Elucidating the Interaction Between the Molecular Chaperone Hsp104 and the Yeast Prion Sup35

Elucidating the interaction between the molecular chaperone Hsp104 and the yeast prion Sup35

Christopher Werner Helsen

A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Department of Biochemistry University of Toronto

Elucidating the interaction between the molecular chaperone Hsp104 and the yeast prion Sup35

Christopher Werner Helsen

Doctor of Philosophy

Department of Biochemistry University of Toronto

2012 Abstract

Hsp104 is a protein remodeling factor that is crucially important for induced thermotolerance and prion propagation in yeast. Recent work demonstrates that Hsp104 is able to directly recognize and interact with synthetic polypeptide substrates, and that this interaction is dependent on the amino acid composition or sequence (Lum et al., 2008). Here this concept is applied to the in vivo substrate Sup35. Sup35, a translation termination factor, also forms the yeast prion [PSI+].

The maintenance of the prion is critically dependent on the expression levels of Hsp104. Over- expression of Hsp104 leads to the loss of prions, as does inhibition of this protein remodeling factor. As part of this thesis, an in vitro assay was established in which spontaneous nucleation, the event preceding of fiber formation, was suppressed. Fibrilization itself then becomes strictly dependent on the chaperones Hsp104, huHsp70p and Ydj1. In line with in vivo observations,

Hsp104 mutants that fail to propagate [PSI+] also fail to overcome nucleation inhibition in this assay. Following this, the next part of this work established that the middle (M) domain of Sup35 inhibited this process, while not affecting spontaneous fibrilization under non-inhibitory conditions. This finding was reproduced in vivo, as middle domain over-expression also led to curing of weak [PSI+]. This suggested that the M-domain contains an Hsp104 binding site. This hypothesis is supported by data presented in this thesis which show that a small segment 129-148 ii within the Middle domain has enhanced Hsp104 binding properties. Deletion of this 20-mer peptide also reduced the Hsp104 ability to interact with this prion substrate; it also results in the destabilization of the prion and enhanced curing by the prion curing agent guandidinium hydrochloride. This represents the first ever Hsp104 binding site identified within a natural substrate.

iii

Acknowledgments

This thesis could not have been completed without the guidance of my supervisor, Dr. John R. Glover, whom I thank for all his patience with me and support over the years. His enormous experience and continuous scientific input were crucial in helping me to grow as an independent scientist. He has provided a free research environment that allowed me to gain crucial experience in an overall friendly environment.

I would also like to thank the members of my supervisory committee, Drs. Alan Davidson and Christopher Yip, for the advice, encouragement, and harsh critiques that they freely and frequently offered. I must also thank the graduate students and post-doctoral fellows of the Glover lab, both past and present: Johnny Tkach, Ronnie Lum, Monika Niggemann, Linda Davies, Michael Shuen, Ryder Mackay, Maria Michalowska and most recently joined Shoeib Moradei. Each of you has given valuable, substantial and crucial support for my work in the lab. For this I am extremely thankful.

I would like to express my thanks to colleagues, the faculty and staff members of the Graduate Department of Biochemistry at the University of Toronto. Particularly, I wish to thank those on the fifth floor of the Medical Sciences Building.

I must also recognize the generous financial support that I have received throughout my training. I would thus like to express my gratitude to the University of Toronto, the Canadian Institute of Health Research, and PrionNet.

I would like to dedicate special thanks to Usheer Kanjee and Hannah Zhao for their critique of and input into this work. I would like to express my deep gratitude to Yoon Gee for her immense support for my work and critical input into my thesis. Finally, I would like to express my extreme thanks to my wife Jennifer Tsai for her continuous support and patience over the years, without which I would not have been able to complete this work successfully.

Table of Contents

Contents

Acknowledgments ...... iv

Table of Contents ...... v

List of Tables ...... ix

List of Figures ...... x

List of Abbreviations ...... xii

1 Introduction ...... 1

1.1 Thesis overview ...... 1

1.2 From disordered polypeptide chain to folded protein ...... 2

1.3 Protein aggregation ...... 3

1.3.1 Factors promoting aggregation ...... 3

1.3.2 Characteristics of Aggregates ...... 5

1.3.3 Management of protein aggregation ...... 9

1.3.4 Chaperones promoting protein folding, preventing aggregation ...... 10

1.3.5 Chaperones that are disaggregases ...... 11

1.3.6 Clearance of misfolded proteins by the proteasome ...... 12

1.3.7 Sequestering protein aggregates into aggresomes ...... 14

1.3.8 Summary ...... 15

1.4 Cellular chaperones ...... 15

1.4.1 Small heat shock proteins ...... 15

1.4.2 Hsp60 the folding chamber ...... 16

1.4.3 Hsp70/40 chaperone partners ...... 18

1.4.4 Hsp90 and its network ...... 23

1.4.5 Summary ...... 24

1.5 Hsp104: a protein disaggregase ...... 25

1.5.1 Hsp100/Clp are part of the AAA+ superfamily, diverse in biological function relying on similar molecular mechanisms ...... 25

1.5.2 Hsp104 structure and molecular mechanism ...... 26

1.5.3 Hsp104 characterization in vivo and in vitro ...... 30

1.5.4 Substrate interaction ...... 40

1.6 Sup35 translation termination factor and ―psi‖ factor ...... 42

1.6.1 Sup35 a yeast prion protein ...... 45

1.6.1.1 Sup35 protein is the psi factor and an amyloid ...... 45

1.6.1.1 Structural features ...... 49

1.6.1.2 General features of amyloidogenesis, and specifics to Sup35...... 53

1.6.1.3 Sup35 prion in vivo observations and strain diversity ...... 60

1.6.1.4 Sup35 properties important for prion formation ...... 65

1.6.1.5 Factors influencing [PSI+] ...... 66

1.6.2 The Hsp104 - Sup35 prion connection ...... 68

1.6.3 Summary ...... 70

1.7 Thesis rationale and objective ...... 70

2 The Sup35 M domain inhibits propagation of [PSI+] and chaperone-dependent fibrilization of the prionogenic domain NM ...... 74

2.1 Abstract ...... 74

2.2 Introduction ...... 74

2.3 Results ...... 76

2.3.1 Chaperone-dependent fibrilization ...... 76

2.3.2 Measuring fiber formation in real time reveals a block in nucleation ...... 81

2.3.3 The M-domain destabilizes [PSI+] in vivo and inhibits chaperone-dependent fibrilization in vitro ...... 81

2.4 Materials and Methods ...... 89

2.4.1 Cloning and protein preparation ...... 89

2.4.2 Protein expression and purification ...... 90

2.4.3 Protein Labeling ...... 91

2.4.4 Fluorescence measurements ...... 91

2.4.5 Fibrilization conditions ...... 92

2.4.6 Yeast strains and manipulation ...... 92

2.4.7 Gel electrophoresis and Western blotting ...... 93

2.4.8 TEM microscopy ...... 93

3 An Hsp104-Sup35 interaction site required for efficient prion propagation and Hsp104- mediated curing ...... 94

3.1 Abstract ...... 94

3.2 Introduction ...... 95

3.3 Results ...... 98

3.3.1 The Sup35 M-domain interacts with Hsp104 ...... 98

3.3.2 The M-Domain region 105-163 interacts with Hsp104 ...... 98

3.3.3 Sup35 segment 129-148 is crucial for in vitro Hsp104 interaction properties ... 107

3.3.4 Deleting Sup35 residues 129-148 results in reduced prion particle fragmentation ...... 107

3.3.5 Deleting Sup35 residues 129-148 inhibits prion curing by Hsp104 overexpression ...... 109

3.4 Discussion ...... 116

3.5 Materials and Methods ...... 120

3.5.1 Mutagenesis and plasmid construction ...... 120

3.5.2 Yeast strains and manipulation ...... 121

3.5.3 Protein expression and purification ...... 122

3.5.4 Hsp104 binding to peptide arrays ...... 123

vii

3.5.5 Soluble peptide synthesis ...... 124

3.5.6 Gel electrophoresis and Western blotting ...... 124

3.5.7 In vitro fibrilization ...... 124

3.5.8 fRCMLa binding ...... 125

3.5.9 ATPase assays ...... 125

4 Summary and Future Directions ...... 126

4.1 Summary ...... 126

4.2 Short term goals ...... 128

4.3 Long term perspective ...... 140

References or Bibliography ...... 142

viii

List of Tables

Table 1: Hsp104 mutations and their consequences ...... 34

Table 2: Primers used to generate NM,NMCys106 and M-domain ...... 89

Table 3: Primers used for to generate NM and M deletion constructs ...... 121

List of Figures

Figure 1: Hypothetical model for protein folding and aggregation...... 8

Figure 2: Overview of Hsp70, Hsp40 and the Hsp70 chaperone cycle...... 22

Figure 3: Hsp100/Clp protein overview...... 36

Figure 4: Hsp104 model and structure ...... 39

Figure 5: N-Domain alignment ...... 47

Figure 6: M-Domain alignment and schematic overview over Sup35 NM domain ...... 48

Figure 7: Amyloid structural features ...... 52

Figure 8: Nucleated polymerization mechanisms...... 56

Figure 9: Overview of Sup35 prion properties...... 64

Figure 10: Overview of chapters 2 and 3 ...... 73

Figure 11: Inhibition of spontaneous fibrilization by combined addition of Tween™ 20 and glycerol...... 79

Figure 12: Role of Hsp104 in chaperone-dependent fibrilization...... 80

Figure 13: Continuous monitoring of fibrilization with fluorescent NM...... 83

Figure 14: M-domain interferes with prion propagation and chaperone dependent fibrilization. 85

Figure 15: Ssa1 inhibits chaperone dependent fibrilisation ...... 86

Figure 16: Model of Hsp104-dependent propagation and curing of [PSI+]...... 97

Figure 17: The Sup35 M-domain interacts with Hsp104...... 101

Figure 18: Peptide array analysis identifies candidate Hsp104-binding sites in the Sup35 M- domain...... 102

Figure 19: Interaction of the basic region of the Sup35 M-domain with Hsp104...... 103

Figure 20: The interaction of soluble M-domain peptides with Hsp104...... 104

Figure 21: Deletion of amino acid 129-148 eliminates interactions with Hsp104...... 106

Figure 22: Sup35129-148 displays a propagation defect in vivo...... 112

Figure 23: [PSI+] prion maintained by Sup35delat129-148 is resistant to curing by Hsp104 overexpression...... 113

Figure 24: The prion maintained by Sup35129-148 is not a different ―strain‖...... 115

Figure 25: Models for spontaneous, inhibited and chaperone assisted fibrilisation...... 133

Figure 26: Measuring oligomer rearrangement...... 136

List of Abbreviations

AAA+ ATPases associated with a variety of cellular activities

ADP Adenosine diphosphate,

AMPPNP Adenylyl-imidodiphosphate

ATP Adenosine triphosphate,

CCD Coiled-coil domain

Clp Caseinolytic protease cryo-EM Cryoelectron microscopy

FFL Firefly luciferase fRCMLa Fluorescein-labeled reduced carboxymethylated α–lactalbumin

FRET fluorescence resonance energy transfer

GFP Green fluorescent protein

Hsp Heat shock protein

NADH Nicotinamide adenine dinucleotide

NBD Nucleotide binding domain

NTD N-terminal domain

PCR Polymerase chain reaction

RCMLa Reduced carboxymethylated α–lactalbumin sHsp Small heat shock protein

STRE Stress response element

xii

TEV Tobacco Etch Virus

ThT Thioflavin T

TPR Tetratricopeptide-repeat

xiii 1

1 Introduction 1.1 Thesis overview

After synthesis, polypeptide chains organize into a well defined, stable three-dimensional shape (fold). Typically, this three-dimensional fold is required for the biological activity of proteins. However, if proteins misfold, several polypeptide chains may self-associate in an unspecific and non-functional manner, forming aggregates (review: (Stefani and Dobson, 2003)). A whole class of proteins has evolved that either prevent or actively disassemble such aggregates (Walter and Buchner, 2002). One such disaggregase is Hsp104, the chaperone that is the focus of this thesis. Specifically, the ability of Hsp104 to recognize its aggregated substrates will be investigated. In particular, the interaction between the molecular chaperone Hsp104, and a model substrate, the yeast prion protein Sup35, will be explored.

As Hsp104 is a protein chaperone, the first chapter will introduce the problem of protein folding, how chaperones are often an integral part of this process, and general cellular responses to protein misfolding. Due to the importance of protein aggregation in this thesis, the process of aggregation will be addressed, with special emphasis on the occurrence of the ordered amyloid aggregates such as Sup35 in yeast. A more detailed discussion of the amyloid formation and propagation and factors influencing these processes will follow. As Hsp104 is one of the most potent factors influencing Sup35 prion formation and propagation, our current understanding of this interaction will be addressed.

The second chapter will illustrate the development of an assay that is capable of measuring chaperone dependent fibrilization of Sup35 NM domains in real time. The assay is a robust method in which spontaneous fibrilization is suppressed due to the use of a detergent buffer. However, this inhibition can be overcome with the use of chaperones. Different methods of measuring this process will be demonstrated, and the importance of the chaperone network will be established. Finally, the ability to measure interference of chaperone dependent fibrilization is a powerful tool to screen for substances that interfere with this process. Thus it was discovered that expression of the middle domain alone was able to inhibit this reaction, and that this inhibition was dependent on a 20 amino acid stretch contained within that domain.

In the third chapter, the finding that the M-domain is able to interfere with the chaperone dependent fibrilization process is further investigated. This work will describe the discovery of a specific 20 amino acid spanning region (129-148) within Sup35 that is required for Hsp104 remodeling. Various methods will demonstrate that the interaction between Hsp104 and Sup35 can be markedly affected by removing this short 20mer peptide sequence. Initially, in vitro methods will be used to narrow down this interaction region, the importance of which will then be demonstrated in vitro as well as in vivo.

The last chapter will discuss the question of whether Hsp104 preferred interaction sites can be generalized to other yeast prions.

1.2 From disordered polypeptide chain to folded protein

Life is based on the self-organization of the cell, in which a multitude of metabolic processes allow for cells to grow, multiply and repair themselves. This principle is the same from the simplest single cell to a multi-cellular organism. These processes are often orchestrated by proteins, whose function is most commonly coupled to their three-dimensional fold (Martin et al., 1998). Most polypeptide chains can fold spontaneously into their final low energy conformation, indicating that the folding information is contained within the amino acid sequence (Anfinsen, 1973; Anfinsen and Haber, 1961). Ideally, if one was able to understand the ―protein folding code‖, it would be possible to synthesize polypeptides with a defined fold. It is clear that certain principles govern the folding process, since theoretical predictions, better known as the ―Levinthal Paradox‖, show that if polypeptides were to attain their final state by sampling all possible confirmations first, even the folding of a small 100 amino acid polypeptide with would require billions of years, thus far exceeding the polypeptide folding time that is observed in nature (Levinthal, 1969). For example, the small 61 residue engrailed homeodomain protein can fold within a few microseconds (Mayor et al., 2003). The protein folding time scale varies enormously between different proteins, is dependent on chain length as well as the final protein structure (Chen et al., 2008), and may extend to up to several seconds (review: (Rumfeldt et al., 2008)). However, it is still much faster than a random sampling of all amino acid conformations. One possible solution would be that rather than sampling all possible confirmations, local interactions would guide initial folding, consequentially leading to interactions between more distant amino acids, allowing for the rapid folding observed in

3 biological systems (Levinthal, 1969). Such a process would be highly cooperative, such that many interactions between amino acids act in concert to obtain a stabilized fold; hence proteins would have evolved to ensure both robust protein function and stable protein folding (Onuchic and Wolynes, 2004). Recent models propose that protein folding follows along a ―funnel like energy landscape‖ (Figure 1 A). This model is able to encompass different starting conditions for a polypeptide chain, based on pH, temperature, and other factors. Thus, rather than assuming there is only one possible folding pathway, there may be several pathways that in parallel lead to the final protein fold (Dill and Chan, 1997). Multiple folding pathways would also suggest that rather than having one defined folding intermediate, an ensemble of such intermediate structures should be expected.

However, the existence of intermediates, trapped in local energy minima, pose a potential detrimental problem for cells, in that these folding intermediates often expose hydrophobic patches; in the highly crowded cellular environment with its high protein concentrations, this makes these non-native state proteins aggregation prone (Dobson, 2001; Zimmerman and Trach, 1991). Protein aggregation is a complex process that is poorly understood, and encompasses not only random non-native protein associations, but also the highly ordered amyloid aggregates that form the basis of diseases like bovine spongiform encephalopathy (BSE) and Alzheimer’s disease (Stefani and Dobson, 2003). As non-native protein aggregation is deleterious to cells, a multitude of mechanisms to address these potentially damaging protein aggregates have evolved. This includes chaperones for prevention of aggregation and disaggregation of formed aggregates; the proteasome for efficient aggregate removal; and the aggresome for aggregate storage (Kopito, 2000; Stefani and Dobson, 2003; Walter and Buchner, 2002; Weibezahn et al., 2004a).

1.3 Protein aggregation

1.3.1 Factors promoting aggregation

Proteins are constantly produced, giving rise to a constant influx of polypeptide chains in various folding states. The energetic barriers between a folded protein and its unfolded state are usually low, within 10 – 40 kJ/mol (Creighton, 1990; Naganathan et al., 2005). It is important to note here that the biophysical properties are determined in vitro, usually in highly dilute protein solutions. However, proteins folding within cells encounter a significantly different environment; they fold in solutions containing a very high protein concentration. In bacteria, protein

4 concentrations are estimated to be in the 300 mg/ml range (Zimmerman and Trach, 1991). This can affect the protein folding pathway, protein stability and oligomer integrity. While it is uncertain how applicable biophysically determined energy measures are, the basic principles of protein folding along a energy landscape containing potential local energy minima still apply. Consequently, cells are in a dynamic equilibrium between natively folded and unfolded/aggregated proteins (Figure 1B). Proteostasis has been coined to describe this balancing act (Powers et al., 2009). This equilibrium is dependent on several factors, each of which by itself, or in combination with others, can tip the balance from one side to the other. One factor can be the polypeptide chain itself, that either via mutation or transcription/translation errors may produce polypeptides that denature easily or cannot attain the folded state, leading to aggregate formation. Additionally, loss-of-function mutations in proteins crucial to the quality control system may promote aggregation (Kitada et al., 1998; Olzmann et al., 2007). Environmental conditions such as heat and oxidative stress may also promote aggregation; while thermal stress can result in mass denaturation, oxidative stress can produce radical oxygen species (ROS). ROS may fragment peptides via radical induced peptide bond breakage (Miyata et al., 1999). Another factor in the folding equilibrium involves amino acid side chain modifications. Amino acid side chains may be modified either directly (Pro, Arg, Lys, Thr) or via reactive carbonyl compounds (Lys, Cys, His) derived from glycoxidation, lipids and glycation products (for reviews see (Miyata et al., 1999; Stadtman and Oliver, 1991; Tyedmers et al., 2010)). These modifications can crosslink amino acid chains within a single polypeptide, or between several polypeptides; they can also change characteristics of amino acid side chains, which may then destabilize a given protein fold. Over time, cells accrue damage; the previously mentioned stresses on the cell contribute to the incidence of damaged proteins, leading to an accumulation of misfolded proteins. The precise mechanism by which this happens is unknown, but may involve both reduced capacity of the cellular protein folding quality control system, combined with a steady increase in damaged, truncated or mutated proteins; this may then lead to protein unfolding and consequently favour protein aggregation (Tyedmers et al., 2010). However, protein aggregation encompasses a variety of different aggregate species, and thus different aggregation products may exhibit different characteristics.

1.3.2 Characteristics of Aggregates

Aggregation is a loose umbrella term that is used to describe a wide range of protein associations. An aggregate can be understood to comprise polypeptide chains that interact with each other in a non-physiological, non-functional and non-specifically defined manner. On the other hand, it is also used to describe amyloids, which have a relatively defined core structure and whose formation potentially has a physiological purpose (Dobson, 2001; Shorter and Lindquist, 2005). As the term aggregation is often used without discriminating between different types of aggregates, this section will attempt to characterize and introduce certain classes of aggregates. The first class of aggregates is known as disordered aggregates. These are non-native assemblies of polypeptide chains that associate in a non-specific manner and lead to non- functional products. Such aggregates are normally formed via interactions between misfolded, partially folded or unfolded proteins. Since disordered aggregates are amorphous protein assemblies and thus cannot be produced with any kind of specificity or reproducibility, their study has remained elusive to biochemical methods that determine biological properties over large populations of molecules. These aggregates have to be distinguished from the second class of aggregates, known as amyloids. An amyloid is a long extended rod shaped structure or fiber that is rich in -sheet structure and exhibits birefringence when stained with Congo Red (Reviewed in (Rambaran and Serpell, 2008)). Amyloids are ordered protein aggregates formed by proteins that can attain a stable non-native fold which is distinct from their native functional fold. This alternate-folded protein then forms ordered aggregate particles, which recruit other proteins of the same type into the aggregate. Thus these proteins have a protein-only mode of propagation (for review see:(Rochet and Lansbury, 2000)). Some amyloids can also be prions. The term prion is derived from ―proteinaceous infectious particle‖ and describes a transmissible particle responsible for a disease phenotype (Prusiner, 1982). Thus it is the defining feature of prions that they are able to self-propagate and are transmissible between different organisms. It is important to note that not all amyloids are prions, since they may not be transmissible or lack the ability to self propagate under native cellular or extra cellular conditions (Stefani and Dobson, 2003).

All disordered aggregates have in common that they are formed via non-native interactions. Non- native interactions are understood as interactions that do not lead toward the folded state associated with the biological function of a given molecule. Aggregates can vary based on their

6 origin and cellular environment; for example, if proteins are partially unfolded, either due to stress or accumulation of folding intermediates, an aggregate may contain proteins with fully formed domains that are interconnected via one or several unfolded domain(s) (Stathopulos et al., 2003). Alternatively, completely denatured peptides could form aggregates in which entire peptide chains interact with each other (Dobson, 2001) (Figure 1C). It is also possible that oxidative stress, cellular aging, or an overabundance of reactive compounds such as reducing sugars leads to the modification of proteins, which may further protein aggregation. Another factor to consider is that crosslinking between peptide chains can result in very robust protein aggregates. In this thesis, all the types of aggregates mentioned in the paragraph above will be referred to as disordered aggregates (Miyata et al., 1999).

By contrast with proteins that form aggregates, other proteins also form large, insoluble complexes; however, these complexes are derived from specifically folded proteins that assemble and disassemble in a controlled manner. The concept of disordered aggregation allows the separation of disordered aggregates from large protein complexes such as microtubules, actin filaments or collagen fibers. Although these complexes form large fibrous protein structures, they are highly organized, regulated and of important biological function (Desai and Mitchison, 1997; Shoulders and Raines, 2009; Tang and Anfinogenova, 2008). It is also worth noting that while these assemblies do interact via exposed hydrophobic patches, these are highly defined interactions and thus distinct from the random associations observed in disordered aggregates (Tang and Anfinogenova, 2008). This also suggests that mere size, mode of association, or solubility is not a good indicator of disordered protein aggregation.

It is also important to note that disordered aggregates are distinct from amyloids, as all amyloids share a highly structured relatively consistent -sheet rich core structure and thus are considered ordered aggregates (Liebman, 2005; Stefani and Dobson, 2003). Although the pathway that leads to the formation of these ordered aggregates could be hypothesized to be similar to the pathway of disordered aggregation, the outcome is quite distinct (Dobson, 2001). Amyloids consistently form the same range of -sheet core structures (Liebman, 2005). Another important distinction between disordered aggregates and amyloids is that while all disordered aggregates are viewed as a loss of function or deleterious phenomenon, amyloid formation has been suggested to be potentially advantageous for certain organisms under specific conditions (Shorter and Lindquist,

2005). It is also worth noting that the -sheet-rich core that is inherent to fiber formation is also observed in other natural fibers such as fiber silks (Romer and Scheibel, 2008; Slotta et al., 2007). This indicates that the -sheet core that gives rise to fibrous structures may be a generic concept that may lead to diseases in the case of Alzheimer’s disease or BSE (reviewed in (Rambaran and Serpell, 2008; Stefani and Dobson, 2003)); alternatively, they may be of functional significance, as in the case of CREB-1 for development of long term memory (Bailey et al., 2004), or in the case of fiber silks (Romer and Scheibel, 2008). This makes it difficult to classify the yeast Sup35 amyloid, which is also a prion, as disease-causing or beneficial, since there is experimental / statistical data for either position (Nakayashiki et al., 2005; True and Lindquist, 2000). In this work, the terms ordered aggregate or amyloid will often be used interchangeably, without implying whether these aggregates play a physiologically important role in the cell.

While aggregation seems to be promoted by the presence of partially unfolded or completely unfolded proteins, it is important to note the difference between unfolded proteins or folding intermediates, and a novel class of proteins called ―natively unfolded‖ proteins whose importance is only beginning to emerge (Fink, 2005). These natively unfolded proteins do not appear to have a specific structure when in solution, but adopt specific conformations upon interacting with other proteins or DNA (Fink, 2005). It is generally hypothesized that disordered aggregates form mainly via the association of hydrophobic amino acids (hydrophobic patches) that would normally be hidden in the correctly folded protein (Walter and Buchner, 2002). However, natively unfolded proteins do not have many hydrophobic amino acids, but are enriched in charged residues (Uversky, 2002). This sets them apart from misfolded or unfolded proteins, and may explain why these natively unfolded polypeptides are not aggregation prone, despite exposing a large unstructured domain.

A Reaction cooridnate B te na id or co n io ct ea unfolding

R stress

g r

e Folded Unfolded Aggregate n

E Proteins

Proteins

r F

Partially unfolded Completely unfolded Cross linked aggregates aggregates aggregates

Figure 1: Hypothetical model for protein folding and aggregation.

A. Model landscape for protein folding. Arrows indicate possible pathways along the energy landscape dependent on initial conditions. Red arrow represents a folding pathway to a global energy minimum, which passes through a local energy minimum that may result in trapped folding intermediates. B. General model of protein aggregation. Initially folded proteins have hydrophobic patches (red square) shielded in the protein core. If stress however leads to protein unfolding these hydrophobic patches become exposed and are now freely accessible. This leads to protein aggregation in which unspecific, biologically non-relevant hydrophobic interactions between polypeptide chains are formed. C. Hypothetical types of aggregates possibly formed by a multi-domain protein. (Far left) Partially unfolded proteins form aggregates that contain a mixture of unfolded proteins and folded domains. (Middle) Proteins are completely unfolded and lead to vast inter-domain interactions. (Far right) Completely unfolded proteins have been crosslinked by radical oxygen species and form a more robust aggregate.

1.3.3 Management of protein aggregation

Protein aggregation is, in most cases, not beneficial to cells. There are a variety of different aggregate types; consequently, it is likely that several mechanisms evolved to address each given problem effectively. While the impact of aggregation by itself on the cell can be debated, even the loss of function of the protein that forms the aggregate can be problematic. While it has been observed that proteins of the same type tend to preferentially co-aggregate with each other, it has also been demonstrated that one aggregate species can affect another aggregation process, or that co-aggregation can occur (Chai et al., 2002; Rajan et al., 2001). It can be speculated that different types of aggregates, derived from either different proteins or from different stress factors may be subject to distinct processing mechanisms. The different types of aggregate management processes can be roughly categorized into aggregation prevention, aggregate clearance, and aggregate sequestration to specific storage compartments. All these mechanisms aim at preventing or reducing the impact of aggregation on the cellular environment.

It should be noted that cells constitutively express factors to prevent protein aggregation, but also have the ability to up-regulate proteins that help maintain proteostasis and thus adapt to stress situations, several of which are described below. One example would be the unfolded protein response (UPR) pathway of the endoplasmatic reticulum (ER), one of the major protein folding/trafficking organelles within eukaryotic organisms (for review see (Ma and Hendershot, 2004)). This pathway was first discovered in Saccharomyces cerevisiae (baker’s yeast) and can briefly be summarized as follows. Initially the membrane spanning protein Ire1 is held in an inactive state by ER luminal BiP, an Hsp70 chaperone. In the case of increased protein misfolding, BiP will be sequestered toward unfolded proteins or resulting aggregates, thus freeing and activating Ire1. Ire1 is then able to cleave cytosolic, inactive pre-mRNA that codes for HacI, a transcription factor. After RlgI mediated HacI mRNA re-ligation, the translation product enters the nucleus. HacI can then bind to UPR elements within the genome leading to the expression of stress factors, including many chaperones for the ER (for review see (Ma and Hendershot, 2004)). In the S. cerevisiae heat stress response, Hsf1, a transcription factor for heat shock elements (HSE), is normally held inactive by the Hsp90 and its co-chaperone network (for review see (Akerfelt et al., 2010)). If cellular stress results in an accumulation of misfolded proteins, the chaperones will now be sequestered towards these, thus freeing and activating Hsf1. At the same time Hsf1 will be further post-translationally modified, in order to fine-tune the heat

10 shock response. This then leads to the activation of many heat shock proteins, such as Hsp70 and Hsp40, as well as Hsp104 (for review see (Akerfelt et al., 2010)). Another yeast pathway is based on the activation of stress response elements (STRE’s), in which the transcription factor Msn2 plays a key role. In this pathway, the protein phosphatase 1 complex (PP1), with Glc7 as catalyst and an unknown stress-sensing targeting subunit, de-phosphorylates the inactive phosphorylated form of Msn2. This then enables the import of Mns2 into the nucleus and the subsequent activation of STRE-regulated genes, including the TPS2 (phosphatase subunit of the trehalose-6-phosphate synthase/phosphatase complex) gene, required for synthesis of trehalose, a chemical chaperone (for review see (De Wever et al., 2005)).

These examples show that responses to stress are regulated in several unique ways, all tailored to respond as effectively and specifically as possible to a given situation. These pathways can individually or synergistically act to address protein aggregation as well as many different forms of stress. The ability to sense stress is a crucial element upstream of any directed response towards such adverse conditions.

1.3.4 Chaperones promoting protein folding, preventing aggregation

Since proteins are essential machinery in living cells, their proper folding is of paramount importance. Therefore, cells have developed an extensive system of proteins that can aid cells to adapt to stress situations, by assisting in protein folding and the prevention of aggregation. Generally these proteins are referred to as chaperones. These proteins encompass a huge class of distinct proteins that have in common their ability to bind in a defined way to misfolded proteins or protein aggregates, and also to release these substrates in a controlled manner (Walter and Buchner, 2002). These chaperones can be further categorized into foldases or holdases. Foldases are chaperones that actively assist in protein folding; for example, the Hsp60 and Hsp70 machinery (Bukau and Horwich, 1998). By contrast, holdases such as the small heat shock proteins (sHsps) bind to their substrate tightly, thus salvaging misfolded proteins consequently preventing any protein aggregation (Jakob et al., 1999), (Reviewed in (Narberhaus, 2002)). Chaperones are generally classified according to their molecular weight, similar molecular structure and conserved function. Within such a ―chaperone family‖ these proteins tend to be relatively well conserved across several species (Walter and Buchner, 2002). For example, the heat shock protein Hsp70 describes a 70 kDa protein, which is found in E. coli (DnaK), in yeast

(Ssa, Ssb, Ssc, kar2), and in higher eukaryotes (Hsc70, Hsp70, Grp75, Grp78) (Georgopoulos and Welch, 1993). The main cytosolic chaperones in eukaryotes are sHSP, Hsp70 and Hsp90 (Georgopoulos and Welch, 1993), and are sufficient under normal conditions to prevent significant protein aggregation.

Aside from these molecular chaperones, there are also chemical chaperones; these are understood to be small compounds such as trehalose (E. coli, yeast) or sorbitol (mammals, kidney) that generally stabilize protein folds and also prevent protein aggregation (Burg, 1995; Singer and Lindquist, 1998; Welch and Brown, 1996).

These different molecular and chemical chaperones act synergistically to promote correct protein folding under non-stress conditions, and are significantly up-regulated under stress to prevent protein aggregation and stabilize native protein conformations. Detailed examples for different chaperone systems will be discussed in later sections.

1.3.5 Chaperones that are disaggregases

While the prevention of protein aggregation is the hallmark of a balanced proteostasis, stress factors can overwhelm the constitutive chaperone system, resulting in massive protein aggregation. While the cellular stress response up-regulates chaperones to counter these adverse environmental factors, this process is not immediate, and thus aggregates which are already formed need to be dealt with. This is especially important since protein aggregation may lead to the loss of essential protein function, and hence recovery of these proteins may be critical. Thus cells developed mechanisms to refold these protein aggregates that are usually not accessible to the normal cytosolic chaperones (Lee et al., 2004). These protein disaggregases or hsp100 proteins, such as ClpB in E. coli and Hsp104 in yeast, in concert with other chaperones such as Hsp40 and Hsp70, are capable of acting on aggregated proteins. These chaperones dissolve aggregates, presumably by extracting single polypeptide chains, enabling refolding of these previously denatured proteins (Glover and Lindquist, 1998; Lum et al., 2004; Parsell et al., 1994b; Tessarz et al., 2008). The molecular mechanism of disaggregation will be discussed in more detail in later chapters.

1.3.6 Clearance of misfolded proteins by the proteasome

A different approach to dealing with protein misfolding is degradation of misfolded proteins, rather than refolding them. Proteins that repeatedly fail to fold into their native conformation are labeled for degradation by the cellular protein quality control system (Buchberger et al., 2010; Vembar and Brodsky, 2008). It is important for a cell to balance these two pathways. As the synthesis of polypeptides consumes a lot of energy, protein degradation does not seem to be the most effective way to deal with misfolded aggregates; rather, chaperone mediated refolding is favoured. However, keeping irreparable peptides cycling in the chaperone network would ultimately saturate the cell’s chaperone capacity.

Consequently, highly regulated mechanisms for protein degradation have evolved (for review see (Buchberger et al., 2010)). In bacteria, proteases are generally ATP dependent, to regulate and ensure specificity of protein degradation by restricting access / entry to the catalytic core of the protease. There are several proteases known in bacteria (for review see (Gottesman, 1996)), which are required for degradation of a wide variety of substrates. The cylinder shaped proteases (ClpP or ClpQ) have their catalytic sites shielded within their inner channel, which is only accessible via an associated AAA+ (ATPases Associated with diverse cellular Activities) (Hanson and Whiteheart, 2005) protein complex (ClpA, ClpX, ClpY). The usually ring-shaped ATPase oligomers facilitate ATP dependent translocation of various substrates to the proteolytic active core (for review see (De Mot et al., 1999)). Substrate recognition is not well understood, except in cases like ClpP/X, where a specific tag is required for substrate targeting for degradation (Hoskins et al., 2002).

One example of a bacterial protein degradation system is the ClpP/X system, where ClpP forms a heptameric cylinder shaped protease complex, and ClpX the associated hexameric AAA+ protein complex required for substrate translocation (Sauer et al., 2004). ClpP/X is mainly focused on degrading polypeptides that are stalled at the ribosome and subsequently get tagged with the SsrA signal sequence (Lies and Maurizi, 2008). Another example is HslV/HslU (ClpQ/ClpY), which forms a similar protease complex (Missiakas et al., 1996). However, the targeting mechanism of ClpQ/Y is not well understood (Missiakas et al., 1996). In E. coli, it appears that ClpQ/Y plays a role in the heat shock response in degrading misfolded proteins, as well as ultimately limiting the heat shock response itself by degrading heat shock initiation factors

(Kanemori et al., 1997; Missiakas et al., 1996). The E. coli heat shock factor sigma (σ32) is required for transcription of many heat shock proteins. Initially, under stress conditions, the ClpQ/Y system, itself up-regulated by the sigma factor, is saturated with damaged or unfolded proteins. Once the cell stress diminishes, the sigma factor itself is degraded by ClpQ/Y, thus negatively regulating the heat shock response (Kanemori et al., 1997).

It was found that in eukaryotes, most cytosolic protein degradation is mediated by the 26S proteasome complex (Coux et al., 1996). This complex comprises the hetero-oligomeric proteolytic cylinder and a AAA+ oligomer complex ―gating‖ entry into the protease (Voges et al., 1999). While proteasomes in general are used to remove misfolded or damaged proteins, cells also target specific signaling molecules for degradation to limit their half life. In general, targeting of substrates to the proteasome is facilitated using small signaling protein chains (ubiquitin) which get covalently attached to proteins destined for degradation (for review see (Hochstrasser, 1996)). Ubiquitin chains are ligated to target proteins via E3 ligases, which thus need to be able to specifically recognize, target and modify desired substrates (For review see (Buchberger et al., 2010))

While proteasome degradation in eukaryotes is tightly monitored to prevent unspecific protein hydrolysis, it is of interest to understand how unfolded or damaged proteins are ultimately targeted to the proteasome. There are primarily two different systems that target either cytosolic or endoplasmatic reticulum localized proteins for degradation. For example, cytosolic proteins that misfold initially become substrates for the chaperone network, for example Hsp70/40. If protein folding is not successful after several rounds of chaperone action, the protein becomes ubiquitinylated by CHIP (carboxyl-terminus of Hsc70 interacting protein). This E3 ligase is able to interact with Hsp70 or Hsp90 via its TPR (tetratricopeptide) domain and thus initiates the removal of misfolded proteins from the chaperone network, to avoid jamming the system with irreparable protein substrates (for review see (Buchberger et al., 2010)). In the endoplasmatic reticulum, the ER-associated protein degradation (ERAD) response has a similar mechanism, although protein folding in the ER is more complex, involving disulfide bridge generation as well as glycoslysation. Chaperones such as BiP (Hsp70 in the ER), in concert with protein folding catalysts such as protein disulfide isomerase (PDI), are able to detect misfolded proteins. Similar to the cytosolic system, should a protein fail to fold after several iterations of chaperone action, it will be targeted for degradation. This is accomplished by another protein E3 ubiquitin

14 ligase such as gp78 (for review see (Buchberger et al., 2010)), which facilitates the marking of substrates for degradation and aids in its translocation to the cytosol. The translocation across the membrane of substrates also requires the action of the AAA+ protein p97/VCP (Valosin- containing protein) in mammals or Cdc48 in yeast (DeLaBarre et al., 2006; Rabinovich et al., 2002), (review: (Ballar and Fang, 2008)).

These mechanisms thus couple chaperone action to protein degradation in such a way as to strike a balance between protein folding and its degradation. Ultimately this allows the removal of terminally misfolded proteins and hence prevents protein aggregation. However, it should be noted that the proteasome may be less effective in the clearance of actual aggregates, compared to lysosomes, since once these aggregates are formed, they have the potential to ultimately inhibit the proteasome (Tyedmers et al., 2010). A special role in the clearance of aggregated proteins is played by amyloid deposits. These very stable complexes may be resistant to most if not all forms of cellular protein degradation, as was observed for the Alzheimer causing A4/ peptide forming amyloids (Knauer et al., 1992).

1.3.7 Sequestering protein aggregates into aggresomes

Once aggregation prevention or disaggregation fails, as when the proteasome in mammalian cells is inhibited (Wojcik, 1997; Wojcik et al., 1996), the formation of large protein aggregate assemblies can be observed (review see (Kopito, 2000; Tyedmers et al., 2010). In response to aggregate accumulation, so-called aggresomes are formed which are dependent on intact microtubule transport (Johnston et al., 1998). One possible transport mechanism could be via the adaptor histone deacetylase 6 (HDAC6), as it is required for aggresome formation and is capable of binding both to polyubiquitin chains and dynein (Kawaguchi et al., 2003). In contrast to bacterial inclusion bodies, mammalian aggresomes contain many different proteins which are normally cytosolic, for example Hsc70’s, Hsp40’s and the proteasome (for review see (Kopito, 2000)). However, recent work proposes that this multitude of proteins in the aggresome is the consequence of a highly orchestrated aggregate scavenging system, rather than random co- aggregation (Rajan et al., 2001). Hence it is likely that aggresomes are specific sites of protein aggregate accumulation. It is possible that these aggresomes are then later subject to autophagy to effect final protein degradation. Currently it is not clear if aggresomes are designated areas

15 that accumulate aggregates for lysosomal degradation, or if they represent a protein junkyard (Kopito, 2000).

1.3.8 Summary

Protein misfolding and aggregation is a continuously occurring biological process. Cells have therefore developed a variety of processes to combat protein misfolding and protein aggregation. These different pathways may be required to not only address the different conditions under which protein aggregation may occur, but also to ensure that the large variety of distinct aggregate species can be effectively cleared. Amyloids may form a special type of ordered aggregate that may be capable of evading most of the cellular anti-aggregation strategies.

1.4 Cellular chaperones

The focus of this work is on how Hsp104 is able to recognize substrates using a biologically relevant model system. In order to put this into perspective and highlight the common schemes of chaperone function in general, the major classes of chaperone systems will be discussed with emphasis on substrate recognition, process cycles and regulation. Initially small heat shock proteins will be covered, followed by the Hsp60 system, then the Hsp70/40 co-chaperone network, and finally the Hsp90 chaperone system. It bears emphasizing that although the generic acronym ―Hsp‖ (heat shock protein) was coined due to the fact that many chaperones are overexpressed during heat stress, stress response is likely not their only role. Most chaperones are crucial factors during non-stress conditions (Bukau and Horwich, 1998; Tyedmers et al., 2010). For example, Hsp70s play a crucial role in polypeptide synthesis by preventing protein aggregation and in turn promoting correct protein folding (Deuerling et al., 1999; Mayer and Bukau, 2005; Thulasiraman et al., 1999).

1.4.1 Small heat shock proteins

Small heat shock proteins (sHsp) represent a class of chaperones that in their primary function bind to partially unfolded proteins, removing them from the cellular pool of unfolded proteins, thus preventing the formation of terminal protein aggregates (Sun and MacRae, 2005; Tyedmers et al., 2010). Small heat shock proteins consist of a variable N-terminal domain, a well conserved -crystalline central domain of about 90 amino acids, and a variable C-terminal domain.

Oligomerization of sHsps is postulated to be a key element as it is required for substrate binding. Oligomers can consist of 8-24 monomers; however, given the diversity of sHsps, other oligomer assemblies are also possible (Benesch et al., 2008). Recent work has highlighted how diverse these different assemblies can be. This suggests that oligomer assemblies are very dynamic, being able to adjust their conformations, and that this is an elemental component of sHsp substrate binding ability (Stengel et al., 2010). Interestingly, the switching between a high and low affinity state of these chaperones is not controlled via nucleotide binding and hydrolysis; rather, data indicates that environmental factors such as temperature directly affect sHsp binding properties (Haslbeck et al., 2005). Environmental conditions together with post-translational modifications, in some cases, may lead to modifications in the sHsp primary fold or rearrangements of the oligomer substructure, ultimately enhancing substrate affinity (Benesch et al., 2008). sHsp oligomer assemblies are very dynamic and appear to recognize a variety of substrates within the cell without the help of co-chaperones (Sun and MacRae, 2005). The N- terminus may play a special role in sHsp function, as it was proposed that its flexibility, enabling the formation of a variety of binding loops, may be essential for degenerate substrate recognition by sHsps (Jaya et al., 2009). This may also explain why there is a large variation in the N-termini between different sHsps, as this would improve the ability of various sHsps to bind different substrates. It is also important to note that once stress conditions subside, sHsp proteins need to work in association with ATP-dependent chaperones such as Hsp70 to effect substrate release and refolding (Sun and MacRae, 2005).

1.4.2 Hsp60 the folding chamber

The chaperone Hsp60 forms a family of chaperones that is highly conserved within prokaryotes (Zeilstra-Ryalls et al., 1991). These chaperones form a heptameric ring-shaped assembly of identical single 60 kDa subunits. Two such rings are associated back-to-back, each providing a central chamber that is accessible to protein substrates (for review see (Bukau and Horwich, 1998)). In E.coli, Hsp60 (GroEL) forms a complex with an additional factor, GroES, that binds to the top of a GroEL ring, resulting in the characteristic bullet shaped form of this chaperone (Xu et al., 1997).

While not essential, the importance of this factor was highlighted by studies that showed that under normal steady-state conditions, 10-15% of all newly translated proteins fold via GroEL/GroES assistance, while under heat stress that number increases to up to 30% (Ewalt et al., 1997). In order for GroEL to function, the chaperone has to first recognize and bind its substrate, then assist in its correct protein folding, and finally release the protein. Binding of substrate may be due to the exposure of hydrophobic loops in the central chamber of GroEL; unfolded proteins that expose hydrophobic patches can then interact with GroEL and bind via multivalent hydrophobic interactions to the chaperone (for review see (Farr et al., 2000; Horwich and Fenton, 2009)). Whether there are sequence features that would enhance a substrate’s ability to interact with GroEL remains to be seen, although theoretical studies indicate that proteins that expose certain hydrophobic loops may bind preferentially to GroEL (Chaudhuri and Gupta, 2005).

Currently it is believed that only one chamber within the double ring binds to the substrate at a time, while the other remains empty. Binding of substrate is accompanied by ATP binding, which then enables binding by GroES. Upon ATP hydrolysis, each subunit performs large conformational changes that exert force onto a given substrate, similar to a pull and tug action, enabling protein unfolding. This step may aid proteins to overcome kinetic folding traps, giving these substrates the opportunity to re-fold within the protected cavity of the chaperone. Binding of a new substrate and ATP to the empty chamber of the double ring then effects substrate release of the initially bound substrate (Bukau and Horwich, 1998; Horwich and Fenton, 2009).

While eukaryotic cells do not have GroES/EL, they do have chaperones that fulfill the same role of providing a folding chamber for nascent polypeptides. This protein is TRiC, also called CCT. While there are substantial differences in how the eukaryotic protein functions compared to what is known about the GroEL/ES system, both provide a protected enclosed folding environment for proteins, and presumably use ATP hydrolysis to actively assist in protein folding (Meyer et al., 2003). However, TRiC/CCT does not have a ―lid‖ cofactor, but seems to have a built in ―lid‖ that helps confine a substrate to the folding chamber. Details of the mechanism of TRiC/CCT are still being elucidated.

1.4.3 Hsp70/40 chaperone partners

Another group of highly conserved chaperones is the Hsp70 family of chaperones (Boorstein et al., 1994). These chaperones are ubiquitously present in all known organisms and in all cellular compartments. In contrast to Hsp60, Hsp70 does not form a protective folding chamber, but rather holds on to hydrophobic patches that are exposed in extended non-native conformations (for review see (Bukau and Horwich, 1998; Bukau et al., 2006). Hsp70 protein chaperones contain 3 different domains: a highly conserved 44 kDa N-terminal nucleotide binding site (NBD), followed by a conserved 10 to 15 kDa substrate binding site, and a 15 kDa C-terminal domain (Figure 2A, B) (Feige and Mollenhauer, 1992). In budding yeast, the four Hsp70s labeled Ssa1-4, are somewhat redundant, with at least one being required for cell viability (Werner-Washburne et al., 1987). In addition, several other Hsp70s have been described in yeast: the cytosolic Ssb1 and 2, as well as the mitochondrial Ssc1, and the ER luminal kar2, all of which share significant sequence similarity (Boorstein et al., 1994). Given the large sequence similarity and often functional redundancy of the Hsp70 family, it can be speculated that their reaction mechanisms are comparable.

As Hsp70 is able to recognize substrates by itself, and as substrate recognition is the crucial first step for any chaperone process, the question how substrate recognition works arises. This question was first addressed using the yeast ER Hsp70 BiP. Using a phage display library of random peptides, it was determined that BiP preferentially bound to extended and hydrophobic polypeptide chains (Blond-Elguindi et al., 1993). Similar studies were also done using the E.coli DnaK and peptide arrays. These arrays consist of cellulose membranes onto which short peptides are spotted. These membranes were then tested for binding with the E. coli Hsp70 protein DnaK. It was found that short 4-6-mer hydrophobic residues flanked by basic amino acids are ideally suited for binding. Interestingly, while such sequences are common within proteins, they normally are buried within a correctly folded protein, hence only misfolded or denatured proteins would expose these binding sites and thus cause these proteins to become DnaK substrates (Bukau and Horwich, 1998; Rudiger et al., 1997).

Following substrate recognition, its regulated binding and release is a necessary component of Hsp70 action. Studies on the E. coli Hsp70 DnaK showed that nucleotide binding at the NBD strongly affects the ability of the chaperone to bind to substrate. In the initial ATP bound state,

19 affinity to substrates is relatively low and a fast exchange rate is favored. However, upon nucleotide hydrolysis, the ADP bound Hsp70 has a very high substrate affinity and a low exchange rate (Bukau and Horwich, 1998). This couples substrate binding, holding and release tightly to the bound nucleotide state.

However, Hsp70s by themselves have a very low ATP hydrolysis rate of 0.02-0.2 min-1, too low to be of functional significance during the average protein folding time scale (Bukau and Horwich, 1998). Findings explaining this data show that Hsp70 works closely with additional co- factors that both influence substrate binding as well as ATP hydrolysis and nucleotide exchange.

ATP hydrolysis and the consequential regulated substrate binding and release is regulated by several different co-factors. In E. coli, DnaK works together with DnaJ, which promotes substrate recognition and ATP hydrolysis, and GrpE, which enhances nucleotide exchange (Harrison, 2003; Harrison et al., 1997; Mayer and Bukau, 2005). In S. cerevisiae, J-proteins similar to bacterial DnaJ such as Ydj1 are important for substrate recognition, delivery and stimulating ATP hydrolysis (Walsh et al., 2004). Nucleotide exchange is stimulated by factors such as Fes1 and Sse1 (Schuermann et al., 2008; Young et al., 2004). Sse1, also known as an Hsp110, belongs to the Hsp70 family and has only recently been characterized. Mammalian cells exhibit a similar framework of Hsp70 family proteins; for example, cytosolic huHsp70 works together with the J-domain proteins Hdj1/2 and the nucleotide exchange factor Bag1 (Young et al., 2004).

While Hsp70 is able to directly interact with its substrates, other target proteins are shuttled to this chaperone via the J-domain co-factors. These proteins can be separated into 3 types, all of which contain the highly conserved N-terminal J-domain (Figure 2C). The first type has a glycine/proline rich region, followed by a zinc finger and the carboxy-terminus. Type II proteins lack the zinc finger, and Type III proteins only contain the J-domain (for review see (Walsh et al., 2004)). The large variety of J-domain co-factors may represent a mechanistic way to shuttle a large and diverse variety of proteins to Hsp70. For example, in S. cerevisiae, the two J-domain co-factors Ydj1 (Type I) and Sis1 (Type 2) were found to have different abilities to assist Ssa1 in protein refolding (Lu and Cyr, 1998). This correlates with the observation that these two co- chaperones appear to have different specialized functions in yeast (Walsh et al., 2004). Studies of Ydj1 showed that short hydrophobic peptides are preferentially recognized (Li and Sha, 2004),

20 which would be compatible with the Hsp70 peptide binding site. These functional differences were further highlighted when the effect of these co-factors on model substrates was elucidated, such as the effect on the ordered aggregates in yeast prion phenotypes such as [PIN+] and [PSI+]. For example, the suppression of the [PSI+] phenotype was markedly enhanced by Sis1 overexpression compared to Ydj1 (Kryndushkin et al., 2002). Later studies also showed that Sis1 but not Ydj1 was required for the maintenance of [PIN+] (Lopez et al., 2003; Sondheimer et al., 2001; Tipton et al., 2008).

These data indicate the complexity of the Hsp70 chaperone system (Figure 2 D), which is able to interact with a large variety of substrates due to its co-factor network. Substrate binding and ATP hydrolysis is tightly coupled due to the action of these co-factors, and substrate release is then regulated by a different set of co-factors.

Figure 2: Overview of Hsp70, Hsp40 and the Hsp70 chaperone cycle.

A. Schematic representation of the Hsp70 domains based on E. coli DnaK. Molecule underneath schematic: structure of DnaK (PDBID: 2KHO). Domains are coloured as seen in schematic above. B. Molecular structure of the peptide binding domain of DnaK (PDBID: 1DKX). Peptide binding domain is coloured as seen in schematic. Peptide is shown in purple. C. Overview of different types of J-domain Hsp40’s. Type I contains the J-domain, glycine-rich domain (G), zinc finger domain and a C-terminal domain (CTD). Type II lacks the glycine-rich domain relative to Type 1, and Type III only contains the J-domain. D. Generic model for Hsp70 chaperone cycle. (i) Hsp70 is in its low affinity ATP bound state. It can interact directly with hydrophobic patches exposed on polypeptides, for example, nascent polypeptide chains at the ribosome (iii). Alternatively, peptide substrate is delivered via Hsp40 (ii). Hsp40 then interacts with Hsp70 forming an Hsp70-Hsp40-peptide complex (iv). Peptide is transferred to Hsp70, and ATP hydrolysis is stimulated by Hsp40 and Hsp40 is released (v). This results in the high affinity Hsp70-peptide-ADP complex (vi). (vii) Hsp70-peptide-ADP interacts with a nucleotide exchange factor (NEF) (i.e. Hsp110) forming an Hsp70-NEF-peptide complex (viii). This leads to the release of ADP, peptide and nucleotide exchange factor (ix).

1.4.4 Hsp90 and its network

Unlike TRiC/CCT and Hsp70, Hsp90 is dispensable for proper folding for most of the yeast proteome (Nathan et al., 1997). However, it has been demonstrated that Hsp90 possesses basic chaperone activity, being able to suppress aggregation as well as promoting refolding of model substrates (Wiech et al., 1992). This suggests that Hsp90 is a ―specialized‖ chaperone with a rather specific subset of cellular targets (for review see (Wandinger et al., 2008)). It has been suggested that its substrates may be proteins that are correctly folded but very labile, or proteins that need to interact with a ligand for stable folding to occur (for review see (Picard, 2002; Whitesell and Lindquist, 2005)).

Structurally, Hsp90 forms a homodimer, and can be organized into 4 distinct domains; the N- terminal domain, a flexible linker domain, the middle domain, and the C-terminal domain. The N-terminal domain contains the ATP binding site, while the C-terminal domain is critically important for dimerization, and for docking of co-chaperones via its EEVD motif (Bracher and Hartl, 2006). N-terminal nucleotide binding was established to be critical for in vivo Hsp90 activity (Panaretou et al., 1998; Prodromou et al., 1997).

Similar to Hsp70, the Hsp90 ATP hydrolysis rate is very slow; however, it can be stimulated by substrates (McLaughlin et al., 2002; Scheibel et al., 1998). Furthermore, it appears that different substrates are affected differently by nucleotide binding, indicating that Hsp90 may possess several distinct substrate binding regions (Scheibel et al., 1998). These findings all point to a very specialized function of the Hsp90 machinery.

The ATPase cycle appears to be well conserved among the different Hsp90s, such as yeast cytosolic Hsp90, its ER homolog Grp94, the mitochondrial homolog TRAP1, and cytosolic human Hsp90 (Frey et al., 2007; Leskovar et al., 2008; Richter et al., 2006; Richter et al., 2008). Upon binding of nucleotide to the N-terminus, an N-terminal loop becomes available, promoting an interaction between the two N-terminal domains of the Hsp90 homodimer. This leads to far- reaching structural changes throughout the chaperone, and ultimately to nucleotide hydrolysis.

As with Hsp70, Hsp90 does not act by itself, but requires a host of co-factors and co-chaperones, including Hsp70/40. Affinity for different substrates may be controlled by different co-factors (Wandinger et al., 2008). Factors modulating / interacting with Hsp90 include, for example,

Hsp70/Hsp90 Organizing Protein (Hop), and carboxy terminus of Hsp70-interacting protein (CHIP). An alternate way to modulate Hsp90 function is its post-translational modifications such as phosphorylation by additional co-factors (Wandinger et al., 2008).

One well studied example for Hsp90 action is the maturation of the oestrogen receptor (OER), a transcription factor (for review see (Whitesell and Lindquist, 2005)). In this case the nascent polypeptide of the receptor folds, exposing the hydrophobic binding pocket designated for oestrogen. This makes it a substrate for Hsp70/40. This OER/Hsp70/Hsp40 complex is then shuttled to the Hsp90 chaperone, with HIP mediating the interaction between these chaperone systems. This leads to the transfer of the substrate receptor to Hsp90, and the release of the Hsp70 system. Hsp90 then forms the ATP-dependent ―mature complex‖, which also involves additional co-factors. In this complex, the oestrogen receptor binding pocket is opened up, making it able to accommodate its ligand. If a ligand is subsequently bound, this leads to receptor activation as well as structural changes. This then enables its release from the chaperone and subsequent transport into the nucleus. This case highlights the special role of Hsp90 in cell signaling. Interestingly, despite the specificity of its substrates, very little is known about the substrate binding regions of Hsp90 or how it recognizes its substrates.

1.4.5 Summary

The focus of this section was to show examples of the basic chaperone classes. For all chaperones, the initial step of substrate recognition also represents a crucial element in our understanding of these unique folding helpers. Substrates can often be identified by generic hydrophobic features, while certain adaptor proteins may help a chaperone to recognize an even larger variety of substrates. Once substrates are recognized, they are usually bound in a controlled manner, thereby preventing aggregation and in some cases promoting folding. Another important feature of chaperones is the subsequent orchestrated and efficient release of the substrate. This may require the action of additional co-factors, as is the case for sHsp and for Hsp70. It is important to note that while each chaperone systems was introduced separately in this section, many of these chaperone systems have significant interactions with each other, shuffling substrates between each set of folding helpers.

1.5 Hsp104: a protein disaggregase

As previously discussed, a chaperone’s ability to recognize and interact with its substrate is pivotal for its role in the cellular metabolism. Chaperones such as Hsp60 and Hsp70 have the ability to recognize substrates themselves, with co-factors further enhancing and diversifying substrate recognition. For Hsp104, both direct substrate interaction and interaction via the Hsp70/40 chaperone system have been described (Bosl et al., 2005; Doyle et al., 2007b; Kedzierska et al., 2005; Lum et al., 2008; Shorter and Lindquist, 2004; Sielaff and Tsai, 2010). Hsp104 belongs to the class of AAA+ (ATPases Associated with diverse cellular Activities) proteins and can be further specified as belonging to the Clp/Hsp100 sub-family of proteins. This section seeks to introduce this quite diverse family of chaperones, and highlight similarities to emphasize mechanistic and structural conservation that allows insights from one family member to be applied to the other. Hsp104 structural features will be discussed, followed by Hsp104 in vivo function; this section further includes a discussion of the proposed mechanism of Hsp104 action. Finally, the intriguing subject of substrate recognition will be highlighted.

1.5.1 Hsp100/Clp are part of the AAA+ superfamily, diverse in biological function relying on similar molecular mechanisms

The AAA+ superfamily was first described as a group of various proteins that contain a Walker A and B motif, which are required for nucleotide binding within a AAA+ cassette (Erdmann et al., 1991; Kunau et al., 1993). These AAA+ cassettes are found in many distinct proteins that have enormous functional diversity. The cassettes show significant sequence similarity beyond the conserved Walker motif (Figure 3A,B) (Beyer, 1997; Kunau et al., 1993). The Walker motif is required for ATP binding and hydrolysis and comprises two conserved sequences, Walker A and B. The Walker A motif is required for coordination of the nucleotide phosphate group. The Walker B motif contains the catalytic glutamic acid residue essential for nucleotide hydrolysis (Saraste et al., 1990; Stratford et al., 2007). The Hsp100/Clp group of proteins is a subfamily within the AAA+ superfamily, as the AAA+ cassettes are highly conserved within this classification (Gottesman et al., 1990). This subfamily includes the protease-associated ClpA, ClpX and HslU, as well as the chaperones ClpB in E. coli and Hsp104 in S. cerevisiae. The Hsp100/Clp family can be divided into two classes (Figure 3A). Class 1 includes proteins that

26 contain two AAA+ domains that are separated by a linker domain. Further subgrouping within the class 1 category is determined by the linker region, which can be short as in the case of ClpA, or rather extended as in the case of Hsp104 or ClpB (for review see (Schirmer et al., 1996)). Class 2 refers to proteins with a single AAA+ domain, and includes ClpX and HslU. Both Class 1 and 2 proteins have a similar nucleotide-dependent tendency to form ring shaped oligomers (for review see (Mogk et al., 2008; Schirmer et al., 1996)). ClpX and ClpA are required for successful proteolytic activity by ClpP, but neither ClpX nor ClpA have any proteolytic activity by themselves. If purified and assembled in the absence of ClpP, these chaperones exhibit protein remodeling functions similar to Hsp104 or ClpB (Mogk et al., 2008; Schirmer et al., 1996). However, in ClpB mutants that are able to interact with ClpP, its remodeling function is suppressed and the ClpB/ClpP complex becomes an efficient protease (Weibezahn et al., 2004b). The same was observed for Hsp104 mutants that were modified to interact with ClpP (Tessarz et al., 2008). Conserved central loops or diaphragms that protrude into the axial channel have been shown to be of functional significance for several members of the Hsp100/Clp family (Figure 3B) (Mogk et al., 2008). These observations support the hypothesis that these ring-shaped oligomers (Figure 3 D) share the same mechanism to effect substrate remodeling, and that this mechanism is conserved within all members of this subfamily (Mogk et al., 2008). In addition to functional conservation, there seems to be significant structural conservation as well, which has been used to apply known structural features from one member of the Clp/Hsp104 family to another, especially in the case of ClpB which has a known crystal structure and Hsp104 where only EM-structures are available (Lee et al., 2007; Lee et al., 2010; Lee et al., 2003; Wendler et al., 2007).

1.5.2 Hsp104 structure and molecular mechanism

A structural understanding of Hsp104 is helpful to better appreciate this protein’s reaction mechanism as well as its ATPase cycle. Thus structural data of this molecular motor will be discussed in the subsequent chapter. Unfortunately, to date no crystal structure of Hsp104 has been solved, and with its 100kDa mass it is not suitable for NMR. The only direct structural information available comes from electron microscopy (EM) with limited resolution (Lee et al., 2010; Parsell et al., 1994a; Wendler et al., 2007). However, different nucleotide bound states were visualized using EM, and crystal structures for other related proteins such as ClpB, ClpX and HslU are available (Bochtler et al., 2000; Glynn et al., 2009; Lee et al., 2007). Together

27 these data significantly enhance our understanding of a likely action mechanism of this molecular machine.

Hsp104 can be divided into several modules or domains: the N-terminal domain, the first AAA+ module, the middle (M) domain, and the C-terminal AAA+ module (for review (Haslberger et al., 2010)). Both AAA+ modules contain their respective nucleotide binding domains (NBDS), with the first AAA+ module containing NBD1, and the second AAA+ module containing NBD2. Both AAA+ modules also contain a ―small domain‖ at their respective C-termini. Inserted into the AAA+ small domain is the coiled coil domain (CCD). This domain is -helical and plays a central role in the function of Hsp104/ClpB (for review see (Haslberger et al., 2010)). The second AAA+ module contains a C-terminal small domain. S. cerevisiae Hsp104 contains an additional C-terminal extension, following the C-terminal small domain of the second AAA+ module (Mackay et al., 2008) (Figure 3A).

Based on EM images of Hsp104, together with crystallographic data from ClpB, both NBD1 and NBD2 appear to form globular domains that are stacked on top of each other (Lee et al., 2010; Lee et al., 2003). While there is some debate about the location of the M-domain within this complex, a wealth of biochemical as well as structural data suggests that the M-domain protrudes outwards of the hexameric complex (Haslberger et al., 2007; Lee et al., 2010; Lee et al., 2003). The N-terminal domain is located on top of NBD1, also forming a globular domain (Lee et al., 2010). Interestingly, a so-called sensor 2 motif ―arginine finger‖ found in both NBDs, required for ATP binding, is involved in Hsp104 intra-molecular interaction; two neighboring Hsp104 monomers within the complex are required to complete the binding pocket, with one subunit donating its ―arginine finger" to its neighboring subunit (Lee et al., 2003) (Figure 3C). This is in agreement with biochemical data that suggests that oligomerisation is crucial for ATP hydrolysis (Hattendorf and Lindquist, 2002b; Schirmer et al., 1998).

A current model of Clp/Hsp104 protein action postulates that substrates are ―threaded‖ through the central pore in an ATP-dependent manner (for review see (Haslberger et al., 2010)). To establish this model, it was first shown that substrates were indeed passing through the central pore (Tessarz et al., 2008; Weibezahn et al., 2004b). In these studies both ClpB and Hsp104 were modified such that they were able to interact with the protease ClpP. The proteolytic center of ClpP is only accessible through a narrow pore. Usually ClpA or ClpX form a stable ring shaped

28 complex on top of the ClpP, ―gating‖ the pore opening and guiding substrates through this channel of ClpP to effect protein degradation (Gottesman et al., 1998; Grimaud et al., 1998; Hoskins et al., 1998; Singh et al., 2000; Wang et al., 1997, 1998). When ClpB and Hsp104 were fused to ClpP, these protein remodeling factors enabled proteolysis similar to ClpX and ClpA (Tessarz et al., 2008; Weibezahn et al., 2004b). As it is likely that ClpB and Hsp104 would interact with ClpP in a similar fashion as ClpX and ClpA, it suggests that Hsp104 and ClpB are able to thread substrates through their central channel, thereby suggesting that this is the likely mode of action also employed for the usual protein desegregation / remodeling function of ClpB and Hsp104.

This idea of passing substrate through the axial channel of Hsp104 is further supported by data that show that the conserved loops protruding into the central pore are crucial for Hsp104 function (Lum et al., 2004). Data from ClpX also showed that the conserved loops are important for function (Martin et al., 2008). In the case of ClpB, it was shown via crosslinking that the central loops directly interact with substrates (Schlieker et al., 2004). Hence it is very likely that these loops directly interact with substrate and that this substrate-loop interaction is important for the function of the Clp/Hsp100 proteins including Hsp104.

While data supports the premise that the central conserved loops are important for the function of Hsp104 and that threading through the central channel is the likely mode of action, the mechanism by which substrates are threaded remains to be elucidated. One observation is that the central pore of ClpB has a significant difference in its diameter based on its nucleotide bound state (Lee et al., 2007); data suggests that the ADP-bound state has a smaller pore size than the ATP-bound state (Figure 3E). This change is diameter is likely controlled by overall domain movements of ClpB including the central loops. This suggests that the loops could form some kind of ―diaphragm‖ that could control the width of the axial channel in a nucleotide dependent manner (Hinnerwisch et al., 2005; Lum et al., 2004; Martin et al., 2008). Movement of the first loop in NBD1 was observed by the change in fluorescence of Hsp104 (Lum et al., 2004). In the case of ClpX, structural data also indicates that the loops differ in backbone orientation depending on the nucleotide bound (Glynn et al., 2009) (Figure 3F). Taken together, this data supports the ―threading model‖ by which substrate is threaded through the central pore of Hsp104, and that the threading action is dependent on the central loops’ ability to interact with the substrate and then move it in a nucleotide dependent manner.

Both biochemical as well as structural data suggest that ATP binding as well as hydrolysis is orchestrated in a cooperative cycle within the Hsp104 oligomer (Figure 4A) (Bosl et al., 2005; Cashikar et al., 2002; Lum et al., 2008; Schirmer et al., 2001). Initially, the ATP-Hsp104 is in a high affinity state towards a polypeptide substrate. The Hsp104-ADP complex exhibits a markedly lower affinity towards a polypeptide substrate. In either ATP- or ADP- bound forms, however, the overall nucleotide exchange rate is high in the absence of polypeptide substrate bound to Hsp104 (Bosl et al., 2005). Upon substrate interaction, the nucleotide exchange rate with the Hsp104-ATP complex is reduced, presumably stabilizing the Hsp104-ATP-substrate complex (Bosl et al., 2005). Polypeptide substrate binding to Hsp104 also changes nucleotide affinity substantially both at NBD1 and NBD2. For example, while Hsp104’s NBD1 affinity towards ATP in the absence of polypeptide substrate is 170 M, upon peptide binding this is reduced by half to 84 M (Lum et al., 2008). Hydrolysis of ATP leads to structural rearrangements that lead to substrate translocation through the axial channel (Figure 4B) (Lee et al., 2007; Lee et al., 2010). It has been shown that the nucleotide state in NBD affects the hydrolysis activity of the other NBD. Hence after the initial binding of substrate to Hsp104, ATP hydrolysis in NBD2 is stimulated (Lum et al., 2008). The resulting NBD2-ADP state in turn stimulates ATP hydrolysis in NBD1 (Hattendorf and Lindquist, 2002b). This cycle of ATP hydrolysis then leads to the processing of the polypeptide through the central pore (Lum et al., 2008).

The model of substrate ―threading‖ is based on biochemical data (see below) as well as structural data from homologues such as ClpB, all centered around the rather narrow axial channel (Lee et al., 2003). However, alternate views also exist, based on cryo-EM structures of Hsp104, where instead of a narrow axial channel, Hsp104 would harbor a rather spacious internal cavity (Figure 4C) (Wendler et al., 2007). This data is intriguing as it would suggest that Hsp104 has a completely different fold and potential reaction mechanism compared to other known Clp/Hsp100 members such as HslU, ClpX and ClpB (Glynn et al., 2009; Lee et al., 2003; Sousa et al., 2000). That the idea of Hsp104 having a central cavity rather than the usually proposed axial channel is controversial is further highlighted by recent work that also uses cryo-EM data but proposes an Hsp104 model with a narrow axial channel (Lee et al., 2010) (Figure 4D).

Another difficulty associated with the idea of Hsp104 having a central cavity is the debated location of the coiled coil domain (CCD). Studies have shown that the CCD is important for

Hsp70 interaction with Hsp104 (Sielaff and Tsai, 2010). The Hsp104 central cavity model places the coiled coil domain within the Hsp104 oligomer, hence it would be inaccessible to the environment. Hence it becomes difficult to envision how the Hsp70 machinery would be able to interact with Hsp104 via its coiled coil domain. On the other hand, as the Hsp104 coiled coil domain seems flexible, no electron density was obtained by others, making it hard to precisely locate this domain (Figure 4D) (Lee et al., 2010). However, Lee et al. introduced a small globular protein (lysozyme) within the Hsp104 coiled coil domain and were able to visualize the new globular domain on the outside of Hsp104. As the Hsp104 chimera is functional, this suggests that the lysozyme insertion itself does not perturb the normal fold of Hsp104 and therefore advocates that the coiled coil domain indeed extends to the outside of the Hsp104 hexameric complex (Figure 4E) (Lee et al., 2010).

Other challenges with the Wendler model concern the inability to fit the conserved sensor ―arginine fingers‖ into any NBD site. At the current time it remains unclear which model is most accurate, although the model proposed by Lee et al. (Lee et al., 2010) seems to fit better overall with the available biochemical data for Hsp104 and structures solved for other homologous proteins such as HslU, ClpB and ClpX (Bochtler et al., 2000; Glynn et al., 2009; Lee et al., 2007).

1.5.3 Hsp104 characterization in vivo and in vitro

Saccharomyces cerevisiae cells that are exposed to a sudden increase in temperature to 50˚C die off rapidly; however, if the same cells are subjected to a pre-heat treatment at 37˚C and then shifted to 50˚C, their survival drastically increases. This enhanced cell survival is termed ―thermotolerance‖ (McAlister and Finkelstein, 1980). The improved survival is presumably due to the expression of thermotolerance factors such as the heat shock proteins (Hsps). One of the most dominant factors associated with this thermal resistance is Hsp104, as cells lacking this gene have a drastically reduced ability to withstand induced heat stress (Sanchez and Lindquist, 1990). Overexpression of Hsp104 via an inducible promoter is sufficient to induce significant thermotolerance without enhanced expression of additional factors (Lindquist and Kim, 1996). Expression of Hsp104 is stress induced and not limited to heat stress alone; ethanol treatment leads to Hsp104 induction, as well as growth on acetate or galactose carbon sources, which lead to a high respiratory metabolism (Sanchez et al., 1992). As such, Hsp104 expression is also

31 induced in stationary cells, which explains their enhanced resistance to heat stress compared to exponentially growing cells.

The mechanism by which Hsp104 is able to mediate thermotolerance is distinct from other chaperones. Hsp104 overexpression does not prevent the model substrate luciferase form forming aggregates in vivo, which are visible as electron dense patches in electron microscope images (Parsell et al., 1994b). Instead, Hsp104 enables the reactivation of these aggregated proteins. This Hsp104-dependent process results in the resolubilization and enzymatic reactivation of firefly luciferase, as well as the disappearance of the cellular aggregates (Parsell et al., 1994b). These observations were later corroborated in vitro, since denatured firefly luciferase could be refolded using purified Hsp104 together with Hsp70 and Hsp40 (Glover and Lindquist, 1998). These data together demonstrate that Hsp104 is a protein disaggregase or protein remodeling factor.

Purified Hsp104 assembles into hexameric, ring shaped oligomers that have a small central pore (Parsell et al., 1994a). Similar structures were observed for ClpB, ClpA and other Hsp100/Clp proteins (Effantin et al., 2010; Lee et al., 2003), (for review see (Mogk et al., 2008)). Hexamerisation is mainly controlled by the C-terminal NBD2 of Hsp104. Mutations like K620T, which eliminate ATP binding to NBD2, result in a severe assembly defect (Parsell et al., 1994a). This shows that nucleotide binding is a likely requirement for the hexamer formation of Hsp104. The K620T mutation also affects overall ATPase activity, reducing it to 10% of the WT level (Schirmer et al., 1998). The oligomerisation defect caused by K620T can be partially overcome at enhanced protein concentrations, which also leads to a significant increase in ATPase activity (Schirmer et al., 2001). By contrast, mutations that prevent ATP binding in NBD1, like K218T, affect oligomerisation minimally but virtually eliminate ATP hydrolysis (Parsell et al., 1994a; Schirmer et al., 1998). Unlike the K620T mutant, increasing protein concentration does not restore ATPase activity. These data clearly indicate that the two NBD’s have distinct functions in the oligomeric complex.

Environmental conditions also affect the oligomerisation status of Hsp104. Increasing salt concentration from 10 mM to 200 mM leads from a fully assembled to a virtually unassembled Hsp104 (Hattendorf and Lindquist, 2002b). Increasing salt concentrations in a similar range also has a profound negative effect on ATP hydrolysis (Schirmer et al., 1998). Similar observations

32 were made using the zwitterionic detergent CHAPS (3-[(3-Cholamidopropyl) dimethylammonio]-1-propanesulfonate). The detergent disturbed Hsp104 oligomer formation at 10 mM concentration, which also resulted in an approximately 5-fold reduction in ATP hydrolysis (Schirmer et al., 2001). These data indicate that the ability to assemble into an oligomeric complex is crucial for ATP hydrolysis, and therefore probably also for the biological function of Hsp104. Co-expression of WT Hsp104 with the ATPase deficient K218T/A315T mutant leads to loss of thermotolerance in S. cerevisiae (Schirmer et al., 2001), further supporting the idea that the biological function of Hsp104 requires an assembled and functional Hsp104 oligomer. An additional factor that has a negative effect on Hsp104 function is guanidinium hydrochloride. This chaotropic salt can be added to Hsp104 at 5 mM concentration, which is not high enough to perturb Hsp104 structure, yet completely suppresses ATP hydrolysis (Grimminger et al., 2004).

To further support the notion that Hsp104 hexamer assembly is required comes from an in vivo screen for Hsp104 molecules that are unable to interact with denatured proteins (Tkach and Glover, 2004). In this screen, Hsp104 mutants that were unable to interact with substrate in vivo also failed to assemble in vitro. This suggests that substrate interaction with Hsp104 requires the assembled complex; hence inhibition of complex formation also interferes with substrate recognition (Tkach and Glover, 2004). This again highlights the importance of hexamer formation for Hsp104 function.

As previously described, Hsp104 contains two nucleotide binding domains (NBD). Within these domains, the conserved Walker A motif required for ATP binding was identified. Based on sequence homology, mutations were introduced in the Walker A motif which were likely to interfere with ATP binding. The resulting Hsp104 K218T and K620T mutants were indeed devoid of thermotolerance and ATPase activity (Parsell et al., 1991; Schirmer et al., 1998). This data supports the idea that ATP hydrolysis is crucial for Hsp104 activity. In agreement with these findings, mutations in the sensor 1 motif of both NBD1 and 2 (T317A, N728A) resulted in an ATP hydrolysis defect which also eliminated thermotolerance (Hattendorf and Lindquist, 2002b). Similar results were obtained for mutations in the ―arginine finger‖, a conserved arginine in the sensor 2 motif required for efficient ATP binding (Figure 3C) (Hattendorf and Lindquist, 2002a).

The Walker B motif is required for the hydrolysis of ATP by Hsp104 as well as ClpB (Bosl et al., 2005; Lum et al., 2008; Weibezahn et al., 2003). These mutants are able to bind ATP yet are unable to hydrolyze it; thus, they can form so called ―TRAP‖ molecules in which the high affinity state of the chaperones is indefinitely preserved and thus allows the stable formation of the chaperone-ATP-substrate complexes (Bosl et al., 2005; Lum et al., 2008). These mutations have also been useful for structural studies as they ensure the formation of a stable hexameric complex of Hsp104 or ClpB rather than the likely very dynamic and hence short lived WT hexamer (Lee et al., 2010; Weibezahn et al., 2003; Werbeck et al., 2008). Important mutations including the Walker A and B mutants and their respective consequences are summarized in table 1.

G215V NBD1 Significantly reduced (Parsell et al., 1991) thermotolerance G217V NBD1 Measurable ATPase activity but (Schirmer et al., 1998), significantly reduced (Schirmer et al., 2001) K218T NBD1 Measurable ATPase activity but (Parsell et al., 1991) significantly reduced, remains oligomerization competent G617V NBD 2 Significantly reduced (Parsell et al., 1991) thermotolerance G619V NBD2 Oligomerization defect. ATPase (Schirmer et al., 1998), activity enhanced at high protein (Schirmer et al., 2001) concentrations K620T NBD2 Defect in oligomerization and in (Parsell et al., 1991), ATPase activity. ATPase activity (Schirmer et al., 2001) enhanced at high protein concentrations

E285Q NBD1, Walker B ATP binding, but not hydrolysis (Bosl et al., 2005) E687Q NBD2, Walker B ATP binding, but not hydrolysis (Bosl et al., 2005) E285A NBD1, Walker B ATP binding, but not hydrolysis (Lum et al., 2008) E687A NBD2, Walker B ATP binding, but not hydrolysis (Lum et al., 2008)

T317A Sensor 1 motif NBD1 10x reduced ATPase in NBD1, (Hattendorf and Lindquist, NBD2 slightly increased 2002b) N728A Sensor 1 motif NBD2 Eliminates ATP hydrolysis in (Hattendorf and Lindquist, NBD2, reduces it in NBD1 2002b) R826M Conserved arginine in Reduces affinity to ADP/ATP in (Hattendorf and Lindquist, Sensor 2 motif of NBD2 equally, reduces ATP 2002a) Hsp104 hydrolysis in NBD1.

Y257A Diaphragm NBD1 Reduces thermotolerance 10x (Lum et al., 2004) relative to WT Hsp104 Y662A/K Diaphragm NBD2 Abolishes thermotolerance and in (Lum et al., 2004) (conserved motif vitro refolding GYVG) E645K Axial channel Abolishes thermotolerance and in (Lum et al., 2004) vitro refolding

Del DDLD 4 C-terminal residues in No effect on thermotolerance (Mackay et al., 2008) Hsp104 extension tail Del 38 Entire 38 amino acid C- Oligomerization defect (Mackay et al., 2008) terminal extension Low ATPase activity

S745P, F772S, C-terminal small domain No oligomerization (Tkach and Glover, 2004) E774Term K747R, L814S, L840Q, C-terminal small domain No oligomerization (Tkach and Glover, 2004) E878G I722T, F772S, K774E, C-terminal small domain No oligomerization (Tkach and Glover, 2004) L775P, L845I

Y819W Second AAA domain Probe changes fluorescence (Hattendorf and Lindquist, depending on ADP/ATP binding 2002a)

Table 1: Hsp104 mutations and their consequences

Figure 3: Hsp100/Clp protein overview.

A. Hsp100/Clp proteins can be categorized based on the number of their AAA domains. Class 1 molecules have two AAA+ domains that can be separated via spacer or a coiled coil domain (CCD). The latter is observed in ClpB and Hsp104. Class 2 molecules contain only one AAA+ domain. B. Sequence alignment of various AAA+ proteins. For Class 1: ClpB from E. coli & T. thermophilus (T.Therm), ClpA from E. coli, Hsp104 from S. cerevisiae (S.Ser) and VCP/p97 from H. sapiens (H.Sap). For Class 2: E. coli ClpX and E. coli HsiU. The conserved Walker A and B motifs critical for ATP binding and hydrolysis are highlighted in gray, as is the diaphragm proposed to be crucial for threading functionality. C. The displayed molecule shows the structure of the Walker A (turquoise) motif and the Walker B (dark blue) motif accommodating ADP. The ―arginine finger‖ (green) from the neighbouring subunit contacts the nucleotide, and is likely to transmit the nucleotide bound state to the neighbouring subunit. D. Electron microscopy images of HslU, ClpB and Hsp104 (Lee et al., 2007; Parsell et al., 1994a; Rohrwild et al., 1997) demonstrating an overall similar architecture. The three-fold symmetry as well as the central pore hallmarks of these Hsp100/Clp proteins can be seen. E. Surface representation of the crystallographic structure of HslU in the ADP-bound (PDBID: 1G4A) as well as the ATP-bound (PDBID: 1G3I) state. In the ATP-bound state, the GYVG motif, extruding into the central channel, is not resolved presumably due to flexibility of the loop region. The central pore has a markedly different diameter; however, as the central loops are not resolved in the ATP-bound structure, the change in pore diameter is not determined. F. The pore residues extruding into the central pore are overlaid (RMSD 3.3Å). The ADP-bound structure (green) shows a different backbone orientation from the ATP-bound (red) structure. Arrows indicate the change in backbone orientation at the highlighted residues (purple-ATP and light green-ADP). The pore

37 position of these residues is in agreement with biochemical data that suggest an important role in the Hsp100/Clp threading mechanism. These data suggest that these loops are flexible and that their movement may propel the threading of substrates.

Figure 4: Hsp104 model and structure

A. Top view of a schematic representation of the hexameric orientation proposed for Hsp104. Each blue circle represents one subunit and the brown hexagons extending into the central core represent the pore loops proposed to be important for the threading model of hsp104. These pore loops form the diaphragm. B. Schematic representation of the proposed threading model of Hsp104. (I) Protein aggregates are bound by Hsp104. (II) Due to ATP hydrolysis and pore loop movement the peptide is extracted from the aggregated. (III) threading of the peptide is complete and it is released. C. Represents the cryo-EM model taken from (Wendler et al., 2007), Reprinted with the permission of Elsevier. This model shows an unconventional large central cavity of Hsp104. D. For comparison the cryo-EM reconstruction taken from (Lee et al., 2010)). Showing Hsp104 in a more classic narrow channel model. On top a non-crosslinked structure is compared to a crosslinked structure. Neither strutcure shows any density for the M domain that is proposed to protrude away from the hexamer E. Cryo-EM image from (Lee et al., 2010)) with the Hsp104 protein model into the electron density map. (Left) The M domains are extended from the central structure and accessible. (Right) Visualization of the central channel highlighting the central pore loops that extend into the channel forming the diaphragm 1 (D1-pore loop) (NBD1) and diaphragm 2 (D2-pore loop) (NBD2). Both figures D and E are copyright of PNAS and reprinted with their permission.

1.5.4 Substrate interaction

As discussed earlier, substrate recognition and interaction between a chaperone and its substrate is of pivotal importance to initiate remodeling activity. In the case of Hsp104, the nature of substrate recognition is being intensely studied.

Recent data has shown that Hsp70/ 40 are likely acting upstream of Hsp104, making aggregates competent for the disaggregation action of Hsp104 (Kedzierska et al., 2005; Zietkiewicz et al., 2004). Studies on ClpB have shown that the coiled coil domain (CCD) plays a crucial part in the coordination between the Hsp70/40 system and ClpB. (Haslberger et al., 2007). It is known that the synergistic coordination between ClpB and the bacterial Hsp70/40 is species specific, and would not work if ClpB was substituted with Hsp104 (Glover and Lindquist, 1998; Miot et al., 2011). However, if the Hsp104 CCD is substituted with the ClpB CCD, the resulting Hsp104ClpB- CCD mutant gains the ability to interact with the bacterial Hsp70/40 chaperones but is no longer able to interact with the yeast equivalents (Sielaff and Tsai, 2010). These data highlight the importance of the Hsp104/ClpB coiled coil domain for the interaction with Hsp70/40 and that this interaction is crucial for Hsp104/ClpB to act on aggregated proteins.

However interaction with substrate itself is CCD independent, as deletion variants of Hsp104 lacking the CCD are able to interact with model substrates (Sielaff and Tsai, 2010). For ClpB it was shown that mutations in the M-domain obliterated disaggregation ability, without affecting the ability of ClpB to interact with or translocate unfolded but non-aggregated model substrates (Haslberger et al., 2007). In fact it was shown that what was perturbed was the coupling of the Hsp70/40 system with ClpB (Haslberger et al., 2007). This suggests that Hsp104 interaction with substrate is not strictly Hsp70/40 dependent; however the Hsp70 chaperone network is required to effect efficient disaggregation. The precise mechanism by which this is done remains elusive, as Hsp104 mutants were engineered that had T4 Lysozyme introduced into their CCD and gained the ability to disaggregate a variety of substrates in the absence of Hsp70/40 (Sielaff and Tsai, 2010). This shows that Hsp104 is able to directly identify and interact with its substrates, and further complicates our understanding of the Hsp70/40 role in this process.

The observation that Hsp104 directly identifies and interacts with substrates has also been shown with several other model substrates (Bosl et al., 2005; Doyle et al., 2007a; Doyle et al., 2007b; Lum et al., 2008; Shorter and Lindquist, 2004). For example, a model substrate, reduced

41 carboxymethylated lactalbumin (RCMLa), which forms an unfolded yet aggregation resistant polypeptide, was shown to directly interact with Hsp104 (Bosl et al., 2005). Others have used peptide arrays and subsequently soluble peptides which also showed direct binding to Hsp104 (Lum et al., 2008). That this binding is likely to be of functional relevance was demonstrated when these peptides were fused to the model substrate firefly luciferase. Peptides that previously showed binding to Hsp104 also enhanced the refolding rate of the binding peptide-luciferase mutant, while inert peptides did not (Lum et al., 2008). The ability of Hsp104 to do this is further suggested by experiments in which Hsp70/40 was omitted, but ATP together with its non- hydrolysable ATP analogue ATP--S was added (Doyle et al., 2007b). Under these conditions, Hsp104 was able to show protein disaggregation action for certain substrates. It’s possible that the asymmetric deceleration of ATP hydrolysis mimics the usually required regulation function of the Hsp104 co chaperones.

Taken together these data point to a crucial role of the Hsp70/40 system in the disaggregation action of Hsp104. Potentially, the Hsp70/40 chaperones assist in both activating aggregated substrates for Hsp104 as well as controlling the ATPase cycle of Hsp104. Hsp104 itself is able to recognize and interact directly with several different substrates; however, this does not exclude the possibility that the Hsp70/40 system may assist in the recognition of certain substrates.

Direct substrate interaction and recognition by Hsp104 has been very elusive and difficult to study. Aggregated proteins such as luciferase, green fluorescence protein (GFP) or malate dehydrogenase (MDH) are commonly used as substrates (Doyle et al., 2007a; Glover and Lindquist, 1998; Hoskins et al., 2009). As discussed previously, aggregate is an umbrella term that describes a wide variety of possible protein conformations with poorly defined biochemical characteristics. As this results in an ever-changing pool of substrate conformations, these substrates are poorly suited to study specifics of Hsp104-substrate recognition. The model RCMLa can be used instead, as it does not form aggregates, yet is an Hsp104 substrate (Bosl et al., 2005). As the RCMLa model substrate remains in solution and thus has known properties, it was successfully used to determine the detailed role of the ATP/ADP Hsp104 complex in substrate binding (Bosl et al., 2005). Identification of recognition motifs or sequence features that are preferentially recognized were successfully identified for ClpB using peptide arrays, with -galactosidase as model substrate (Schlieker et al., 2004). A similar technique was used for Hsp104, where the sequences of a variety of proteins were probed for recognition by Hsp104

(Lum et al., 2008). These studies were able to identify that Hsp104 preferentially recognizes aromatic residues such as phenylalanine and tyrosine.

The ability of Hsp104 to recognize specific sequence features has been demonstrated. However, these experiments were all done using model substrates of no biological significance. Hence the ability to apply the current understanding of Hsp104-substrate binding on a biologically relevant system has yet to be demonstrated. This thesis addresses this knowledge gap by using the S. cerevisiae Sup35, a known in vivo substrate of Hsp104 (Lindquist et al., 1995; Schirmer and Lindquist, 1997) as model substrate to identify, characterize and demonstrate the significance of such potential interaction sites.

1.6 Sup35 translation termination factor and “psi” factor

Sup35 is an essential S. cerevisiae protein required for translation termination (Stansfield et al., 1995; Ter-Avanesyan et al., 1993). Sup35 is the yeast version of the eRF-3 (Eukaryotic Release Factor 3). It can be divided into three distinct domains (Kushnirov et al., 1988; Stansfield et al., 1995) (Figure 6B). The well-conserved C-terminal domain of Sup35 is necessary and sufficient to maintain cell viability (Samsonova et al., 1991; Ter-Avanesyan et al., 1993). The N-terminus can be further sub-divided into the extreme N-terminus (1-123) and the middle region (123-253) (Figure 5 and Figure 6) (Ter-Avanesyan et al., 1993). The N-terminal domain and the middle domain (M-domain) differ significantly from each other in their amino acid composition. While the region 1-123 is rich in asparagines and glutamines, the middle region is enriched in charged residues such as lysine, aspartate and glutamate (Kushnirov et al., 1988; Ter-Avanesyan et al., 1993). The general architecture of Sup35, the Q/N rich N-terminal region, the charged M-domain and the conserved C-terminus is present in most fungi sequenced so far; however, there are substantial differences within their primary sequences (Figure 5 and Figure 6). In Sup35, the N- domain is divided into the first 40 residue ―core‖ sequence, followed by the Q/N rich repeat region (40-123). The initial core sequence is still Q/N rich; however, the core sequence does not contain any repeat sequences. The M-domain is then further divided into the initial basic region 123-171 and the more acidic region 171-253. Other fungal Sup35 proteins have N-termini with various lengths, but are generally rich in Q/N; one exception is Pneumocystis carinii where the N-terminus is not Q/N rich and is more similar to the middle domain, in that it is enriched in charged residues. The imperfect repeats found in Sup35 (PQGGYQQYN) (Liu and Lindquist,

1999) are unique to S. cerevisiae; other fungi eRF3s may also contain repeats of their own, but they are distinct in sequence from Sup35 (Figure 5B). The middle domain in fungi eRF3s seems to generally contain a first more basic region, enriched in lysine, and a second more acidic region with a larger proportion of aspartic and glutamic acid (Figure 6A). Interestingly, mammalian eRF3s do not have a Q/N rich N-terminal region, but contain a relatively well conserved N- terminus that is distinct from both the N and M-domain of fungi (Ter-Avanesyan et al., 1993).

In its biological context, full-length Sup35 interacts together with Sup45 to effect translation termination at the ribosome (Stansfield et al., 1995). Sup45 directly interacts with the mRNA stop codon within the ribosome A site. The Sup35/Sup45 complex then induces the hydrolysis of the nascent polypeptide chain and thus its subsequent release from the ribosome (for review see: (Inge-Vechtomov et al., 2003)) (Figure 9). At the same time Sup35 is required for the formation of the so called ―psi-factor‖, inheritable trait in S.cerevisiae. This factor and its relationship with Sup35 is described in the following segment.

The ―psi-factor‖ was found during research in which yeast strains were subjected to random mutagenesis; some resultant yeast strains were able to suppress a stop codon mutation within the

Ade2 gene. The Ade2 gene encodes an enzyme which is essential for adenine biosynthesis; however, once the stop codon is inserted no functional gene product can be produced. The mutant gene is known as ade2-1.

However, some yeast strains retained or developed the ability to grow without adenine, despite having this stop codon mutation (Cox, 1965). Interestingly, among the suppressor strains were a few that showed unusual behaviors. Their suppressor ability was not due to secondary mutations and demonstrated a non-Mendelian mode of inheritance; hence a novel ―suppressor factor‖ was postulated (Cox, 1965). For example, a diploid yeast cell that originates from mating of two yeast strains, where one of which contains the suppressor while the other does not, should consequently form a diploid cell that is expected to be heterozygotic with respect to the suppressor. If these yeast cells are then induced to sporulate, entering meiosis to form four new haploid yeast spores or tetrads, the resulting four yeast cells should consist of two that contain

the suppressor factor and two that do not. This would be expected if the suppressor factor was chromosomally encoded. However, all four tetrads contained the suppressor (Cox, 1965). Intriguingly, the suppressor was not limited to the ade2-1 gene or its particular stop codon (ochre UAA), but also affected stop codon mutations in different metabolic genes, for example in the histidine (his 3-11 opal stop codon UGA) or lysine (lys2-8 amber stop codon UAG) synthesis pathway (Cox, 1965). Due to this generic suppression ability, the term ―super suppressor‖ was coined.

The properties of this heritable factor that distinguished it from conventional alleles prompted the introduction of a new convention. The heritable element associated with the ―psi‖ factor was designated [PSI+], and the alternative, no suppressor element, was called [psi-].

On rich media, yeast strains with the ade2-1 mutation appeared white if they are [PSI+], and red if they are [psi-] (for review see (Tuite and Cox, 2003)). The red coloration is due to the accumulation of the red pigment P-ribosylamino imidazole (AIR), an intermediate product in adenine biosynthesis (for review see (Tuite and Cox, 2003)).

Sup35 was proposed to either directly or indirectly be associated with the psi factor, as overexpression of full length protein or its N-terminal (1-253) fragment resulted in the appearance of the psi-factor, and consequently the ability to suppress the ade2-1 stop codon. Expression of the

C-terminal domain alone re-enabled faithful translation termination at the ochre internal termination codon in ade2-1 (Ter-Avanesyan et al., 1993). However, it does so without eliminating the psi-factor within the cells; this means that cells are still [PSI+], but do not demonstrate the usual [PSI+]-associated suppression (Ter-Avanesyan et al., 1993).

1.6.1 Sup35 a yeast prion protein

1.6.1.1 Sup35 protein is the psi factor and an amyloid

The enigma of the psi factor (Cox, 1965) centers around Sup35. [PSI+] spontaneously appears in WT populations at a rate of 1x10-7 to 1x10-6 (Derkatch et al., 1997). This means that one cell out of a million or more will have the psi factor. Based on multiple observations, Wickner and colleagues adopted the prion model to explain and describe the psi factor. The prion model was previously proposed by Prusiner and colleagues for mammalian diseases (Prusiner, 1982; Wickner, 1994). The model proposed by Prusiner hypothesizes that a ―prion protein‖ can exist in two states: the native cellular form and the non-native amyloid form. The amyloid form of the protein then recruits its natively folded counterparts and converts them into the amyloid fold. Providing that these particles are also transmissible between organisms, these amyloids then can be categorized as prions (proteinaceous infectious particles) (Prusiner, 1982). In his work Wickner established basic conventions, based on experimental observations, which characterize a yeast prion. First, the mode of inheritance for prion factors is non-Mendelian, and does not require transfer of chromosomal DNA. Often cytoduction, which leads to a transfer of cytoplasmic material, not chromosomal DNA, is sufficient to transfer the prion factor. Second, although [PSI+] suppression is comparable with a loss-of-function mutation (i.e. cells are no longer able to efficiently effect translation termination), suppression itself requires the expression of an intact gene. This means that functional protein has to be produced for the occurrence of the loss or reduced function phenotype of that protein. [PSI+] is curable (meaning the loss of the inheritable psi factor), for example by growth on 5mM guanidinium hydrochloride. Once cured, however, the psi factor can reappear at the same frequency as they initially occurred. This suggests a dynamic change within a cell population rather than a permanent genetic mutation. Lastly, overexpression of the protein responsible for the prion factor significantly enhances the spontaneous appearance of these prions by 1-2 orders of magnitude (Wickner, 1994).

Based on these criteria, [PSI+] is the result of a yeast prion, the Sup35 prion protein (Derkatch et al., 1997; Wickner, 1994). First, the intact Sup35 gene is required for [PSI+] induction and maintenance (Ter-Avanesyan et al., 1993). Second, over-expression of Sup35 enhances the appearance of [PSI+] (Chernoff et al., 1993). Later it was directly shown that the first NM domain (1-253) was able to induce the suppression phenotype, and that this was not dependent on the C-terminal domain (Derkatch et al., 1997; Li and Lindquist, 2000). Thus, the prion

46 properties are carried by the N-terminal residues (Patino et al., 1996; Ter-Avanesyan et al., 1994). That the psi-factor is the amyloid form of Sup35 was later demonstrated (Glover et al., 1997).

The amino acid composition of the extreme N-terminal region (1-123) of Sup35 is similar to that of another yeast amyloid such as Ure2p. For both Ure2p and Sup35, asparagine and glutamine rich sequences are crucial for amyloid formation. Interestingly, for both Ure2p and Sup35, it has been shown that it is the amino acid composition rather than the sequence that is important for the amyloid properties (Liu et al., 2007; Ross et al., 2004; Ross et al., 2005). This amino acid composition is common to other prion proteins; however, such sequences are not rare among eukaryotic organisms (Michelitsch and Weissman, 2000). While many proteins contain such Q/N rich sequences, few have been found to form prions. Nevertheless, using this sequence-based approach, many more yeast prions have been identified, including the following: HET-S, [Het-s], (Maddelein et al., 2002); Rnq1p, [PIN+] or [RNQ+], (Derkatch et al., 2001); Mca1, [MCA1+], (Nemecek et al., 2009); Swi1, [Swi1+], (Du et al., 2008); Cyc8, [OCT+], (Patel et al., 2009); Mot3, [MOT3+], (Alberti et al., 2009).

Whether prions are an accident of nature and hence a disease, or whether prions are an evolutionary adaptation is still debated (Derkatch et al., 1997; Nakayashiki et al., 2005; Shorter and Lindquist, 2005). However, for the purpose of this thesis, the ability to use one of the best studied yeast amyloids, Sup35, is quite appealing. In the following sections, details of the Sup35 amyloid protein which are important to this thesis will be discussed.

Figure 5: N-Domain alignment The conserved C-terminus of Sup35 was taken to perform a BLAST search against fungal genomes. Hits showing a high degree of conservation were taken for multiple sequence alignment using the ClustalW algorithm. A. Shows a simplified taxonomy of the different species. B. Sequence alignment of the N domain. The highlighted features are specific for Sup35 as general conservation within this region is very low. The composition is generally conserved (rich in Q/N) with the exception of P.carinii. The imperfect repeats found in Sup35 are not present in other fungi. However, other eRF3’s may have their own imperfect repeats with different sequence, and different repeat number.

Figure 6: M-Domain alignment and schematic overview over Sup35 NM domain

As before the conserved C-terminus of Sup35 was taken to perform a BLAST search against fungal genomes. Hits showing a high degree of conservation were taken for multiple sequence alignment using the ClustalW algorithm. A. Sequence alignment of representative yeast M- domain across several species. It can be seen that all sequences are tentatively enriched in more basic residues initially (indicated by blue headline), then the sequences tend to contain relatively more acidic residues (indicated by red headline). Compared to the N-domain, the Q/N composition is markedly lower while there is a much larger composition of polar residues. Sequence conservation remains low while composition seems to be conserved. It is noteworthy that the sequence conservation goes up significantly at the end of the M-domain interfacing with the conserved C-terminal domain. B. Schematic representation of the Sup35 NM-domain. The N-domain (also known as Prion forming domain) can be subdivided into the core residues (1-40) which do not contain repeats and the repeat region (30-123). The M-domain contains the initial basic then acidic region. The remaining C-terminal GTPase domain is highly conserved (Data not shown).

1.6.1.1 Structural features

1.6.1.1.1 Discussion of general features found in amyloids

Amyloids have been observed in a vast variety of different proteins; for example, acylphosphatase from Sulfolobus solfataricus, human superoxide dismutase 1, human transthyretin, human β2-microglobulin, human prion protein or the Alzheimer precursor protein to name a few (for review see: (Chiti and Dobson, 2009)). It has been generally hypothesised that the ability to form amyloids is innate to polypeptides, but may depend on environmental conditions, protein stability and other factors, for example chaperones (for review see: (Chiti and Dobson, 2009; Dobson, 2003)). Thus amyloid structure has been intensely studied, aiming to elucidate how so many different proteins are able to form ordered aggregates.

Figure 7 shows the structure model for the amyloid formed by the Alzheimer precursor protein (A(1-40)) (Luhrs et al., 2005) (PDB: 2BEG). A(1-40) is used as an example for amyloids in general, and while different amyloids are likely to deviate from each other to some degree, the basic principles are believed to be universal (for review see: (Chiti and Dobson, 2009)). Using negative EM staining, amyloids appear as long rods (Figure 7A). This is a generic feature of amyloids; however, different amylogenic proteins may show protein specific varieties from this general rod shaped appearance, such as globular attachments to the central rod, as was observed in full length Sup35 (Glover et al., 1997). At the molecular level, the fiber is built of polpypetide beta sheets that are stacked on top of each other. These beta sheets are perpendicular to the fiber axis. Interestingly, the fiber is stabilized via hydrogen bonding between the backbone amino acids of each polypeptide chain (Figure 7B-C). It may be because of this generic interaction of the backbone that so many different proteins can form amyloids, given the appropriate conditions.

As far as amyloid formation and propagation is concerned, the general principle is that a protein can convert from its soluble state to the amyloid state (for review see: (Chiti and Dobson, 2009)). For some candidate proteins that are natively unfolded, this process is more easily conceivable, since no primary stable tertiary fold has to be overcome to get to the alternate ordered aggregate fold. For folded proteins, it is likely that partially unfolded intermediates, potentially the result of environmental factors such as temperature shift, are the stepping stone that can lead to amyloid conversion (for review see: (Chiti and Dobson, 2009)).

1.6.1.1.2 The Sup35 amyloid

Sup35 has been shown to be an amyloid sharing the key features associated with amyloids, such as sheet core structure, ability to bind dyes such as Congo Red, and formation of rod shaped elongated fibers (Glover et al., 1997). While this gives as a clear idea of the generic structural features of Sup35 amyloids, the detailed structure remains elusive. Using indirect studies testing the accessibility of NM fibers to a fluorescent probe, it became clear that the residues 20 to 60 which are contained within the extreme N-terminal domain of Sup35, also known as PrD (Prion Domain), seem to be the least solvent accessible. The N-domain residues close to the M-domain residues, as well as the M-domain itself, are freely solvent accessible (Krishnan and Lindquist, 2005). Further solvent accessibility data suggests that the less stable 4˚C fibers have a shorter solvent inaccessible core compared to the thermodynamically more stable 25˚C fibers (Krishnan and Lindquist, 2005). This observation would support previous observations that demonstrated the connection between prion strength and thermal stability of its prion particles. This suggests the N-domain to be the likely polypeptide involved in the Sup35 amyloid sheet formation.

Based on circular dichroism (CD), X-Ray diffraction or solid state NMR, the core structure of the fiber was determined to be beta-sheet rich (for reviews see (Liebman, 2005) and (Tycko, 2006)). In these models, hydrogen bonding between the backbone as well as between side chains is crucial for prion stability (Liebman, 2005). While the role of beta-sheets is widely accepted, the exact orientation and organization is unknown for Sup35. While some have proposed a beta- sheet helix core structure for Sup35 amyloids, or a structure that would resemble water-filled nanotubes (Kishimoto et al., 2004; Perutz et al., 2002), other proposals include a tightly packed parallel in-register or anti-parallel structure for the core fiber (Krishnan and Lindquist, 2005; Shewmaker et al., 2006). The tight packing proposed by either model agrees well with the observed thermal stability of prions in SDS (Kryndushkin et al., 2003).

One interesting feature is the ability of Sup35 amyloids to convert other soluble Sup35 protein into the amyloid (Krishnan and Lindquist, 2005). It has been proposed that this is based on the interaction of a soluble Sup35 N-domain, probably resembling something like a natively unfolded protein, with for example a preformed amyloid (Krishnan and Lindquist, 2005). This interaction then allows the soluble N-domain to adapt the amyloid fold and hence integrate into the ordered aggregate (Krishnan and Lindquist, 2005; Scheibel et al., 2004). This would assume

51 that the initial interaction between soluble Sup35 and amyloid form is crucial for a successful conversion to the ordered aggregate state. It is interesting that it has been shown that the first 40 amino acids (core residues of the N-domain) are crucial for this process (Krishnan and Lindquist, 2005). This would also explain why these core residues are crucial to determine the ―species‖ barrier (Hara et al., 2003). Species barrier refers to the observation that Sup35 from different yeasts can form fibers, but cannot necessarily integrate Sup35 proteins from another yeast species (Hara et al., 2003).

Figure 7: Amyloid structural features

Shows the amyloid peptides structure of the A(1-40) Alzheimer precursor protein (LVFFAEDVGSNKGAIIGLMVGGVVIA). A. Negative stain electron microscope image of these peptides taken from (Luhrs et al., 2005); this figure is copyright of PNAS and reprinted with their permission. It shows the fiber-like structure of the peptide amyloid. B. Solid state NMR structure model of the peptide showing the parallel -sheet organization of the amyloid. C. Shows a side view of a ball and stick model on top of a service model of the peptide fiber. It alows to visualize the dense packing of the amyloid. D. Shows two different peptide chains that stack together to form the -sheet running perpendicular to the fiber length. It is interesting that the driving forces for this interaction are backbone interactions. Figures B/C/D were generated from the PDB structure (2BEG) (Luhrs et al., 2005).

1.6.1.2 General features of amyloidogenesis, and specifics to Sup35

While knowing the structural features of amyloids is crucial to understand how so many different proteins are able to form such ordered aggregates, it does not help in the understanding of the process of amyloid formation (amyloidogenesis). One key element in this field of research is the study of amyloidogenesis kinetics. In general amyloid formation is akin to well known nucleated polymerization processes (Figure 8 A). The kinetics of such a polymerization are characterized by an initial ―lag phase‖ during which no polymer is detected. During this lag phase the ―nucleus‖ is formed. Nucleus describes the very first stable polymer unit that then enables rapid polymerization to occur. This then leads to the assembly phase, where monomers are rapidly added to the polymer (for review see (Jarrett and Lansbury, 1993)). The nucleation phase can be eliminated if already preformed polymers are added to a fresh solution. In these ―seeded‖ reactions, assembly commences right away since the need for nuclei formation has been overcome.

The process of nucleated polymerization can follow various different mechanistic paths, some of which will be discussed in the following segment. Using the ―simple‖ non-amyloidogenic nucleation model of actin, these basic principles can be observed (Nishida and Sakai, 1983) (Figure 8 B). The reaction initially requires the formation of a nucleus, which in this case needs the association of 2 to 4 monomers (Nishida and Sakai, 1983). This initial association of monomers is unfavorable. However once a nucleus is formed, it becomes energetically favorable to associate with the nucleus and thus polymerization is initiated (for review see (Jarrett and Lansbury, 1993)). It is interesting to note that this reaction is strongly concentration dependent. If the protein concentration is too low, association of monomers becomes energetically so unfavorable that a nucleus will not form. Only once a ―critical‖ concentration is obtained does nucleus formation become possible. Additionally, concentration has an exponential relationship with the length of the lag phase. For example, increasing the concentration of actin 2-fold reduced the lag phase 4-fold (Nishida and Sakai, 1983). Once equilibrium between monomer and polymer is reached, the assembly phase ends, and the polymer/monomer mix remains in dynamic equilibrium. It is important to note that in this process, unlike with amyloids, no conversion step is required. Interestingly, if such a model applies, one can calculate the number of monomers required for nucleus formation based on the lag phase/concentration dependency.

In a second, monomer directed model (Figure 8 C), it is assumed that, as in the case of amyloids, a structural conversion into an alternate, polymer competent state is required. The hypothetical soluble protein is in a given equilibrium with its alternate pre-amyloid state. It is assumed that the pre-amyloid state is rare. As with the previously described ―simple‖ model, nucleation depends on the association of sufficient pre-amyloid particles. Once such a nucleus has formed, it becomes sufficiently stable to persist. Now it becomes very favorable to add other pre-amyloid particles to the growing polymer, which then leads to the assembly phase. This process is very similar to a ―simple‖ model, providing that protein concentrations do not alter the equilibrium between soluble and amyloid competent state (for review see (Jarrett and Lansbury, 1993)). A more complicated model can be described as nucleated conformational conversion (Figure 8 D). This model is based on the assumption that conversion can be induced by the polymer itself (for review see: (Rochet and Lansbury, 2000)). This model again presumes that nucleation is dependent on the association of pre-amyloid competent states. It is further assumed that the soluble state is in equilibrium with the pre-amyloid state, with the amyloid state being rare. However, soluble monomers can also form an off-pathway oligomer, which can trap pre-amyloid competent proteins, and thus delay or prevent nucleation from occurring. Once a nucleus is formed, it is now able to interact with either its pre-amyloid or soluble counterparts, and either integrate them directly or induce conversion and then integrate them into the growing polymer (for review see: (Rochet and Lansbury, 2000)). This enhances the complexity of nucleation significantly; thus the ―simple‖ model correlation between lag phase and protein concentration no longer applies, as higher protein concentrations would both favor off-pathway aggregates as well as pre-amyloid particles. Thus the lag phase contains two components, oligomer formation versus nucleus formation. This makes it difficult to predict the effect of protein concentration on the lag phase.

Alternatively nucleated conformational conversion can also be formulated assuming that oligomers are on-pathway and hence important for nucleation (Serio et al., 2000) (Figure 8 E). In this case nucleation is divided into two steps: oligomer formation, which is concentration dependent, and conversion into the nucleus. This last process is not well understood. Once a nucleus is formed, assembly again requires association and then conversion of protein. In this model, both nucleation and assembly are divided into an association and a conversion step. This makes it hard to predict the effect of concentration on both lag and assembly phase.

Figure 8: Nucleated polymerization mechanisms.

Here a general overview of different polymerization models is given. A. Shows a kinetic that is typical for a nucleated polymerization event. The initial ―lag phase‖ is followed by a rapid assembly phase during which the polymer grows rapidly until a final equilibrium between soluble particles and polymer is reached. B. Shows a ―simple‖ nucleation model. Here nucleation requires the energetically unfavorable association of particles (P); once enough particles associate, a stable nucleus is formed (PN). Now association becomes energetically favorable and rapid assembly ensues (PN+1). The length of the lag phase is exponentially dependent on the protein concentration. C. A more complex model that is more applicable to amyloids, since it includes structural conversion. However, in this model, conversion is not induced, but the pre- amyloid (A) state naturally exists in equilibrium with its soluble state (S). Nucleation is again dependent on association of sufficient (A) states to form a stable nucleus. Once such a nucleus is formed, rapid addition of other (A) state molecules ensues. Lag phase should also be strongly dependent on protein concentration, provided the initial equilibrium (A) to (S) is not affected. D. Nucleated conformation conversion model assuming oligomers are off-pathway. Again, (S) and

(A) states are in equilibrium, and nuclei (AN) formation requires the association of sufficient (A) states molecules. However, (S) state molecules can form oligomers (Soligomer) that sequester (A) state molecules away, hence preventing/inhibiting efficient nuclei formation. Once a nucleus is formed, it is now able to interact with (S) state molecules and convert and integrate them into the amyloid (AN+1). This process is usually irreversible. Concentration dependence is now complex and hard to predict. E. Nucleated conformation conversion model assuming oligomers are on- pathway. Here oligomers (Soligomer) are in an initial equilibrium with monomers (S). However, due to an unknown conversion process, the oligomer converts to become a nucleus (AN). The nucleus then interacts with other (S) state molecules to convert them and integrate them into the forming amyloid (AN+1). Here, it is difficult to determine a concentration dependency, since every step is divided into ―association‖, which is likely concentration dependent, and ―conversion‖, a poorly understood process which is likely concentration independent.

Since amyloidogenesis can give deep insight into the process that leads to amyloid formation, such studies were performed for Sup35, particularly using the N-domain which contains the prion forming domain (Glover et al., 1997; Serio et al., 2000). However, initial research into the kinetics of fiber formation proved difficult; while it was relatively straight forward to purify Sup35 which then produced amyloid fibers, every purification batch showed a different fibrilization kinetic (Glover et al., 1997). It was presumed that this was likely due to the existence of seeds or nuclei at different maturation stages within the protein preparation. In order to produce protein preparations that have no seeds or nuclei within them, denaturing purification conditions were chosen (Glover et al., 1997). For this, the NM domain was expressed, since it is proposed to not contain any secondary or tertiary structure which could be destroyed via such a procedure. Based on FRET exchange efficiency studies, the NM domain was determined to resemble an ensemble of rapidly interchanging structures with a collapsed extreme N-terminus (amino acids 1-123), and a more extended and accessible M domain (123-253) (Mukhopadhyay et al., 2007). Further, expressing the N-domain alone was difficult, since it rapidly aggregated and was difficult to work with even under denaturing conditions (Glover et al., 1997). Others showed that a successful purification and fibrilization of this domain requires the use of harsh, non-aqueous buffers (0.1% TFA, 40% acetonitrile) (King et al., 1997). However, the purified NM (amino acids 1-253) domain remains reasonably stable in 8M urea for several days, before it starts forming fibers even in 8M urea (Glover et al., 1997). This means that denaturing conditions delay the process of amyloidogenesis sufficiently to enable the preparation and use of protein samples that show consistent fibrilization kinetics.

Others showed later that NM can be purified using non-denaturing conditions; however, fibrilization kinetics are the same irrespective whether denaturing or native conditions were used (Scheibel and Lindquist, 2001). Thus NM protein purification under denaturing conditions, as this is the most robust and reliable purification procedure, has since become the most dominant method in Sup35 protein in vitro work.

The purified NM domain, once diluted in non-denaturing buffer, forms fibrillar structures (Glover et al., 1997). The fibrilization kinetics has the generic characteristics of a nucleation dependent polymerization reaction (Glover et al., 1997). It exhibits a lag phase and an assembly phase. It also shows that if preformed fibers, or late lag phase material, is added to non-nucleated NM protein, these can act as seeds for the fibrilization reaction. In these cases, the lag phase is

58 eliminated and assembly phase is initiated (Glover et al., 1997). Hence the data is in agreement with the NM/Sup35 fibrilisation process being a nucleation limited polymerization process (Glover et al., 1997; Serio et al., 2000).

The first step of analysis therefore focused on the properties of the lag phase. If NM amyloidogenesis was to follow a ―simple‖ nucleation model, different concentrations of protein should exponentially reduce the lag phase as mentioned above. However, as protein concentrations can be varied over a 500-fold range, but the lag phase is only affected 10-fold, it suggests a more complex mode of polymerization (Serio et al., 2000). Intriguingly, conditions that favor NM oligomer formation, such as adding an artificial histidine tag, also reduce the lag phase. Conversely, conditions that inhibit oligomer formation, such as high salt, prolong the lag phase (Serio et al., 2000). The low protein concentration-lag phase dependency, together with the observation that oligomer formation aids nucleation, led to the model proposed by Serio et.al. (Serio et al., 2000). The proposed mechanism, as described above (Figure 8 E), hypothesizes that oligomer formation precedes and is required for nuclei conversion (Serio et al., 2000). Later work has demonstrated that the lag phase is more strongly dependent on physical shear forces than protein concentration. Thus it was proposed that the nucleation has two stages, the initial ―primary‖ nucleation during which time the nucleus forms de novo, and the more dominant process, which contributes to the lag phase length, so-called ―secondary‖ nucleation. This describes the breaking apart or severing of the initial nucleus, whereby the number of nuclei is increased, leading to faster transition into the assembly phase (Knowles et al., 2009).

One interesting question is how, during the assembly phase, proteins are added to the growing fiber. The most likely mechanism is addition at the ends of the growing fibers. This is supported by several observations. Spinning down these particles removes the fibrilization ability from a reaction, resetting it to the lag phase. Conversely, sonicating fiber material greatly enhances the polymerization speed. This process also explains why adding higher concentrations of soluble material does not increase the assembly stage by that much, since it is not soluble monomer but available polymer ends that are the rate limiting step (Knowles et al., 2009; Serio et al., 2000). This model was confirmed by studies that showed that new materials were added to the fiber ends (DePace and Weissman, 2002; Inoue et al., 2001; Scheibel et al., 2001).

For the process of protein addition towards the amyloid state, two scenarios are conceivable. First, only amyloid competent particles integrate into the fiber. Second, soluble NM-protein interacts with the growing fiber and amyloid conversion is induced via this interaction. Thus amyloid growth can be separated into association and conversion. Using various labeling and purification techniques, it was demonstrated that NM protein is first recruited to the growing fiber end ―association‖, and then upon recruitment transformed into the amyloid state ―conversion‖ (Collins et al., 2004; Scheibel et al., 2004).

One aspect of the directionality of fiber assembly remained elusive, as different groups reported different findings, either reporting fiber growth was unidirectional (Inoue et al., 2001) or bidirectional (Scheibel et al., 2001). A potential solution to this problem was later discovered, as it appears that fibers formed in vitro are of different subtypes (DePace and Weissman, 2002) which have different growth properties. Some fibers exhibited unidirectional growth properties, while others exhibited bidirectional fiber growth. This diversity was further highlighted by observations that demonstrated that fibers made at 4˚C had lower thermal stability compared to fibers made at 37˚C (Tanaka et al., 2004). Taken together, these data suggest that there is a large variety of possible fiber folds and consequently fiber properties that can occur.

The relevance of these in vitro fibers was determined using yeast extracts. Extracts from [PSI+] but not [psi-] were able to seed fibrilization reactions of purified NM protein, resulting in fibers similar to preparations of purified material (Glover et al., 1997); this suggests that fibers formed in vitro share important properties with in vivo psi-factor. Recent work has further shown that in vivo [PSI+] cells contain fiber-like particles that are similar to amyloids made in vitro, having a 20 nm diameter with lengths of a few hundred nanometers (Glover et al., 1997; Kawai-Noma et al., 2010). These finding are able to tie together the elusive psi-factor and the Sup35 amyloid form. It demonstrates that the reduced functionality of Sup35 is likely due to its sequestration into the amyloid polymer,and that these in vivo amyloids share essential features with in vitro amyloids. Based on these data, experimental in vitro results can give valuable insights into the in vivo processes governing prion propagation, inheritance and maintenance in [PSI+] cells.

While these experiments showed that the psi-factor is likely to be the Sup35 amyloid form, as it was able to seed in vitro fibrilization kinetics, the converse would still need to be shown. This means that in vitro particles can act as psi-factor and induce [PSI+] in [psi-] cells. Moreover this

60 would also establish the protein-only mode of inheritance for the Sup35 dependent [PSI+] and establish the infectivity/transmissibility of Sup35 amyloids, thus proving them to have prionogenic properties. This was accomplished; in a direct proof of the prion hypothesis, fibers were made in vitro using only purified N-terminal (1-253) Sup35 protein and introduced into yeast cells, which effectively converted them to [PSI+] (Sparrer et al., 2000). This was also the first proof of the general prion hypothesis, that a protein-only mode of inheritance is possible and occurs in nature.

These studies also shed light on a different phenomenon observed in yeast cells. The [PSI+] read- through ability showed very strong variation in different yeasts. Some strains showed very strong suppression, while others did not. As mentioned earlier, in vitro fibers have a large variety of fiber subtypes that differ in growth and thermal stability; this is similar to the strain variety observed in [PSI+] cells. Fibers made at 4ºC exhibited distinctly lower stability when subjected to SDS thermal melts, compared to fibers made at 25ºC or 38ºC (Tanaka et al., 2004). When these fibers were transfected into yeast, the resulting [PSI+] phenotype strength was directly determined by the intrinsic stability of the in vitro prion particles. Thermally more stable prion fragments induced a weaker [PSI+] phenotype, compared to thermally more labile variants (Tanaka et al., 2004). These thermal differences in different prion preparations are likely due to alternate folds of the prion particle itself (Krishnan and Lindquist, 2005). It seems that, at least in vitro, prions can form a large variety of different particle types with distinct properties (DePace and Weissman, 2002). This suggests that the strain diversity, and the corresponding distinct prion particle properties, is a natural property of prions. Interestingly, this strain diversity may be dependent on the specific amino acid region 124-137 (Bradley and Liebman, 2004). However, the precise molecular basis of this is unclear.

In conclusion, based on these data, we believe that prion particles formed in vitro are structurally and functionally similar to in vivo prion particles, and that in vitro work can provide invaluable insight into in vivo processes or observations.

1.6.1.3 Sup35 prion in vivo observations and strain diversity

The discovery that Sup35 forms amyloids and that the amyloid form of Sup35 is the elusive psi- factor enabled a significantly improved understanding of the in vivo properties Sup35 had in [PSI+] cells.

For example, [PSI+] cells exhibit reduced Sup35 solubility relative to [psi-] cells. If GFP-tagged N-terminal domains (NM, 1-253) are expressed in [PSI+] cells, discrete fluorescent foci are formed, while the signal remains diffuse in [psi-] cells (Patino et al., 1996). The aggregates can range from several 100 kDa to a few MDa. This was demonstrated using the ability of Sup35 amyloids to withstand treatment with SDS at moderate temperatures (38˚C), which allows the separation of pure amyloid particles without any additional proteins associated with the fiber. It also enables experimentally to distinguish between Sup35 aggregates, which are not SDS resistant, and Sup35 amyloids, which are. The purified fiber particles are then run on agarose gels using molecular weight markers, which allows a rough estimation of the in vivo Sup35 amyloid size (Kryndushkin et al., 2003). These ordered aggregates then directly recruit freshly synthesized Sup35, keeping the soluble pool of Sup35 low (Satpute-Krishnan and Serio, 2005). This is in agreement with the observation of increased stop codon read-through (Figure 9A). As more Sup35 is concentrated in these ordered aggregates, only a limited amount of soluble and thus active Sup35 remains.

However, [PSI+] strains can be distinguished in their stop codon suppression ability. Some strains show strong suppression and are white (strong [PSI+]), while others have a pink (weak [PSI+]) appearance, indicative of lower suppression (Derkatch et al., 1997). These differences are not due to yeast mutations, as overexpression of the Sup35, which can induce [PSI+] in the same strains of yeast, results in the formation of stable prions with distinct strong or weak suppression phenotypes (Derkatch et al., 1997). These differences in suppression are likely due to a different ratio between soluble and aggregated Sup35. Less aggregated and more soluble Sup35 is observed in weak [PSI+], while more aggregated and less soluble Sup35 is found in strong [PSI+] variants (Zhou et al., 1999). Furthermore, it appears that strains exhibiting strong [PSI+] suppression phenotype generally exhibit shorter or smaller ordered aggregates, while weak [PSI+] strains have comparatively larger fragments (Kryndushkin et al., 2003). As mentioned above, these differences are likely due to the different amyloid properties of Sup35 that are likely to determine the amount of soluble Sup35 within the cell. As the driving factor of Sup35 amyloid growth is proposed to be the availability of fiber ends, the more ends, meaning the more fiber particles there are, the more soluble Sup35 can be recruited into the amyloid, the lower is the soluble pool of Sup35 and consequently the stronger is the suppression phenotype. This would

62 also explain why thermodynamically les stable amyloids, which are probably more easily fragmented in vivo, show stronger suppression (Sparrer et al., 2000).

Weak [PSI+] strains not only have a weak suppression phenotype and large particle size, but also tend to spontaneously lose [PSI+] (Derkatch et al., 1997). This observation may be explained by the data suggesting that efficient prion propagation requires a minimum set of prion particles or ―propagons‖, and that prion inheritance depends on efficient segregation of prion particles from mother to daughter cell (Figure 9B) (Cox et al., 2003; Eaglestone et al., 2000). The number of propagons per cell was estimated based on the idea that the addition of the chemical compound guanidinium hydrochloride stops the propagation of propagons. Hence, a cell would be stuck with a set number of amyloid particles. If one then measures the number of generations it takes to ―dilute‖ out these particles, it is possible to estimate the original propagon number (Eaglestone et al., 2000). Alternatively, one can arrest a single yeast cell in guanidinium hydrochloride and let it form a colony, which then includes several generations of yeast cells. The individual cells of the colony can then be isolated and tested for [PSI+], also allowing an estimation of the number of propagons per cell (Cox et al., 2003). Based on the latter technique, it was determined that the number of propagons varies between different yeast strains and can range from 30 to 1000 (Cox et al., 2003). Others have suggested that rather than particle number, the particle size itself may be the limiting factor preventing prion particle transfer from mother to daughter cells (Derdowski et al., 2010). This suggests that the difference between weak and strong [PSI+] phenotype is based either on different prion particle numbers per cell, or on the particle size itself. In general, weak strains tend to have fewer but larger prion particles, with a larger pool of soluble Sup35. This in turn explains the weaker suppression, as more Sup35 is available for translation termination. But it also shows that the weaker [PSI+] phenotype would have a higher propensity to be lost, as fewer prion particles have a higher chance to be unequally segregated (Cox et al., 2003; Derkatch et al., 1997; Eaglestone et al., 2000).

Figure 9: Overview of Sup35 prion properties.

A. Theory explaining the read-through phenomenon. Initially, soluble Sup35 (red) interacts with Sup45, enabling efficient translation termination. This leads to premature translation termination at the inserted stop codon. However, once prions have formed, the pool of soluble Sup35 is significantly diminished; hence translation termination is less efficient and stop codon read- through occurs. B. In vivo, the state of Hsp104 has a dominant effect on prion maintenance. (I) At intermediate Hsp104 expression levels, the prion is maintained. (II) However, if Hsp104 is overexpressed, that leads to dissolution of aggregates and thus the prion is lost. (III) If Hsp104 is inhibited, prion particles grow larger and fewer particles are present within the cell. This leads to the gradual loss of prion particles during cell division. C. Model of Hsp104 severing action on Sup35 fibers or prion particles. Based on the proposed threading mechanism of Hsp104, it extracts Sup35 peptides out of the fiber, thus severing the prion particle and maintaining a given particle size and number within the cell.

1.6.1.4 Sup35 properties important for prion formation

The amino acid composition of the PrD is exceptional in that it is rich in asparagines and glutamines (DePace et al., 1998; Liu and Lindquist, 1999; Ter-Avanesyan et al., 1993). The importance of the imperfect repeats was demonstrated, as when additional repeats are added, the appearance of [PSI+] markedly increases; when repeats are removed, the opposite is observed (Liu and Lindquist, 1999). Prions can still form if these repeats are scrambled, although the efficiency is reduced (Ross et al., 2005). These data point to the importance of the N-domain composition and its effect on prion formation.

Another interesting observation is that prions do show a certain species specificity; for example, Candida albicans Sup35 can form prions, but these cannot cross-seed or incorporate Saccharomyces cerevisiae Sup35 (Hara et al., 2003). Studies found that the first 40 amino acid residues of the PrD are essential to determine this species barrier (Hara et al., 2003). This suggests that although the composition itself is the striking feature that permits the prion formation, compatibility between different prions is dependent on the actual amino acid sequence.

Intriguingly, other than prion formation, no known function has been attributed to the N-terminal domain. However, the N-terminal domain and its rich Q/N amino acid composition seem to be conserved among a large variety of yeasts (Harrison et al., 2007). While it has not been shown that all these diverse yeast strains can actually form prions, it is an open question as to why the N-terminus is conserved. One side argues that this conservation is due to the importance of prion formation (Shorter and Lindquist, 2005); in this case, all the Sup35 variants should be able to form prions. The theory is that the [PSI+] state allows for the accumulation of phenotypically silent diversity that is revealed when [PSI+] is lost and may pose a selective advantage. Others, arguing that prions are diseases in yeast, would likely conclude that this N-terminus has an undiscovered non-essential function in yeast (Nakayashiki et al., 2005). The hypothesis was that if Sup35 amyloids would be advantageous, one should find examples of [PSI+] populations in the environment. However, none of the many different yeasts, found in a variety of different environmental surroundings showed any [PSI+]. Another hypothesis is based on mutational studies that suggest a regulatory role for the N-domain. The authors found mutations that N-

66 domain may interact with the C-domain in order to repress translation termination (Volkov et al., 2007). However, details of this proposed regulatory role have yet to be established.

In addition to the prion forming domain (1-123), the M-domain (124-253) also plays an important role in prion formation. In vitro, the M-domain enhances the solubility of the extreme N-terminal domain (Glover et al., 1997). In vivo, M-domain deletion results in a poorly soluble Sup35 molecule (Glover et al., 1997; Liu et al., 2002). While Sup35 lacking the M-domain can retain [PSI+] and even maintain different strength of [PSI+] phenotype, its mitotic stability is reduced (Liu et al., 2002). If the M-domain is replaced with a random highly charged synthetic polypeptide, the solubility and mitotic stability of the N-domain containing construct is restored (Liu et al., 2002); however, its meiotic stability is reduced. Furthermore, changes to the M- domain can have a profound impact on the resulting properties of the Sup35 amyloid. These may result in amyloids that cannot be cured by increased Hsp104 levels, or ordered Sup35 aggregates that require co-expression of Sup35 WT protein for amyloid formation and propagation (Liu et al., 2002). These data suggest that the M-domain influences the Sup35 prion properties in a complex manner crucial for a stable [PSI+] phenotype.

1.6.1.5 Factors influencing [PSI+]

In vivo, the [PSI+] phenotype can be influenced by a variety of means that can either enhance the appearance of [PSI+] or lead to the loss of this phenotype. One class of proteins that has an especially strong effect on prions are chaperones (Osherovich and Weissman, 2002). As chaperones are crucial in the maintenance of healthy proteostasis within the cell, they are also the most likely to affect aggregation behaviour of the Sup35 prion particles. As in vitro work has shown, oligomer formation precedes fiber formation. It is possible that these oligomers would also be targeted by chaperones. For example, when assembled amyloid particles are isolated from soluble proteins via ultracentrifugation into sucrose cushion, these fibers are associated with a variety of chaperones such as Hsp104, Sse1, Ydj1, Sis1 as well as the Hsp70 chaperones Ssa1/2 and Ssb1/2 (Allen et al., 2005; Bagriantsev et al., 2008). This is intriguing, as it may indicate an important role of the Ssa/Ssb family of chaperones in prion formation and/or propagation. This idea was supported by the finding that Ssa1 overexpression enhances prion particle size and increases the pool of soluble Sup35 (Allen et al., 2005). Ssb proteins, on the other hand, were found to counteract the prion phenotype in yeast (Allen et al., 2005). Mutations

67 in Ssa1 can lead to reduced or perturbed prion propagation in yeast (Jung et al., 2000). Furthermore, the pro-[PSI+] action of Ssas is mainly determined by the peptide binding site (Allen et al., 2005). This indicates that Hsp70s are major factors determining the spontaneous appearance and propagation of the Sup35 prion particle. This is supported by data suggesting that Hsp40s such as Sis1p, or nucleotide exchange factors such as Fes1, can affect prion propagation (Jones et al., 2004). In these studies, overexpression of Fes1enhanced [PSI+] prion propagation, while depletion weakened [PSI+] inheritance. Sti1 is required for effective curing by Hsp104 overexpression (Reidy and Masison, 2010). Further, loss of [PSI+] is both influenced by Ydj1 and Sis1, with Sis1 being the more potent factor (Kryndushkin et al., 2002). Other studies have shown that Sis1 is required for [PSI+] propagation (Higurashi et al., 2008). This further supports the crucial role of the Hsp70 system in Sup35 prion propagation.

Chemical agents also affect [PSI+] curing, the most prominent of which is guanidinium hydrochloride (GdmHCl) (Tuite et al., 1981). This chaotropic salt is often used at high concentrations (~6 M) to denature proteins. However, at 5 mM concentration, which is too low to denature proteins, GdmHCl exhibits prion curing ability (Eaglestone et al., 2000). It was found that GdmHCl inhibits a crucial step in the propagation of prions, and that the consequent loss of prions is a direct consequence of cell division (Eaglestone et al., 2000). This finding is supported by the observation that prion particle size increases with the addition of GdmHCl (Kryndushkin et al., 2003). The increase in particle size and the corresponding reduction in prion particle number caused by GdmHCl likely enhances the loss of prions via cell division, ultimately resulting in the curing of prions. Intriguingly, cells lacking Ssb show enhanced sensitivity to curing by GdmHCl, due to an increased uptake of this curing agent into cells (Jones et al., 2003).

The curing effect of GdmHCl on cells seems to be the inhibition of Hsp104 (Ferreira et al., 2001). As Hsp104 is an important modulator of Sup35 prion particles, the interaction between Hsp104 and Sup35 will be discussed in detail in the next section. Overexpression of Hsp104 has the ability to cure cells of [PSI+] (Chernoff et al., 1995).

In conclusion, many factors influence the [PSI+] phenotype. Chaperones such as Hsp70, Hsp40 and Hsp104 are all interconnected in the process of prion propagation. This indicates that the process of prion propagation is quite complex including many different players, the most dominant of which is Hsp104.

1.6.2 The Hsp104 - Sup35 prion connection

While the process of prion particle propagation in vivo is very complex, involving many different chaperone players, Hsp104 was identified as having a major effect on Sup35 prions (Chernoff et al., 1995). For example, Hsp104 expression is essential to ensure the stable inheritance or maintenance of several yeast prions, including Sup35 (for review see (Osherovich and Weissman, 2002)). Its overexpression is unique in that it can effect curing of [PSI+] (Chernoff et al., 1995). Cells co-expressing functionally inactive Hsp104 mutants (K218T, K620T) also fail to propagate Sup35 prion particles (Chernoff et al., 1995). In vivo Sup35 aggregation and prion propagation is dependent on both the cellular concentration and the functional state of Hsp104 (Patino et al., 1996). Interestingly, the reversible inhibition of Hsp104 by GdmHCl (Grimminger et al., 2004) leads to the gradual loss of the prion phenotype (Wegrzyn et al., 2001) by blocking an essential step in prion propagation (Eaglestone et al., 2000). One Hsp104 mutation (D184N) abolishes GdmHCl sensitivity whereby curing of Sup35 amyloids by GdmHCl is no longer possible. This shows that Hsp104 is indeed the target of GdmHCl (Jung et al., 2002). As these data demonstrate, Hsp104 is an important factor in prion propagation. However, while in vivo studies highlight the importance of Hsp104 as well as an co-sedimentation of Hsp104 with the prion (Bagriantsev et al., 2008) direct interaction or effect of Hsp104 on Sup35 amyloid particles could not be established.

To address this, in vitro data confirm that Hsp104 is able to directly interact with Sup35 (Shorter and Lindquist, 2004). However, the interaction may be weak or transient, as gel filtration studies failed to detect any notable amount of Hsp104 bound to prion particles (Krzewska and Melki, 2006). On the other hand, fluorescence microscopy studies showed that Hsp104 was able to directly bind to Sup35 fibers (Inoue et al., 2004). Other data suggested that Hsp104 may be interacting with small oligomer fragments of N-terminal PrD domain, rather than monomers or larger oligomers (Narayanan et al., 2003). In our studies, we were able to see Hsp104 co- precipitation with prion particles with the Hsp104 (E285A, E687A), also referred to as ―Hsp104TRAP‖ (data not shown). Hsp104TRAP is able to bind but not hydrolyze ATP and thus locks Hsp104 into its high affinity state (Lum et al., 2008). Taken together, these data support a direct interaction between Sup35 and Hsp104; however, the molecular details of this interaction remain unknown.

This problem was further addressed by functional in vitro studies of the effect of Hsp104 on NM fibrilization. It was shown that low levels of Hsp104 enhance fiber formation by virtually eliminating the usual fibrilization lag phase (Shorter and Lindquist, 2004). The elimination of lag phase requires the assembled Hsp104 hexamer; however, ATP hydrolysis, while enhancing the effect, is dispensable (Shorter and Lindquist, 2004). Hsp104TRAP mutants appear to be able to block fiber formation, while high concentrations of Hsp104 disassemble fibers (Shorter and Lindquist, 2004). Interestingly, Hsp104 critically affects the formation of oligomers, a critical step in the formation of seeds during the lag phase, a process that can be blocked by the addition of an oligomer specific antibody (Shorter and Lindquist, 2006). An oligomer is understood as being an aggregation of several NM monomers that not have yet attained any amyloid properties. The antibody recognizes these oligomers while not being able to bind to either nuclei or amyloids (Shorter and Lindquist, 2006). While low levels of Hsp104 enhance oligomer formation, high levels seem to delay or prevent it. These data are in line with the observed effect of Hsp104 on the fibrilization rate (Shorter and Lindquist, 2006). Taken together, these in vitro experiments are in alignment with in vivo data, in that Hsp104 is required for prion formation, that Hsp104 has a positive effect on fiber assembly at intermediate concentration, and that Hsp104 destroys fibers at high concentrations (for review see (Tuite and Lindquist, 1996)). These different functions only require purified Hsp104 proteins, and thus they indirectly show a physical interaction between Sup35 and Hsp104. Others have found a similar effect on full length Sup35, where Hsp104 enhances fiber formation at 10ºC (Krzewska and Melki, 2006). This enhanced fibrilization rate was dependent on Hsp104 alone, and was inhibited if Sis1 or Ssa1 were added (Krzewska and Melki, 2006). While these studies indicate that a direct Hsp104- prion interaction exists, others have suggested that other factors may be required for Hsp104- Sup35 prion severing action (Inoue et al., 2004). Here, yeast cell lysate was required to effect prion fragmentation by purified Hsp104 (Inoue et al., 2004). While these data do not impact the idea of direct Hsp104-fiber interaction, they do suggest that Hsp104 action on its substrate may require additional factors. However, the technique used in this study (Inoue et al., 2004), in which fibers are bound to magnetic beads, and the release of protein from beads is used as a measure of fragmentation efficiency, is tricky. During the initial stages of this thesis work, this assay was successfully established. However, fragmentation efficiency was found to be very low, with as much as 90% of particles remaining on the beads. This is surprising as efficient fragmentation that could ultimately lead to complete dissolution of Sup35 prion particles

(Shorter and Lindquist, 2006) should result in a majority of protein being released from the magnetic beads. More data will be required to elucidate the role of Hsp104 in this fragmentation assay.

The basic effect of Hsp104 on prions can thus be separated into two distinct processes: first, the generation of NM fibers, and second, the fragmentation of these particles. Both processes are influenced by Hsp104 alone. Currently it is believed, based on the proposed models for Hsp104 function, that Hsp104 is directly able to sever fibers (for review see (Sweeny and Shorter, 2008)). It is hypothesised that Hsp104 is able to extract single NM or Sup35 proteins from an assembled fiber (Figure 9C). This extraction could occur anywhere in the fiber filament, effectively breaking it apart or severing it. This idea would be in line with observations that Hsp104 inhibition leads to an increased particle size (Kryndushkin et al., 2003).

1.6.3 Summary

The Sup35 prion protein, while being a translation termination factor, also possesses the ability to convert into an amyloid particle. This conversion then enables the recruitment of soluble proteins into ordered aggregates, thus depleting cells of soluble protein, leading to the suppression phenotype. The process of prion particle formation as well as its propagation is complex and influenced by sequence features in the PrD, other cellular proteins (namely chaperones) and chemical agents that act through chaperones. The Sup35 amyloid itself has several distinct attributes. It induces a suppression phenotype, results in more Sup35 aggregation and ultimately in a higher proportion of insoluble Sup35. Further the inheritance of Sup35 amyloids is non-Mendelian, but is dependent on several cellular factors such as Hsp104 activity.

1.7 Thesis rationale and objective

The goal of this thesis is to achieve a better understanding of Hsp104 interaction sites and to demonstrate that such interaction sites have biological relevance; that Hsp104 propagates and cures the [PSI+] prion by direct binding to Sup35, and that the site of this binding can be localized. Alteration of the binding site will change the characteristics of Hsp104-dependent propagation and curing of [PSI+].

We used Sup35, specifically its NM domain, because this protein has easily accessible in vitro properties such as fiber formation kinetics and fiber morphology. In vivo this protein has easily observable characteristics such as its solubility, termination codon read-through and aggregate size. Thus Sup35 is a model system to characterize the potential effects of the hypothetical Hsp104 binding site, as it is amenable many different analytical techniques, both in vivo and in vitro. The Hsp104-Sup35 system should help to facilitate answering the question whether substrate binding by Hsp104 has actual in vivo implications.

To address the question of Hsp104-Sup35 interaction, an in vitro assay was developed to test Hsp104 action on NM protein (Chapter 2). Following the establishment of this assay, the hypothetical Hsp104 binding site was identified and its significance was demonstrated both via in vitro as well as in vivo assays (Chapter 3). An overview of the content of chapter 2 and 3 is given in Figure 10. Finally (Chapter 4), a brief summary of the two preceding research chapters and a general outlook on what further questions need to be addressed is given, as well as possible questions and experimental approaches which may further enhance our understanding of Hsp104 substrate recognition.

This research was originally published in the Journal of Biochemistry (Helsen and Glover, 2011).

Figure 10: Overview of chapters 2 and 3

The figure shows a rough outline of the main research questions in each chapter combined with the main conclusions that were drawn from data presented in those chapters.

2 The Sup35 M domain inhibits propagation of [PSI+] and chaperone-dependent fibrilization of the prionogenic domain NM

2.1 Abstract

Molecular chaperones play an important role in the propagation of yeast prions to ensure their continuous inheritance. Full-length prionogenic proteins or subsegments spontaneously form amyloid fibrils in vitro without additional factors. In vitro reactions have been developed that examine the ability of molecular chaperones to accelerate or inhibit nucleation, fibril growth or fibril disassembly. Here we describe a fibrilization reaction using the Sup35 NM-domain that is wholly dependent on molecular chaperones and ATP. In these reactions, nucleation is blocked by the addition of glycerol and Tween™ 20. The inhibition of nucleation is overcome by the addition of seed derived from pre-formed NM fibrils or by the action of Hsp104 together with the yeast Hsp40 Ydj1, and huHsp70. To demonstrate the relevance of the assay to prion biology we demonstrate that expression the Sup35 M-domain inhibits propagation of [PSI+] in vivo correlating with the inhibition of chaperone-dependent fibrilization in vitro without effecting spontaneous or seeded polymerization.

2.2 Introduction

The yeast translation termination factor Sup35 is classified as a yeast prionogenic protein based on its ability to spontaneously form self-replicating aggregates that serve as heritable elements during budding and meiosis (Tuite and Cox, 2003). The Sup35 heritable element or prion is known as [PSI+]. Full-length Sup35 and smaller segments derived from its N-terminal 253 amino acids spontaneously form amyloid-like fibrils through a nucleated polymerization mechanism in vitro (Serio et al., 2000). The physiological relevance of these fibrils is suggested by the observations that Sup35 polymerization can be seeded by extracts of [PSI+] cells but not [psi-] cells (Glover et al., 1997; Paushkin et al., 1997) and that fibrils formed in vitro can be used to infect [psi-] cells converting them to [PSI+] (Sparrer et al., 2000). Importantly fibers formed

75 under different conditions in vitro have distinct physical properties and result in the establishment of distinct [PSI+] strains upon infection (King and Diaz-Avalos, 2004; Tanaka et al., 2004). Very recently deposits of fibrillar proteins corresponding to subcellular foci that recruit fluorescently tagged Sup35 in [PSI+] cells have been described (Kawai-Noma et al., 2010). Together these results suggest that fibrils manufactured in vitro have physical properties very like or identical to the major conformer of Sup35 found in [PSI+] cells.

The propagation of [PSI+] is highly dependent on the AAA+ ATPase Hsp104 (Chernoff et al., 1995; Kryndushkin et al., 2003). Elimination of the gene encoding Hsp104 or the inhibition of Hsp104’s ATPase activity by guanidine treatment (Ferreira et al., 2001; Jung and Masison, 2001) results in the loss of [PSI+]. Overexpression of Hsp104 also eliminates [PSI+]. The dependence on Hsp104 for both propagation and curing can be equally attributed to the protein disaggregation activity of Hsp104. At the low constitutive levels of Hsp104 present in unstressed cells, fibrils are severed infrequently. This action creates larger numbers of smaller fibrils and ensures inheritance of multiple seeds as the cytosol partitions into daughter cells during budding. Eliminating Hsp104 or antagonizing its severing action with an inhibitor results in larger fibrils and fewer seeds. The probability of inheritance is reduced resulting in prion loss. Overproduction of Hsp104 may result in the reduction of fibril size through enhanced severing to the point where the seeding property of the aggregates is lost. While Hsp104 is critical for the stable propagation of [PSI+] and a number of other yeast prions, other molecular chaperones clearly influence propagation in vivo (reviewed in (Sweeny and Shorter, 2008)). These include the cytosolic Hsp70s Ssa1-4 and Ssb1,2 as well as the Hsp40 family members, Ydj1 and Sis1 and a variety of Hsp70 nucleotide exchange factors.

In vitro, spontaneous fibrilization of a segment of Sup35 consisting of the first 253 amino acid residues (NM) is accelerated by substoichiometric amounts of Hsp104 and preformed fibrils are rapidly disassembled when Hsp104 is present at higher concentrations.(Shorter and Lindquist, 2004). Others have also observed fragmentation of preformed fibrils, albeit relatively inefficiently, in reactions that required unidentified factors present in a yeast extract (Inoue et al., 2004). Each of these in vitro systems would be highly useful in elucidating the interactions between chaperones and prionogenic proteins. However we experienced difficulty reproducing the reported observations suggesting that they may be highly dependent on procedural subtleties that are not immediately obvious.

In this paper we describe a robust in vitro system in which the spontaneous nucleation of NM is blocked. The nucleation block is overcome by the addition of small amounts of preformed fibrils or by the addition of a set of molecular chaperones including Hsp104 and ATP. To demonstrate the biological relevance of this in system we found that over-expression of the non-prionogenic Sup35 M-domain alone inhibits propagation of [PSI+] in vivo and also inhibits fibrilization in our in vitro system. These results suggest that in vitro chaperone-dependent fibrilization has similar requirements as in vivo prion propagation.

2.3 Results

2.3.1 Chaperone-dependent fibrilization

Through trial and error we found that a low ionic strength buffer (FIB) containing both 10% (v/v) glycerol and 0.03% (v/v) and Tween™ 20 (FIB+) inhibited the fibrilization of NM in slowly rotated reactions. Fiber formation was measured by Thioflavin T (ThT) fluorescence. Fibers readily formed in buffer with physiological salt concentrations (PB) or FIB without amendments (Figure 11A). FIB with either glycerol or Tween™ 20 alone resulted in only modest inhibition of fibrilization.

We hypothesized that additives present in FIB+ may promote ―off-pathway‖ aggregation of NM and thereby limit the amount of soluble NM available for spontaneous nucleation and fibril growth. We reasoned that if thermally or chemically denatured proteins can be rescued and refolded by a bichaperone network consisting of Hsp104, Hsp70 and Hsp40, then it might be possible that fibrilization in FIB+ could be restored by the same chaperone set. To test this idea, we added Hsp104, Ydj1 (a yeast cytosolic Hsp40) and human Hsp70 (huHsp70; HSPA1A) alone or in combination, with or without ATP and an ATP regenerating system into a solution of unpolymerized NM in FIB+ and incubated the reactions without agitation. In addition to ThT binding (Figure 11B upper panel) we also tested whether we could observe the formation of NM resistant to SDS solubilization in gently heated samples (Figure 11B lower panel). We found that a ThT-binding product was formed in the presence of all three chaperones and that this reaction was dependent on ATP. ThT binding was correlated with the formation of high molecular weight, SDS-resistant NM whose migration in the gel was arrested at the interface

77 between the stacking gel and resolving gel. No single chaperone or pair-wise combination of chaperones was able to promote fibrilization.

It has been previously observed that Hsp104 is able to accelerate fibrilization of NM in rapidly rotated reactions even in the presence of slowly-hydrolyzable ATP analogues suggesting that its ability to unfold and disaggregate proteins is not strictly required for stimulating nucleation (Shorter and Lindquist, 2004). Because huHsp70 activity also requires ATP hydrolysis we explored the role of ATP in chaperone-dependent fibrilization by substituting the wild-type form of Hsp104 with a so-called ―trap‖ mutant that can bind but not hydrolyze ATP (E258A/E687A) (Bosl et al., 2005; Lum et al., 2008). In addition we tested the ability of Hsp104 derivatives that can bind and hydrolyze ATP but which have Tyr  Ala substitutions that are proposed to prevent protein unfolding via the axial channel of Hsp104 (Y257A and Y662A) (Lum et al., 2004). None of these Hsp104 derivatives supported fibrilization suggesting that ATP hydrolysis and protein unfolding by Hsp104 both required for fibrilization of NM in these reactions (Figure 12A). Likewise, addition of a low millimolar amount of guanidinium hydrochloride (GdmHCl) known to inhibit the ATPase activity of Hsp104 (Grimminger et al., 2004), also inhibited fibrilization (Figure 12B).

Although ThT binding and SDS-resistance suggested that chaperones promote NM fibrilization, we confirmed the presence of fibrillar material by visualizing the final results of the reactions with transmission electron microscopy. In reactions inhibited by GdmHCl (Figure 12C, left panel) and reactions without chaperones (not shown) we observed an amorphous network of protein supporting the idea that formation of off-pathway aggregates under these conditions reduce the chances of spontaneous fibrilization. The action of the full set of chaperones resulted in the formation of relatively short fibers (Figure 12C, middle panel) similar in dimensions to fibrils formed spontaneously and then sonicated to sheer them into smaller fragments (Figure 12C, right panel).

i c

c a

s 10

i u

l o F 0 FB FIB FIB FIB FIB +gly +T20 +T20 +gly

B T

h 75 T

e FIB+T20/Gly

i c

n e

e 50

r c

o 25

i u

d l

o 0 F + + + - + - - + Hsp104 + - + + - + - + huHsp70 + + - + - - + + Ydj1 + + + + + + + - ATP boiled + - + - + - + - + - + - + - + - * Interface Hsp104 huHsp70 Ydj1 NM

Figure 11: Inhibition of spontaneous fibrilization by combined addition of Tween™ 20 and glycerol.

(A) 2 µM NM was diluted either into buffers FB or FIB. Tween™ 20 (T20; 0.03% v/v) and glycerol (gly; 10% v/v) were added to FIB as indicated. After incubation overnight with gentle agitation the fold increase in ThT was determined relative to the initial sample (N=3). (B) NM was diluted into reactions containing the indicated chaperones and ThT fluorescence was determined after 15 to 17 h in still reactions incubated at room temperature. ATP was added as indicated. Histograms show the mean and standard deviation of data compiled from 3 independent experiments (upper panel). To test for SDS-resistance, end point reactions we either heated to 99ºC (boiled) to 38ºC for 25 min. Proteins were separated on a 10% SDS-PAGE and stained with Coomassie blue (lower panel). The asterisk draws attention to the sample with the highest ThT binding and highest SDS-resistance.

A B

75 75

h e

i c

e n n

50 e

i c

e 50

n c

s e

c e

a r

e o

r n

r i

c l o

25 f 25

n d

i u l

o F 0 0 W T Y Y Co -Gdn +Gdn T rap 66 25 n 2A 7A C

100 nm 100 nm 100 nm Chaperones + Gdn Chaperones Spontaneous

Figure 12: Role of Hsp104 in chaperone-dependent fibrilization.

(A) Reactions containing huHsp70, Ydj1, ATP and an ATP-regenerating system were conducted in the presence of wild type Hsp104 (WT), a derivative that does not hydrolyze ATP (Trap), or Hsp104s with substitutions in pore loops in the second (Y662A) or first (Y257A) AAA+ domain, or without Hsp104 (CON) (N=3). (B) Reactions with WT Hsp104 we incubated with or without 2 mM guandinium hydrochloride (N=3). (C) Transmission electron microscopy of negatively stained reaction products formed in the presence chaperones (with or without GdmHCl) compared to sonicated fibrils formed spontaneously in PB.

2.3.2 Measuring fiber formation in real time reveals a block in nucleation

To continuously monitor the progress of the reaction we re-created a site-specific labeling site in NM by introducing a unique Cys residue at position 106 that has been previously shown to be innocuous with respect to the kinetics of spontaneous fibrilization ((Krishnan and Lindquist, 2005; Scheibel and Lindquist, 2001). The fluorescence spectrum of freshly dispersed acrylodan-labeled NM had an emission maximum at 515 nm that shifted to about 485 nm upon fibrilization (data not shown). Continuous monitoring of a chaperone–dependent reaction containing 25% acrylodan-labeled NM in a fluorometer (Figure 13A) was conducted parallel with identically prepared samples of unlabeled NM that were analyzed by ThT binding (Figure 13B) and by SDS-AGE (Figure 13C). Under these conditions the chaperone-mediated reaction had a 5 h lag phase followed by a rapid increase in acrylodan fluorescence. The time course of the reaction corresponded with both an increase in ThT binding and the formation of high molecular weight SDS-resistant smears of NM.

The requirement for assembly of nucleating particles can be circumvented by seeding the reaction with preformed fibrils and thereby eliminating the lag phase of polymerization. In undisturbed reactions we found that seeding the unpolymerized NM with sonicated NM fibrils stimulated fibrilization even FIB+ although the end-point of ThT binding was not as high as reactions seeded in the PB (Figure 13D). This observation suggests that inhibition of fibrilization in FIB+ occurs primarily at the nucleation step and that molecular chaperones restore the possibility of nucleation but do not eliminate the lag phase of the reaction.

2.3.3 The M-domain destabilizes [PSI+] in vivo and inhibits chaperone- dependent fibrilization in vitro

It is uncertain that chaperones play a critical role in the nucleation of prions in vivo as is the case in our in vitro reaction. But it is likely that at the level of protein-protein contacts, the chaperone-Sup35 interactions that promote nucleation in vitro are the same as those that are involved in [PSI+] propagation in vivo. To date, it is uncertain where molecular chaperones bind to Sup35. We hypothesized that Hsp104 dependent propagation of [PSI+] would depend on an interaction between Hsp104 and part of Sup35 that is accessible in the assembled state — likely the M-domain. The M-domain has previously defined as the region from Met 123 to Met 253

82 based largely on the convenience of using the methionine codons as an translation initiation codon for the expression of truncated Sup35. In Sup35 the N-terminal domain is composed two subregions. The very N-terminal Gln- and Asn-rich region (1-40) is largely protected from proton exchange (Toyama et al., 2007) and inaccessible to chemical modification (Krishnan and Lindquist, 2005) in assembled fibers. The N domain also contains 5.5 tandemly repeated nonapeptide sequences (P/QQGGYQQ/SYN: residues 41-97) that are involved the stability of some prion strains (Shkundina et al., 2006) and may form part of an extended core structure in some fibrils. For our experiments we chose to extend the M-domain to residue Tyr 106 which is within a region situated C-terminal of the peptide repeats and the basic region of the conventionally defined M-domain in a part of NM that is only partially protected from proton exchange in assembled fibers of different types and largely accessible to chemical modification.

When M-domain alone was over-expressed in a [PSI+] yeast the prion was progressively lost over time (Figure 14A,B). We next tested the ability of the purified M-domain to inhibit chaperone-dependent fibrilization in vitro. For these experiments we adopted the assay for acrylodan-labeled NM described above to a 96-well microplate format enabling us to simultaneously monitor a number of reactions. We observed a substantial delay in nucleation that was dependent on the concentration of M-domain.

We considered the possibility that the M-domain plays direct role in physically interfering with fibril expansion in vitro and in vivo. We therefore performed spontaneous fibrilization reactions in the presence of M-domain. We initially attempted these reactions in microwell plates with the acrylodon-labeled NM but we noted considerable well-to-well variation in the progress of the reaction possibly attributable to the type of agitation we were able to perform in the plate reader (data not shown). We therefore used our standard gentle rotation method for spontaneous fibrilization and a standard format (see Figure 14) for chaperone dependent fibrilization in the presence of various concentrations of M-domain measuring the outcome with ThT binding. In overnight (16 h) reactions we found that M-domain did not interfere with spontaneous fibrilization but did inhibit chaperone-dependent fibilization at higher concentrations (Figure 14E).

A B e

e 100 100

e )

m s

s 75

u u

e 75

e +ATP

o i

u x

f a

d m m

d 50

e f

z o

l l

25 a

(

( m

m 25 r

r -ATP

o N

N 0 0 0 1 2 3 4 5 6 7 0 1 2 3 4 5 6 7 C Time (h) D Time (h)

e s

aggregates c a

s 8

i u

l 4

h F monomer T 0 0 1 3 3.5 4 5 5.5 6 6.5 7 - - Seed Time (h) + + FB FIB+

Figure 13: Continuous monitoring of fibrilization with fluorescent NM.

(A) Time course of a 3 µM NM (25% acrylodan-labeled NMY106C) fibrilization measured at 10 min intervals at ambient temperature. (B) Fibrilization reaction with 3 µM of unlabelled NM was run in parallel with the reaction in panel B. ThT binding was normalized to the initial and final values and expressed as a percent. (C) Samples of the parallel 3 µM NM fibrilization reaction were incubated at 38ºC for 25 min, separated by SDS-AGE, blotted and probed with an anti-M domain antibody. (D) Preformed NM fibers were sonicated and added, as indicated, to a final concentration of 15 nM to 3 µM NM and incubated overnight without agitation. ThT fluorescence was expressed as fold increase over the initial value (N=3).

A anti-Sup35 blot C Md 75

Md Control d

e r

u 50

B %

25 Control d

M 0 0 3 6 9 D Days in culture

l 100

e no Md

c r

t 20 µM

n e ) 40 µM

c 80

o m

s 80 µM

C e

m i

o 60

f a

d m

Day 0 Day 9 e 40

% (

m 20 r

o -ATP N 0

0 2 4 6 8 10 Time (h) E Spontaneous Chaperone-dependent

T T h

h 80 T

T 20

e e

n c n c

i i

n 60

e e e

e 15

s s

c c

a s a s

e e e e

r r r

r 10 40

c o c o

n u n u

i i

l l

F F d

d 20 l

l 5

o o

F F 0 0 0 5 10 20 40 60 0 5 10 20 40 60 Md concentration (µM) Md concentration (µM)

Figure 14: M-domain interferes with prion propagation and chaperone dependent fibrilization.

(A) Western blot of M-domain expression in OT55. The protein concentration of extracts were equalized prior to loading. Yeast harbouring a plasmid lacking an insert was used as control. (B) At the start of the culture (Day 0) and at intervals during culture in 50 µM copper to induce M- domain expression, aliquots of cells were plated on medium lacking copper. Day 0 and Day 9 plates are shown. (C) The number of red-pigmented cells (cured) on all plates were scored as a percentage of the total number cells. (D) Fibrilization of acrylodan-labelled NM was monitored in a 96-well plate in reactions chaperone-dependent reactions. Reactions were supplemented with the indicated concentration of purified M-domain (N=3). (E) The effect of M-domain on spontaneous and chaperone dependent fibrilization in 16 h reactions was measured by ThT fluorescence and expressed as fold increase in fluorescence compared to the starting material (N=2).

22500 Ssa1 inhibition +ATP

0.02 µM

)

c n

n 18000

y r

s 0.06 µM

e a

r r

t i

o 13500 2 µM

u b

r F

a 6 µM ( 9000 -ATP

0 3 6 9 12 Time (h)

Figure 15: Ssa1 inhibits chaperone dependent fibrilisation

Inhibition of chaperone-dependent fibrilization by Ssa1. 3 µM total NM consisting of 75% unmodified NM and 25% acrylodan-labeled NMY106C was incubated in FIB+ together with 0.1 µM Hsp104 hexamers, 0.3 µM Ydj1 dimers, and 0.6 µM huHsp70 monomers, ATP and an ATP regenerating system without Ssa1 or with the indicated concentrations of Ssa1 monomers. A reaction lacking ATP was used as a negative control. Acrylodan fluorescence was monitored with an excitation wavelength of 380 nm and emission wavelength of 460 nm.

Discussion

A robust system in which the remodeling NM is wholly dependent chaperones is an important step toward identifying the sites of interaction between chaperones and a specific well- defined substrate. In the glycerol/Tween 20-supplemented buffer described in this procedure we did not observe spontaneous formation of fibrils in either still or gently rotated reactions even after prolonged incubations. However, with the addition of sonicated fibrils, unpolymerized NM is readily recruited into fibrils in the same buffer. These observations suggest that spontaneous fibrilization under these conditions is blocked primarily at the nucleation step and not at the stage of fibril elongation.

In TEM images we saw networks of amorphously aggregated material in reactions lacking chaperones (not shown) or when the ATPase activity of Hsp104 is blocked by GdmHCl. This supports the idea that the inclusion of glycerol and TWEEN 20 in the buffer promotes the formation of aggregates that are off-pathway with respect to nucleation. It is possible that the role of chaperones in promoting nucleation is to extract NM monomers out of these aggregates making them available for the formation of on-pathway oligomers that can, in turn, nucleate fibrilization. We have observed that spontaneous fibrilization of NM buffer in FIB+ can be achieved by enhancing agitation during rotation. For example we could observe spontaneous fibrilization with overnight rotated incubations by filling microcentrifuge tubes with unpolymerized NM in FIB+ with only 200 µL of solution compared to the 800 µL we used in a standard reaction (data not shown). Thus it appears that molecular chaperones perform an action that can be replaced by more vigorous shear forces.

Another intriguing observation was that Hsp104 by itself was not able to promote nucleation in contrast to other reports (Shorter and Lindquist, 2004, 2006). It is possible that the high rotation speeds (80 rpm) which accelerates nucleation relative to still reactions, substitutes for molecular chaperones that might normally co-operate in Hsp104-mediated disaggregation. Indeed, one of the proposed roles for Hsp70/40 chaperones in Hsp104-mediated refolding is to reduce large aggregates to smaller aggregates before Hsp104 can extract polypeptides from them (Zietkiewicz et al., 2004; Zietkiewicz et al., 2006).

It is also interesting that in previously published work the elimination of the fibrilization lag phase was supported in reactions containing Hsp104 alone together with the slowly-

88 hydrolyzed ATP analog AMP-PNP (Shorter and Lindquist, 2004). We find that a ―trap‖ mutant of Hsp104 that can bind but not hydrolyze ATP and which can bind a model unfolded protein in the presence of ATP (Bosl et al., 2005; Lum et al., 2008) does not promote nucleation suggesting that Hsp104 is not playing a passive role as a template the formation nuclei in our reactions.

The requirement for Hsp70 and Hsp40 in nucleation is similar to the requirement for bichaperone network-dependent refolding of amorphously aggregated proteins by Hsp104 (Glover and Lindquist, 1998; Krzewska et al., 2001). In the case of denatured aggregated proteins, both cytosolic Ssa1 and Ssa2 Hsp70s and Ydj1 and Sis1 Hsp40s have been shown to functionally interact with Hsp104 to promote refolding. However, we found that Ssa1 inhibits the fibrilization reaction (Figure 15). On the other hand, substituting Ssa1 with huHsp70 (HSPA1A) promotes fibrilization, resulting in successful fiber formation. Previously, it was shown that Hsp104 functions as a protein refolding factor when expressed in human cells, and also in vitro in co-operation with both huHsc70 and huHsp70 and the human Hsp40s Hdj1 and Hdj2 (Mosser et al., 2004). This suggests that Hsp104 is able to work both with human and yeast co-chaperone network to effect protein disaggregation. Thus it is currently enigmatic why huHsp70 supports fiber formation whereas S.cerevisiae doesn’t. On the other hand it is not unexpected that Ssa1 does not support fiber formation and is even inhibitory as the chaperones inhibitory characteristic has been previously described (Krzewska and Melki, 2006; Shorter and Lindquist, 2008). Further work will be necessary to establish how huHsp70 and S. cerevisiae Ssa1, interacting with the same Hsp40, promote such different outcomes of the chaperone dependent fibrilization reaction.

Another aspect of this reaction that entices further research concerns additional cofactors. For example, Hsp70 activity is crucial for this chaperone dependent fibrilization assay, modulators of its activity would thus be expected to also affect the chaperone dependent fibrilisation process. For example, Sse1 or Hsp110, an Hsp70-like protein with an extended C- terminal domain, which can also be found in association with Sup35 aggregates from [PSI+] cells (Fan et al., 2007; Sadlish et al., 2008) would be a likely candidate to modulate the fibrilisation process. Especially since Sse1, a nucleotide exchange factor for Hsp70 but a chaperone in its own right was shown to accelerate nucleation in spontaneous fibrilization reactions (Sadlish et al., 2008).

The chaperone-dependent fibrilization technique we present here could serve as basic working model that can be adapted to investigating the influence of additional factors in [PSI+] acquisition, propagation and curing.

Finally, we have shown that the M-domain may be an important determinant of chaperone-dependent propagation in vivo and in vitro. Others had previous shown that elimination of the M-domain and/or the replacement of the M-domain with other segments resulted in mitotic instability of [PSI+] (Liu et al., 2002). Because inclusion of the M-domain inhibits only chaperone-dependent fibrilization and not spontaneous polymerization we propose that the M-domain, a segment of Sup35 that is at least partially exposed in the assembled prion, contains chaperone-binding sites that are critical for the propagation of [PSI+] in vivo and for the restoration of nucleation in our in vitro assay system and acts as a competitive inhibitor in both.

2.4 Materials and Methods

2.4.1 Cloning and protein preparation

NMA TAATACGACTCACTATAGGGAGA NMB GGGAATGTTACCAGTGCTGATGCCTTG M22A GCTAATCATATGAACTACAATAACAATTTGCAAGGA M22B GCTAATGAATTCTTAATCGTTAACAACTTCGTC NMCys106B CCAGCTTGATATCCTTGCAAATTGTTATTGCAGTTGAAGTTTTTG NMC GAAGGAGATCCATGGGGTCGGATTCAAACC CUP1A TTTTTGAGCTCGATATCGAATTCCTATACG CUP1B CGTTTGGTCGTTCATCCCGG MCUP1A GAAGGAGATGGATCCATGAACTACAATAACAATTTGC MCUP1B GGTGGTGGTGGTGCTCGAGTGCGG huHsp70 (A) TTTTTGGATCCTCGTCGTCGTCGGCCAAAGCCGCGGCGATCGGC huHsp70 (B) AAAAAGAGCTCCTACTAATCTACCTCCTCAATGGTGG

Table 2: Primers used to generate NM,NMCys106 and M-domain

The NM domain was cloned from pJC45NM (Glover et al., 1997) with the primers NMA and NMB using NdeI and BamHI to insert the product into pET3a (Novagen) to create pET3aNM. For fluorescence measurements a mutation was introduced (Krishnan and Lindquist, 2005) using primers NMCys106B and NMC (Table 2). The PCR product was then cloned into pJC40 (Clos and Brandau, 1994) using NcoI and EcoRV. A codon encoding a single Gly residue was inserted

90 after the initiation codon to maintain the correct reading frame. Primers M22A and M22B were used to amplify the M-domain (residues 106-253) from pET3aNM and subsequently inserted into pET22b using NdeI and EcoRI to create plasmid pET22bM. p425CUP1 was generated by amplifying the CUP1 promoter from pCAUHSEM104 using primers CUP1A and CUP1B. The GAL1 promoter in p425GAL1 (Mumberg et al., 1994) was replaced with the CUP1 promoter using SacI and BamHI. For expression in yeast the M-domain was amplified from pET22bM using primers MCUP1A and MCUP1B. The PCR product was inserted into p425CUP1 using BamHI and XhoI. All constructs were sequenced to verify the fidelity of amplification. Human Hsp70 (Wu et al., 1985) was amplified using huHSP70 primers (A and B) and inserted into pPROEX using BamHI and SacI restriction digest.

2.4.2 Protein expression and purification

Proteins were expressed in BL21 [DE3] strain of E. coli harboring the pRARE plasmid. Fresh transformants were grown in 1 L of Circlegrow (Qbiogene, Inc.) with 100 µg/mL ampicillin and

34 µg/mL chloramphenicol and grown at 37°C to an OD600 of 0.5-0.7. Expression was induced with 1 mM IPTG followed by incubation at 25°C for 4 h. Cells where harvested, washed in lysis buffer (150 mM NaCl, 40 mM HEPES, pH 7.5, containing 1 µg/mL each of pepstatin A, leupeptin, and aprotinin and 0.1 mM PMSF), flash frozen in liquid nitrogen and stored at -80°C until purification. Lysis buffer for M-domain expression was 40 mM Tris-HCl, pH8.4, 10 mM NaCl with protease inhibitors. NM-domain, NMY106C and the M-domain, were all purified at room temperature. NM-domain and NMY106C were lysed in lysis buffer by boiling at 99°C for 25 min. The lysate was then cleared at 20,000  g for 30 min. For NM-Domain purification the supernatant was rapidly precipitated with 50% saturated ammonium sulphate. The resulting pellet was resuspended in 40 mM citrate pH 5.0, 1.6 M (NH4)2SO4, 8 M urea, filtered and applied to HiTrap Phenyl-sepharose (high sub) fast flow (GE Healthcare, NJ, USA). Columns were washed with at least 20 column volumes and eluted with the same buffer without ammonium sulfate. Protein was buffer exchanged into 40 mM Tris-HCl pH 8.4,10 mM NaCl, 8 M urea on a G-25 column (GE Healthcare, NJ, USA ) and subsequently bound to a HiTrap Q HP (GE Healthcare, NJ, USA) column, washed with at least 20 column volumes and eluted with 40 mM Tris-HCl pH 8.4, 250 mM NaCl, 8 M urea. The protein was aliquoted, precipitated with 9 volumes of cold methanol. Pellets were dried and stored at -80°C. For purification of the

NMY106C protein, 5 mM β-mercaptoethanol is added to all buffers. For M-domain cleared lysate was loaded onto HiTrap Q HP (GE Healthcare, NJ, USA), washed with at least 20 column volumes of 40 mM Tris-HCl, pH 8.4, 60 mM NaCl and eluted with same buffer containing 250 mM NaCl. The protein was dialysed against sterile water, aliquoted, flash frozen and stored at - 80°C. The M-domain was resuspended in buffer AA (Tris-HCl, pH 8.4, 10 mM NaCl) and then lysed by boiling at 99°C for 25 min. The lysate was centrifuged at 20,000  g for 30 min. The cleared lysates was loaded onto HiTrap Q HP (GE Healthcare, NJ, USA), washed with at least 20 column volumes of AAII buffer (40mM Tris-HCl, pH 8.4, 10 mM NaCl,) and 5% (v/v) ABII buffer (40 mM Tris-HCl, pH 8.4, 1 M NaCl,) AAII. Protein was eluted at 25% (v/v) ABII buffer in AAII. Proteins were dialysed against sterile water, aliquoted, flash frozen and stored at -80°C. The chaperones (Hsp104, huHsp70, Ydj1) were purified as described previously (Cyr et al., 1992; Lum et al., 2004).

2.4.3 Protein Labeling

Purified NMY106C was incubated for 30 min at room temperature with 10 mM dithiothreitol (DTT). DTT was removed and the buffer changed to 6 M guanidinium hydrochloride using a G- 25 column. A 20-fold molar excess of acrylodan (Invitrogen, CA, USA) dissolved in DMSO was added and the reaction was incubated overnight at room temperature. Unbound acrylodan was removed by desalting on G-25. Labelled protein was aliquoted, flash frozen and stored at -80°C.

Labeling efficiency is determined by measuring acrylodan absorbance A372 (extinction -1 -1 coefficient = 844114 M cm ) relative to the protein concentration determined at A280 (extinction coefficient = 28310 M-1cm-1). Labeling efficiency was above 50%.

2.4.4 Fluorescence measurements

Samples were brought to 10 µM Thioflavin T and fluorescence measured using the Spex Fluorolog-3 (Jobin-Yvon) using an excitation wavelength of 442 nm and emission wavelength of 482 nm. For time-dependent fibrilization, 25% of the total NM concentration was substituted with acrylodan-labeled NMY106C. Reactions were monitored at 10 min intervals for up to 10 h using an excitation wavelength of 380 nm, and an emission wavelength of 460 nm). To record spectra of acrylodan-labeled NM before and after fibrilization, samples are excited at 380 nm and emission was recorded in 0.5 nm increments (bandwidth is 2 nm) between 440 to 560 nm.

96-well plate fibrilization reactions were carried out in a volume of 100 µL in black, clear flat- bottom, non-binding 96-well plates (Corning, NY, USA). Fluorescence was measured in a FLUOstar Omega (BMG LABTECH GmbH, Germany) fluorescence plate reader equipped with 380 nm excitation and 460 nm emission filters. Measurements were taken at 10 min intervals using 10 flashes per read.

2.4.5 Fibrilization conditions

All fibrilization reactions were carried out at ambient temperature. For spontaneous reactions, 3 µM of NM protein in 150 mM NaCl, 25 mM HEPES-KOH, pH 7.5 (FB) was rotated end-over- end at 8 rpm on a laboratory wheel. A second buffer (FIB) 25 mM HEPES-KOH, pH 7.5, 5 mM KCl was supplemented (FIB+) with 0.03% (v/v) Tween™ 20 and 10% (v/v) glycerol in Figure 11A (as indicated) and B. A standardized version of FIB+ containing 2% (v/v) glycerol and 0.006% Tween™ 20 was used in all subsequent experiments. Seeded reactions were carried out in FB and FIB+ buffer. For these reactions, preformed fibers were sonicated and 0.015 M final concentration was added to freshly dispersed 3 µM NM and incubated overnight without agitation at ambient temperature. The increase in ThT signal was measured relative to samples that were flash frozen immediately after seeding. In chaperone-dependent reactions, Hsp104, huHsp70 and Ydj1 at a final concentration of 0.6 µM with respect monomers was added to 3 µM NM together with an ATP-regenerating system consisting 40 mM creatine phosphate and 12 U of creatine phosphate kinase, 10 mM MgCl2, and 1 mM DTT. ATP was added to a final concentration of 1 mM to initiate the reactions. Prior to the addition, M-domain was filtered through a 0.22 m syringe filter (Millex filters, Millipore, MA, USA) and its concentration determined with a Micro BCATM Protein assay Kit (ThermoFisher Scientific, Nepean, ON, CAN).

2.4.6 Yeast strains and manipulation

For in vivo curing of [PSI+] by M-domain expression, the yeast strain OT55 (MATa, ade1- 14UGA, his3, leu2, trp1-289UAG, ura3 [PSI+]) (Newnam et al., 1999) was with p425CUP1M or p425CUP1. Both strains were cultured in minimal selective medium with 50 M CuSO4 and repeatedly diluted into 3 mL of fresh medium. At regular intervals cells were removed, washed

in sterile water and plated on selective medium, lacking CuSO4. Curing was assessed by colony colour with pale cells considered to be [PSI+] and red colonies [psi-].

2.4.7 Gel electrophoresis and Western blotting InFigure 13, and equal volume of each reaction was heated in sample buffer for either 5 min at 95°C or 20 min at 38°C, resolved on a 10 % SDS-PAGE slab and stained with Coomassie blue. For detection of NM aggregation, reactions were heated in sample buffer for 20 min at 38°C and resolved on 3 mm thick 1.8% agarose gels prepared in 375 mM Tris-HCl, pH8.8, 0.1% (w/v) SDS and overlaid with a 1.8% stacking gel made in 125 mM Tris-HCl, pH 6.8, 0.1% (w/v) SDS. Gels are run for 1 h at 125 V. Proteins were transferred to a PVDF membranes (Pall Corp. FL, USA). Membranes were blocked in TBS-T (20 mM Tris-HCl, pH 7.6, 137 mM NaCl, 0.01% (v/v) Tween™ 20) with 5% (w/v) skim milk powder. NM was detected using an anti-N-domain polyclonal antibody at a dilution of 1:500. For Western blot analysis of M-domain expression (9A) yeast were lysed with glass beads in 150 mM NaCl, 25mM HEPES-KOH, pH 7.5, 10 mM EDTA with protease inhibitor cocktail. The lysate was cleared at 400  g, for 2 min at 4°C and the protein concentrations were determined with the Bio-Rad protein assay (Bio-Rad Laboratories, Hercules, CA). 30 µg of each extract was separated on a 10% SDS-PAGE gel. After transfer and blocking, M-domain was detected using an anti-M-domain antibody (Santa Cruz Bioscience, CA, USA) at 1:250 dilution.

2.4.8 TEM microscopy

Samples are dialyzed overnight against ddH2O. Samples were dispersed onto carbon films and stained with uranyl acetate. Grids were observed on a Hitachi 8700 transmission electron microscope (Hitachi Science Systems Ltd., Ibaraki, Japan) with an acceleration of 75 kV and a beam current of 25 amp. Images were recorded with an AMT-digital camera system (Advanced Microscopy Techniques, Corp., Danvers, MA).

3 An Hsp104-Sup35 interaction site required for efficient prion propagation and Hsp104-mediated curing

3.1 Abstract

Yeast prions are propagated in vivo by Hsp104-dependent severing of pre-existing fibrilar aggregates. One such prion, [PSI+], is an insoluble conformer of Sup35 and imposes global suppression of nonsense codons. Sup35 consists of three domains: the N-domain that contains an Asn/Gln-rich segment that forms the core of prion fibrils, the highly charged M-domain, and the C-domain that functions in translation termination. Here we provide in vitro and in vivo evidence for the existence of an Hsp104-binding site in the positively-charged segment of the Sup35 M- domain. The intact Sup35 M-domain inhibits chaperone-dependent fibrilization of Sup35 NM, stimulates the ATPase activity and competes for protein binding to Hsp104 whereas an M- domain lacking the Hsp104 binding site loses these properties. The segment is also required for NM to undergo in vitro chaperone-dependent fibrilization. In vivo, prions composed of Sup35 lacking the segment exhibit a larger particle size distribution but are still dependent on Hsp104 for propagation. Whereas prions composed of full-length Sup35 are readily cured by Hsp104 overexpression, prions that lack the Hsp104 interaction site are completely resistant. These results suggest that yeast prions that can be cured by Hsp104 over expression must have a high- affinity Hsp104 binding site.

3.2 Introduction

In yeast, certain proteins have the propensity to exist in two stable conformations (Tuite and Cox, 2003). In the case of Sup35, the yeast homologue of eRF3, the soluble form participates along with Sup45 (eRF1) in translation termination. When sequestered in the aggregated form, the fidelity of translation termination is reduced resulting in the suppression of nonsense codons. During budding, particles of aggregated Sup35 are partitioned into daughter cells along with other cytoplasmic components where they continue to recruit newly synthesized soluble Sup35 and maintaining the suppression phenotype of the mother cell (Satpute-Krishnan et al., 2007). The ―genetic‖ element associated with the inheritance of this form of suppression is designated [PSI+]. Because of the many parallels between and the mode of transmission and expansion of mammalian prions and the molecular basis of the inheritance of [PSI+] and another factor [URE3+] first proposed by Reed Wickner (Wickner et al., 1995) the application of the term ―prion‖ to describe these elements in yeast has been generally accepted.

An important factor in the stable inheritance of yeast prions is the maintenance of a sufficiently large number of seeds to ensure partitioning of at least some of them during budding (Byrne et al., 2009). Mathematical modeling of the rate of prion loss after replication is inhibited suggest that the number [PSI+] seeds is in the range of 1000 per cell requiring several generations to dilute away these preexisting seeds before buds can be produced that are devoid of seeds (Byrne et al., 2009). In a newly formed daughter cell, inherited seeds will expand by the recruitment of newly synthesized protein. But these elongated fibers must undergo division a sufficient number of times to maintain the population of seeds required to support stable inheritance.

Propagation of virtually all yeast prions depends on the protein disaggregase Hsp104 (Osherovich and Weissman, 2002). Hsp104 is a hexameric protein with two AAA+ domains in each protomer (Bösl et al., 2006). Hsp104 contributes to survival of thermally damaged cells by extracting proteins out of aggregates. This is accomplished by contacting an extended region of protein at an accessible terminus or loop region, and through conformational changes elicited by ATP binding and hydrolysis. Hsp104 unfolds and threads the substrate protein through the central cavity formed by the assembled hexamer. A similar mechanism may be employed to

96 extract polypeptide chains from prion fibrils, thereby disrupting the hydrogen bond network that stabilizes the -sheet rich amyloid-like fibril core (Sweeny and Shorter, 2008).

The genetic interaction between [PSI+] and Hsp104 was established in a screen to search for proteins that when overexpressed destabilized the inheritance of the suppression phenotype (Chernoff et al., 1995). Once the ―protein-only‖ based inheritance of [PSI+] was established (Sparrer et al., 2000) together with knowledge of the disaggregation function of Hsp104 (Glover and Lindquist, 1998) it was logical to assume that Hsp104 overexpression intensifies the extraction of polypeptides leading to the wholesale destabilization of prion particles (Figure 16). However, neither [PIN+] (also called [RNQ+]) (Derkatch et al., 2001) nor [URE3] (Osherovich and Weissman, 2002) are cured by Hsp104. Indeed, in the rapidly expanding compilation of yeast prions including [SWI+] (Du et al., 2008) and [MOT3+] (Alberti et al., 2009) the ability of Hsp104 overexpression to efficiently cure [PSI+] is unique.

The core of the [PSI+] prion is composed of an asparagines/glutamine-rich region of Sup35 located in the N-terminal 40 residues and extending at least partway into a region of 5.5 imperfect nonapeptide repeats (residues 41-97) (Krishnan and Lindquist, 2005). Between the core of the prion and the globular C-terminal domain of Sup35 is the M-domain which is highly charged. Although there is some indication that part of the M-domain may be involved in the structured domains of the fibril (Krishnan and Lindquist, 2005) it is the most likely location of sites where Hsp104 might be able to engage Sup35 and initiate extraction and fiber severing.

As discussed in Chapter 2, we found that over expression of the M-domain in yeast inhibits propagation of [PSI+] and inhibits a chaperone dependent fibilization reaction in vitro possibly by competitive inhibition of Hsp104/Sup35 interactions. In this chapter we show that the M- domain interacts with Hsp104 and identify a 20 amino acid segment (residues 129-148) that is required for efficient severing of the [PSI+] prion. An NM-domain derivative lacking this region is resistant to chaperone-dependent fibrilization in vitro. In vivo, prions maintained by Sup35 lacking 20-amino acid binding site are larger than their wild type counterparts and are lost more rapidly by after inhibition of propagation indicating that fewer prions are present in these cells. Finally, these prions are resistant to curing by Hsp104. This represents the first time that a functional interaction site for Hsp104 has been elucidated in a known cellular target protein and explains the molecular basis of Hsp104-mediated curing of [PSI+].

97 M-Domain: Extends away from the amyloid core

N-Domain: Forms the amyloid core

Figure 16: Model of Hsp104-dependent propagation and curing of [PSI+].

An Asn/Gln rich segment of the Sup35 N-domain is thought to form the core of the prion fibril with peripheral disordered segments of the M-domain and globular C-domain (not illustrated) displayed on the surface. Fibrils grow by the recruitment of new Sup35 molecules on to the end of pre-existing fibrils. The propagation of prion seeds is accomplished by the periodic severing of larger fibrils by Hsp104 establishing a large population of transmissible particles and is common to almost all yeast prions. Prion inheritance depends on some of the seeds being transmitted, along with other cytosolic components, to daughter cells. When Hsp104 is overexpressed seeds are disassembled and the stable inheritance is perturbed as the population of transmissible seeds declines. This property is unique to [PSI+].

3.3 Results

3.3.1 The Sup35 M-domain interacts with Hsp104

In Chapter 2 it was established that over-expression of the M-domain (residues 106-253) results in the loss of [PSI+] and inhibits chaperone-dependent fibrilization of Sup35 NM in vitro (Figure 17 A). Small peptides (13-mers) that bind to Hsp104, stimulate its ATPase activity and compete for binding of the model unfolded protein reduced carboxymethylated alpha-lactalbumin (Lum et al., 2008). We observed that the middle domain also stimulated the ATPase activity of Hsp104 to about the same extent as the Hsp104-binding peptide p370, a synthetic peptide known to interact directly with Hsp104 (Lum et al., 2008). As a control, the non-binding peptide pSGG was used and showed little stimulation (Figure 17 B). The binding of fluorescently-labeled RCMLa (fRCMLa) has been measured using fluorescence anisotropy and found to be dependent on Hsp104 being in the fully ATP-bound state either using slowly hydrolyzed ATP analogs or a ―trap‖ mutant of Hsp104 that can bind but not hydrolyze ATP (Bosl et al., 2005; Lum et al., 2008). We find that the Sup35 M-domain inhibits fRCMLa binding (Figure 17 C). Together these data indicate that the M-domain interacts directly with Hsp104.

In work prior to this thesis, peptide arrays were used to identify candidate Hsp104-interacting peptides including p370 (Lum et al., 2008). When arrays of peptides corresponding to the primary sequence of the globular eRF3 domain of Sup35 were probed, Hsp104 we found that binding peptides were mostly solvent inaccessible in the folded structure consistent with the idea that Hsp104 may recognize segments of proteins that are rich in hydrophobic residues that are fully exposed only in the misfolded state. When we probed an array of peptides corresponding the Sup35 NM-domain (residues 1-253) we detected Hsp104 binding to 3 regions of the array (Figure 18). The first of these (105-120) is located after the repeat region of the N- domain and before the highly charged regions of the M-domain in a region of primary sequence we call the ―transition‖ segment. The remaining two sites are within the region of the M-domain that is rich in basic residues.

3.3.2 The M-Domain region 105-163 interacts with Hsp104

Previous experience suggests that not all peptides that bind Hsp104 on peptide arrays retain their binding properties when analyzed as soluble peptides (Lum et al., 2008). To corroborate the

99 array results, the properties of the M-domain were characterized by dividing the full-length domain into two segments. The 105-163 region contains the N->M transition segment and the positively-charged portion of the M-domain along with the putative Hsp104-binding sites detected on arrays. The second segment was composed of the more negatively-charged 164-253 region of the M-domain that had shown scant interaction with Hsp104 on the peptide array.

Attempts to express these individual segments as independent peptides or fusion proteins in [PSI+] yeast failed. Nonetheless we were able to ascertain the properties of the peptides biochemically. We found that the 105-163 region was a potent inhibitor of chaperone-dependent NM fibrilization while the non-binding 164-253 region had no effect (Figure 19A). Hsp104 ATPase stimulation by 105-163 was similar to the full length M-domain while the 164-253 polypeptide showed only weak stimulation (Figure 19B). Consistent with these findings fRCMLA binding was inhibited by 105-163 at similar levels as full-length M-Domain (Figure 19C). Competition by 164-253 was two-fold less compared to the full length M-domain and the 105-163 polypeptide.

Because the 105-163 region contained three putative binding sites for Hsp104 we sought to narrow down the candidate binding region by testing the effect of overlapping 20-mer peptides on the ATPase activity of Hsp104 and to measure their ability to compete for Hsp104 binding with fRCMLa (Figure 20). Using the p370 peptide as a standard, conditions were chosen so that we could detect either a comparative increase or decrease in peptide-mediated properties sacrificing the overall amplitude of each measurement technique. In these assays peptides spanning the region 126-161 stimulated the ATPase activity of Hsp104 and inhibited fRCMLa binding as well or better than p370. The 129-148 peptide was the most potent stimulator of Hsp104 ATPase activity as well as good inhibitor of fRCMLa binding and as such was selected for further analysis.

100

e no M-Domain

c 20 µM M-Domain

n ) e 80 40 µM M-Domain

A c m

s 80 µM M-Domain

m i

o 60

f a

d m

e 40

% (

m 20 r

o -ATP N 0

0 2 4 6 8 10

Time (h) 4

B 0

1 2.5 Md

s y

t p370

c a

n 2.0

a u

P 1.5

m T

t A

s pSGG

l o f 1.0

0 20 40 60 80 peptide concentration (µM)

C 100

)

(

p 75

s i

n 50

i l

a 25

o n 0 ATP ADP ATP+Md

101

Figure 17: The Sup35 M-domain interacts with Hsp104.

A. The fibrilization of 3 µM acrylodan-labeled Sup35 NM in the presence of Hsp104, huHsp70, and Ydj1 (0.6 µM monomers each) was monitored over time in the presence of increasing concentrations of M-domain. The enhancement of acrylodan fluorescence was normalized to the maximum value obtained in reactions without M-domain. B. The ATPase activity of Hsp104 was measured in the presence of various concentrations of M-domain, the Hsp104-binding peptide p370 and the non-binding peptide pSGG. And expressed as the fold increase over activity measured in the absence of peptide. C. Fluorescence anisotropy was used to measure fRCMLA (0.2 µM) binding to Hsp104Trap (2 µM monomer) in the presence of ATP (100%), ADP (no binding) and in the presence of 7.5 µM M-domain.

102

Figure 18: Peptide array analysis identifies candidate Hsp104-binding sites in the Sup35 M-domain.

A. 13-mer overlapping peptides spanning the Sup35 N- and M-domains (amino acids 1-253) were spot-synthesized on a cellulose membrane and probed with 35 nM Hsp104Trap with 2 mM ATP. Bound protein was transferred to a PVDF membrane and probed with anti-Hsp104 antibodies. Three binding regions were identified and are highlighted in Boxes A, B, and C. B. Schematic of the primary sequence of Sup35. C. The peptide sequences of the strong binders in panel A.

103

A Con Md105-163 Md164-253 20µM 100 Con 40µM 80µM

) 75

(

Δ 20µM 50

d 40µM

z i

l 80µM a

m 25 r

o - ATP - ATP n 0 0 2 4 6 8 10 0 2 4 6 8 10 Time (h) Time (h) B C 2.0 100

Md )

(

a l

Md105-163 t u

1.5 o 30

d 20

Md164-253 d

z i

l 10

1.0 a

m r

o 0 0 20 40 60 80 n ATP ADP Md Md164-253 Md105-163 Peptide concentration (µM)

Figure 19: Interaction of the basic region of the Sup35 M-domain with Hsp104.

A. The fibrilization of 3 µM acrylodan-labeled Sup35 NM in the presence of Hsp104, huHsp70, and Ydj1 (0.6 µM monomers each) was monitored over time in the presence of increasing concentrations polypeptides corresponding to either the basic region of the M-domain (105-163) or acidic region (164-253). The enhancement of acrylodan fluorescence was normalized to the maximum value obtained in reactions without additions. B. The ATPase activity of Hsp104 was measured in the presence of various concentrations of full-length M-domain, and the acidic and basic regions of the M-domain.and expressed as the fold increase over activity measured in the absence of proteins. C. Fluorescence anisotropy was used to measure fRCMLA (0.2 µM) binding to Hsp104Trap (2 µM monomer) in the presence of ATP (100%), ADP (no binding) and in the presence of 7.5 µM M-domain, M-domain basic region and M-domain acidic region.

104

Figure 20: The interaction of soluble M-domain peptides with Hsp104.

Overlapping 20-mer peptides corresponding the basic region of the Sup35 M-domain were assayed for Hsp104 ATPase stimulation (right panel) at a concentration of 26 µM and inhibition of fRCMLA binding (left panel) at a concentration of 7.5 µM. These concentrations were chosen so that the positive control peptide p370 effect was about 50% of its maximum. The non-binding peptide pSGG was used as a negative control.

105

106

Figure 21: Deletion of amino acid 129-148 eliminates interactions with Hsp104.

A. The ATPase activity of Hsp104 was measured in the presence of various concentrations of intact M-domain and M129-148 and expressed as the fold increase over activity measured in the absence of peptide. B. The fibrilization of 3 µM acrylodan-labeled Sup35 NM in the presence of Hsp104, huHsp70, and Ydj1 (0.6 µM monomers each) was monitored over time in the presence of increasing concentrations of M129-148. The enhancement of acrylodan fluorescence was normalized to the maximum value obtained in reactions without addition of peptide. C. Spontaneous and chaperone-dependent fibrilization of intact NM and NM129-148 were compared. For spontaneous fibilization 3 µM of the each protein was rotated over night and fibrilization was measured by Thioflavin T binding compared to the starting material and expressed as a fold increase in fluorescence. Chaperone-dependent reactions were as described in panel B with ThT-binding was used as readout.

107

3.3.3 Sup35 segment 129-148 is crucial for in vitro Hsp104 interaction properties

To test the role of the 129-148 region in conferring an Hsp104 interaction within the context of the M-domain we created an M-domain lacking these residues (Md129-148). Compared to the intact M-domain, the Md129-148 was converted into a poor stimulator of the Hsp104 ATPase activity (Figure 21A). Likewise Md129-148 failed to impair chaperone-dependent NM fibrilization. (Figure 21B).

As a corollary to these findings, we created a NM-domain derivative incorporating the 129-148 deletion (NM129-148). Since the 129-148 deletion does not include any portion of the Sup35 N-domain that makes up the core axis of the prion fibril (Krishnan and Lindquist, 2005) we anticipated that it should be able to undergo spontaneous fibrilization. In overnight, gently agitated reactions NM and NM129-148 produced roughly the same amount of ThT binding (Figure 21C, left panel) which we have previously shown correlates with the appearance of fibrils (Chapter 2). Thus deletion of 129-148 does not interfere with nucleated polymerization. However, NM129-148 was refractory to the formation of fibrils in chaperone-dependent fibilization experiments (Figure 21C right panel). We conclude that the 129-148 region is important for chaperone dependent remodeling that leads to nucleation in these reactions, but is entirely dispensable for spontaneous fibrilization.

3.3.4 Deleting Sup35 residues 129-148 results in reduced prion particle fragmentation

The above suggests that the Sup35 129-148 region is important for the Hsp104-Sup35 interaction in vitro. In vivo, low levels of Hsp104 are thought to be required for the periodic severing of Sup35 fibrils that is the basis for prion propagation (Kryndushkin et al., 2003). To test the effect of eliminating an important Hsp104-binding site from Sup35, we created a derivative of Sup35 for expression in yeast incorporating the 129-148 deletion (Sup35129-148). Single copy LEU2 plasmids for the expression of full-length Sup35 (Sup35fl) and Sup35129-148 were transformed into a [PSI+] yeast strain (780-1D; (Song et al., 2005)) in which the viability of yeast is maintained by a single copy of SUP35 present on a URA3-marked plasmid. For the analysis of Hsp104 curing (see below), cells were co-transformed with either a HIS3-marked plasmid for

108 the galactose-inducible over-expression of Hsp104 or the corresponding empty vector. Several independent isolates of each strain were cultured in 5’-fluoroorotic acid (5’-FOA) to induce the loss of URA3-marked plasmid (Figure 22 A).

After plasmid shuffling, the expression of Sup35129-148 and Sup35fl was confirmed by Western blotting (Figure 22B). The gels were run for extra time to highlight the small difference in molecular mass of Sup35fl and Sup35129-148 so that YADH that we normally use as a loading control was run off the gel. Equal loading of the lanes was double checked by protein quantitation of the extracts and Coomassie blue staining of a duplicate gel (data not shown). Sup35129-148 expression was somewhat higher than Sup35fl and this discrepancy in steady state accumulation levels was corroborated in at least three independent isolates from both [PSI+] and [psi-] backgrounds.

The presence of a suppressible ade2-1 allele in the strain background provided a convenient visual indicator of prion-mediated suppression. In [psi-] colonies, suppression is low and the colonies accumulate a red pigment indicative of a block in adenine biosynthesis. [PSI+] colonies, on the other hand, are pale indicating that sufficient full-length gene-product is produced from the ade2-1 allele to deplete the pigment pool. After plasmid shuffle the suppression phenotype of the strain with Sup35fl was identical to the [PSI+] parental strain. [PSI+] cells expressing Sup35129-148 remained [PSI+] but with an intermediate level of suppression indicted by the pink colony color (Figure 22C).

Intermediate suppression can be observed in cells with weak prion strains (Kryndushkin et al., 2003) that are characterized as having larger prion particle size distributions with concomitant increase Sup35 monomer (Kryndushkin et al., 2003). We therefore analyzed the particle size distribution of the parental strain and both plasmid shuffled derivatives on agarose gels. Indeed while Sup35fl maintained the same particle size as the parental strain, the particle size in yeast expressing Sup35129-148 was substantially larger (Figure 22D).

The larger particle size distribution of Sup35129-148 prions indicate that they are severed less frequently than fibrils composed of Sup35fl. Nonetheless the prion in this strain is stably maintained suggesting that new prion seeds are produced with at least the minimum frequency necessary for continuous mitotic inheritance. To test whether propagation of the Sup35129-148

109 prion remained dependent on Hsp104, we grew yeast strains in a low concentration guanidinium hydrochloride to inhibit Hsp104 function. [PSI+] prions maintained by either Sup35fl or Sup35129-148 were cured by this treatment confirming that Hsp104 plays a role in propagating both prions (Figure 22E). However curing of the Sup35129-148 prion was much faster and is likely indicative of the lower number of seeding particles present in this strain when the production of new seeds is halted by inhibition of Hsp104.

3.3.5 Deleting Sup35 residues 129-148 inhibits prion curing by Hsp104 overexpression

We continued to probe the consequences of eliminating Sup35 residues 129-148 by examining the effect of Hsp104 overexpression on [PSI+] curing. Strains with either galactose-inducible HSP104 or the corresponding empty vector were cultured overnight in medium supplemented with either galactose or glucose. Western blot analysis showed Hsp104 expression to be 4- to 5- fold higher in galactose medium than in glucose (Figure 23A). After overnight growth and plating onto glucose medium to suppress further Hsp104 over-expression, the strain in which [PSI+] was maintained by Sup35fl, about 50% of the colonies accumulated the red pigment associated with high fidelity termination in the ade2-1 background and were scored as ―cured‖ (Figure 23B and C). The same strain co-transformed with an empty vector in place of galactose- inducible Hsp104, were not cured by growth in galactose (data not shown). In contrast, yeast expressing Sup35 129-148 were not cured by Hsp104 over-expression.

While both in vitro and in vivo data point to an important role of the Sup35 129-148 region as an Hsp104-Sup35 interaction site, it is possible that the elimination of the 129-148 region allows for the conversion of the strong [PSI+] in the parental strain to a weaker prion strain after plasmid shuffling. Altered physical properties of the core fibril structure could explain the larger prion particle size distribution and resistance to Hsp104-mediated curing. If this were to be the case, we anticipated that if the prion maintained by Sup35129-148 had indeed converted to a different strain, the properties of this new strain would be maintained after re-introduction of Sup35fl.

We therefore reintroduced Sup35fl on a URA3 marker into both [PSI+] strains maintaining cultures for several generations in medium supplemented with leucine to permit the loss of the LEU2-marked plasmid. After restoring the genotype of the parental strain, the prion particle size

110 distribution in yeast previously expressing Sup35129-148 was restored to the same size distribution as the original parental strain (Figure 24A). Importantly, once the Sup35 129-148 region was restored, curing by Hsp104 over-expression was also restored (Figure 24B). These observations are consistent with the conclusion that in [PSI+] yeast expressing Sup35129-148, the larger particle size distribution and resistance to Hsp104-mediated curing as the direct result of an impaired Hsp104-Sup35 interaction rather than a change in the physical properties of the original prion strain.

111

112

Figure 22: Sup35129-148 displays a propagation defect in vivo.

A. schematic of the plasmid swap procedure. Viability of the yeast strain 780-1D lacking a chromosomal SUP35 gene is maintained by a single-copy URA3 marked plasmid with wt SUP35 expressed from its own promoter. For Hsp104-medaited [PSI+] curing the strain was transformed with a plasmid with Hsp104 on a galactose-inducible promoter and maintained on glucose media. Sup35 exchange was accomplished by transforming with a second Sup35 and elimination of the original URA3 plasmid by counter selection on 5’-FOA. B. After plasmid swapping expression of Sup35 and Sup35129-148 was confirmed by western blot analysis. C. The suppression phenotypes of two isolates each of [psi-] and [PSI+] were assessed by streaking on ¼ YPD. D. The SDS-resistant Sup35 particle size distributions of the [PSI+] parental strain and the plasmid-swapped strains were analyzed by agarose gel-electrophoresis and western blotting. E. Time-dependent guanidinium-HCl curing was determined by culturing cells in selective media supplemented with 5 mM GdmHCl. Aliquots were periodically with drawn and plated. Red colonies were scored as cured and expressed as a percentage of the total number of colonies counted.

113

[%]

]

- [psi

Figure 23: [PSI+] prion maintained by Sup35delat129-148 is resistant to curing by Hsp104 overexpression.

[PSI+] cells were cultured overnight in selective medium containing 2% galactose and 0.03% glucose. A. Galactose inducible Hsp104 expression was compared to cells grown in glucose by western blotting. Blots were reprobed with an antibody against yeast alcohol dehydrogenase as loading control. B. Cells were washed and plated onto glucose-containing selective medium to suppress further Hsp104 overexpression. C. Red colonies were scored as cured and expressed as a percentage of the total number of colonies counted.

114

115

Figure 24: The prion maintained by Sup35129-148 is not a different “strain”.

[PSI+] cells in which the prion was maintained by either wt Sup35 or Sup35129-148 were transformed with wt Sup35 on a URA3 marker and grown for many generations with out selection for the LEU2 marked plasmid to restore the parental cell genotype. A. The SDS- resistant Sup35 particle size distributions of the [PSI+] parental strain, the plasmid-swapped strains, and the restored were analyzed by agarose gel-elctrophoresis and western blotting. B. The strain that was restored following the maintenance of [PSI+] by Sup35129-148 was grown overnight in galactose and aliquots plated. The presence of red colonies indicates the restoration of Hsp104-dependent curing.

116

3.4 Discussion

Recognition and subsequent interaction with substrates is one of the key elements in any chaperone mediated protein remodeling reaction. Hsp70 proteins can either recognize substrates by themselves or with the help of the Hsp40 co-chaperone machinery (Rudiger et al., 1997; Walsh et al., 2004). Hsp104 appears to interact directly with the NM domain of Sup35 (Shorter and Lindquist, 2004), with peptides (Lum et al., 2008) and the model unfolded protein RCMLA (Bosl et al., 2005). However, the action by chaperones such as Hsp70 and Hsp40 may also be important for the transfer of aggregated proteins to Hsp104 (Haslberger et al., 2007; Tipton et al., 2008). Previous work has established that peptides binding to Hsp104 are typically enriched in non-polar and large aromatic residues (Lum et al., 2008). Due to the non-polar nature of these residues, they would usually be inaccessible to Hsp104 in a correctly folded protein, providing a potential mechanism to differentiate between misfolded proteins also found in aggregates, and stably folded proteins. The Hsp104 binding site we identified in the Sup35 middle domain however (129-148) (FQKQQKQAAPKPKKTLKLVS) is surprisingly different from binding sites previously described for Hsp104.

While most Hsp104 binding sites are predicted to be hidden within a folded protein (Lum et al., 2008), the binding site identified for the M-domain is predicted to be accessible both in the cellular non-prion form and in the prion form of Sup35 (Krishnan and Lindquist, 2005; Toyama et al., 2007). Surprisingly, while it is predicted that especially large aromatic amino acids such as phenylalanine and tyrosine would be favored for Hsp104 binding, these are absent in the identified Sup35-Hsp104 binding site. In contrast, this site is enriched in polar and charged amino acids.

Together with the findings of others, our discovery might suggest that there are distinct classes of Hsp104 interactors such as unfolded proteins and aggregates (Glover and Lindquist, 1998), oxidatively damaged proteins (Erjavec et al., 2007), and prions (Shorter and Lindquist, 2004). This notion would also be supported by the finding that the normal disaggregation function, thought to be the main action of Hsp104 during thermal stress (Parsell et al., 1994b), does not require the N-terminal domain of Hsp104. The curing of Sup35 prions by Hsp104 requires the N- terminal domain (Hung and Masison, 2006), perhaps suggesting that the interaction with Sup35 or an important cofactor in [PSI+] is mediated by this domain.

117

Additionally, it is hypothesized that prions can act as selective and reversible epigenetic modifiers of metabolism or gene expression that permit rapid adaptation to stress (Shorter and Lindquist, 2005). The Hsp104 binding site identified in Sup35 would support this model and may have co-evolved with a Sup35-specific binding interaction site on Hsp104. This would promote the loss of suppression in [PSI+] and the subsequent expression of an alternative proteome which may have adaptive advantages. It is of interest to note that Hsp104 from different yeast species show various efficiencies to complement the ability of Saccharomyces cerevisiae Hsp104 to maintain [PSI+]. For example, S. pombe Hsp104 fails to propagate S. cerevisiae Sup35 prions (Senechal et al., 2009), while C. albicans is able to do so (Zenthon et al., 2006). This suggests that S. cerevisiae Sup35-specific binding function or cofactor interactions that are important for in vivo Hsp104 in S. cerevisiae may be lacking in Hsp104s from other yeast species.

Looking at the properties of binding peptides and non-binding peptides established previously (Lum et al., 2008), it is possible to predict relative binding quotients for peptides. As so far there is no data with respect to the sequence importance of binding peptides, a simple summation model can be used to generate a rough prediction whether a peptide is more or less likely to directly bind to Hsp104. The binding quotient is then determined by adding up the amino acid likelihood for individual amino acids for Hsp104 binding (Lum et al., 2008) divided by the total number of amino acids. A higher number per residue indicates a more likely Hsp104 binder. For example, the synthetic binding peptide p370 (KLSFDDVFEREYA) has a relative Hsp104 binding quotient of 17 per amino acid. This can then be compared to the non binding pSGG peptide (SGGSGGSGGSGGS) peptide which scores -20 per amino acid. The amino acid region identified in this work (129-148) (FQKQQKQAAPKPKKTLKLVS), which is comparable to p370 in its ability to stimulate Hsp104 ATPase activity, scores with a relative Hsp104 binding quotient of 12 per amino acid. This indicates that theoretical prediction of binding peptides is possible and that such binding sites likely affect Hsp104 in vivo ability to act on these substrates.

The in vitro data was then tested in vivo. One would hypothesize that in accordance with our findings, a Sup35 deletion mutant (Sup35129-148) should have reduced Hsp104 interaction. This in consequence should lead to a weaker [PSI+]. Further curing by guanidinium should be enhanced, as Hsp104 complexes are already less effective in severing Sup35 (129-

118

148) fibers. Both of these hypotheses were confirmed in vivo. However, we also observed that the Sup35129-148 showed a markedly higher expression compared to WT Sup35, despite both of the proteins being subject to the same native Sup35 promoter. This finding is interesting since others have demonstrated a role for Hsp104 in the degradation of polyglutamine repeat proteins (Lee do and Goldberg, 2010). However, we did not obtain conclusive results indicating a longer in vivo half-life for Sup35129-148 compared to Sup35fl (data not shown). Further work is necessary to further elucidate the high protein level of Sup35129-148 relative to wild type.

Others have reported that extreme overexpression of Sup35 leads to the formation of Sup35 aggregates, which are not heritable and hence are distinct from the Sup35 prionogenic form (Salnikova et al., 2005). If this were the case with Sup35129-148, the 129-148 mutant should not form prionogenic particles and one would expect the loss of [PSI+] after several generations in the absence of Sup35WT. Because we have shown not only that [PSI+] is maintained but also that the original prion strain is conserved, it seems unlikely that overexpression is sufficient in the case of Sup35129-148 to induce the formation of non- heritable aggregates. Others have reported that mild overexpression leads to the formation of larger prionogenic particles, which show reduced heritability and a weaker suppression phenotype as a result of a less effective mother-daughter cell prion transmission of larger prion particles (Derdowski et al., 2010). While this may indeed be the case in our pseudodiploid strains (Sup35WT / Sup35129-149) which show a very mild weakening in [PSI+] suppression, it is unlikely to account for the Sup35129-148 haploid phenotype of a significantly weaker suppression. This is because the overexpression of Sup35129-148 is the same in pseudodiploid or haploid Sup35129-149 cells. Given the same expression level of prionogenic protein, it would be expected that the phenotype of reduced suppression, based on only protein overexpression, would remain the same in both pseudodiploid and haploid cells. However, this is not observed.

It is likely that Sup35129-148 and Sup35WT are incorporated into the same prion particles; even after several generations of Sup35129-148 haploidy, once Sup35WT is reintroduced the original prion strain reemerges. This would not be expected if Sup35 and Sup35129-148 formed distinct particles that do not interact with each other, since in that case either [PSI+] would be lost or a different prion strain would emerge, after several generations of

119 cells solely expressing Sup35129-148. Thus it is unlikely that WT and mutant Sup35 form separate complexes containing only the WT or the mutant form.

Taken together, these data suggest that overexpression by itself does not account for our observations of reduced suppression by Sup35129-149, making a reduced Hsp104 Sup35129- 149 interaction the likely cause of the change in suppression phenotype.

Future work will have to establish whether such binding sites are unique to Sup35, or if they can also be found in other yeast prions. Of the known yeast prions, most are dependent on Hsp104 for their propagation; however, only Sup35 can be cured by Hsp104 overexpression (Osherovich and Weissman, 2002). However, this unique curing ability of Sup35 may not be due to a robust interaction of Hsp104 with Sup35, but rather the disaggregation products of the prion In in vitro experiments (Shorter and Lindquist, 2006), Hsp104 acted on both Ure2 and on Sup35, but their respective disaggregation products exhibited different characteristics. In the case of Sup35, the disaggregation products were unable to seed new fibers in vitro or to efficiently convert [psi-] yeast to [PSI+] when introduced into yeast. In the case of Ure2, the disaggregation products retained their fiber seeding capacity in vitro and could transform yeast from [ure3] to [URE3].

One can hypothesize that there are a variety of Hsp104 recognition motifs, which may differentiate different types of substrates from prions to protein aggregates. If such a region were to be removed, the resulting reduction in prion propagation might be similar to what is observed when prions are maintained by Hsp104 mutants with attenuated ATP hydrolysis (Takahashi et al., 2007). In agreement with these findings, earlier work also demonstrated that direct inhibition of Hsp104 ATPase activity by guanidinium also results in a increase in prion fragment size, presumably due to a loss of prion fragmentation (Kryndushkin et al., 2003). This shows that prion fragmentation is intrinsically dependent on Hsp104, and any reduction in Hsp104’s ability to sever these fibers has an immediate impact on particle size. These observations are in agreement with the results of this study, where removal of an Hsp104 binding site reduces fragmentation rates in the presence of a fully active Hsp104 protein pool.

In turn, this also suggests that curing of [PSI+] by Hsp104 overexpression is critically dependent on both fiber stability as well as Hsp104’s ability to interact with the prion. It is well established

120 that the physical stability of Sup35 prions has a direct effect on the degree of suppression (Tanaka et al., 2004). This stability is attributed to differences in the interactions of proteins in the fiber axis. Our results suggest that different interaction patterns could affect the accessibility of an Hsp104 recognition site and might also play a role in the biological properties of different prion species. In this case, one would expect that removal of such a binding region, as was done in this study, should mimic a weak [PSI+] and alter the ability of over-expressed Hsp104 to effect prion curing. Here we see support for this hypothesis, as we observe both a reduced fragmentation rate that gives rise to a weak [PSI+] without changing the thermodynamic stability of the prion, and a reduced ability of Hsp104 to cure the binding site deficient prion variant. Thus, this data would describe the first case in which differences in suppression arise from differences in a prion’s ability to interact with Hsp104 rather than a difference in prion fold. It would be intriguing to examine how fibers with different thermodynamic stabilities present the Hsp104 interaction region. For example, it is known that fibers that show a higher stability also show an extended stable core structure spanning many of the first 70 amino acids, relative to less stable fibers that may be restricted to the basic core structure of the initial 40 N-terminal amino acids (Toyama et al., 2007). However, the degree to which this affects the Hsp104 recognition motif, which is not located within the core structure, is unknown.

As data accumulates that suggests that Hsp104 may have multiple functions within a cell, not limited to protein disaggregation, the nature of these other potential roles can be investigated. Consequently, the question of how Hsp104 is able to specifically interact and differentiate between different substrates becomes crucial. For example, curing of the Sup35 prion may require such a special recognition site, and consequently its removal obliterates the ability of Hsp104 to cure Sup35 prions. Further, this work shows that Sup35 lacking the Hsp104 interaction region shows an elevated level of expression.

3.5 Materials and Methods

3.5.1 Mutagenesis and plasmid construction

All oligonucleotide sequences are listed in Table 3. To generate the M domain truncations 105- 163 and 164-253 primers M105-163 (A and B) or M163-153 (A and B) were used respectively. PCR products were then subcloned using BamHI and XhoI into the pET22b(+) vector (Novagene). Overlap extension polymerase chain reaction was used to generate pET3a NM

121

129-148 using primers NM 129-148 (A and B) in combination with primer NM (A and B). Flanking AgeI and BstBI restriction sites were introduced resulting in Q118E and S150T. These substitutions in themselves have no effect on the suppression phenotype of [PSI+] or Hsp104- mediated curing (data not shown). Using BclI and PstI the NM 129-148 fragment was then subcloned into pRS315 Sup35 (Hara et al., 2003; Sikorski and Hieter, 1989) generating pRS315sup35129-148. NMY106C and the M-domain (residues 105-253) from pET3a NM and subsequently inserted into pET22b using NdeI and EcoRI. To generate pET22b M 129-148 primers M22 (A and B) were used with pET3a NM 129-148 as template and cloned into pET22b with NdeI and XhoI. Primer Sequence NM (A) (T7) TAATACGACTCACTATAGGGAGA NM (B) GGGAATGTTACCAGTGCTGATGCCTTG NM (C) GAAGGAGATCCATGGGGTCGGATTCAAACC NM 129-148 (A) GTCGTTCAAAGACATACCTTGAGACTGTGGTTCGAAACCAGC NM 129-148 (B) TCTCAAGGTATGTCTTTGAACGACAGTACCGGTATCAAGTTGGCCAATG M22 (A) GCTAATCATATGAACTACAATAACAATTTGCAAGGA M22 (B) GCTAATGAATTCTTAATCGTTAACAACTTCGTC M105-163 (A) TTTTTTCATATGAACTACAATAACAATTTGC M105-163 (B) ATCAGATTCCTCGAGTTATGTGCCAACCTTCTTGG M164-253 (A) GAAGGTTCATATGAAACCTGCCGAATCTGATAAG M164-253 (B) CGGAGCTCCTCGAGTTAATCGTTAACAACTTCGTCATCC

Table 3: Primers used for to generate NM and M deletion constructs

3.5.2 Yeast strains and manipulation

Plasmid swapping experiments replacing Sup35 WT with Sup35129-148 were preformed in 780-1D (MATa kar1–1, SUQ5, ade2–,1 his3Δ202, leu2Δ1, trp1Δ63, ura3–52, sup35::KanMX [pJ533: URA3-SUP35] [PSI +]) kindly provided by Dan Masison, National Institutes of Health, Bethesda, MD (Song et al., 2005). Yeast strains were transformed following the standard Lithium Acetate transformation protocol (Gietz et al., 1995). Plasmid shuffle was performed using 1mg/mL 5’- fluoroorotic acid (5FoA) supplemented in the appropriate selective media. Cells were grown until saturation diluted into fresh media selective media containing 5FOA, until saturation was reached again. Cells were then plated and selective media. For curing by Hsp104 over-expression, expression was induced in 2% galactose and 0.03% glucose selective media, cells were grown to saturation washed in sterile water and plated on selective plates with 2% (w/v) glucose. Yeast were lysed in 25 mM, HEPES-KOH, pH 7.5, 150 mM NaCl, 10 mM

122

EDTA with 1 µg/mL stock of pepstatin A, leupeptin, aprotinin and 0.1 mM PMSF. Cell debris was removed by centrifugation at 400  g, for 2 min at 4°C and the protein concentrations of the supernatants were determined using the Bio-Rad Protein Assay (Bio-Rad Laboratories, CA, USA)

3.5.3 Protein expression and purification

Hsp104, Hsp104TRAP, Hsp104E285A (Lum et al., 2004; Schirmer et al., 1998), Ydj1 (Glover and Lindquist, 1998) and huHsp70 were transformed into BL21 Gold pRIL and grown in Circlegrow (Bio101, CA, USA). Expression was induced with 1mM IPTG. After overnight expression at 25°C, bacteria were harvested and either flash frozen and stored at -80°C or used directly for protein purification. Hsp104, its mutant derivatives and Ydj1 were purified as described elsewhere (Cyr et al., 1992; Lum et al., 2004). HuHsp70 was purified following the same procedure as used for Hsp104. All purification procedures were performed at 4°C. The bacterial pellet was resuspended in 20 mM Tris-HCl, pH 8.0, 500 mM NaCl, 10 mM imidazole, 1.4 mM -mercaptoethanol with protease inhibitors and lysed by passing through a French press twice. The lysates were cleared at 20,000  g at 4°C for 30 min. The supernatant was passed three times through a Ni2+-NTA column (Qiagen). The column was washed with 100 column volumes of lysis buffer. Bound protein was eluted with the same buffer containing 200 mM imidazole. After dialysis into cleavage buffer (50 mM Tris pH 8.0, 100 mM NaCl, 5% Glycerol, 1.4 mM - Mercaptoethanol) the His-tag was removed by TEV protease cleavage for 3 h at 30°C. Cleavage reaction was then reapplied to a nickel column and cleaved protein was collected in the flow through. Cleaved protein was dialysed into anion exchange buffer A (20 mM Tris –HCl, pH 8.0, 50 mM NaCl, 10% (v/v) glycerol, 1.4 mM -mercaptoethanol) and bound to a HiTrap Q HP (GE Healthcare, NJ, USA) column. Protein was eluted with salt gradient with anion exchange buffer B (20 mM Tris pH 8.0, 1 M NaCl, 10% (v/v) glycerol, 1.4 mM -mercaptoethanol).

Constructs for the expression of M-domain segments 105-163 and 164-253 were transformed into BL21[DE3] pRARE, grown in Circlegrow at 37°C. Expression was induced with 1 mM IPTG overnight at 25°C. NM129-148, M129-148, M105-163 and M164-253 were all purified at room temperature. NM129-148 was resuspended in lysis buffer (150 mM NaCl, 40 mM HEPES, pH 7.5) and lysed by boiling at 99C for 25min. The lysate was then centrifugated at 20000g for 35 min at 4C. The supernatant was rapidly precipitated with 50% saturated

123 ammonium sulfate. The resulting pellet was resuspended in 40 mM citrate pH 5.0, 1.6 M

(NH4)2SO4, 8 M urea, filtered and applied to HiTrap Phenyl-sepharose (high sub) fast flow (GE Healthcare, NJ, USA). Columns were washed with at least 20 column volumes and eluted with the same buffer without ammonium sulfate. Protein was buffer exchanged into 40 mM Tris-HCl pH 8.4,10 mM NaCl, 8 M urea on a G-25 column (GE Healthcare, NJ, USA ) and subsequently bound to a HiTrap Q HP (GE Healthcare, NJ, USA) column, washed with at least 20 column volumes and eluted with 40 mM Tris-HCl pH 8.4, 250 mM NaCl, 8 M urea. The protein was aliquoted, precipitated with 9 volumes of cold methanol. Pellets were dried and stored at -80°C. For M129-148 and M164-253 cells were lysed in buffer AA (Tris-HCl, pH 8.4, 10 mM NaCl) by boiling at 99°C for 25 min. The lysate was centrifuged at 20,000  g for 30 min. The cleared lysates was loaded onto HiTrap Q HP (GE Healthcare, NJ, USA), washed with at least 20 column volumes of AAII buffer (40mM Tris-HCl, pH 8.4, 10 mM NaCl,) and 5% (v/v) ABII buffer (40 mM Tris-HCl, pH 8.4, 1 M NaCl,) AAII. Protein was eluted at 25% (v/v) ABII buffer in AAII. Proteins were dialysed against sterile water, aliquoted, flash frozen and stored at -80°C.

Cells expressing M105-163 were lysed by boiling in PBA (5 mM HyKxPO4 pH 6.8) and the cleared extract was applied to a ceramic hydroxyapatite colume Type I, washed with 10% PBB

(500 mM HyKxPO4, pH 6.8) in PBA and collected via gradient elution 10%-100% PBB in PBA. Protein-containing fractions were pooled, dialysed against sterile water, aliquoted, flash frozen and stored at -80°C.

3.5.4 Hsp104 binding to peptide arrays

Peptide array binding and analysis was performed as described previously (Lum et al., 2008). Briefly, Arrays were blocked in 1x Blocking Solution (Sigma- Aldrich) diluted in binding buffer (50 mM Tris-HCl, pH 8, 150 mM NaCl, 10 mM MgCl2, 1 mM dithiothreitol), rinsed three times in binding buffer, and overlaid with 35 nM Hsp104Trap in the presence of 2 mM ATP for 1 h at room temperature. Unbound Hsp104 was removed by extensive washing in binding buffer containing ATP. Bound protein was then transferred to polyvinylidene difluoride using a semidry blotter, and Hsp104 Trap was detected with a rabbit polyclonal antibody. Immunoreactive spots were detected by enhanced chemiluminescence (Amersham Biosciences) and recorded on a Versadoc imaging system (Bio-Rad).

124

3.5.5 Soluble peptide synthesis

Peptides were synthesized as previously described (Lum et al., 2008).

3.5.6 Gel electrophoresis and Western blotting

After SDS-PAGE separation, protein as transferred to a PVDF membrane (Pall Corp. FL, USA) and blocked in 20 mM Tris-HCl, pH 7.6, 137 mM NaCl, 0.02% v/v TWEEN-20 5% w/v milk powder solution. NM was detected using an anti N-domain polyclonal antibody (gift from Susan Lindquist) at a dilution of 1:500. M-domain was detected using an anti-M-domain antibody (Santa Cruz bioscience, CA, USA) at 1:250 dilution. Hsp104 was detected with a rabbit polyclonal antibody. For loading control anti- yeast alcohol dehydrogenase antibodies (Abcam, MA, USA) were used (1:5000). Yeast lysates containing prion particles were incubated in sample buffer (50 mM Tris-HCl pH 6.8, 100 mM DTT, 2% (w/v) SDS, 10% (v/v) glycerol) containing 2% SDS at either 38°C or 99°C for 25 min. The lysates were then separated on a 2% (w/v) continuous agarose gel in TAE buffer (40 mM Tris-HCl, pH 8.0, 1 mM EDTA, 20 mM Na acetate) using a horizontal gel apparatus (Bio-Rad) and separated at 100 V in TAE with 0.1% (w/v) SDS. Protein concentrations were either determined using the Bio-Rad protein assay or the Micro BCATM Protein assay Kit (ThermoFisher Scientific)

3.5.7 In vitro fibrilization

Spontaneous fibrilization was performed in PB buffer (150 mM, 25 mM, HEPES pH 7.5) with slow (10 rpm) end-over-end rotation (Roller Drum TC-7, New Brunswick, NJ, USA) at room temperature. Chaperones-dependent fibrilization was performed in FIB+ (25 mM HEPES pH 7.5, 5 mM KCl, 2% v/v glycerol, 0.006% v/v TWEENTM20) containing 2 mM ATP, ATP regenerating system (20 mM phosphocreatine, 6 U creatinephosphokinase), 0.6 M (monomers) each of Hsp104, huHsp70 and Ydj, and 3 M total of NM. Fiber formation was assessed by Thioflavin T binding (10 M final concentration) using a Spex Fluorolog-3 (Jobin-Yvon), ext.: 442 nm, em.: 482 nm. Real-time Fibrilization was measured in the FLUOstar Omega (BMG LABTECH GmbH, Germany) using black, clear flat bottom non-binding 96 well plates (Corning, NY, USA) as previously described.

125

3.5.8 fRCMLa binding fRCMLa binding was performed as previously describe (Lum et al., 2008). Briefly, 0.6 M

Hsp104 was incubated in 20mM HEPES, 150mM NaCl, 10mM MgCl2 pH 7.5 and 2mM ATP. Reactions were incubated 30 minutes at room temperature before a mixture of 0.2M fRCMLa and 7.5M peptides were added. Reactions were incubated 30 minutes at room temperature before measured with the excitation 495nm and emission 515nm.

3.5.9 ATPase assays

ATPase assays were performed as previously described (Lum et al., 2008). Briefly, a coupled enzymatic spectrophotometric assay in combination with an ATP-regenerating system (Weibezahn et al., 2003) was used to monitor ATP hydrolysis by Hsp104E285A. All reagents were purchased from Sigma-Aldrich unless otherwise indicated. Reactions were carried out in reaction buffer containing 3 mM phosphoenolpyruvate, 0.23 mM NADH (Bioshop, Canada), 70 units/ml pyruvate kinase, and 100 units/ml L-lactate dehydrogenase (both obtained from rabbit muscle), 2mM ATP, and 0.2 M Hsp104E285A. Assays were performed in a polystyrene 96-well flat- bottom plate using a SpectraMax 340PC384 microplate reader (Molecular Devices) at 30 °C monitoring NADH oxidation at 340 nm. The ATPase rate was calculated from the slope dA340 nm/dt using a molar extinction coefficient for NADH of 340 nm 6200 M-1cm-1.

126

4 Summary and Future Directions

4.1 Summary

The initial goal of establishing a robust assay to measure Hsp104 dependent fibrilization was successfully met with the development of this chaperone dependent fibrilization assay (Figure 12 and Figure 13). The assay requires the presence of both Hsp70 and Hsp40, which is dissimilar to previously published assays (Krzewska and Melki, 2006; Shorter and Lindquist, 2004). However, our assay did not require special treatments like rotation at high speeds (Shorter and Lindquist, 2004) or slow rotation at low temperature (Krzewska and Melki, 2006). The inhibitory buffer used in our assay enhanced our ability to look at chaperone dependent fibrilization by suppressing spontaneously occurring nucleation (Figure 11). As fibrilization did not require any rotation, the assay could easily be adapted to a 96 well plate format and fibrilization was monitored in real time (Figure 13). Thus, the established assay developed as part of this work represents a reliable and powerful tool that can be used to quickly screen the effect of many different agents on the chaperone dependent fibrilization process. Here, we have shown that the M-domain derived from Sup35 is able to inhibit the chaperone dependent fibrilization process (Figure 14). This in vitro observation was then tested in vivo, where it was shown that M-domain can interfere with the Hsp104 dependent process of [PSI+] propagation (Figure 14). This assay, which was described in Chapter 2, represents a reliable and stable means to measure chaperone dependent fibrilization in real time.

After we discovered that the M-domain is able to interfere with chaperone dependent fibrilization, we tried to establish how this works. Our hypothesis is that M-domain directly interacts with Hsp104 and that this interaction is responsible for the inhibitory action of the M- domain. Using several independent assays we confirmed that the M-domain interacts directly with Hsp104 (Figure 17). We narrowed down the interaction region to the basic portion (105- 163) of the M-domain (Figure 18 and Figure 19). We used ATPase stimulation as well as competition with fRCMLa to further narrow down the interaction region within the basic portion of the M-domain (Figure 20). While the data indicates that the entire region demonstrates the ability to interact with Hsp104, one short amino acid stretch (129-148) was a particularly strong Hsp104 interactor (Figure 20). Based on our hypothesis, the deletion of a potent interaction

127 region should also affect the interaction with Hsp104, and indeed that is what we observed (Figure 21). Both the ability of the M-domain to inhibit chaperone dependent fibrilization, as well as the ability to stimulate Hsp104 ATPase activity, were lost. Additionally, the NM domain lacking the region 129-148, while able to spontaneously fibrilize, was unable to form fibers in a chaperone dependent assay (Figure 21). Taken together, these data build a strong case that Hsp104 interaction with the M-domain is dependent on the amino acid sequence 129-148. We then tested the consequences of deleting this sequence in vivo. Based on our in vitro data, one would expect diminished Hsp104 interaction with Sup35d129-148 mutants, which should have an effect on the [PSI+] phenotype as well as curability by Hsp104. Using plasmid shuffle, we introduced the mutant version of Sup35 (Sup35d129-148) into the yeast strain 780-1D [PSI+]. Once the Sup35 WT was gone, we noticed weaker [PSI+] as the coloration of the colonies changed from pure white to pink. At the same time, we also determined that the particle size of the Sup35d129-148 was increased (Figure 22 and Figure 23). We tested if these observations were a consequence of a ―strain‖ switch due to the Sup35 deletion. However, once we reintroduced Sup35 WT and ―lost‖ the mutant Sup35, the original [PSI+] phenotype (both colony coloration and in vivo prion particle size) re-emerged (Figure 24). Thus the data is consistent with a reduced interaction of Hsp104 with Sup35d129-148. To further corroborate these findings, we tested the curability of both Sup35 WT and Sup35d129-148 by GdnHCl. GdnHCl inhibits Hsp104 and thus leads to the loss of [PSI+]. If Hsp104 interaction with Sup35d129-148 is weaker, curing should be enhanced relative to Sup35 WT. Indeed, our curing experiments support this hypothesis (Figure 22); further overexpression of Hsp104, usually able to cure [PSI+], failed to cure cells harboring mutant Sup35d129-148 (Figure 23). Taken together, both our in vitro as well as our in vivo data presented in Chapter 3, support a model in which Hsp104 directly interacts with Sup35, and that this interaction is dependent to a significant extent on the amino acid region 129-148 found in the basic portion of the M-domain.

128

4.2 Short term goals

In chapter 2, a novel in vitro assay was introduced that established a system in which spontaneous fibrilization is suppressed. Fibrilization in this system is dependent on chaperone action. As such, this is a potent method to screen for agents that may disrupt the chaperone action. However, it would require further investigation to determine exactly how the glycerol / Tween 20TM buffer conditions inhibit nucleation, and therefore how Hsp104 together with Hsp70 / Hsp40 may overcome this inhibition. Figure 25 shows a hypothetical model of the nucleation process occurring during lag phase in an in vitro reaction.

In this model, shown in Figure 25 A (I), it is assumed that the NM molecule may exist in equilibrium between its monomeric state, an oligomeric state and a larger aggregated state. One key assumption is that the oligomeric state is the key to the nucleation process. This is supported by earlier findings showing that enhancement of oligomer formation also enhances nucleation (Serio et al., 2000) and that oligomer specific antibodies can inhibit nucleation (Shorter and Lindquist, 2004). However, we also observed that certain modifications of the NM domain (deletion 115-165) made the construct more aggregation prone, hindering fibrilization and leading to non-amyloid aggregates at high concentrations (data not shown). This leads us to believe that while oligomer formation may be on pathway, formation of larger aggregates is likely not.

We also observed that certain physical conditions enhance nucleation. For example, the nucleation preventative effect of the inhibitory buffer can be overcome by enhancing shear forces (data not shown). This may suggest that in order for nuclei to form oligomers, the oligomers need to constantly dissociate and associate to allow the required conformational changes that ultimately lead to nucleus formation (shown in Figure 25 A (II)). Thus each cycle of dissociation and association may result in oligomers of enhanced thermodynamic stability, with the nucleus representing the relatively most stable form. However, it must be stated that ―most stable‖ nuclei is a relative term, as it has been shown that any given fiber reaction is likely to contain several structurally/phenotypically distinct nuclei populations. This makes it unlikely that ultimately only one ―most stable‖ nuclei forms (DePace and Weissman, 2002). The existence of populations of nuclei with different thermodynamic stabilities is further supported by findings that show that lower temperatures (like 4˚C) give rise to amyloids of lower

129 thermodynamic stability compared to amyloids grown at higher temperatures (37˚C) (Toyama et al., 2007). This likely also means that the nuclei at these temperatures are distinct from nuclei at higher temperatures. The proposed model Figure 25 A would explain this observation, as it postulates that oligomer association / dissociation cycles or ―oligomer evolution‖ (shown in Figure 25 A (III)) is the driving force behind nuclei formation. Lower temperatures would generally permit less stable oligomer assemblies to persist, thus the ultimately formed nuclei could also be less stable relative to nuclei that have been formed at more stringent conditions, for example higher temperatures.

Once nuclei have formed amyloid assembly commences Figure 25 A (IV). Amyloid assembly can be divided into both the interaction of non-amyloid protein with the amyloid ―ends‖ and its subsequent conversion (Scheibel et al., 2004). These ―ends‖ are the respective end points of the amyloid and may vary in their recruitment capability, as it seems not all fiber ends are able or equally efficient to recruit protein (DePace and Weissman, 2002). The creation of more amyloid ends via fragmentation of existing fibers represents the second important element in the assembly phase (Knowles et al., 2009).

The initial hypothesis postulated by this model suggests the existence of oligmers and larger aggregates. While others have shown that oligomers are important for nucleation (Serio et al., 2000; Shorter and Lindquist, 2004), it remains to our knowledge unknown how populated these oligomeric states are relative to the monomeric form at different stages of the nucleation or lag phase. It also remains unknown if the postulated larger aggregates indeed exist. At the late lag phase, up to 10% of the total NM may be in oligomeric states (Shorter and Lindquist, 2004), which suggests that oligomers should be not a subpopulation and thus should be detectable. However, in the previous study, oligomers were detected via filtration through 100kDa filters, a method that can not differentiate between oligomers and larger aggregates. Other methods like EM or AFM also show the existence of amorphous protein material (Figure 12: Role of Hsp104 in chaperone-dependent fibrilization.Figure 12); however, those methods do not directly distinguish between an oligomer and an aggregate. Further, samples subjected to EM may be prone to aggregate formation as a consequence of dehydration, while cryo-EM is limited by the requirement of well formed repetitively occurring structures due to its inherently low contrast. Solution AFM may provide a possible solution, providing oligomer assemblies that are sufficiently stable. Alternatively, it should be possible to analyze the average size of oligomers

130 and the postulated aggregates using dynamic light scattering (DLS). Previously, it has been suggested that oligomers may contain 8 or more polypeptides (Narayanan et al., 2003), which would be sufficiently different in size from monomers to be detected by dynamic light scattering techniques (Golub et al., 2007). DLS should be able to differentiate molecular species that have sufficiently large differences in their hydrodynamic radius, and due to the high sensitivity should also be able to detect small molecular populations.

These techniques could also be used to investigate how the inhibitory buffer is able to suppress nuclei formation. Theoretically, it is possible that the Tween20 / Glycerol mix stabilizes either the monomer, oligomeric, or aggregated state of NM. Since only nucleation but not fiber assembly is inhibited, a direct inhibition of protein recruitment to the amyloid can be excluded. Additionally, it was observed that enhanced shear forces neutralize the inhibitory effect of Tween20 / Glycerol. Stabilization of monomers is therefore unlikely, as it is difficult to conceptualize how shear forces would counteract this, leading to enhanced oligomer formation. On the other hand, shear forces could account for an increased de-stabilization of oligomers or aggregates. It seems most likely that either oligomers or larger aggregates are stabilized Figure 25 B (V). To test this, seeded fiber assembly under inhibitory and non-inhibitory conditions should be measured. If any of the species is significantly stabilized, and subsequently its population enriched, one should see reduced assembly rates relative to uninhibited reactions. This should be monitored via fluorescence of either Thioflavin T or acrylodan labeled NM. However, such experiments would not rule out monomer stabilization.

It would be interesting to directly look at the presence and relative distribution of NM proteins into monomers, oligomers or larger aggregates. As postulated in Figure 25 B (V), stabilization of oligomers and larger aggregates could directly inhibit the oligomer rearrangement step essential for nucleation. One possible outcome of such measurements could be that, relative to non- inhibitory conditions, more oligomers are formed relative to monomers, speaking to the idea of stabilizing oligomeric species.

One potential problem one could encounter in such measurements is that if size distribution is very broad, it could be very difficult to distinguish different oligomeric states. As oligomerisation and aggregation are partially dependent on protein concentration as well as buffer conditions, experimental conditions may have to be adjusted to obtain intelligible results.

131

For example, higher salt concentrations generally tend to disfavor oligomer formation (Serio et al., 2000), as should low protein concentrations.

Initial studies show the pivotal role of oligomers (Serio et al., 2000; Shorter and Lindquist, 2004) and demonstrate that certain antibodies that recognize some -sheet rich oligomeric species are able to suppress nucleation. However, this does not address how these late state -sheet rich oligomers form that are recognized by the antibody (Shorter and Lindquist, 2004). The process proposed by our model would suggest ―oligomer evolution‖ as the mechanism that drives nuclei formation. This process would also form the basis of our postulation as to how the inhibitory buffer may prevent nucleation Figure 25 A (V). As Tween20 / Glycerol may stabilize oligomers, this would in turn prevent the rearrangement cycle, which is essential for nucleation, from occurring. To overcome this, either enhanced shear forces or molecular remodeling factors such as Hsp104 would be required.

To test this model, FRET techniques could be used (Figure 26). The idea is that one set of NM would be labeled with a fluorescence donor, while a different set would be labeled with the appropriate quencher. In an uninhibited reaction (Figure 26 A), we should be able to observe the lag phase during which no amyloid is detected, and the assembly phase during which amyloids rapidly increase. This is represented by the red fiber curve in Figure 26 A. However, this does not give any information about the oligomeric state of non-amyloid species. Based on our proposed model of oligomer evolution, it would be expected that oligomers exist throughout the lag phase and frequently associate and dissociate. Initially, if the populations of fluorescence labeled and quencher modified NM proteins are incubated separately allowing oligomer formation to occur, and are then subsequently combined, we should observe exchange of monomers between these two species (as shown in Figure 26 A). This should result in a gradual decrease in fluorescence. Once assembly phase is initiated, one would expect a further potentially more rapid decrease in fluorescence.

132

133

Figure 25: Models for spontaneous, inhibited and chaperone assisted fibrilisation. The models are generally divided into the lag phase (nucleation phase) and the assembly phase (fiber growth). A. Shows a model for spontaneous fibrilisation. (I) Initially there is a equilibrium between the monomeric NM protein (N-domain (green), M-domain (red)), its oligomeric state, and a larger aggregated state. The oligomeric state is the key component in the nucleation process. (II) During the lag phase, oligomers frequently dissociate and re-associate, resulting in a constant rearrangement of the oligomer. (III) Over time, more and more stable oligomers are formed, until seeding competent nuclei appear that contain a stable -sheet structure. These nuclei then recruit soluble protein and the assembly phase starts. (IV) Fiber assembly consists of two distinct processes. On the one hand, soluble protein interacts with the fiber ends and is thereby converted into the amyloid state and thus incorporated into the fiber. On the other hand, fiber fragmentation is crucial for assembly as it provides additional fiber ends competent to recruit and convert additional soluble protein. B. Hypothetical model for an inhibited reaction. (V) Glycerol and Tween20 stabilize the oligomeric protein complex. Thereby they perturb the dissociation and re-association of oligomers. This in turn prevents nucleation. C. Model for chaperone assisted fibrilisation. (VI) Chaperones act on larger aggregates reducing the population of fibrilisation incompetent protein. (VII) Oligomers formerly stabilized by Tween20 and Glycerol are now disaggregated by the Hsp104/70/40 chaperone machinery. This in turn permits the constant association/dissociation of oligomers, ultimately leading to nucleus formation.

134

Based on previous work, it is unlikely that oligomers represent a marginal sub-population that would be undetectable (Shorter and Lindquist, 2004). Further, based on DLS data, it should be possible to predict the relative abundance of oligomers at different stages of the nucleation phase. This is essential for the proposed FRET experiment to work, as subpopulations may be below the detection limit of this method.

In inhibitory conditions (Figure 26 B), no fiber formation should be observed, and oligomer evolution should also be inhibited; thus no significant fluorescence quenching should be observed. Conversely, once inhibition is overcome, oligomeric rearrangement should be enhanced, and fluorescence should decrease more rapidly (Figure 26 C). It would also be interesting to see if there is a connection between the relative rate of the postulated oligomer rearrangement and the length of the lag phase. For example, given two conditions A and B (Figure 26 C) with A having a slower oligomer rearrangement rate compared to B, the relative length of the lag phase should be longer for condition A as opposed to condition B. Based on our model, a higher oligomer rearrangement rate should also result in a shorted nucleation phase. This would also be helpful to elucidate the role of chaperones in the assay. Postulated by our model, one could assume that the remodeling factor Hsp104 together with Hsp70 and Hsp40 enhances the oligomer rearrangement rate (Figure 25 A (VI/VII)). This should then result in enhanced fluorescence quenching after chaperones are added under inhibitory conditions (Figure 26 C). It would then be very interesting to see what different concentrations and ratios of Hsp104/70/40 would accomplish.

Importantly, this work has broader application than just addressing the intricacies of a particular assay system. If rearrangement of oligomers slowly leads to nuclei formation, it would form a solid basis from which to explain the significant diversity of Sup35 fiber populations or prion strain phenotypes (DePace and Weissman, 2002; Zhou et al., 1999), as such oligomer evolution would likely not have a defined outcome but lead to an ensemble of nuclei. Thus this work would be an important initial step to understand the early stages of amyloidogenesis. Additionally, the roles chaperones may play in this process could be elucidated. As many features of amyloids and amyloidogenesis are generic, it is likely that nucleation principles uncovered in this work can be generally applied to other amyloid systems.

135

136

Figure 26: Measuring oligomer rearrangement. Fluorescence labeled NM (red) is diluted from denaturing into fibrilisation buffer the same is done for NM labeled with a quencher molecule (black) in a separate tube. A. After a short incubation time, fluorescence labeled NM is combined with quenching NM. Based on the hypothetical dissociation/association of oligomers, this should result in a slow mixing of the two NM populations leading to a reduced fluorescence signal. Graphically, fibrilisation is depicted as a red dotted line. The graph is divided into lag phase and assembly phase. While during the lag phase no change in fiber signal can be detected, a population of oligomers should gradually form via association and dissociation. Thus, the initially high fluorescence signal from the labeled NM molecule should gradually decrease. Once assembly phase starts and NM gets recruited into the amyloid, a further potentially more pronounced decrease in fluorescence signal would be expected until the final amyloid equilibrium is reached. B. In an inhibited reaction, oligomers are stabilized and almost no exchange between oligomers should be observed, resulting in no fluorescence decrease (green line); also, no fiber formation would be expected (red dotted line). C. In a chaperone assisted reaction, no fibrilisation should occur if chaperones are omitted, however once added oligomer rearrangement should commence, resulting in a gradual loss of fluorescence signal. This gradual loss of signal should be dependent on chaperone concentrations and buffer conditions. We should observe different ―rearrangement rates‖ given different experimental conditions (hypothetical condition A and B).

137

A different observation in this assay is that huHsp70 supports chaperone dependent fibrilization, whereas Ssa1 shows inhibition of nucleation (Figure 15). Our findings reflect what others have previously shown, that Ssa1 in concert with Ydj1 is a potent inhibitor of fiber formation (Krzewska and Melki, 2006; Shorter and Lindquist, 2008). Given that Hsp104 can support efficient protein refolding with both human and yeast co-factors it is unclear why in the chaperone dependent fibrilization assay huHsp70 is supportive whereas Ssa1 is inhibitory (Glover and Lindquist, 1998; Mosser et al., 2004).

The role of Ssa1 in [PSI+] has been reported to be both supportive and inhibitory (for review see: (Allen et al., 2005; Sweeny and Shorter, 2008)). It seems that the effect of Ssa1 on prion formation, at least in vivo, is highly dependent on the cellular context. For example, overexpression of Sup35 together with Ssa1 leads to curing of [PSI+] (Allen et al., 2005). However, overexpression of Ssa1 alone enhances the appearance of [PSI+] (Allen et al., 2005). This suggests that the role of Ssa1 in Sup35 prion formation and curing is complex and likely dependent on its various cofactors. In our case, it would be interesting to see how Ssa1 together with different Hsp40s or Hsp110s influences the chaperone dependent fibrilization assay. It is possible to envision that one set of cofactor-Ssa1 combinations is inhibitory, while another set would enhance fibrilization. To test this hypothesis, we could run a chaperone dependent refolding reaction in a 96 well plate format, sampling many different conditions and chaperone combinations. It would be interesting to see whether combinations that support as well as combinations that inhibit chaperone dependent fibrilization could be established.

It would be interesting to attempt to develop an assay that can measure in vitro fiber fragmentation, which is suggested to play a crucial role in prion maintenance in vivo (Shorter and Lindquist, 2008). The major problem to overcome in such an assay would be that fiber fragmentation is in constant competition with fiber growth, making this hard to measure. Thus a system that prevents fiber assembly would need to be devised. The current assay, however, is unable to do this, as fiber assembly and therefore the amyloid recruitment and conversion process is not inhibited. One such system could potentially be envisioned if molecules were able to form fibers only under very specific conditions or protein concentrations. To this end, we discovered that purified M-domain at very high concentrations (up to 40 ug/ul) will spontaneously form amyloid fibers in aqueous buffer. The high protein concentration is required as fiber formation was never observed at the lower concentrations usually used in our work (2-6

138 ug/ul). In this case, fiber assembly could be stopped and fragmentation itself measured efficiently. This would also then permit investigation into factors that would inhibit fragmentation. For example, would an excess of soluble M-domain prevent fragmentation of the M-domain fibers by Hsp104? What modifications to the M-domain could be made to reduce the ability of Hsp104 to act on these M-domain fibers?

Alternatively, one could consider attempting to block amyloid propagation itself. Others have reported that molecules resembling chemical aggregates directly localize to amyloids and prevent conversion of proteins (Feng et al., 2008). For example, 50M of clotrimazole was found to effectively inhibit Sup35 amyloid propagation. The postulated mechanism suggests that the colloidal aggregates attach to the fiber, thereby preventing recruitment and conversion of other proteins. This would be a potential alternate route to develop a more robust disaggregation assay relative to the one reported by others (Shorter and Lindquist, 2006).

In chapter 3, an Hsp104 interaction site in the Sup35 molecule was identified and its significance for in vivo Sup35 prion maintenance was demonstrated. However, a direct interaction between Hsp104 and NM was not demonstrated. In order to observe a direct interaction, one could use anisotropy data. Fluorescence labeled NM molecules could be titrated to Hsp104TRAP and a binding curve established, which would allow binding constants to be derived (Lum et al., 2008). It would also allow us to test how much the interaction between NM 129-148 is reduced, as suggested by our fRCMLa competition data. This would provide direct evidence of Hsp104-NM interaction, and that this interaction is influenced directly and quantitatively by properties of the Hsp104 binding site. Furthermore, it would be interesting to see how this interaction is affected by Hsp104 N, as this construct is unable to cure [PSI+] via overexpression (Hung and Masison, 2006). One would thus predict a potentially weakened interaction between NM and Hsp104 N.

Another open question concerns what property of the region 129-148 is required for Hsp104 binding. It would be interesting to see if sequence composition rather than the sequence itself is required for Hsp104 binding, as the M-domain has low sequence complexity.

Further Hsp104 ATPase stimulation and the competition of several M-domain peptides with fRCMLa for Hsp104 binding showed mixed results. While peptide 129-148 was the strongest stimulator and competitor compared to the other M-domain peptides, it was only somewhat

139 stronger, suggesting that other peptides also had an appreciable ability to interact with Hsp104. To address this issue, the 129-148 sequence could be scrambled and subsequently the Hsp104 binding affinity determined. To this end, M-domain itself could be fluorescently labeled and direct interaction with Hsp104 could be measured via anisotropy. In addition to random scrambling of the region 129-148, known Hsp104 interactors such as p370 could be introduced, and the subsequent binding affinity to Hsp104 could be measured. As control, the non- interacting SGG peptide repeat could also be introduced. Together, this data would enhance our understanding as to what factors influence Hsp104 binding to the M-domain.

It would be also interesting to examine the structure of the molecular ensembles that are formed by short peptides, using NMR or molecular modeling. As experimental data suggests an extended random coil structure for the M-domain (Mukhopadhyay et al., 2007), it is likely that short peptides derived from this domain also do not have a defined fold. However, it is an intriguing possibility that the sequence itself determines a certain ensemble of structures, and that this ensemble itself may be the driving force for Hsp104 substrate recognition. One could then ask if a stable fold containing these interaction properties can be engineered, and if that engineered peptide would bind with enhanced affinity to Hsp104.

Still another open question is whether the concept of Hsp104 interaction sites is universal, and thus can be found in other proteins, or if adding a putative Hsp104 interaction site to a molecule would convert it into an Hsp104 substrate. The first question is harder to address, as it would require secure knowledge of several interaction sites to determine a consensus motif. While peptide array data exists that suggests preferred residues in Hsp104 binding peptides (Lum et al., 2008), it is still difficult to predict what sequence actually constitutes a strong Hsp104 binder. More Hsp104 interacting regions need to be identified and characterized before properties of Hsp104 interacting consensus sequences can be determined. On the other hand, as Hsp104 interacting peptides have been identified (Lum et al., 2008), it is possible to investigate whether these sequences can be used as a generalized binding motif to target any desired substrate to Hsp104. An Hsp104-ClpP mutant has been established which combines Hsp104 refolding and recognition with degradation (Tessarz et al., 2008). If the binding site identified in this thesis can be recognized by Hsp104 without its specific Sup35 context, the presence of the binding site should target any substrate towards Hsp104-dependent degradation by the Hsp104-ClpP construct. One could thus test a variety of substrates with the specific 129-148 peptide, its

140 scrambled versions, or inert peptides such as poly-SGG (Lum et al., 2008). One would predict that degradation of a construct such as GFP-129-148 would be enhanced due to the presence of the specific 129-148 peptide, while degradation of a six time repeat of the SGG poly-peptide fused with GFP (GFP-(SGG)6) would not be affected. Such experiments would give further in vivo evidence that Hsp104 binding sites comprise a general concept that is independent of the specific prion system described in this thesis.

4.3 Long term perspective

In the long run, a very intriguing question is whether Hsp104’s ability to recognize specific sites is a general concept applicable not only to Sup35 but other known non-prion Hsp104 substrates such as Spa2, a member of the polarisome complex required to maintain cell polarization (Tessarz et al., 2009). Analyses similar to the ones performed in this thesis would shed light on whether Spa2 has such interaction sites.

This would subsequently lead to the more general question whether Hsp104 has two distinct modes of substrate recognition. On the one hand, Hsp104 may generically interact with many denatured protein substrates as part of its disaggregation function (Lum et al., 2008). However, there may also be more specialized binding sites similar to the one identified in this work. This idea is supported by observations that show that some Hsp104 mutations only affect the Sup35 prion, but do not affect general chaperone function (Hung and Masison, 2006). Other data showing that C. albicans Hsp104 is able to support S. cerevisiae Sup35 prions while S. pombe Hsp104 is not, further speaks to the existence of specific recognition sites on substrates of Hsp104 (Senechal et al., 2009; Zenthon et al., 2006).

A second question will be whether Hsp104 direct substrate recognition is the prevalent mode of substrate targeting, or whether co-chaperones are the key players in this process, as with Hsp70 (Cyr et al., 1992; Rudiger et al., 1997; Tipton et al., 2008). While this work demonstrates that Hsp104 is able to recognize substrates itself, which is in line with earlier observations (Shorter and Lindquist, 2004), others have reported that co-chaperones such as Sis1 (Tipton et al., 2008) play a key role in substrate delivery to Hsp104. It will be intriguing to observe which of these modes of delivery is dominant. One possibility is that specific Hsp104 substrates, like the one identified in this work, are more likely to be directly identified by Hsp104, maybe even requiring Hsp104 domains that are otherwise dispensable for basic Hsp104 chaperone function (Hung and

141

Masison, 2006). On the other hand, the thermotolerance and disaggregation functions of Hsp104 may be dependent on co-chaperones delivering substrates to the disaggregase. This would be similar to the Hsp70 system (Bukau and Horwich, 1998), allowing Hsp104 to interact with a huge variety of substrates without the limitation of Hsp104-only recognition.

In essence, a better understanding of how Hsp104 interacts with substrates, and what co-factors are required for particular substrate interactions, will ultimately help to elucidate the multiple roles Hsp104 may have within the cell. This is in line with recent work that has shown Hsp104’s role in processes that are distinct from simple heat disaggregation (Erjavec et al., 2007; Lee do and Goldberg, 2010; Tessarz et al., 2009). Understanding how Hsp104 interacts with these different substrates may be an important step to understanding how Hsp104 performs multiple different roles and what exactly Hsp104’s function is in these distinct processes.

142

References or Bibliography

Akerfelt, M., Morimoto, R.I., and Sistonen, L. (2010). Heat shock factors: integrators of cell stress, development and lifespan. Nat Rev Mol Cell Biol 11, 545-555.

Alberti, S., Halfmann, R., King, O., Kapila, A., and Lindquist, S. (2009). A systematic survey identifies prions and illuminates sequence features of prionogenic proteins. Cell 137, 146-158.

Allen, K.D., Wegrzyn, R.D., Chernova, T.A., Muller, S., Newnam, G.P., Winslett, P.A., Wittich, K.B., Wilkinson, K.D., and Chernoff, Y.O. (2005). Hsp70 chaperones as modulators of prion life cycle: novel effects of Ssa and Ssb on the Saccharomyces cerevisiae prion [PSI+]. Genetics 169, 1227-1242.

Anfinsen, C.B. (1973). Principles that govern the folding of protein chains. Science 181, 223- 230.

Anfinsen, C.B., and Haber, E. (1961). Studies on the reduction and re-formation of protein disulfide bonds. J Biol Chem. 236, 1361-1363.

Bagriantsev, S.N., Gracheva, E.O., Richmond, J.E., and Liebman, S.W. (2008). Variant-specific [PSI+] infection is transmitted by Sup35 polymers within [PSI+] aggregates with heterogeneous protein composition. Mol Biol Cell 19, 2433-2443.

Bailey, C.H., Kandel, E.R., and Si, K. (2004). The persistence of long-term memory: a molecular approach to self-sustaining changes in learning-induced synaptic growth. Neuron. 44, 49-57.

Ballar, P., and Fang, S. (2008). Regulation of ER-associated degradation via p97/VCP- interacting motif. Biochem Soc Trans 36, 818-822.

Benesch, J.L., Ayoub, M., Robinson, C.V., and Aquilina, J.A. (2008). Small heat shock protein activity is regulated by variable oligomeric substructure. J Biol Chem 283, 28513-28517.

Beyer, A. (1997). Sequence analysis of the AAA protein family. Protein Sci 6, 2043-2058.

Blond-Elguindi, S., Cwirla, S.E., Dower, W.J., Lipshutz, R.J., Sprang, S.R., Sambrook, J.F., and Gething, M.J. (1993). Affinity panning of a library of peptides displayed on bacteriophages reveals the binding specificity of BiP. Cell 75, 717-728.

Bochtler, M., Hartmann, C., Song, H.K., Bourenkov, G.P., Bartunik, H.D., and Huber, R. (2000). The structures of HsIU and the ATP-dependent protease HsIU-HsIV. Nature 403, 800-805.

Boorstein, W.R., Ziegelhoffer, T., and Craig, E.A. (1994). Molecular evolution of the HSP70 multigene family. J Mol Evol 38, 1-17.

Bosl, B., Grimminger, V., and Walter, S. (2005). Substrate binding to the molecular chaperone Hsp104 and its regulation by nucleotides. J Biol Chem 280, 38170-38176.

143

Bösl, B., Grimminger, V., and Walter, S. (2006). The molecular chaperone Hsp104--A molecular machine for protein disaggregation. Journal of Structural Biology 156, 139-148.

Bracher, A., and Hartl, F.U. (2006). Hsp90 structure: when two ends meet. Nat Struct Mol Biol 13, 478-480.

Bradley, M.E., and Liebman, S.W. (2004). The Sup35 domains required for maintenance of weak, strong or undifferentiated yeast [PSI+] prions. Mol Microbiol 51, 1649-1659.

Buchberger, A., Bukau, B., and Sommer, T. (2010). Protein quality control in the cytosol and the endoplasmic reticulum: brothers in arms. Mol Cell 40, 238-252.

Bukau, B., and Horwich, A.L. (1998). The Hsp70 and Hsp60 chaperone machines. Cell 92, 351- 366.

Bukau, B., Weissman, J., and Horwich, A. (2006). Molecular chaperones and protein quality control. Cell 125, 443-451.

Burg, M.B. (1995). Molecular basis of osmotic regulation. Am J Physiol. 268, F983-996.

Byrne, L.J., Cole, D.J., Cox, B.S., Ridout, M.S., Morgan, B.J., and Tuite, M.F. (2009). The number and transmission of [PSI] prion seeds (Propagons) in the yeast Saccharomyces cerevisiae. PLoS ONE 4, e4670.

Cashikar, A.G., Schirmer, E.C., Hattendorf, D.A., Glover, J.R., Ramakrishnan, M.S., Ware, D.M., and Lindquist, S.L. (2002). Defining a pathway of communication from the C-terminal peptide binding domain to the N-terminal ATPase domain in a AAA protein. Mol Cell 9, 751- 760.

Chai, Y., Shao, J., Miller, V.M., Williams, A., and Paulson, H.L. (2002). Live-cell imaging reveals divergent intracellular dynamics of polyglutamine disease proteins and supports a sequestration model of pathogenesis. Proc Natl Acad Sci U S A 99, 9310-9315.

Chaudhuri, T.K., and Gupta, P. (2005). Factors governing the substrate recognition by GroEL chaperone: a sequence correlation approach. Cell Stress Chaperones 10, 24-36.

Chen, Y., Ding, F., Nie, H., Serohijos, A.W., Sharma, S., Wilcox, K.C., Yin, S., and Dokholyan, N.V. (2008). Protein folding: then and now. Arch Biochem Biophys 469, 4-19.

Chernoff, Y.O., Derkach, I.L., and Inge-Vechtomov, S.G. (1993). Multicopy SUP35 gene induces de-novo appearance of psi-like factors in the yeast Saccharomyces cerevisiae. Curr Genet 24, 268-270.

Chernoff, Y.O., Lindquist, S.L., Ono, B., Inge-Vechtomov, S.G., and Liebman, S.W. (1995). Role of the chaperone protein Hsp104 in propagation of the yeast prion-like factor [psi+]. Science 268, 880-884.

Chiti, F., and Dobson, C.M. (2009). Amyloid formation by globular proteins under native conditions. Nat Chem Biol 5, 15-22.

144

Clos, J., and Brandau, S. (1994). pJC20 and pJC40--two high-copy-number vectors for T7 RNA polymerase-dependent expression of recombinant genes in Escherichia coli. Protein Expr Purif 5, 133-137.

Collins, S.R., Douglass, A., Vale, R.D., and Weissman, J.S. (2004). Mechanism of prion propagation: amyloid growth occurs by monomer addition. PLoS Biol 2, e321.

Coux, O., Tanaka, K., and Goldberg, A.L. (1996). Structure and functions of the 20S and 26S proteasomes. Annu Rev Biochem 65, 801-847.

Cox, B., Ness, F., and Tuite, M. (2003). Analysis of the generation and segregation of propagons: entities that propagate the [PSI+] prion in yeast. Genetics 165, 23-33.

Cox, B.S. (1965). [Psi], A cytoplasmic suppressor of super-suppressor in yeast. Heredity 20, 505-521.

Creighton, T.E. (1990). Protein folding. Biochem J 270, 1-16.

Cyr, D.M., Lu, X., and Douglas, M.G. (1992). Regulation of Hsp70 function by a eukaryotic DnaJ homolog. J Biol Chem 267, 20927-20931.

De Mot, R., Nagy, I., Walz, J., and Baumeister, W. (1999). Proteasomes and other self- compartmentalizing proteases in prokaryotes. Trends Microbiol 7, 88-92.

De Wever, V., Reiter, W., Ballarini, A., Ammerer, G., and Brocard, C. (2005). A dual role for PP1 in shaping the Msn2-dependent transcriptional response to glucose starvation. EMBO J 24, 4115-4123.

DeLaBarre, B., Christianson, J.C., Kopito, R.R., and Brunger, A.T. (2006). Central pore residues mediate the p97/VCP activity required for ERAD. Mol Cell 22, 451-462.

DePace, A.H., Santoso, A., Hillner, P., and Weissman, J.S. (1998). A critical role for amino- terminal glutamine/asparagine repeats in the formation and propagation of a yeast prion. Cell 93, 1241-1252.

DePace, A.H., and Weissman, J.S. (2002). Origins and kinetic consequences of diversity in Sup35 yeast prion fibers. Nat Struct Biol 9, 389-396.

Derdowski, A., Sindi, S.S., Klaips, C.L., DiSalvo, S., and Serio, T.R. (2010). A size threshold limits prion transmission and establishes phenotypic diversity. Science 330, 680-683.

Derkatch, I.L., Bradley, M.E., Hong, J.Y., and Liebman, S.W. (2001). Prions affect the appearance of other prions: the story of [PIN(+)]. Cell 106, 171-182.

Derkatch, I.L., Bradley, M.E., Zhou, P., Chernoff, Y.O., and Liebman, S.W. (1997). Genetic and environmental factors affecting the de novo appearance of the [PSI+] prion in Saccharomyces cerevisiae. Genetics 147, 507-519.

145

Desai, A., and Mitchison, T.J. (1997). Microtubule polymerization dynamics. Annu Rev Cell Dev Biol. 13, 83-117.

Deuerling, E., Schulze-Specking, A., Tomoyasu, T., Mogk, A., and Bukau, B. (1999). Trigger factor and DnaK cooperate in folding of newly synthesized proteins. Nature 400, 693-696.

Dill, K.A., and Chan, H.S. (1997). From Levinthal to pathways to funnels. Nat Struct Biol. 4, 10- 19.

Dobson, C.M. (2001). The structural basis of protein folding and its links with human disease. Philos Trans R Soc Lond B Biol Sci. 356, 133-145.

Dobson, C.M. (2003). Protein folding and misfolding. Nature 426, 884-890.

Doyle, S.M., Hoskins, J.R., and Wickner, S. (2007a). Collaboration between the ClpB AAA+ remodeling protein and the DnaK chaperone system. Proc Natl Acad Sci U S A 104, 11138- 11144.

Doyle, S.M., Shorter, J., Zolkiewski, M., Hoskins, J.R., Lindquist, S., and Wickner, S. (2007b). Asymmetric deceleration of ClpB or Hsp104 ATPase activity unleashes protein-remodeling activity. Nat Struct Mol Biol 14, 114-122.

Du, Z., Park, K.W., Yu, H., Fan, Q., and Li, L. (2008). Newly identified prion linked to the chromatin-remodeling factor Swi1 in Saccharomyces cerevisiae. Nat Genet 40, 460-465.

Eaglestone, S.S., Ruddock, L.W., Cox, B.S., and Tuite, M.F. (2000). Guanidine hydrochloride blocks a critical step in the propagation of the prion-like determinant [PSI(+)] of Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 97, 240-244.

Effantin, G., Ishikawa, T., De Donatis, G.M., Maurizi, M.R., and Steven, A.C. (2010). Local and global mobility in the ClpA AAA+ chaperone detected by cryo-electron microscopy: functional connotations. Structure 18, 553-562.

Erdmann, R., Wiebel, F.F., Flessau, A., Rytka, J., Beyer, A., Frohlich, K.U., and Kunau, W.H. (1991). PAS1, a yeast gene required for peroxisome biogenesis, encodes a member of a novel family of putative ATPases. Cell 64, 499-510.

Erjavec, N., Larsson, L., Grantham, J., and Nystrom, T. (2007). Accelerated aging and failure to segregate damaged proteins in Sir2 mutants can be suppressed by overproducing the protein aggregation-remodeling factor Hsp104p. Genes Dev. 21, 2410-2421.

Ewalt, K.L., Hendrick, J.P., Houry, W.A., and Hartl, F.U. (1997). In vivo observation of polypeptide flux through the bacterial chaperonin system. Cell 90, 491-500.

Fan, Q., Park, K.W., Du, Z., Morano, K.A., and Li, L. (2007). The role of Sse1 in the de novo formation and variant determination of the [PSI+] prion. Genetics 177, 1583-1593.

146

Farr, G.W., Furtak, K., Rowland, M.B., Ranson, N.A., Saibil, H.R., Kirchhausen, T., and Horwich, A.L. (2000). Multivalent binding of nonnative substrate proteins by the chaperonin GroEL. Cell 100, 561-573.

Feige, U., and Mollenhauer, J. (1992). Heat shock proteins. Introduction. Experientia 48, 621- 622.

Feng, B.Y., Toyama, B.H., Wille, H., Colby, D.W., Collins, S.R., May, B.C., Prusiner, S.B., Weissman, J., and Shoichet, B.K. (2008). Small-molecule aggregates inhibit amyloid polymerization. Nat Chem Biol 4, 197-199.

Ferreira, P.C., Ness, F., Edwards, S.R., Cox, B.S., and Tuite, M.F. (2001). The elimination of the yeast [PSI+] prion by guanidine hydrochloride is the result of Hsp104 inactivation. Mol Microbiol 40, 1357-1369.

Fink, A.L. (2005). Natively unfolded proteins. Curr Opin Struct Biol. 15, 35-41.

Frey, S., Leskovar, A., Reinstein, J., and Buchner, J. (2007). The ATPase cycle of the endoplasmic chaperone Grp94. J Biol Chem 282, 35612-35620.

Georgopoulos, C., and Welch, W.J. (1993). Role of the major heat shock proteins as molecular chaperones. Annu Rev Cell Biol. 9, 601-634.

Gietz, R.D., Schiestl, R.H., Willems, A.R., and Woods, R.A. (1995). Studies on the transformation of intact yeast cells by the LiAc/SS-DNA/PEG procedure. Yeast 11, 355-360.

Glover, J.R., Kowal, A.S., Schirmer, E.C., Patino, M.M., Liu, J.J., and Lindquist, S. (1997). Self- seeded fibers formed by Sup35, the protein determinant of [PSI+], a heritable prion-like factor of S. cerevisiae. Cell 89, 811-819.

Glover, J.R., and Lindquist, S. (1998). Hsp104, Hsp70, and Hsp40: a novel chaperone system that rescues previously aggregated proteins. Cell 94, 73-82.

Glynn, S.E., Martin, A., Nager, A.R., Baker, T.A., and Sauer, R.T. (2009). Structures of asymmetric ClpX hexamers reveal nucleotide-dependent motions in a AAA+ protein-unfolding machine. Cell 139, 744-756.

Golub, N., Meremyanin, A., Markossian, K., Eronina, T., Chebotareva, N., Asryants, R., Muronets, V., and Kurganov, B. (2007). Evidence for the formation of start aggregates as an initial stage of protein aggregation. FEBS Lett 581, 4223-4227.

Gottesman, S. (1996). Proteases and their targets in Escherichia coli. Annu Rev Genet 30, 465- 506.

Gottesman, S., Roche, E., Zhou, Y., and Sauer, R.T. (1998). The ClpXP and ClpAP proteases degrade proteins with carboxy-terminal peptide tails added by the SsrA-tagging system. Genes Dev 12, 1338-1347.

147

Gottesman, S., Squires, C., Pichersky, E., Carrington, M., Hobbs, M., Mattick, J.S., Dalrymple, B., Kuramitsu, H., Shiroza, T., Foster, T., and et al. (1990). Conservation of the regulatory subunit for the Clp ATP-dependent protease in prokaryotes and eukaryotes. Proc Natl Acad Sci U S A 87, 3513-3517.

Grimaud, R., Kessel, M., Beuron, F., Steven, A.C., and Maurizi, M.R. (1998). Enzymatic and structural similarities between the Escherichia coli ATP-dependent proteases, ClpXP and ClpAP. J Biol Chem 273, 12476-12481.

Grimminger, V., Richter, K., Imhof, A., Buchner, J., and Walter, S. (2004). The prion curing agent guanidinium chloride specifically inhibits ATP hydrolysis by Hsp104. J Biol Chem 279, 7378-7383.

Hanson, P.I., and Whiteheart, S.W. (2005). AAA+ proteins: have engine, will work. Nat Rev Mol Cell Biol 6, 519-529.

Hara, H., Nakayashiki, T., Crist, C.G., and Nakamura, Y. (2003). Prion domain interaction responsible for species discrimination in yeast [PSI+] transmission. Genes Cells 8, 925-939.

Harrison, C. (2003). GrpE, a nucleotide exchange factor for DnaK. Cell Stress Chaperones 8, 218-224.

Harrison, C.J., Hayer-Hartl, M., Di Liberto, M., Hartl, F., and Kuriyan, J. (1997). Crystal structure of the nucleotide exchange factor GrpE bound to the ATPase domain of the molecular chaperone DnaK. Science 276, 431-435.

Harrison, L.B., Yu, Z., Stajich, J.E., Dietrich, F.S., and Harrison, P.M. (2007). Evolution of budding yeast prion-determinant sequences across diverse fungi. J Mol Biol 368, 273-282.

Haslbeck, M., Franzmann, T., Weinfurtner, D., and Buchner, J. (2005). Some like it hot: the structure and function of small heat-shock proteins. Nat Struct Mol Biol 12, 842-846.

Haslberger, T., Bukau, B., and Mogk, A. (2010). Towards a unifying mechanism for ClpB/Hsp104-mediated protein disaggregation and prion propagation. Biochem Cell Biol 88, 63- 75.

Haslberger, T., Weibezahn, J., Zahn, R., Lee, S., Tsai, F.T., Bukau, B., and Mogk, A. (2007). M domains couple the ClpB threading motor with the DnaK chaperone activity. Mol Cell 25, 247- 260.

Hattendorf, D.A., and Lindquist, S.L. (2002a). Analysis of the AAA sensor-2 motif in the C- terminal ATPase domain of Hsp104 with a site-specific fluorescent probe of nucleotide binding. Proc Natl Acad Sci U S A 99, 2732-2737.

Hattendorf, D.A., and Lindquist, S.L. (2002b). Cooperative kinetics of both Hsp104 ATPase domains and interdomain communication revealed by AAA sensor-1 mutants. EMBO J 21, 12- 21.

148

Helsen, C.W., and Glover, J.R. (2011). Insight into the Molecular Basis of Curing of the [PSI+] Prion by Overexpression of the 104 kDa Heat Shock Protein (Hsp104). J Biol Chem.

Higurashi, T., Hines, J.K., Sahi, C., Aron, R., and Craig, E.A. (2008). Specificity of the J-protein Sis1 in the propagation of 3 yeast prions. Proc Natl Acad Sci U S A 105, 16596-16601.

Hinnerwisch, J., Fenton, W.A., Furtak, K.J., Farr, G.W., and Horwich, A.L. (2005). Loops in the central channel of ClpA chaperone mediate protein binding, unfolding, and translocation. Cell 121, 1029-1041.

Hochstrasser, M. (1996). Ubiquitin-dependent protein degradation. Annu Rev Genet 30, 405- 439.

Horwich, A.L., and Fenton, W.A. (2009). Chaperonin-mediated protein folding: using a central cavity to kinetically assist polypeptide chain folding. Q Rev Biophys 42, 83-116.

Hoskins, J.R., Doyle, S.M., and Wickner, S. (2009). Coupling ATP utilization to protein remodeling by ClpB, a hexameric AAA+ protein. Proc Natl Acad Sci U S A 106, 22233-22238.

Hoskins, J.R., Pak, M., Maurizi, M.R., and Wickner, S. (1998). The role of the ClpA chaperone in proteolysis by ClpAP. Proc Natl Acad Sci U S A 95, 12135-12140.

Hoskins, J.R., Yanagihara, K., Mizuuchi, K., and Wickner, S. (2002). ClpAP and ClpXP degrade proteins with tags located in the interior of the primary sequence. Proc Natl Acad Sci U S A 99, 11037-11042.

Hung, G.C., and Masison, D.C. (2006). N-terminal domain of yeast Hsp104 chaperone is dispensable for thermotolerance and prion propagation but necessary for curing prions by Hsp104 overexpression. Genetics 173, 611-620.

Inge-Vechtomov, S., Zhouravleva, G., and Philippe, M. (2003). Eukaryotic release factors (eRFs) history. Biol Cell 95, 195-209.

Inoue, Y., Kishimoto, A., Hirao, J., Yoshida, M., and Taguchi, H. (2001). Strong growth polarity of yeast prion fiber revealed by single fiber imaging. J Biol Chem 276, 35227-35230.

Inoue, Y., Taguchi, H., Kishimoto, A., and Yoshida, M. (2004). Hsp104 binds to yeast Sup35 prion fiber but needs other factor(s) to sever it. J Biol Chem 279, 52319-52323.

Jakob, U., Muse, W., Eser, M., and Bardwell, J.C. (1999). Chaperone activity with a redox switch. Cell 96, 341-352.

Jarrett, J.T., and Lansbury, P.T., Jr. (1993). Seeding "one-dimensional crystallization" of amyloid: a pathogenic mechanism in Alzheimer's disease and scrapie? Cell 73, 1055-1058.

Jaya, N., Garcia, V., and Vierling, E. (2009). Substrate binding site flexibility of the small heat shock protein molecular chaperones. Proc Natl Acad Sci U S A 106, 15604-15609.

149

Johnston, J.A., Ward, C.L., and Kopito, R.R. (1998). Aggresomes: a cellular response to misfolded proteins. J Cell Biol 143, 1883-1898.

Jones, G., Song, Y., Chung, S., and Masison, D.C. (2004). Propagation of Saccharomyces cerevisiae [PSI+] prion is impaired by factors that regulate Hsp70 substrate binding. Mol Cell Biol 24, 3928-3937.

Jones, G.W., Song, Y., and Masison, D.C. (2003). Deletion of the Hsp70 chaperone gene SSB causes hypersensitivity to guanidine toxicity and curing of the [PSI+] prion by increasing guanidine uptake in yeast. Mol Genet Genomics 269, 304-311.

Jung, G., Jones, G., and Masison, D.C. (2002). Amino acid residue 184 of yeast Hsp104 chaperone is critical for prion-curing by guanidine, prion propagation, and thermotolerance. Proc Natl Acad Sci U S A 99, 9936-9941.

Jung, G., Jones, G., Wegrzyn, R.D., and Masison, D.C. (2000). A role for cytosolic hsp70 in yeast [PSI(+)] prion propagation and [PSI(+)] as a cellular stress. Genetics 156, 559-570.

Jung, G., and Masison, D.C. (2001). Guanidine hydrochloride inhibits Hsp104 activity in vivo: a possible explanation for its effect in curing yeast prions. Curr Microbiol 43, 7-10.

Kanemori, M., Nishihara, K., Yanagi, H., and Yura, T. (1997). Synergistic roles of HslVU and other ATP-dependent proteases in controlling in vivo turnover of sigma32 and abnormal proteins in Escherichia coli. J Bacteriol 179, 7219-7225.

Kawaguchi, Y., Kovacs, J.J., McLaurin, A., Vance, J.M., Ito, A., and Yao, T.P. (2003). The deacetylase HDAC6 regulates aggresome formation and cell viability in response to misfolded protein stress. Cell 115, 727-738.

Kawai-Noma, S., Pack, C.G., Kojidani, T., Asakawa, H., Hiraoka, Y., Kinjo, M., Haraguchi, T., Taguchi, H., and Hirata, A. (2010). In vivo evidence for the fibrillar structures of Sup35 prions in yeast cells. J Cell Biol 190, 223-231.

Kedzierska, S., Chesnokova, L.S., Witt, S.N., and Zolkiewski, M. (2005). Interactions within the ClpB/DnaK bi-chaperone system from Escherichia coli. Arch Biochem Biophys 444, 61-65.

King, C.Y., and Diaz-Avalos, R. (2004). Protein-only transmission of three yeast prion strains. Nature 428, 319-323.

King, C.Y., Tittmann, P., Gross, H., Gebert, R., Aebi, M., and Wuthrich, K. (1997). Prion- inducing domain 2-114 of yeast Sup35 protein transforms in vitro into amyloid-like filaments. Proc Natl Acad Sci U S A 94, 6618-6622.

Kishimoto, A., Hasegawa, K., Suzuki, H., Taguchi, H., Namba, K., and Yoshida, M. (2004). beta-Helix is a likely core structure of yeast prion Sup35 amyloid fibers. Biochem Biophys Res Commun 315, 739-745.

150

Kitada, T., Asakawa, S., Hattori, N., Matsumine, H., Yamamura, Y., Minoshima, S., Yokochi, M., Mizuno, Y., and Shimizu, N. (1998). Mutations in the parkin gene cause autosomal recessive juvenile parkinsonism. Nature 392, 605-608.

Knauer, M.F., Soreghan, B., Burdick, D., Kosmoski, J., and Glabe, C.G. (1992). Intracellular accumulation and resistance to degradation of the Alzheimer amyloid A4/beta protein. Proc Natl Acad Sci U S A 89, 7437-7441.

Knowles, T.P., Waudby, C.A., Devlin, G.L., Cohen, S.I., Aguzzi, A., Vendruscolo, M., Terentjev, E.M., Welland, M.E., and Dobson, C.M. (2009). An analytical solution to the kinetics of breakable filament assembly. Science 326, 1533-1537.

Kopito, R.R. (2000). Aggresomes, inclusion bodies and protein aggregation. Trends Cell Biol. 10, 524-530.

Krishnan, R., and Lindquist, S.L. (2005). Structural insights into a yeast prion illuminate nucleation and strain diversity. Nature 435, 765-772.

Kryndushkin, D.S., Alexandrov, I.M., Ter-Avanesyan, M.D., and Kushnirov, V.V. (2003). Yeast [PSI+] prion aggregates are formed by small Sup35 polymers fragmented by Hsp104. J Biol Chem 278, 49636-49643.

Kryndushkin, D.S., Smirnov, V.N., Ter-Avanesyan, M.D., and Kushnirov, V.V. (2002). Increased expression of Hsp40 chaperones, transcriptional factors, and ribosomal protein Rpp0 can cure yeast prions. J Biol Chem 277, 23702-23708.

Krzewska, J., Langer, T., and Liberek, K. (2001). Mitochondrial Hsp78, a member of the Clp/Hsp100 family in Saccharomyces cerevisiae, cooperates with Hsp70 in protein refolding. FEBS Lett. 489, 92-96.

Krzewska, J., and Melki, R. (2006). Molecular chaperones and the assembly of the prion Sup35p, an in vitro study. EMBO J 25, 822-833.

Kunau, W.H., Beyer, A., Franken, T., Gotte, K., Marzioch, M., Saidowsky, J., Skaletz-Rorowski, A., and Wiebel, F.F. (1993). Two complementary approaches to study peroxisome biogenesis in Saccharomyces cerevisiae: forward and reversed genetics. Biochimie 75, 209-224.

Kushnirov, V.V., Ter-Avanesyan, M.D., Telckov, M.V., Surguchov, A.P., Smirnov, V.N., and Inge-Vechtomov, S.G. (1988). Nucleotide sequence of the SUP2 (SUP35) gene of Saccharomyces cerevisiae. Gene 66, 45-54.

Lee do, H., and Goldberg, A.L. (2010). Hsp104 is essential for the selective degradation in yeast of polyglutamine expanded ataxin-1 but not most misfolded proteins generally. Biochem Biophys Res Commun. 391, 1056-1061. Epub 2009 Dec 1056.

Lee, S., Choi, J.M., and Tsai, F.T. (2007). Visualizing the ATPase cycle in a protein disaggregating machine: structural basis for substrate binding by ClpB. Mol Cell 25, 261-271.

151

Lee, S., Sielaff, B., Lee, J., and Tsai, F.T. (2010). CryoEM structure of Hsp104 and its mechanistic implication for protein disaggregation. Proc Natl Acad Sci U S A 107, 8135-8140.

Lee, S., Sowa, M.E., Choi, J.M., and Tsai, F.T. (2004). The ClpB/Hsp104 molecular chaperone-a protein disaggregating machine. J Struct Biol 146, 99-105.

Lee, S., Sowa, M.E., Watanabe, Y.H., Sigler, P.B., Chiu, W., Yoshida, M., and Tsai, F.T. (2003). The structure of ClpB: a molecular chaperone that rescues proteins from an aggregated state. Cell 115, 229-240.

Leskovar, A., Wegele, H., Werbeck, N.D., Buchner, J., and Reinstein, J. (2008). The ATPase cycle of the mitochondrial Hsp90 analog Trap1. J Biol Chem 283, 11677-11688.

Levinthal, C. (1969). How to Fold Graciously. In Mossbauer Spectroscopy in Biological Systems: Proceedings of a meeting held at Allerton House, Monticello, Illinois, J.T.P. Debrunnder, and E. Munck, eds. (University of Illinois Press), pp. 22-24.

Li, J., and Sha, B. (2004). Peptide substrate identification for yeast Hsp40 Ydj1 by screening the phage display library. Biol Proced Online 6, 204-208.

Li, L., and Lindquist, S. (2000). Creating a protein-based element of inheritance. Science 287, 661-664.

Liebman, S.W. (2005). Structural clues to prion mysteries. Nat.Struct.Mol.Biol. 12, 567-568.

Lies, M., and Maurizi, M.R. (2008). Turnover of endogenous SsrA-tagged proteins mediated by ATP-dependent proteases in Escherichia coli. J Biol Chem 283, 22918-22929.

Lindquist, S., and Kim, G. (1996). Heat-shock protein 104 expression is sufficient for thermotolerance in yeast. Proc Natl Acad Sci U S A 93, 5301-5306.

Lindquist, S., Patino, M.M., Chernoff, Y.O., Kowal, A.S., Singer, M.A., Liebman, S.W., Lee, K.H., and Blake, T. (1995). The role of Hsp104 in stress tolerance and [PSI+] propagation in Saccharomyces cerevisiae. Cold Spring Harb Symp Quant Biol 60, 451-460.

Liu, J.J., and Lindquist, S. (1999). Oligopeptide-repeat expansions modulate 'protein-only' inheritance in yeast. Nature 400, 573-576.

Liu, J.J., Sondheimer, N., and Lindquist, S.L. (2002). Changes in the middle region of Sup35 profoundly alter the nature of epigenetic inheritance for the yeast prion [PSI+]. Proc Natl Acad Sci U S A 99 Suppl 4, 16446-16453.

Liu, Y., Wei, H., Wang, J., Qu, J., Zhao, W., and Tao, H. (2007). Effects of randomizing the Sup35NM prion domain sequence on formation of amyloid fibrils in vitro. Biochem Biophys Res Commun 353, 139-146.

Lopez, N., Aron, R., and Craig, E.A. (2003). Specificity of class II Hsp40 Sis1 in maintenance of yeast prion [RNQ+]. Mol Biol Cell 14, 1172-1181.

152

Lu, Z., and Cyr, D.M. (1998). Protein folding activity of Hsp70 is modified differentially by the hsp40 co-chaperones Sis1 and Ydj1. J Biol Chem 273, 27824-27830.

Luhrs, T., Ritter, C., Adrian, M., Riek-Loher, D., Bohrmann, B., Dobeli, H., Schubert, D., and Riek, R. (2005). 3D structure of Alzheimer's amyloid-beta(1-42) fibrils. Proc Natl Acad Sci U S A 102, 17342-17347.

Lum, R., Niggemann, M., and Glover, J.R. (2008). Peptide and protein binding in the axial channel of Hsp104. Insights into the mechanism of protein unfolding. J Biol Chem 283, 30139- 30150.

Lum, R., Tkach, J.M., Vierling, E., and Glover, J.R. (2004). Evidence for an unfolding/threading mechanism for protein disaggregation by Saccharomyces cerevisiae Hsp104. J Biol Chem 279, 29139-29146.

Ma, Y., and Hendershot, L.M. (2004). The role of the unfolded protein response in tumour development: friend or foe? Nat Rev Cancer 4, 966-977.

Mackay, R.G., Helsen, C.W., Tkach, J.M., and Glover, J.R. (2008). The C-terminal extension of Saccharomyces cerevisiae Hsp104 plays a role in oligomer assembly. Biochemistry 47, 1918- 1927.

Maddelein, M.L., Dos Reis, S., Duvezin-Caubet, S., Coulary-Salin, B., and Saupe, S.J. (2002). Amyloid aggregates of the HET-s prion protein are infectious. Proc Natl Acad Sci U S A 99, 7402-7407.

Martin, A., Baker, T.A., and Sauer, R.T. (2008). Pore loops of the AAA+ ClpX machine grip substrates to drive translocation and unfolding. Nat Struct Mol Biol 15, 1147-1151.

Martin, A.C., Orengo, C.A., Hutchinson, E.G., Jones, S., Karmirantzou, M., Laskowski, R.A., Mitchell, J.B., Taroni, C., and Thornton, J.M. (1998). Protein folds and functions. Structure. 6, 875-884.

Mayer, M.P., and Bukau, B. (2005). Hsp70 chaperones: cellular functions and molecular mechanism. Cell Mol Life Sci 62, 670-684.

Mayor, U., Guydosh, N.R., Johnson, C.M., Grossmann, J.G., Sato, S., Jas, G.S., Freund, S.M., Alonso, D.O., Daggett, V., and Fersht, A.R. (2003). The complete folding pathway of a protein from nanoseconds to microseconds. Nature 421, 863-867.

McAlister, L., and Finkelstein, D.B. (1980). Heat shock proteins and thermal resistance in yeast. Biochem Biophys Res Commun 93, 819-824.

McLaughlin, S.H., Smith, H.W., and Jackson, S.E. (2002). Stimulation of the weak ATPase activity of human hsp90 by a client protein. J Mol Biol 315, 787-798.

Meyer, A.S., Gillespie, J.R., Walther, D., Millet, I.S., Doniach, S., and Frydman, J. (2003). Closing the folding chamber of the eukaryotic chaperonin requires the transition state of ATP hydrolysis. Cell 113, 369-381.

153

Michelitsch, M.D., and Weissman, J.S. (2000). A census of glutamine/asparagine-rich regions: implications for their conserved function and the prediction of novel prions. Proc Natl Acad Sci U S A 97, 11910-11915.

Miot, M., Reidy, M., Doyle, S.M., Hoskins, J.R., Johnston, D.M., Genest, O., Vitery, M.C., Masison, D.C., and Wickner, S. (2011). Species-specific collaboration of heat shock proteins (Hsp) 70 and 100 in thermotolerance and protein disaggregation. Proc Natl Acad Sci U S A.

Missiakas, D., Schwager, F., Betton, J.M., Georgopoulos, C., and Raina, S. (1996). Identification and characterization of HsIV HsIU (ClpQ ClpY) proteins involved in overall proteolysis of misfolded proteins in Escherichia coli. EMBO J 15, 6899-6909.

Miyata, T., van Ypersele de Strihou, C., Kurokawa, K., and Baynes, J.W. (1999). Alterations in nonenzymatic biochemistry in uremia: origin and significance of "carbonyl stress" in long-term uremic complications. Kidney Int 55, 389-399.

Mogk, A., Haslberger, T., Tessarz, P., and Bukau, B. (2008). Common and specific mechanisms of AAA+ proteins involved in protein quality control. Biochem Soc Trans 36, 120-125.

Mosser, D.D., Ho, S., and Glover, J.R. (2004). Saccharomyces cerevisiae Hsp104 enhances the chaperone capacity of human cells and inhibits heat stress-induced proapoptotic signaling. Biochemistry 43, 8107-8115.

Mukhopadhyay, S., Krishnan, R., Lemke, E.A., Lindquist, S., and Deniz, A.A. (2007). A natively unfolded yeast prion monomer adopts an ensemble of collapsed and rapidly fluctuating structures. Proc Natl Acad Sci U S A 104, 2649-2654.

Mumberg, D., Muller, R., and Funk, M. (1994). Regulatable promoters of Saccharomyces cerevisiae: comparison of transcriptional activity and their use for heterologous expression. Nucleic Acids Res 22, 5767-5768.

Naganathan, A.N., Sanchez-Ruiz, J.M., and Munoz, V. (2005). Direct measurement of barrier heights in protein folding. J Am Chem Soc 127, 17970-17971.

Nakayashiki, T., Kurtzman, C.P., Edskes, H.K., and Wickner, R.B. (2005). Yeast prions [URE3] and [PSI+] are diseases. Proc.Natl.Acad.Sci.U.S.A 102, 10575-10580.

Narayanan, S., Bosl, B., Walter, S., and Reif, B. (2003). Importance of low-oligomeric-weight species for prion propagation in the yeast prion system Sup35/Hsp104. Proc Natl Acad Sci U S A 100, 9286-9291.

Narberhaus, F. (2002). Alpha-crystallin-type heat shock proteins: socializing minichaperones in the context of a multichaperone network. Microbiol Mol Biol Rev 66, 64-93; table of contents.

Nathan, D.F., Vos, M.H., and Lindquist, S. (1997). In vivo functions of the Saccharomyces cerevisiae Hsp90 chaperone. Proc Natl Acad Sci U S A 94, 12949-12956.

Nemecek, J., Nakayashiki, T., and Wickner, R.B. (2009). A prion of yeast metacaspase homolog (Mca1p) detected by a genetic screen. Proc Natl Acad Sci U S A 106, 1892-1896.

154

Newnam, G.P., Wegrzyn, R.D., Lindquist, S.L., and Chernoff, Y.O. (1999). Antagonistic interactions between yeast chaperones Hsp104 and Hsp70 in prion curing. Mol. Cell. Biol. 19, 1325-1333.

Nishida, E., and Sakai, H. (1983). Kinetic analysis of actin polymerization. J Biochem 93, 1011- 1020.

Olzmann, J.A., Li, L., Chudaev, M.V., Chen, J., Perez, F.A., Palmiter, R.D., and Chin, L.S. (2007). Parkin-mediated K63-linked polyubiquitination targets misfolded DJ-1 to aggresomes via binding to HDAC6. J Cell Biol 178, 1025-1038.

Onuchic, J.N., and Wolynes, P.G. (2004). Theory of protein folding. Curr Opin Struct Biol. 14, 70-75.

Osherovich, L.Z., and Weissman, J.S. (2002). The utility of prions. Dev Cell 2, 143-151.

Panaretou, B., Prodromou, C., Roe, S.M., O'Brien, R., Ladbury, J.E., Piper, P.W., and Pearl, L.H. (1998). ATP binding and hydrolysis are essential to the function of the Hsp90 molecular chaperone in vivo. EMBO J 17, 4829-4836.

Parsell, D.A., Kowal, A.S., and Lindquist, S. (1994a). Saccharomyces cerevisiae Hsp104 protein. Purification and characterization of ATP-induced structural changes. J Biol Chem 269, 4480- 4487.

Parsell, D.A., Kowal, A.S., Singer, M.A., and Lindquist, S. (1994b). Protein disaggregation mediated by heat-shock protein Hsp104. Nature 372, 475-478.

Parsell, D.A., Sanchez, Y., Stitzel, J.D., and Lindquist, S. (1991). Hsp104 is a highly conserved protein with two essential nucleotide-binding sites. Nature 353, 270-273.

Patel, B.K., Gavin-Smyth, J., and Liebman, S.W. (2009). The yeast global transcriptional co- repressor protein Cyc8 can propagate as a prion. Nat Cell Biol 11, 344-349.

Patino, M.M., Liu, J.J., Glover, J.R., and Lindquist, S. (1996). Support for the prion hypothesis for inheritance of a phenotypic trait in yeast. Science 273, 622-626.

Paushkin, S.V., Kushnirov, V.V., Smirnov, V.N., and Ter-Avanesyan, M.D. (1997). In vitro propagation of the prion-like state of yeast Sup35 protein. Science 277, 381-383.

Perutz, M.F., Finch, J.T., Berriman, J., and Lesk, A. (2002). Amyloid fibers are water-filled nanotubes. Proc Natl Acad Sci U S A 99, 5591-5595.

Picard, D. (2002). Heat-shock protein 90, a chaperone for folding and regulation. Cell Mol Life Sci 59, 1640-1648.

Powers, E.T., Morimoto, R.I., Dillin, A., Kelly, J.W., and Balch, W.E. (2009). Biological and chemical approaches to diseases of proteostasis deficiency. Annu Rev Biochem 78, 959-991.

155

Prodromou, C., Roe, S.M., O'Brien, R., Ladbury, J.E., Piper, P.W., and Pearl, L.H. (1997). Identification and structural characterization of the ATP/ADP-binding site in the Hsp90 molecular chaperone. Cell 90, 65-75.

Prusiner, S.B. (1982). Novel proteinaceous infectious particles cause scrapie. Science 216, 136- 144.

Rabinovich, E., Kerem, A., Frohlich, K.U., Diamant, N., and Bar-Nun, S. (2002). AAA-ATPase p97/Cdc48p, a cytosolic chaperone required for endoplasmic reticulum-associated protein degradation. Mol Cell Biol 22, 626-634.

Rajan, R.S., Illing, M.E., Bence, N.F., and Kopito, R.R. (2001). Specificity in intracellular protein aggregation and inclusion body formation. Proc Natl Acad Sci U S A 98, 13060-13065.

Rambaran, R.N., and Serpell, L.C. (2008). Amyloid fibrils: abnormal protein assembly. Prion 2, 112-117.

Reidy, M., and Masison, D.C. (2010). Sti1 regulation of Hsp70 and Hsp90 is critical for curing of Saccharomyces cerevisiae [PSI+] prions by Hsp104. Mol Cell Biol 30, 3542-3552.

Richter, K., Moser, S., Hagn, F., Friedrich, R., Hainzl, O., Heller, M., Schlee, S., Kessler, H., Reinstein, J., and Buchner, J. (2006). Intrinsic inhibition of the Hsp90 ATPase activity. J Biol Chem 281, 11301-11311.

Richter, K., Soroka, J., Skalniak, L., Leskovar, A., Hessling, M., Reinstein, J., and Buchner, J. (2008). Conserved conformational changes in the ATPase cycle of human Hsp90. J Biol Chem 283, 17757-17765.

Rochet, J.C., and Lansbury, P.T., Jr. (2000). Amyloid fibrillogenesis: themes and variations. Curr Opin Struct Biol 10, 60-68.

Rohrwild, M., Pfeifer, G., Santarius, U., Muller, S.A., Huang, H.C., Engel, A., Baumeister, W., and Goldberg, A.L. (1997). The ATP-dependent HslVU protease from Escherichia coli is a four- ring structure resembling the proteasome. Nat Struct Biol 4, 133-139.

Romer, L., and Scheibel, T. (2008). The elaborate structure of spider silk: structure and function of a natural high performance fiber. Prion. 2, 154-161. Epub 2008 Oct 2020.

Ross, E.D., Baxa, U., and Wickner, R.B. (2004). Scrambled prion domains form prions and amyloid. Mol Cell Biol 24, 7206-7213.

Ross, E.D., Edskes, H.K., Terry, M.J., and Wickner, R.B. (2005). Primary sequence independence for prion formation. Proc Natl Acad Sci U S A 102, 12825-12830.

Rudiger, S., Germeroth, L., Schneider-Mergener, J., and Bukau, B. (1997). Substrate specificity of the DnaK chaperone determined by screening cellulose-bound peptide libraries. EMBO J 16, 1501-1507.

156

Rumfeldt, J.A., Galvagnion, C., Vassall, K.A., and Meiering, E.M. (2008). Conformational stability and folding mechanisms of dimeric proteins. Prog Biophys Mol Biol 98, 61-84.

Sadlish, H., Rampelt, H., Shorter, J., Wegrzyn, R.D., Andreasson, C., Lindquist, S., and Bukau, B. (2008). Hsp110 chaperones regulate prion formation and propagation in S. cerevisiae by two discrete activities. PLoS ONE 3, e1763.

Salnikova, A.B., Kryndushkin, D.S., Smirnov, V.N., Kushnirov, V.V., and Ter-Avanesyan, M.D. (2005). Nonsense suppression in yeast cells overproducing Sup35 (eRF3) is caused by its non- heritable amyloids. J Biol Chem 280, 8808-8812.

Samsonova, M.G., Inge-Vechtomov, S.G., and Taylor, P. (1991). Structure comparison and evolutionary relations between elongation factors EF-Tu (EF-1 alpha) and SUP 2 proteins. Genetica 85, 35-44.

Sanchez, Y., and Lindquist, S.L. (1990). HSP104 required for induced thermotolerance. Science 248, 1112-1115.

Sanchez, Y., Taulien, J., Borkovich, K.A., and Lindquist, S. (1992). Hsp104 is required for tolerance to many forms of stress. EMBO J 11, 2357-2364.

Saraste, M., Sibbald, P.R., and Wittinghofer, A. (1990). The P-loop--a common motif in ATP- and GTP-binding proteins. Trends Biochem Sci 15, 430-434.

Satpute-Krishnan, P., Langseth, S.X., and Serio, T.R. (2007). Hsp104-dependent remodeling of prion complexes mediates protein-only inheritance. PLoS.Biol 5, e24.

Satpute-Krishnan, P., and Serio, T.R. (2005). Prion protein remodelling confers an immediate phenotypic switch. Nature 437, 262-265.

Sauer, R.T., Bolon, D.N., Burton, B.M., Burton, R.E., Flynn, J.M., Grant, R.A., Hersch, G.L., Joshi, S.A., Kenniston, J.A., Levchenko, I., et al. (2004). Sculpting the proteome with AAA(+) proteases and disassembly machines. Cell 119, 9-18.

Scheibel, T., Bloom, J., and Lindquist, S.L. (2004). The elongation of yeast prion fibers involves separable steps of association and conversion. Proc Natl Acad Sci U S A 101, 2287-2292.

Scheibel, T., Kowal, A.S., Bloom, J.D., and Lindquist, S.L. (2001). Bidirectional amyloid fiber growth for a yeast prion determinant. Curr Biol 11, 366-369.

Scheibel, T., and Lindquist, S.L. (2001). The role of conformational flexibility in prion propagation and maintenance for Sup35p. Nat Struct Biol 8, 958-962.

Scheibel, T., Weikl, T., and Buchner, J. (1998). Two chaperone sites in Hsp90 differing in substrate specificity and ATP dependence. Proc Natl Acad Sci U S A 95, 1495-1499.

Schirmer, E.C., Glover, J.R., Singer, M.A., and Lindquist, S. (1996). HSP100/Clp proteins: a common mechanism explains diverse functions. Trends Biochem Sci 21, 289-296.

157

Schirmer, E.C., and Lindquist, S. (1997). Interactions of the chaperone Hsp104 with yeast Sup35 and mammalian PrP. Proc Natl Acad Sci U S A 94, 13932-13937.

Schirmer, E.C., Queitsch, C., Kowal, A.S., Parsell, D.A., and Lindquist, S. (1998). The ATPase activity of Hsp104, effects of environmental conditions and mutations. J Biol Chem 273, 15546- 15552.

Schirmer, E.C., Ware, D.M., Queitsch, C., Kowal, A.S., and Lindquist, S.L. (2001). Subunit interactions influence the biochemical and biological properties of Hsp104. Proc Natl Acad Sci U S A 98, 914-919.

Schlieker, C., Weibezahn, J., Patzelt, H., Tessarz, P., Strub, C., Zeth, K., Erbse, A., Schneider- Mergener, J., Chin, J.W., Schultz, P.G., et al. (2004). Substrate recognition by the AAA+ chaperone ClpB. Nat Struct Mol Biol 11, 607-615.

Schuermann, J.P., Jiang, J., Cuellar, J., Llorca, O., Wang, L., Gimenez, L.E., Jin, S., Taylor, A.B., Demeler, B., Morano, K.A., et al. (2008). Structure of the Hsp110:Hsc70 nucleotide exchange machine. Mol Cell 31, 232-243.

Senechal, P., Arseneault, G., Leroux, A., Lindquist, S., and Rokeach, L.A. (2009). The Schizosaccharomyces pombe Hsp104 disaggregase is unable to propagate the [PSI] prion. PLoS ONE 4, e6939.

Serio, T.R., Cashikar, A.G., Kowal, A.S., Sawicki, G.J., Moslehi, J.J., Serpell, L., Arnsdorf, M.F., and Lindquist, S.L. (2000). Nucleated conformational conversion and the replication of conformational information by a prion determinant. Science 289, 1317-1321.

Shewmaker, F., Wickner, R.B., and Tycko, R. (2006). Amyloid of the prion domain of Sup35p has an in-register parallel beta-sheet structure. Proc Natl Acad Sci U S A 103, 19754-19759.

Shkundina, I.S., Kushnirov, V.V., Tuite, M.F., and Ter-Avanesyan, M.D. (2006). The role of the N-terminal oligopeptide repeats of the yeast Sup35 prion protein in propagation and transmission of prion variants. Genetics 172, 827-835.

Shorter, J., and Lindquist, S. (2004). Hsp104 catalyzes formation and elimination of self- replicating Sup35 prion conformers. Science 304, 1793-1797.

Shorter, J., and Lindquist, S. (2005). Prions as adaptive conduits of memory and inheritance. Nat Rev Genet 6, 435-450.

Shorter, J., and Lindquist, S. (2006). Destruction or potentiation of different prions catalyzed by similar Hsp104 remodeling activities. Mol Cell 23, 425-438.

Shorter, J., and Lindquist, S. (2008). Hsp104, Hsp70 and Hsp40 interplay regulates formation, growth and elimination of Sup35 prions. EMBO J 27, 2712-2724.

Shoulders, M.D., and Raines, R.T. (2009). Collagen structure and stability. Annu Rev Biochem. 78, 929-958.

158

Sielaff, B., and Tsai, F.T. (2010). The M-domain controls Hsp104 protein remodeling activity in an Hsp70/Hsp40-dependent manner. J Mol Biol 402, 30-37.

Sikorski, R.S., and Hieter, P. (1989). A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122, 19-27.

Singer, M.A., and Lindquist, S. (1998). Multiple effects of trehalose on protein folding in vitro and in vivo. Mol Cell 1, 639-648.

Singh, S.K., Grimaud, R., Hoskins, J.R., Wickner, S., and Maurizi, M.R. (2000). Unfolding and internalization of proteins by the ATP-dependent proteases ClpXP and ClpAP. Proc Natl Acad Sci U S A 97, 8898-8903.

Slotta, U., Hess, S., Spiess, K., Stromer, T., Serpell, L., and Scheibel, T. (2007). Spider silk and amyloid fibrils: a structural comparison. Macromol Biosci. 7, 183-188.

Sondheimer, N., Lopez, N., Craig, E.A., and Lindquist, S. (2001). The role of Sis1 in the maintenance of the [RNQ+] prion. EMBO J 20, 2435-2442.

Song, Y., Wu, Y.X., Jung, G., Tutar, Y., Eisenberg, E., Greene, L.E., and Masison, D.C. (2005). Role for Hsp70 chaperone in Saccharomyces cerevisiae prion seed replication. Eukaryot.Cell 4, 289-297.

Sousa, M.C., Trame, C.B., Tsuruta, H., Wilbanks, S.M., Reddy, V.S., and McKay, D.B. (2000). Crystal and solution structures of an HslUV protease-chaperone complex. Cell 103, 633-643.

Sparrer, H.E., Santoso, A., Szoka, F.C., Jr., and Weissman, J.S. (2000). Evidence for the prion hypothesis: induction of the yeast [PSI+] factor by in vitro- converted Sup35 protein. Science 289, 595-599.

Stadtman, E.R., and Oliver, C.N. (1991). Metal-catalyzed oxidation of proteins. Physiological consequences. J Biol Chem 266, 2005-2008.

Stansfield, I., Jones, K.M., Kushnirov, V.V., Dagkesamanskaya, A.R., Poznyakovski, A.I., Paushkin, S.V., Nierras, C.R., Cox, B.S., Ter-Avanesyan, M.D., and Tuite, M.F. (1995). The products of the SUP45 (eRF1) and SUP35 genes interact to mediate translation termination in Saccharomyces cerevisiae. EMBO J 14, 4365-4373.

Stathopulos, P.B., Rumfeldt, J.A., Scholz, G.A., Irani, R.A., Frey, H.E., Hallewell, R.A., Lepock, J.R., and Meiering, E.M. (2003). Cu/Zn superoxide dismutase mutants associated with amyotrophic lateral sclerosis show enhanced formation of aggregates in vitro. Proc Natl Acad Sci U S A 100, 7021-7026.

Stefani, M., and Dobson, C.M. (2003). Protein aggregation and aggregate toxicity: new insights into protein folding, misfolding diseases and biological evolution. J Mol Med. 81, 678-699. Epub 2003 Aug 2027.

159

Stengel, F., Baldwin, A.J., Painter, A.J., Jaya, N., Basha, E., Kay, L.E., Vierling, E., Robinson, C.V., and Benesch, J.L. (2010). Quaternary dynamics and plasticity underlie small heat shock protein chaperone function. Proc Natl Acad Sci U S A 107, 2007-2012.

Stratford, F.L., Ramjeesingh, M., Cheung, J.C., Huan, L.J., and Bear, C.E. (2007). The Walker B motif of the second nucleotide-binding domain (NBD2) of CFTR plays a key role in ATPase activity by the NBD1-NBD2 heterodimer. Biochem J 401, 581-586.

Sun, Y., and MacRae, T.H. (2005). Small heat shock proteins: molecular structure and chaperone function. Cell Mol Life Sci 62, 2460-2476.

Sweeny, E.A., and Shorter, J. (2008). Prion proteostasis: Hsp104 meets its supporting cast. Prion 2, 135-140.

Takahashi, A., Hara, H., Kurahashi, H., and Nakamura, Y. (2007). A systematic evaluation of the function of the protein-remodeling factor Hsp104 in [PSI+] prion propagation in S. cerevisiae by comprehensive chromosomal mutations. Prion. 1, 69-77. Epub 2007 Jan 2026.

Tanaka, M., Chien, P., Naber, N., Cooke, R., and Weissman, J.S. (2004). Conformational variations in an infectious protein determine prion strain differences. Nature 428, 323-328.

Tang, D.D., and Anfinogenova, Y. (2008). Physiologic properties and regulation of the actin cytoskeleton in vascular smooth muscle. J Cardiovasc Pharmacol Ther. 13, 130-140. Epub 2008 Jan 2022.

Ter-Avanesyan, M.D., Dagkesamanskaya, A.R., Kushnirov, V.V., and Smirnov, V.N. (1994). The SUP35 omnipotent suppressor gene is involved in the maintenance of the non-Mendelian determinant [psi+] in the yeast Saccharomyces cerevisiae. Genetics 137, 671-676.

Ter-Avanesyan, M.D., Kushnirov, V.V., Dagkesamanskaya, A.R., Didichenko, S.A., Chernoff, Y.O., Inge-Vechtomov, S.G., and Smirnov, V.N. (1993). Deletion analysis of the SUP35 gene of the yeast Saccharomyces cerevisiae reveals two non-overlapping functional regions in the encoded protein. Mol Microbiol 7, 683-692.

Tessarz, P., Mogk, A., and Bukau, B. (2008). Substrate threading through the central pore of the Hsp104 chaperone as a common mechanism for protein disaggregation and prion propagation. Mol Microbiol 68, 87-97.

Tessarz, P., Schwarz, M., Mogk, A., and Bukau, B. (2009). The yeast AAA+ chaperone Hsp104 is part of a network that links the actin cytoskeleton with the inheritance of damaged proteins. Mol Cell Biol 29, 3738-3745.

Thulasiraman, V., Yang, C.F., and Frydman, J. (1999). In vivo newly translated polypeptides are sequestered in a protected folding environment. EMBO J 18, 85-95.

Tipton, K.A., Verges, K.J., and Weissman, J.S. (2008). In vivo monitoring of the prion replication cycle reveals a critical role for Sis1 in delivering substrates to Hsp104. Mol Cell 32, 584-591.

160

Tkach, J.M., and Glover, J.R. (2004). Amino acid substitutions in the C-terminal AAA+ module of Hsp104 prevent substrate recognition by disrupting oligomerization and cause high temperature inactivation. J Biol Chem 279, 35692-35701.

Toyama, B.H., Kelly, M.J., Gross, J.D., and Weissman, J.S. (2007). The structural basis of yeast prion strain variants. Nature 449, 233-237.

True, H.L., and Lindquist, S.L. (2000). A yeast prion provides a mechanism for genetic variation and phenotypic diversity. Nature 407, 477-483.

Tuite, M.F., and Cox, B.S. (2003). Propagation of yeast prions. Nat Rev Mol Cell Biol 4, 878- 890.

Tuite, M.F., and Lindquist, S.L. (1996). Maintenance and inheritance of yeast prions. Trends Genet 12, 467-471.

Tuite, M.F., Mundy, C.R., and Cox, B.S. (1981). Agents that cause a high frequency of genetic change from [psi+] to [psi-] in Saccharomyces cerevisiae. Genetics 98, 691-711.

Tycko, R. (2006). Molecular structure of amyloid fibrils: insights from solid-state NMR. Q Rev Biophys 39, 1-55.

Tyedmers, J., Mogk, A., and Bukau, B. (2010). Cellular strategies for controlling protein aggregation. Nat Rev Mol Cell Biol 11, 777-788.

Uversky, V.N. (2002). Natively unfolded proteins: a point where biology waits for physics. Protein Sci 11, 739-756.

Vembar, S.S., and Brodsky, J.L. (2008). One step at a time: endoplasmic reticulum-associated degradation. Nat Rev Mol Cell Biol 9, 944-957.

Voges, D., Zwickl, P., and Baumeister, W. (1999). The 26S proteasome: a molecular machine designed for controlled proteolysis. Annu Rev Biochem 68, 1015-1068.

Volkov, K., Osipov, K., Valouev, I., Inge-Vechtomov, S., and Mironova, L. (2007). N-terminal extension of Saccharomyces cerevisiae translation termination factor eRF3 influences the suppression efficiency of sup35 mutations. FEMS Yeast Res 7, 357-365.

Walsh, P., Bursac, D., Law, Y.C., Cyr, D., and Lithgow, T. (2004). The J-protein family: modulating protein assembly, disassembly and translocation. EMBO Rep 5, 567-571.

Walter, S., and Buchner, J. (2002). Molecular chaperones--cellular machines for protein folding. Angew Chem Int Ed Engl 41, 1098-1113.

Wandinger, S.K., Richter, K., and Buchner, J. (2008). The Hsp90 chaperone machinery. J Biol Chem 283, 18473-18477.

Wang, J., Hartling, J.A., and Flanagan, J.M. (1997). The structure of ClpP at 2.3 A resolution suggests a model for ATP-dependent proteolysis. Cell 91, 447-456.

161

Wang, J., Hartling, J.A., and Flanagan, J.M. (1998). Crystal structure determination of Escherichia coli ClpP starting from an EM-derived mask. J Struct Biol 124, 151-163.

Wegrzyn, R.D., Bapat, K., Newnam, G.P., Zink, A.D., and Chernoff, Y.O. (2001). Mechanism of prion loss after Hsp104 inactivation in yeast. Mol Cell Biol 21, 4656-4669.

Weibezahn, J., Bukau, B., and Mogk, A. (2004a). Unscrambling an egg: protein disaggregation by AAA+ proteins. Microb Cell Fact. 3, 1.

Weibezahn, J., Schlieker, C., Bukau, B., and Mogk, A. (2003). Characterization of a trap mutant of the AAA+ chaperone ClpB. J Biol Chem 278, 32608-32617.

Weibezahn, J., Tessarz, P., Schlieker, C., Zahn, R., Maglica, Z., Lee, S., Zentgraf, H., Weber- Ban, E.U., Dougan, D.A., Tsai, F.T., et al. (2004b). Thermotolerance requires refolding of aggregated proteins by substrate translocation through the central pore of ClpB. Cell 119, 653- 665.

Welch, W.J., and Brown, C.R. (1996). Influence of molecular and chemical chaperones on protein folding. Cell Stress Chaperones 1, 109-115.

Wendler, P., Shorter, J., Plisson, C., Cashikar, A.G., Lindquist, S., and Saibil, H.R. (2007). Atypical AAA+ subunit packing creates an expanded cavity for disaggregation by the protein- remodeling factor Hsp104. Cell 131, 1366-1377.

Werbeck, N.D., Schlee, S., and Reinstein, J. (2008). Coupling and dynamics of subunits in the hexameric AAA+ chaperone ClpB. J Mol Biol 378, 178-190.

Werner-Washburne, M., Stone, D.E., and Craig, E.A. (1987). Complex interactions among members of an essential subfamily of hsp70 genes in Saccharomyces cerevisiae. Mol Cell Biol 7, 2568-2577.

Whitesell, L., and Lindquist, S.L. (2005). HSP90 and the chaperoning of cancer. Nat Rev Cancer 5, 761-772.

Wickner, R.B. (1994). [URE3] as an altered URE2 protein: evidence for a prion analog in Saccharomyces cerevisiae. Science 264, 566-569.

Wickner, R.B., Masison, D.C., and Edskes, H.K. (1995). [PSI] and [URE3] as yeast prions. Yeast 11, 1671-1685.

Wiech, H., Buchner, J., Zimmermann, R., and Jakob, U. (1992). Hsp90 chaperones protein folding in vitro. Nature 358, 169-170.

Wojcik, C. (1997). An inhibitor of the chymotrypsin-like activity of the proteasome (PSI) induces similar morphological changes in various cell lines. Folia Histochem Cytobiol 35, 211- 214.

162

Wojcik, C., Schroeter, D., Wilk, S., Lamprecht, J., and Paweletz, N. (1996). Ubiquitin-mediated proteolysis centers in HeLa cells: indication from studies of an inhibitor of the chymotrypsin-like activity of the proteasome. Eur J Cell Biol 71, 311-318.

Wu, B., Hunt, C., and Morimoto, R. (1985). Structure and expression of the human gene encoding major heat shock protein HSP70. Mol Cell Biol 5, 330-341.

Xu, Z., Horwich, A.L., and Sigler, P.B. (1997). The crystal structure of the asymmetric GroEL- GroES-(ADP)7 chaperonin complex. Nature 388, 741-750.

Young, J.C., Agashe, V.R., Siegers, K., and Hartl, F.U. (2004). Pathways of chaperone-mediated protein folding in the cytosol. Nat Rev Mol Cell Biol 5, 781-791.

Zeilstra-Ryalls, J., Fayet, O., and Georgopoulos, C. (1991). The universally conserved GroE (Hsp60) chaperonins. Annu Rev Microbiol 45, 301-325.

Zenthon, J.F., Ness, F., Cox, B., and Tuite, M.F. (2006). The [PSI+] prion of Saccharomyces cerevisiae can be propagated by an Hsp104 orthologue from Candida albicans. Eukaryot Cell 5, 217-225.

Zhou, P., Derkatch, I.L., Uptain, S.M., Patino, M.M., Lindquist, S., and Liebman, S.W. (1999). The yeast non-Mendelian factor [ETA+] is a variant of [PSI+], a prion-like form of release factor eRF3. EMBO J 18, 1182-1191.

Zietkiewicz, S., Krzewska, J., and Liberek, K. (2004). Successive and synergistic action of the Hsp70 and Hsp100 chaperones in protein disaggregation. J Biol Chem 279, 44376-44383.

Zietkiewicz, S., Lewandowska, A., Stocki, P., and Liberek, K. (2006). Hsp70 chaperone machine remodels protein aggregates at the initial step of Hsp70-Hsp100-dependent disaggregation. J Biol Chem 281, 7022-7029.

Zimmerman, S.B., and Trach, S.O. (1991). Estimation of macromolecule concentrations and excluded volume effects for the cytoplasm of Escherichia coli. J Mol Biol. 222, 599-620.

163

Figure 4 C on page 39 is reprinted from: Atypical AAA+ Subunit Packing Creates an Expanded Cavity for Disaggregation by the Protein-Remodeling Factor Hsp104, 31, Petra Wendler, James Shorter, Celia Plisson, Anil G. Cashikar, Susan Lindquist, and Helen R. Saibil, page 1368, 2007 with permission from Elsevier.

Figure 4 D and E on page 39 is reprinted from: CryoEM structure of Hsp104 and its mechanistic implication for protein disaggregation, vol. 107, Sukyeong Lee, Bernhard Sielaff, Jungsoon Lee, and Francis T. F. Tsai, page 8316, 2010 with permission from PNAS.

Figure 7 A on page 52 is reprinted from: 3D structure of Alzheimer’s amyloid-(1-42) fibrils, vol. 102, Thorsten Lührs, Christiane Ritter, Marc Adrian, Dominique Riek-Loher, Bernd Bohrmann, Heinz Döbeli, David Schubert, and Roland Riek, page17344, 2005 with permission from PNAS

Figure 11 to Figure 24 with the except for Figure 16 were originally published in the Journal of Biochemistry (Helsen and Glover, 2011) and are used in this thesis according the publishers guidelines and with the publishers permission.