusa MD: Biology of renal recovery: Molecules, mecha- help with FACS analyses, J. Woolforth for help with the unilateral nisms, and pathways. Nephron Clin Pract 127: 10–14, 2014 ureteralobstructionmodels, and A. Soofifor helpful advice and mouse 9. Humphreys BD, Czerniak S, DiRocco DP, Hasnain W, Cheema R, Bonventre JV: Repair of injured proximal tubule does not involve spe- colony management. cialized progenitors. Proc Natl Acad Sci U S A 108: 9226–9231, 2011 This work was supported in part by National Institutes of Health 10. Humphreys BD, Valerius MT, Kobayashi A, Mugford JW, Soeung S, grants DK073722 and DK054740 to G.R.D. and by the Young Sci- Duffield JS, et al.: Intrinsic epithelial cells repair the kidney after injury. entist Fellowship of the Japan Society for the Promotion of Science to Cell Stem Cell 2: 284–291, 2008 A.Y.H. 11. Yang L, Humphreys BD, Bonventre JV: Pathophysiology of acute kidney injury to chronic kidney disease: Maladaptive repair. Contrib A.Y.H. designed experiments and did the FACS analyses, RNA Nephrol 174: 149–155, 2011 isolation, immunostaining, and quantitative RT-PCR; B.J.A. did the 12. Zuk A, Bonventre JV: Acute kidney injury. Annu Rev Med 67: 293–307, bioinformatics analyses, gene clustering, and gene ontology; G.R.D. 2016 designed experiments, did the fibroblast cell culture and quantitative 13. Jun JI, Lau LF: Resolution of organ fibrosis. JClinInvest128: 97–107, RT-PCR, and wrote the text. 2018 14. Bozyk PD, Moore BB: Prostaglandin E2 and the pathogenesis of pulmonary fibrosis. Am J Respir Cell Mol Biol 45: 445–452, 2011 15. Nasrallah R, Hassouneh R, Hébert RL: Chronic kidney disease: Targeting DISCLOSURES prostaglandin E2 receptors. Am J Physiol Renal Physiol 307: F243–F250, None. 2014 16. Nasrallah R, Hassouneh R, Hébert RL: PGE2, kidney disease, and car- This article contains the following supplemental material online at http:// diovascular risk: Beyond hypertension and diabetes. J Am Soc Nephrol – jasn.asnjournals.org/lookup/suppl/doi:10.1681/ASN.2018060644/-/ 27: 666 676, 2016 fi DCSupplemental. 17. Zhang P, Cai Y, Soo A, et al.: Activation of Wnt11 by Transforming Growth Factor-beta Drives Mesenchymal Gene Expression through Non-canonical Wnt Protein Signaling in Renal Epithelial Cells. JBiol Chem 287: 21290–21302, 2012 SUPPLEMENTAL MATERIALS 18. Irizarry RA, Wu Z, Jaffee HA. Comparison of Affymetrix GeneChip expression measures. Bioinformatics 22: 789–794, 2006 19. Chen J, Bardes EE, Aronow BJ, Jegga AG: ToppGene Suite for gene list Supplemental Table 1. AKF FACS raw data from the Affymetrix enrichment analysis and candidate gene prioritization. Nucleic Acids Arrays. Res 37: W305–W311, 2009 Supplemental Table 2. Clustering of gene expression changes in 20. Doi S, Masaki T: Klotho as a therapeutic target during the development fi – AKFs FACS sorted from kidneys. of renal brosis. Contrib Nephrol 189: 178 183, 2017 21. Mencke R, Olauson H, Hillebrands JL: Effects of Klotho on fibrosis and Supplemental Table 3. AKF cell culture, Affymetrix raw data with cancer: A renal focus on mechanisms and therapeutic strategies. Adv b and without PGE2 or Tgf- . Drug Deliv Rev 121: 85–100, 2017 Supplemental Table 4. AKF controls versus PGE2, expression 22. Plasari G, Calabrese A, Dusserre Y, Gronostajski RM, McNair A, Michalik changes. L, et al.: Nuclear factor I-C links platelet-derived growth factor and Supplemental Table 5. AKF controls versus Tgf-b, expression transforming growth factor beta1 signaling to skin wound healing progression. Mol Cell Biol 29: 6006–6017, 2009 changes. 23. Zhou D, Fu H, Xiao L, Mo H, Zhuo H, Tian X, et al.: Fibroblast-specific b Supplemental Table 6. Overlap between Tgf- and PGE2 gene b-catenin signaling dictates the outcome of AKI. JAmSocNephrol29: expression changes. 1257–1271, 2018

J Am Soc Nephrol 30: 80–94, 2019 Gene Expression Changes in Activated Kidney Fibroblasts 93 BASIC RESEARCH www.jasn.org

24. Liu J, Krautzberger AM, Sui SH, Hofmann OM, Chen Y, Baetscher M, 29. Gerarduzzi C, He Q, Antoniou J, Di Battista JA: Quantitative phos- et al.: Cell-specific translational profiling in acute kidney injury. JClin phoproteomic analysis of signaling downstream of the prostaglandin Invest 124: 1242–1254, 2014 e2/g-protein coupled receptor in human synovial fibroblasts: Potential 25. Liu J, Kumar S, Dolzhenko E, Alvarado GF, Guo J, Lu C, et al.: Molecular antifibrotic networks. JProteomeRes13: 5262–5280, 2014 characterization of the transition from acute to chronic kidney injury 30. Huang S, Wettlaufer SH, Hogaboam C, Aronoff DM, Peters-Golden M: following ischemia/reperfusion. JCI Insight 2(18): e94716, 2017 Prostaglandin E(2) inhibits collagen expression and proliferation in patient- 26. Huang SK, Wettlaufer SH, Chung J, Peters-Golden M: Prostaglandin E2 derived normal lung fibroblasts via E prostanoid 2 receptor and cAMP inhibits specificlungfibroblast functions via selective actions of PKA signaling. Am J Physiol Lung Cell Mol Physiol 292: L405–L413, 2007 and Epac-1. Am J Respir Cell Mol Biol 39: 482–489, 2008 31. Borok Z, Gillissen A, Buhl R, Hoyt RF, Hubbard RC, Ozaki T, et al.: 27. Kohyama T, Ertl RF, Valenti V, Spurzem J, Kawamoto M, Nakamura Y, Augmentation of functional prostaglandin E levels on the respiratory et al.: Prostaglandin E(2) inhibits fibroblast chemotaxis. Am J Physiol epithelial surface by aerosol administration of prostaglandin E. Am Rev Lung Cell Mol Physiol 281: L1257–L1263, 2001 Respir Dis 144: 1080–1084, 1991 28. Kolodsick JE, Peters-Golden M, Larios J, Toews GB, Thannickal VJ, 32. Wilborn J, Crofford LJ, Burdick MD, Kunkel SL, Strieter RM, Peters- MooreBB:ProstaglandinE2inhibitsfibroblast to myofibroblast tran- Golden M: Cultured lung fibroblasts isolated from patients with idio- sition via E. prostanoid receptor 2 signaling and cyclic adenosine pathic pulmonary fibrosis have a diminished capacity to synthesize monophosphate elevation. Am J Respir Cell Mol Biol 29: 537–544, prostaglandin E2 and to express cyclooxygenase-2. JClinInvest95: 2003 1861–1868, 1995

94 Journal of the American Society of Nephrology J Am Soc Nephrol 30: 80–94, 2019