Hemiptera: Coleorrhyncha: Peloridiidae)

Home , Coleorrhyncha, Lygaeoidea, Peloridiidae

bs_bs_banner

Environmental Microbiology (2013) doi:10.1111/1462-2920.12101

Diversity of bacterial endosymbionts and bacteria–host co-evolution in Gondwanan relict moss bugs (Hemiptera: Coleorrhyncha: Peloridiidae)

Stefan Martin Kuechler,1* George Gibbs,2 of bacteriomes as well as in the ‘symbiont ball’ of the Daniel Burckhardt,3 Konrad Dettner1 and posterior pole of each developing oocyte. Further- Viktor Hartung4 more, ultrastructural analysis of the Malpighian 1Department of Animal Ecology II, University of tubules revealed that most host nuclei are infected by Bayreuth, Universitaetsstrasse 30, 95440 Bayreuth, an endosymbiotic, intranuclear bacterium that was Germany. determined as an Alphaproteobacterium of the genus 2School of Biological Science, Victoria University, PO Rickettsia. Box 600, Wellington 6000, New Zealand. 3Naturhistorisches Museum, Augustinergasse 2, Introduction CH-4001 Basel, Switzerland. 4Museum für Naturkunde, Leibniz-Institute for Research Most hemipterans, the largest hemimetabolous insect on Evolution and Biodiversity at the Humboldt University order with some 82 000 described species (Cryan and Berlin, Invalidenstrasse 43, 10115 Berlin, Germany. Urban, 2012), are associated with endosymbiotic bacteria (Buchner, 1965; Douglas, 1989). For the constituent Sternorrhyncha (psyllids, whiteflies, aphids, coccoids), Summary Auchenorrhyncha (Cicadomorpha: cicadas, spittlebugs, Many hemipterans are associated with symbiotic leafhoppers, treehoppers; Fulgoromorpha: planthoppers), bacteria, which are usually found intracellularly in Heteroptera (lygaeoids, coreoids, pentatomoid bugs) and specific bacteriomes. In this study, we provide the Coleorrhyncha (moss bugs), a close relationship with obli- first molecular identification of the bacteriome- gate, primary (P-)endosymbionts has been described associated, obligate endosymbiont in a Gondwanan (Buchner, 1965; Baumann, 2005; 2006; Kikuchi et al., relict insect taxon, the moss bugs (Hemiptera: Cole- 2008; Moran et al., 2008; Kuechler et al., 2012). In Ster- orrhyncha: Peloridiidae), which represents one of the norrhyncha, Auchenorrhyncha and Lygaeoidea these oldest lineages within the Hemiptera. Endosymbiotic maternally transmitted symbiotic bacteria are harboured associations of fifteen species of the family were ana- intracellularly in specialized host cells called bacteriocytes lysed, covering representatives from South America, forming an abdominal symbiotic organ called bacteriome. Australia/Tasmania and New Zealand. Phylogenetic In the heteropterous Pentatomoidea and Coreoidea the analysis based on four kilobases of 16S–23S rRNA endosymbionts are localized in specialized midgut crypts gene fragments showed that the obligate endosymbi- and they are transmitted by postnatal transmission ont of Peloridiidae constitute a so far unknown group mechanisms (Buchner, 1965; Kikuchi et al., 2008). of Gammaproteobacteria which is named here ‘Can- Many of these close associations between the primary didatus Evansia muelleri’. They are related to the ster- (P-)endosymbionts and their insect hosts are apparently norrhynchous endosymbionts Candidatus Portiera evolutionary stable for hundreds of millions of years and Candidatus Carsonella. Comparison of the (Moran et al., 2008), and during this long period a strict primary-endosymbiont and host (COI + 28S rRNA) host–symbiont co-speciation has occurred, e.g. in psyllids trees showed overall congruence indicating co- (Carsonella), whiteflies (Portiera), aphids (with Buchnera) speciation the hosts and their symbionts. The distri- or coccoids (Tremblaya) (Baumann, 2005). bution of the endosymbiont within the insect body Most Hemiptera feed with their piercing-sucking mouth- and its transmission was studied using FISH. The parts exclusively on nutritionally restricted diets, like endosymbionts were detected endocellularly in a pair xylem or phloem plant-sap. Such dietary components are difficult to utilize for most animals, because e.g. phloem has a high content of carbohydrates but is deficient in Received 26 November, 2012; revised 16 January, 2013; accepted 22 January, 2013. *For correspondence. E-mail stefan.kuechler@uni- essential amino acids. The essential compounds, which bayreuth.de; Tel. 0049 0921 55 2733; Fax 0049 921 55 2743. the insect can neither synthesize itself nor obtain from its

© 2013 Society for Applied Microbiology and Blackwell Publishing Ltd 2 S. M. Kuechler et al. diet in sufficient quantities, are frequently supplied by the similar form of the bacteriomes and the method of vertical metabolic and biosynthetic capabilities of the associated transmission via egg in peloridiids and members of the endosymbionts. For example, in one of the best-studied Fulgoromorpha as indication of close phylogenetic rela- endosymbiosis, Buchnera aphidicola provides its aphid tionship, and suggested a single bacterial infection occur- host with essential amino acids missing in the host’s diet ring in the hypothesized common ancestor of the two (Shigenobu et al., 2000). Comparable nutritional contribu- lineages. However, this hypothesis was falsified by Schlee tions are known also from Candidatus Carsonella ruddii (1969) by suggesting a series of synapomorphies linking in psyllids (Nakabachi et al., 2006; Sloan and Moran, Coleorrhyncha and Heteroptera. One of the first attempts 2012a). In various representatives of the Auchenorrhyn- to characterize peloridiid endosymbionts with molecular cha, the synthesis of essential amino acids is accom- methods was conducted by Moran and colleagues (2005). plished by the most ancient and widely distributed primary However, the 16S rRNA gene sequences that the authors symbiont Candidatus Sulcia muelleri and a second endo- amplified from the peloridiids belonged to bacteria from the symbiont that varies among host subclades (McCutcheon Betaproteobacteria and to some others corresponding to and Moran, 2010). To date, a lot of investigations have the Microbacteriaceae. Apart from these pieces of informa- focused on the mutualistic endosymbiosis in Sternorrhyn- tion, no further details on the bacterial symbionts of Pelori- cha, Aucheorrhyncha and Heteroptera (Zchori-Fein and diidae are currently known. Bourtzis, 2012). Though considered one of the oldest In this study, we give the first detailed account of the lineages of Hemiptera, the small suborder Coleorrhyncha obligate, primary endosymbiont of moss bugs (Hemiptera, has been so far only poorly studied with respect to their Coleorrhyncha), adding, with new approaches, to bacterial endosymbionts. the morphological information of Müller (1951) and The suborder Coleorrhyncha have existed for over Pendergrast (1962), and developing and enriching the 250 Myr, since the late Permian (Popov and Shcherbakov, recent sequence data of Moran and colleagues (2005). 1991; 1996). Although the phylogenetic position of the Fifteen of the 36 recognized peloridiid species, collected group within the Hemiptera has been controversial for a in Australia, New Zealand and Chile, were analysed. The long time, it is currently widely accepted and well sup- phylogenetic position of the peloridiid endosymbionts ported by morphological and molecular studies that Cole- was elucidated by analysis of 16S–23S rRNA gene orrhyncha form the sister taxon of Heteroptera (Wootton, sequences. For one New Zealand species, Xenophyes 1965; Schlee, 1969; Wheeler et al., 1993; Campbell et al., cascus, the localization as well as the transmission route 1995; Ouvrard et al., 2000; Cryan and Urban, 2012). of a peloridiid symbiont was characterized using molecu- Coleorrhyncha are represented by a single extant family, lar techniques [fluorescence in situ hybridization (FISH)]. the Peloridiidae, comprising 17 genera with 36 species Finally, morphological characteristics of the bacteriome- (Burckhardt, 2009; Burckhardt et al., 2011). The small associated endosymbiont in X. cascus were investigated insects (body length 2–5 mm) occur in temperate and by transmission electron microscopic technique. subantartic rainforests (often with Nothofagus) or sphag- num bogs in South America (Chile, Argentina), New Results Zealand, New Caledonia and eastern Australia (from North Queensland to Tasmania) where they live in wet moss. General observation of the bacteriomes Due to their cryptic lifestyle as well as their poor repre- All dissected individuals of the examined moss bug sentation in collections the biology of moss bugs is rela- species (Fig. 1A) possessed a pair of bacteriomes. These tively poorly known. Available information is summarized slightly orange-coloured bacteriome masses were located by Burckhardt (2010) and Larivière and colleagues on either side of the abdomen adjacent to the gonads and (2011). In addition, vibrational signalling (Hoch et al., were subdivided into three partial bacteriomes of spheri- 2006) and jumping behaviour (Burrows et al., 2007) have cal shape (Figs 1B and S1). They were completely sepa- been described. rated from each other, lying in a straight row. All analysed An early analysis of the internal anatomy revealed that individuals and species were positive for the symbiotic Coleorrhyncha also possess specific bacteriomes, first bacterium presenting the same localization pattern and recorded by Evans (1948) in a drawing of a Hemiodoecus morphological characteristics. The same pattern and fidelis larva. Later, the endosymbiotic system of moss number was also found in larvae of Xenophyes cascus bugs was studied in more detail by Müller (1951) and and Xenophysella greensladeae. Pendergrast (1962). They dissected the bacteriomes and showed that the bacteriomes are present as two masses in Identification of the bacterial symbionts the analysed species, subdivided into 2–4 partial bacteriomes (depending on species and sex), on either side of the A four-kilobase DNA fragment containing the eubacterial abdomen near the gonads. Müller (1951) interpreted the 16S–23S rRNA genes was amplified by PCR from DNA

Candidatus Portiera aleyrodidarum, P-endosymbiont of whiteflies (Hemiptera: Sternorrhyncha: Aleyrodidae). Commonly used primers for the amplification of groEL, gyrB, EF1a gene sequences did not show any results. In addition, another intracellular endosymbiont could be detected inside the nuclei of the primary cells of Mal- pighian tubules. RFLP genotyping and sequencing of the clones identified only a single sequence type and BLAST searches revealed that the 16S rRNA gene sequences showed the highest agreement of 99% with the Rickettsia endosymbiont of the cranefly Limonia chorea (Diptera: Limoniidae).

Phylogenetic analysis of the Peloridiidae symbiont

Phylogenetic analysis of the 16S rRNA gene sequences placed the endosymbionts of Peloridiidae into a well- defined monophyletic group (100% posterior probability) within the Gammaproteobacteria, their closest sequence matches being Candidatus Carsonella ruddii and Candi- datus Portiera aleyrodidarum (Fig. 2). Furthermore, phylogenetic analysis of the 16S rRNA gene sequences divided the monophyletic group of peloridiid endosymbionts into several subgroups supported by high posterior probability values (Fig. 2). The tree branch length of the subgroups is modest, at least compared with those in Cand. Carsonella or Cand. Portiera. The evolutionary substitution rates of the 16S rRNA gene sequences of the peloridiid endosymbionts were higher than those of the related, free-living, culturable bacterium Fig. 1. Intracellular endosymbiotic system of moss bugs. of genus Zymobacter (Table 1). A. Adult female of Xenophyes cascus (photo courtesy E. Wachmann). Scale bar = 1 mm. B. Dissected abdomen showing the pair of tripartite bacteriomes Fluorescence in situ hybridization of the endosymbiotic (arrows) lying between lateral connexivum and thick dark orange Malpighian tubules (asterisk). Scale bar = 0.5 mm. Gammaproteobacterium C. Intracellular localization of bacteriome-associated symbionts of X. cascus by fluorescence in situ hybridization. Staining with the In situ hybridization used for the localization of the specific probe Xeno125 (Cy3, yellow) and DAPI (blue). Scale peloridiid endosymbionts was accomplished with a spe- bar = 100 mm. cific oligonucleotide probe targeting the 16S rRNA gene D. Agglomeration of the X. cascus endosymbiont at the posterior pole end of the oocyte (o) indicating transovarial transmission for cross-sections of the entire body of the moss bugs. ( = auto fluorescence of the egg integument). Scale bar = 100 mm. Specific signals of the primary endosymbiont could only be detected in the tripartite bacteriomes on each side samples of the peloridiid bacteriomes representing 15 (Fig. 1C). As in adults, the bacteriomes with endo- species and subjected to cloning and RFLP (restriction symbionts also occurred in the dissected larval instars fragment length polymorphism) typing. Only a 1.5 kb (fifth stadium). Moreover, fluorescent activity, indicating segment of the 16S rRNA could be amplified from DNA presence of the endosymbiont, was detected in an samples of Peloridium hammoniorum. All clones of each agglomeration located at the posterior pole end of the specific endosymbiont (only one RFLP type) were nearly oocytes (Fig. 1D). This is a strict indication that these identical to each other (99.7–99.9%) among the insect specific bacteria are transferred to offspring by vertical samples derived from geographically distant localities. transmission. Comparison with GenBank databases indicated that bacteriocyte-associated endosymbionts of the Peloridi- Electron microscopy of endosymbionts in X. cascus idae belong to the Gammaproteobacteria. The 16S–23S rRNA gene sequences that exhibit AT contents of 58–60% Ultrastructural examinations of the bacteriomes of showed the highest similarity of 86% to the sequences of X. cascus revealed that the symbiont organ is filled with

Fig. 2. Phylogenetic position of the primary endosymbiont of moss bugs. Consensus tree of the Bayesian interference with 39 sequences of the 16S rRNA gene [MrBayes; 1326 bp (625 variable sites, 513 parsimony-informative), 1 000 000 generations, 1000 trees; samplefreq = 1000; burn-in = 250]. The tree has been rooted with Burkholderia fungorum as an out-group. Support values of > 0.5 are indicated at the nodes.

Table 1. Relative-rate tests for the 16S rRNA gene sequence of the lineages of Xenophyes cascus endosymbiont, Cand. Portiera aleyrodidarum and Zymobacter palmae and Halomonas elongata as free-living relatives, as well as Vibrio cholerae as an out-group.

Organism(s) (Accession No./internal number) in Rate K1–K2 ratio a b c Host Lineage 1 Lineage 2 Out-group K1 K2 (mean Ϯ SD) (K1/K2) P value

Xenophyes Endosymbiont of Z. palmae (NR_041786) V. cholerae 0.235 0.157 0.078 Ϯ 0.0125 1.49 1e-07 cascus X. cascus (HF547808) and H. elongata (JN903897) (X74694) Bemisia tabaci Cand. P. aleyrodidarum Z. palmae (NR_041786) V. cholerae 0.216 0.153 0.063 Ϯ 0.0122 1.41 6.3e-07 (JN204494) and H. elongata (JN903897) (X74694) a. Estimated mean distance between lineage 1 and the last common ancestor of lineages 1 and 2. b. Estimated mean distance between lineage 2 and the last common ancestor of lineages 1 and 2. c. P values were generated using the program RRTree. spherically shaped bacteria (Fig. 3A). The endosymbionts (up to 40 mm) and only retained a small amount of visible of X. cascus have relatively large cells (up to 10 mmin heterochromatin. diameter) that sometimes exceed the cell nuclei in size (Fig. 3B). The overall appearance of the moss bugs endo- Host symbiont co-speciation between moss bugs and symbionts is similar to that of other endosymbiotic bacte- their endosymbionts ria, e.g. of Cand. Portiera aleyrodidarum. Furthermore, another bacterium was detected within A 950 bp segment of the mitochondrial cytochrome the nuclei of the primary cells of the Malpighian tubules oxidase I (COI) gene and a 2 kbp segment of the 28S (Fig. 3C and D). The infected nuclei were greatly enlarged rRNA gene were ampliﬁed by PCR from the moss bugs,

Fig. 3. Transmission electron microscopy (TEM) micrographs of endosymbionts of Xenophyes cascus. A. The bacteriome is completely ﬁlled with the new gammaproteobacterial endosymbiont (asterisk). B. Endosymbiont cells of pleiomorphic shape (asterisk) are densely packed near the nucleus (n). C. Nuclei of Malpighian tubules are infected by an intranuclear bacterium of the genus Rickettsia.in= infected nucleus, un = uninfected nucleus, lmt = lumen of the Malpighian tubule. D. High magniﬁcation of the rod-shaped bacteria in an infected nucleus.

Fig. 4. Phylogenetic concordance between the obligate endosymbionts of moss bugs and their hosts. Phylogenetic trees of the symbiotic bacteria (left) and the host insects (right) were generated with 16 sequences of the bacterial 16S–23S genes (4267 bp) and 16 concatenated sequences of the mitochondrial COI and 28S rRNA genes (2724 bp) respectively. Both consensus trees inferred by the Bayesian method (MrBayes; 1 000 000 generations, 1000 trees; samplefreq = 1000; burn in = 250). The insect and bacterial tree has been rooted with Cand. Portiera aleyrodidarum (NC_018507) and Rhaphigaster nebulosa (Heteroptera: Pentatomidae; AY839169, EU426880) as out-groups respectively. sequenced, and subjected to phylogenetic analysis. Com- (1962) reported three pairs of bacteriomes for the parison with symbiont phylogeny indicated that a signifi- female and four pairs for the male of the Australian cant degree of congruence exists between the hosts and Hackeriella veitchi and three pairs for both sexes of the their endosymbionts (Fig. 4). At the same time, no phylo- New Zealand Xenophyes cascus. For Australian Hemi- genetic concordance with the respective hosts could be odoecus leai, which he also investigated, he gave no observed for the endosymbionts of Peloridium hammonio- numbers. Interestingly, the results of this study differ rum and Hemiodoecellus fidelis. It must be mentioned from those of both authors: for each of the 15 species, here that only COI gene sequences (and No. 28S rRNA regardless of sex, the same number of the three pairs gene sequences) were amplified and sequenced from was determined. As in the studies of Müller or Pender- Peloridium hammoniorum. grast, our samples were small (one or two specimens pro species; X. cascus 26 specimens), so no final con- clusions could be made on the matter, but the contra- Discussion diction between our study and those of Müller (1951) Numerous Hemiptera are characterized by an compre- and Pendergrast (1962) may indicate that number of hensive association with phylogenetically diverse, obli- bacteriomes per individual could possibly vary between gate endosymbionts harboured in varied bacteriomes. different specimens of a peloridiid species. Many of these endosymbionts found in the suborders Sternorrhyncha, Auchenorrhyncha and Heteroptera have Identity of the symbionts and its bearing on the been described by molecular methods in the last 10 years phylogenetic position of the Peloridiidae (e.g. Baumann, 2005; 2006; Kikuchi et al., 2008; Moran et al., 2008; Kuechler et al., 2012). Only the endosymbio- Moran and colleagues (2005) were the first to character- sis of the small, enigmatic suborder Coleorrhyncha ize the symbionts of Peloridiidae (based on the Australian remained uncharacterized by molecular studies for a long Hackeriella veitchi and Rhacophysa taylori) with molecu- time presumably as a consequence of their cryptic, south- lar methods. The 16S rRNA gene sequences that they ern hemisphere lifestyle. In the present study, we provide amplified from the peloridiids belonged to a bacterium of the first molecular identification of the symbiotic bacteria the phylum Betaproteobacteria. In addition they found in moss bugs (Coleorrhyncha: Peloridiidae). bacteria corresponding to Microbacteriaceae (possibly a contamination from the gut lumen). The authors made no further statements concerning the endosymbiosis of the Structure and number of the bacteriomes Peloridiidae. Müller (1951) described two pairs of bacteriomes for the In the present study, the obligate endosymbionts Australian peloridiid Hemiodoecellus fidelis. Pendergrast of the 15 analysed peloridiid species were unambiguously

© 2013 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology Bacterial symbionts of Peloridiidae 7 characterized as a bacterium of the class Gammaproteo- peloridiids evolved. Additional South American species bacteria, forming a well-supported monophyletic group should be analysed for testing these hypotheses. and closely related to the endosymbionts of psyllids (Can- The endosymbionts of New Zealand Peloridiidae in our didatus Carsonella ruddii) and whiteflies (Candidatus analysis are paraphyletic with respect to the Australian Portiera aleyrodidarum). Assuming congruence between species. In the morphological tree (Burckhardt, 2009) the the endosymbiont and host phylogenies, this result is New Zealand (+ New Caledonian) taxa are monophyletic, unexpected, as the sister group relationship of Coleor- forming the sister group of the Australian + South Ameri- rhyncha and Heteroptera is well supported (Grimaldi and can clades. Apart from this, the morphological host tree Engel, 2005). There is no close phylogenetic relationship and the 16S rRNA symbiont tree (Figs 2 and 5) are similar between the analysed peloridiid symbionts and the intra- with monophyletic genera in both analyses. In the cellular endosymbionts found in Heteroptera (Hosokawa COI + 28S rRNA host tree the Australian H. fidelis and et al., 2010; Kuechler et al., 2012; Matsuura et al., 2012). South American P. hammoniorum form a monophylum We hypothesize that the obligate endosymbionts of the which is nested within the New Zealand clade rendering it moss bugs, psyllids and whiteflies do not originate from a paraphyletic. single infection of a hypothesized common ancestor of Despite some contradictions, the primary endosymbi- Sternorrhyncha and Coleorrhyncha, but result from a hori- onts of Peloridiidae demonstrate a significant degree of zontal transfer, and that the obligate endosymbionts found co-evolution with their hosts, particularly in the morpho- in Hemiptera have evolved multiple times independently logical tree (Fig. 5), and slightly less in the COI + 28S (Husník et al., 2011). rRNA tree. In the future, more gene markers should be analysed including more taxa, particularly from South America, New Caledonia and Lord Howe Island. Co-evolution between peloridiid endosymbionts and their hosts Function of the primary symbionts in the Peloridiidae The phylogenetic tree of the peloridiid endosymbionts Peloridiids feed on sap of a variety of mosses and liver- (Fig. 2) based on 16S rRNA gene sequences supports a worts, preferring bryophyte species that possess conduc- monophyletic Australian clade with monophyletic genera. tive tissue (V. Hartung, unpubl. data). Psyllids and The peloridiids Rhacophysa taylori, Peltophysa minor or whiteflies also feed on plant sap, so it is likely that pelori- Craspedophysa monteithi were not analysed for lack of diid endosymbionts play a role similar to theirs. It is known material. The symbiont phylogeny fits reasonably well the that Cand. Carsonella participates in the biosynthesis of morphological tree of Burckhardt (2009) (Fig. 5) with essential amino acids in its psyllid hosts (Nakabachi et al., respect to monophyly of genera as well as their relation- 2006; Tamames et al., 2007; Sloan and Moran, 2012a). ships to each other. Analysis of the genome of Cand. Portiera aleyrodidarum However, neither the 16–23S rRNA endosymbiont suggests that the endosymbiont is also capable to syn- tree nor that of Burckhardt (2009) (Fig. 5) show a perfect thesize and supply their whiteflies hosts with amino acids congruence (Fig. 4) with the host COI + 28S rRNA and carotenoids (Santos-Garcia et al., 2012; Sloan and tree. There, Hemiodoecus crassus is the sister group Moran, 2012b). Thus, one of the functions of peloridiid of the remainder of Hemiodoecus + Hemiowoodwardia symbionts could be complementing the diet with e.g. + Hackeriella, rendering Hemiodoecus paraphyletic. essential amino acids, vitamins. Completely different is the position of the Australian Bryophytes are seldom used as food source (Gerson, Hemiodoecellus fidelis which groups with the South 1982) probably due to a broad spectrum of secondary American Peloridium hammoniorum. In the morphological metabolites protecting them from herbivory (Ando and tree (Burckhardt, 2009), a monophyletic South American Matsuo, 1984; Zinsmeister and Mues, 1990; Xie and Lou, clade is sister group of a monophyletic Australian clade. 2009). In this context, the symbionts of the Peloridiidae Poor representation of South American species in our could play a role in excretion and/or detoxification of the analysis as well as the failure to obtain 28S rRNA gene ingested food. Genome sequencing of the peloridiid endo- sequences from P. hammoniorum may explain this symbiont and transcriptomics of the bacteriome will shed discrepancy. light on the function of bacterial symbionts as well as their The endosymbiont of P. hammoniorum is sister group of phylogenetic affinities. the remaining peloridiids in the bacterial tree (Fig. 2) which is in contrast to the position of host in the morpho- Rickettsia in the nuclei of Malpighian tubules cells logical tree (Burckhardt, 2009) (Fig. 5). This is similar of Peloridiidae to the view of Evans (1982) that P. hammoniorum, the only winged species of the family, is the most generalized Ultrastructural observations via electron microscopy taxon close to the ancestor from which the other revealed that the peloridiid species Xenophyes cascus

Fig. 5. Phylogenetic relationships within the Peloridiidae based on morphological characters, after Burckhardt (2009).

(other species not analysed yet) contains another bacte- Intranuclear bacteria are already known from various rium in addition to the obligate endosymbiont in bacterio- animal organisms (Wolbach, 1919; Pongponratn et al., cytes. These belong to the genus Rickettsia and are found 1998; Zielinski et al., 2009), but intranuclear symbionts inside the primary cell nuclei of the Malpighian tubules. could be detected only in a handful of insects so far

(Grandi et al., 1997; Perotti et al., 2006), including Hemi- ptera (Arneodo et al., 2008). As a result of this massive infestation of Rickettsia – endosymbionts in nuclei of Malpighian tubules (Fig. 3C 28S rRNA and D), it can be assumed that the hypertrophic nucleus has lost its function and the cell will die sooner or later. It is unknown to what extent the function of the

Malpighian tubule is influenced by the intranuclear COI bacteria, but we could not observe anything abnormal – though it is noteworthy that peloridiids generally GenBank Accession No. have very thick and conspicuous Malpighian tubules (Fig. 1C) which may be a consequence of the infestation. A comparable phenomenon was described for HF547813 HF547842 HF547828 HF547814 HF547851 HF547829 HF547810 HF547848 HF547825 HF547809 HF547838 HF547824 HF547808 HF547837 HF547823 HF547815 HF547849 HF547811 HF547844 HF547826 HF547812 HF547850 HF547827 HF547817 HF547845 HF547831 HF547818 HF547839 HF547832 HF547820 HF547841 HF547834 HF547819 HF547840 HF547833 Symbiont16S–23S rRNA Host insect HF547816 HF547846 HF547830 HF547822 HF547847 HF547836 HF547821 HF547843 HF547835 mitochondria of ticks, which were also infected by the bacterium Candidatus Midichloria mitochondrii of the order Rickettsiales (Alphaproteobacteria) (Sacchi et al., a 2004; Sassera et al., 2006; 2011). Even though the bacteria consumed the inner part of most mitochondria and multiplied in them, the infected tissue (oocytes) did not loose its function and appeared to develop normally. Thus, further studies are needed to uncover the relationships of the moss bugs and the bacteria in their Mal- pighian nuclei. On the basis of the distinct genetic, phylogenetic and histological traits described in this paper, we propose the name ‘Candidatus Evansia muelleri’ for the bacteriome- associated, obligate endosymbiont of Peloridiidae forming a new linage within the Gammaproteobacteria. The generic name refers to the first drawing of bacteriomes in peloridiids by J. W. Evans, a famous hemipterist who brought forward the study of the Peloridiidae. In the same way, the specific name honours H. J. Müller who first described the peloridiid endosymbiosis in detail.

Experimental procedures

Sampling and histology

Adults and larvae of 15 peloridiid species were collected in the field, during the years 2009–2012 (Table 2). Individuals of most species were transferred directly upon collection into 100% ethanol and stored at 4°C; only Xenophyes cascus und Oiphysa cumberi were kept alive in a laboratory. For all species, PCR and amplification of the bacterial 16S–23S rRNA gene were carried out. For Xenophyes cascus, in addition to sequencing, morphological analyses were made. The Ulva, Stewart Island, NZ 2010/02/16 V. Hartung Lake Matheson, Westland Tai Poutini NP, S.I., NZ 2010/03/16 V. Hartung Gunn’s Camp, Hollyford Valley, Fiordland NP, S. I., NZ 2010/03/07 V. Hartung Key summit track, Fiordland NP, S. I., NZ 2010/03/08 V. Hartung Otaki Forks, Tararua ranges, Tararua forest park, N. I., NZ 2011/12/30 and 2012/Apr. G. Gibbs Rarcho Grande, Chitoé, Chile 2009/02/27 D. Burckhardt Lake Matheson, Westland Tai Poutini NP, S.I., NZ 2010/03/16 V. Hartung Otaki Forks, Tararua ranges, Tararua forest park, N. I., NZ 2012/Apr. G. Gibbs Mait’s Rest, Great Otways NP, VIC, AUS 2010/Jan. V. Hartung Mt. Wellington, TAS, AUS 2010/02/03 V. Hartung Sawyer’s Hill, Kosciuszko NP, NSW, AUS 2009/12/26 V. Hartung New England NP, NSW, AUS 2009/Dez. V. Hartung Beauchamp falls, Great Otways NP, VIC, AUS 2010/01/14 V. Hartung Russell falls, Mt. Field NP, TAS, AUS 2010/Feb. V. Hartung isolated tissues of this species were subjected to either his- Mt. Hobwee, Lamington NP, QLD, AUS 2009/11/11 V. Hartung tology, fluorescence in situ hybridization (FISH) or electron microscopy. Before fixation in 4% paraformaldehyde overnight, the tegmina were removed from the insects. The fixed bugs were washed in 0.5¥ phosphate-buffered saline and 48% ethanol (v/v), dehydrated serially in ethanol (70%, 90%, 2 ¥ 100%) and embedded in Unicryl™ (Plano GmbH,

Germany). Serial sections (2 mm) were cut using a Leica Samples of moss bugs used in this study. Jung RM2035 rotary microtome (Leica Instruments GmbH,

Wetzlar, Germany), mounted on epoxy-coated glass slides GPS data and other locality information are available from this author. Xenophysella stewartensis Xenophysella greensladeae Xenophyes rhachilophus Xenophyes kinlochensis Xenophyes cascus Peloridium hammoniorum Oiophysa distincta Oiophysa cumberi Hemiowoodwardia wilsoni Hemiodoecus leai Hemiodoecus crassus Table 2. Taxon Localitya. Date (year/month/day) Collector Hackeriella brachycephala Hemiodoecus acutus Hemiodoecellus ﬁdelis and subjected to FISH. Hackeriella veitchi

Table 3. Oligonucleotide primer sequences used in this study.

Primer (sequence 5′→3′)

Forward Reverse Gene target Reference

07F 1507R 16S rRNA Lane (1991) (AGAGTTTGATCMTGGCTCAG) (TACCTTGTTACGACTTCAC) Pelos_23S_F1 Pelos_23S_R1 23S rRNA This study (ACCATAAGTGACTAGTTTAACCGTAAGGATGAC) (GTTACTYATGTCAGCATTCGCACT) Pelos_23S_F2 Pelos_23S_R2 23S rRNA This study (CCTTTAAAGAAAGCGTAATAGCTCA) (GCTCGCGTACCACTTTAAATGGCG) Pelos_COI_F Pelos_COI_R1 COI This study (ACCTTATCGCGWAAATGATT) (ATTCCTCTTAAYCCWAGRAAGTGTTG) Pelos_28S_F1 Pelos_28S_R1 28S rRNA This study (TGCCGAAGCAACTAGCCCTG) (TAATGTAGGTAAGGGAAGTCG) Pelos_28S_F2 Pelos_28S_R2 28S rRNA This study (AGCACTGGGCAGAAATCACAT) (TCGCTATGAACGCTTGGCCGC)

DNA extraction, cloning and sequencing gel, and fixed again in 2.5% glutaraldehyde in 0.1 M cacodylate buffer (pH 7.3) overnight. The tissue was washed All primer pairs for the amplification of bacterial 16S–23S in 0.1 M cacodylate buffer for 20 min three times. Following rRNA, as well as host COI and 28S rRNA gene sequences postfixation in 2% osmium tetroxide for 2 h, the sample was are reported in Table 3. All PCR reactions were performed on washed and stained en bloc in 2% uranyl acetate for 90 min. a Biometra thermal cycler with the following programme: an After fixation, the tissue was dehydrated serially in ethanol initial denaturating step at 94°C for 3 min, followed by 34 (30%, 50%, 70%, 95% and 3 ¥ 100%), transferred to propyl- cycles of 94°C for 30 s, 56°C for 2 min and 72°C for 1 min. A ene oxide and embedded in Epon. Ultrathin sections (70 nm) final extension step of 72°C for 10 min was included. PCR were cut using a diamond knife (Micro-Star, Huntsville, TX) products of the bacterial 16S–23S sequences were cloned on a Leica Ultracut UCT microtome (Leica Microsystems, ™ using the CloneJET PCR Cloning Kit (Fermentas). Suitable Vienna, Austria). Ultrathin sections were mounted on clones for sequencing were selected by RFLP. Inserts were pioloform-coated copper grids and stained with saturated digested by restriction endonucleases RsaI and HhaI. Plas- uranyl acetate, followed by lead citrate. The sections were mids containing the DNA inserts of the expected sizes were viewed using a Zeiss CEM 902 A transmission electron sequenced with pJET1.2 forward and pJET1.2 reverse microscope (Carl Zeiss, Oberkochen, Germany) at 80 kV. sequencing primers (Fermentas). Purified PCR products of the host COI and 28S rRNA gene sequences were sequenced directly. Phylogenetic analysis High-quality sequences of the 16S–23S rRNA, COI and 28S Fluorescence in situ hybridization (FISH) rRNA genes were aligned using the ClustalW software in BioEdit (Hall, 1999) and edited manually. A likelihood ratio The following probes were used for FISH targeted to test was performed using MrModeltest V.2.3 (Nylander, 2004) the 16S rRNA gene: eubacterial probe EUB338 (5′-Cy3- to find the best-fitting models for the underlying molecular GCTGCCTCCCGTAGGAGT-3′); EUB388 II (5′-Cy3-GC data. The Akaike criterion selected the GTR + I + G model for AGCCACCCGTAGGTGT-3′); EUB338 III (5′-Cy3-GCTG 16S–23S rRNA, COI + 28S rRNA gene data. Under the evo- CCACCCGTAGGTGT-3′) (Daims et al., 1999); and the lutionary model, a Bayesian analysis with MrBayes (v.3.1.2) symbiont-specific probe Xeno125, (5′-Cy3-GAATCTG (Huelsenbeck and Ronquist, 2001) was performed with CATAATAGAGG-3′) (this study). In addition, a non-sense four simultaneous Markov chains for each dataset. For the probe complementary to EUB338, NON338 (5′-Cy3- 16S–23S rRNA, COI + 28S rRNA gene data, 1 000 000 ACTCCTACGGGAGGCAGC-3′) (Manz et al., 1992) was generations were used; in total, 1000 trees were obtained used as a negative control of the hybridization protocol. The (samplefreq = 1000) and the first 250 of these were consid- tissue sections were incubated with a hybridization buffer ered as the ‘burn in’ and discarded. A maximum parsimony [20 mM Tris-HCl (pH 8.0), 0.9 M NaCl, 0.01% SDS, 20% analysis was performed with PAUP* v. 4.0b10 (Swofford, formamide] containing 10 pmol ml-1 each of the fluorescent 2000). Relative-rate tests were carried out using Kimura’s probes, kept at 46°C for 90 min, rinsed with a washing buffer two-parameter model in the program RRTree (Robinson- [20 mM Tris-HCl (pH 8.0), 450 mM NaCl, 0.01% SDS], Rechavi and Huchon, 2000). mounted with an anti-bleaching solution (Vectashields Mounting Medium; Vector Laboratories, Peterborough, UK) and viewed under a fluorescence microscope. Sequence data The DNA sequences of bacterial 16S rRNA and 23S rRNA Electron microscopy genes as well as the mitochondrial COI and 28S rRNA host genes determined in this study were deposited in the DDBJ/ Dissected tissues were fixed in 2.5% glutaraldehyde in 0.1 M EMBL/GenBank nucleotide sequence databases under the cacodylate buffer (pH 7.3) for 1 h, embedded in 2% agarose Accession Numbers HF547808–HF547851 respectively.

Acknowledgements Daims, H., Bruhl, A., Amann, R., Schleifer, K.-H., and Wagner, M. (1999) The domain-specific probe EUB338 is We thank S. Geimer and R. Grotjahn for assistance in insufficient for the detection of all bacteria: development electron microscopy analysis, as well as D. Scholz and B. and evaluation of a more comprehensive probe set. Syst Westermann for the opportunity to use the fluorescence Appl Microbiol 22: 434–444. microscope, and for providing help. Viktor Hartung’s collec- Douglas, A.E. (1989) Mycetocyte symbiosis in insects. Biol tion trip in 2009–2010 was supported by an Elsa Neumann Rev Camb Philos Soc 64: 409–434. doctorate grant of the State of Berlin and a German Academic Evans, J.W. (1948) Some former inhabitants of Antarctica. Exchange (DAAD) travel grant. Department of Conservation, The illustrated London News, February 21, 1948: 218. NZ and nature conservation departments of Queensland, Evans, J.W. (1982) A review of present knowledge of the New South Wales, Victoria and Tasmania as well as Austral- family Peloridiidae and new genera and new species from ian Government Department of Environment, Water, Heritage New Zealand and New Caledonia (Hemiptera: Insecta). and Arts provided collection and export permits. Geoff Mon- Rec Aust Mus 34: 381–406. teith was immensely helpful with collection equipment and Gerson, U. (1982) Bryophytes and invertebrates. In Bryo- information on biology and ecology of the moss bugs. Ekke- phyte Ecology. Smith, A. (ed.). London, UK: Chapman and hard Wachmann provided a photo of Xenophyes cascus.We Hall, pp. 291–332. also thank A. Kirpal for technical assistance and Hannelore Grandi, G., Guidi, L., and Chicca, M. (1997) Endonuclear Hoch and Roland Mühlethaler for discussions. Finally, we bacterial symbionts in two termite species: an ultrastruc- thank the two reviewers for their valuable comments. tural study. J Submicrosc Cytol Pathol 29: 281–292. The authors declare that there is no conflict of interests. Grimaldi, D., and Engel, M. (2005) Evolution of the Insects. 1st edn. Cambridge, NY, USA: Cambridge University References Press. Hall, T.A. (1999) BioEdit: a user-friendly biological sequence Ando, H., and Matsuo, A. (1984) Applied bryology. In alignment editor analysis program for Windows 95/98/NT. Adavnces in Bryology 2. Schultze-Motel, W. (ed.). New Nucleic Acids Symp Ser 41: 95–98. York, USA: Lubrecht and Cramer, pp. 133–224. Hoch, H., Deckert, J., and Wessel, A. (2006) Vibrational Arneodo, J.D., Bressan, A., Lherminier, J., Michel, J., and signalling in a Gondwanan relict insect (Hemiptera: Cole- Boudon-Padieu, E. (2008) Ultrastructural detection of an orrhyncha: Peloridiidae). Biol Lett 2: 222–224. unusual intranuclear bacterium in Pentastiridius leporinus Hosokawa, T., Koga, R., Kikuchi, Y., Meng, X.-Y., and (Hemiptera: Cixiidae). J Invertebr Pathol 97: 310–313. Fukatsu, T. (2010) Wolbachia as a bacteriocyte-associated Baumann, P. (2005) Biology bacteriocyte-associated endo- nutritional mutualist. Proc Natl Acad Sci USA 107: 769– symbionts of plant sap-sucking insects. Annu Rev Micro- 774. biol 59: 155–189. Huelsenbeck, J.P., and Ronquist, F. (2001) MrBayes: Baye- Baumann, P. (2006) Diversity of prokaryote-insect associa- sian inference of phylogenetic trees. Bioinformatics 17: tions within the Sternorrhyncha (psyllids, whiteflies, aphids, 754–755. mealybugs). In Insect Symbiosis, Vol. 2. Miller, T.A., and Husník, F., Chrudimský, T., and Hypša, V. (2011) Multiple Bourtzis, K. (eds). Boca Raton, FL, USA: CRC Press, pp. origins of endosymbiosis within the Enterobacteriaceae 1–24. (g-Proteobacteria): convergence of complex phylogenetic Buchner, P. (1965) Endosymbiosis of Animals with Plant approaches. BMC Biol 9: 87. Microorganisms. New York, USA: Interscience Publishers. Kikuchi, Y., Hosokawa, T., and Fukatsu, T. (2008) Diversity of Burckhardt, D. (2009) Taxonomy and phylogeny of the bacterial symbiosis in stinkbugs. In Microbial Ecology Gondwanan moss bugs or Peloridiidae (Hemiptera, Cole- Research Trends. van Dijk, T. (ed.). New York, USA: Nova orrhyncha). Dtsch Entomol Z 56: 173–235. Science Publishers, pp. 39–63. Burckhardt, D. (2010) Mooswanzen – Peloridiidae (Hemi- Kuechler, S.M., Renz, P., Dettner, K., and Kehl, S. (2012) ptera, Coleorrhyncha), eine enigmatische Insektengruppe. Diversity of symbiotic organs and bacterial endosymbionts Entomol Austriaca 17: 9–22. among lygaeoid bugs of the families Blissidae and Lygaei- Burckhardt, D., Bochud, E., Damgaard, J., Gibbs, G.W., dae (Hemiptera: Heteroptera: Lygaeoidea). Appl Environ Hartung, V., Larivière, M.-C., et al. (2011) A review of the Microbiol 78: 2648–2659. moss bug genus Xenophyes (Hemiptera: Coleorrhyncha: Lane, D.J. (1991) 16S and 23S rRNA sequencing. In Nucleic Peloridiidae) from New Zealand: systematics and biogeog- Acid Techniques in Bacterial Systematics. Stackenbrandt, raphy. Zootaxa 2923: 1–26. E., and Goodfellow, M. (eds). New York, USA: John Wiley Burrows, M., Hartung, V., and Hoch, H. (2007) Jumping and Sons, pp. 115–148. behaviour in a Gondwanan relict insect (Hemiptera: Cole- Larivière, M.-C., Burckhardt, D., and Larochelle, A. (2011) orrhyncha: Peloridiidae). J Exp Biol 210: 3311–3318. Peloridiidae (Insecta: Hemiptera: Coleorrhyncha). Fauna N Campbell, B.C., Steffen-Campbell, J.D., Sorensen, J.T., and Z 67: 1–78. Gill, R.J. (1995) Paraphyly of Homoptera and Auchenor- McCutcheon, J.P., and Moran, N.A. (2010) Functional con- rhyncha inferred from 18S rDNA nucleotide sequences. vergence in reduced genomes of bacterial symbionts Syst Entomol 20: 175–194. spanning 200 My of evolution. Genome Biol Evol 2: 708– Cryan, J.R., and Urban, J.M. (2012) Higher-level phylogeny 718. of the insect order Hemiptera: is Auchenorrhyncha really Manz, W., Amann, R., Ludwig, W., Wagner, M., and Schleifer, paraphyletic? Syst Entomol 37: 7–21. K.-H. (1992) Phylogenetic oligodeoxynucleotide probes for

the major subclasses of proteobacteria: problems and mitochondrii’, an endosymbiont of the tick Ixodes ricinus solutions. Syst Appl Microbiol 15: 593–600. with a unique intramitochondrial lifestyle. Int J Syst Evol Matsuura, Y., Kikuchi, Y., Hosokawa, T., Koga, R., Meng, Microbiol 56: 2535–2540. X.Y., Kamagata, Y., et al. (2012) Evolution of symbiotic Sassera, D., Lo, N., Epis, S., D’Auria, G., Montagna, M., organs and endosymbionts in lygaeid stinkbugs. ISME J 6: Comandatore, F., et al. (2011) Phylogenomic evidence for 397–409. the presence of a flagellum and cbb(3) oxidase in the Moran, N.A., Tran, P., and Gerardo, N.M. (2005) Symbiosis free-living mitochondrial ancestor. Mol Biol Evol 28: 3285– and insect diversification: an ancient symbiont of sap- 3296. feeding insects from the bacterial phylum Bacteroidetes. Schlee, D. (1969) Morphologie und Symbiose; ihre Beweisk- Appl Environ Microbiol 71: 8802–8810. raft fur die Verwandtschaftsbeziehungen der Coleorrhyn- Moran, N.A., McCutcheon, J.P., and Nakabachi, A. (2008) cha. Stuttg Beitr Naturk 210: 1–27. Genomics and evolution of heritable bacterial symbionts. Shigenobu, S., Watanabe, H., Hattori, M., Sakaki, Y., and Annu Rev Genet 42: 165–190. Ishikawa, H. (2000) Genome sequence of the endocellular Müller, H.J. (1951) Über die intrazellulare Symbiose der bacterial symbiont of aphids Buchnera sp. APS. Nature Peloridiidae Hemiodoecus fidelis Evans und ihre Stellung 407: 81–86. unter den Homopterensymbiosen. Zool Anz 146: 150–167. Sloan, D.B., and Moran, N.A. (2012a) Genome reduction and Nakabachi, A., Yamashita, A., Toh, H., Ishikawa, H., Dunbar, co-evolution between the primary and secondary bacterial H.E., Moran, N.A., and Hattori, M. (2006) The 160-kilobase symbionts of psyllids. Mol Biol Evol 29: 3781–3792. genome of the bacterial endosymbiont Carsonella. Science Sloan, D.B., and Moran, N.A. (2012b) Endosymbiotic bacte- 314: 267. ria as a source of carotenoids in whiteflies. Biol Lett 8: Nylander, J.A.A. (2004) MrModeltest, Version 2. Uppsala, 986–989. Sweden: Evolutionary Biology Centre, Uppsala University. Swofford, D.L. (2000) PAUP*: Phylogenetic Analysis Using Ouvrard, D., Campbell, B.C., Bourgoin, T., and Chan, K.L. Parsimony (*and Other Methods). Sunderland, MA, USA: (2000) 18S rRNA secondary structure and phylogenetic Sinauer Associates. position of Peloridiidae (Insecta, Hemiptera). Mol Phylo- Tamames, J., Gil, R., Latorre, A., Pereto, J., Silva, F.J., and genet Evol 16: 403–417. Moya, A. (2007) The frontier between cell and organelle: Pendergrast, J.G. (1962) The internal anatomy of the Pelori- genome analysis of Candidatus Carsonella ruddii. BMC diidae. Trans R Entomol Soc Lond 114: 49–65. Evol Biol 7: 181. Perotti, M.A., Clarke, H.K., Turner, B.D., and Braig, H.R. Wheeler, W.C., Schuh, R.T., and Bang, R. (1993) Cladistic (2006) Rickettsia as obligate and mycetomic bacteria. relationships among higher groups of Heteroptera: congru- FASEB J 20: 1646–1656. ence between morphological and molecular data sets. Pongponratn, E., Maneerat, Y., Chaisri, U., Wilairatana, P., Entomol Scand 24: 121–137. Punpoowong, B., Viriyavejakul, P., and Riganti, M. (1998) Wolbach, S.B. (1919) Studies on Rocky Mountain Spotted Electron-microscopic examination of Rickettsia tsutsuga- Fever. J Med Res 41: 1–197. mushi infected human liver. Trop Med Int Health 3: 242– Wootton, R. (1965) Evidence for tracheal capture in early 248. Heteroptera. Proc XII Int Congr Ent (1964, London): Popov, Y.A., and Shcherbakov, D.E. (1991) Mesozoic 65–67. Peloridioidea and their ancestors (Insecta: Hemiptera, Xie, C.-F., and Lou, H.-X. (2009) Secondary metabolites in Coleorrhyncha). Geol Palaeontol 25: 215–235. bryophytes: an ecological aspect. Chem Biodivers 6: 303– Popov, Y.A., and Shcherbakov, D.E. (1996) Origin and evo- 312. lution of the Coleorrhyncha as shown by the fossil record. Zchori-Fein, E., and Bourtzis, K. (2012) Manipulative Tenants In Studies on Hemipteran Phylogeny. Schaefer, C.W. (ed.). – Bacteria Associated with Arthropods. Boca Raton, FL, Lanham, MD, USA: Entomololical Society of America, pp. USA: CRC Press. 9–30. Zielinski, F., Pernthaler, A., Duperron, S., Raggi, L., Giere, O., Robinson-Rechavi, M., and Huchon, D. (2000) RRTree: Borowski, C., and Dubilier, N. (2009) Widespread occur- relative-rate tests between groups of sequences on a phy- rence of an intranuclear bacterial parasite in vent and seep logenetic tree. Bioinformatics 16: 296–297. bathymodiolin mussels. Environ Microbiol 11: 1150–1167. Sacchi, L., Bigliardi, E., Corona, S., Beninati, T., Lo, N., and Zinsmeister, H.D., and Mues, R. (1990) Bryophytes, Their Franceschi, A. (2004) A symbiont of the tick Ixodes ricinus Chemistry and Chemical Taxonomy. Proc Phytochem Soc invades and consumes mitochondria in a mode similar to Europe, Vol. 29. Oxford, UK: Clarendon Press. that of the parasitic bacterium Bdellovibrio bacteriovorus. Tissue Cell 36: 43–53. Santos-Garcia, D., Farnier, P.-A., Beitia, F., Zchori-Fein, E., Supporting information Vavre, F., Mouton, L., et al. (2012) Complete genome Additional Supporting Information may be found in the online sequence of ‘Candidatus Portiera aleyrodidarum’ BT- version of this article at the publisher’s web-site: QVLC, an obligate symbiont that supplies amino acids and carotenoids to Bemisia tabaci. J Bacteriol 194: 6654– Fig. S1. Fifth instar larva of Xenophysella greensladeae. 6655. The orange-coloured bacteriomes, near the Malpighian Sassera, D., Beninati, T., Bandi, C., Bouman, E.A.P., Sacchi, tubules (asterisks), show the formation into three parts L., Fabbi, M., and Lo, N. (2006) ‘Candidatus Midichloria (arrows). Scale bar = 250 mm.