The Pennsylvania State University
The Graduate School
Department of Plant Pathology
MOLECULAR PHYLOGENY AND INCREASES OF YIELD AND THE
ANTIOXIDANTS SELENIUM AND ERGOTHIONEINE IN BASIDIOMATA OF
PLEUROTUS ERYNGII
A Dissertation in
Plant Pathology
by
Alma Edith Rodriguez Estrada
© 2008 Alma Edith Rodriguez Estrada
Submitted in Partial Fulfillment of the Requirements for the Degree of
Doctor of Philosophy
August 2008
The dissertation of Alma Edith Rodriguez Estrada was reviewed and approved* by the following:
Daniel J. Royse Professor of Plant Pathology Dissertation Co-Advisor Co-chair of Committee
Maria del Mar Jimenez-Gasco Assistant Professor of Plant Pathology Dissertation Co-Advisor Co-chair of Committee
C. Peter Romaine Professor of Plant Pathology
Gary W. Moorman Professor of Plant Pathology
Robert B. Beelman Professor of Food Sciences
Barbara J. Christ Professor of Plant Pathology Head of the Department of Plant Pathology
*Signatures are on file in the Graduate School
ABSTRACT
The Pleurotus eryngii species complex comprises at least five varieties: eryngii,
ferulae, elaeoselini, nebrodensis and tingitanus. This species is unique among the genus
Pleurotus because in nature it is found in association with specific members of the
Umbelliferae and Compositae families. Geographic distribution of Pleurotus eryngii is
limited to subtropical regions of the Mediterranean, Central and Southern Europe,
Ukraine, North Africa, East and Central Asia and Iran. Pleurotus eryngii var. eryngii and
nebrodensis were domesticated in 1970 and 1987, respectively, and are now cultivated in some countries of Asia and Europe. In the United States, the var. eryngii was recently introduced with cultivation beginning in 2000.
The varietal status of members of P. eryngii has been widely questioned and the evolutionary relationships among them are unknown. In this research, four regions of the genome were analyzed to establish phylogenetic relationships among isolates of var. eryngii, ferulae, elaeoselini and nebrodensis. No nucleotide variation in the Internal
Transcribed Spacer (ITS) region was found among the varieties eryngii, ferulae and
elaeoselini although intra-isolate polymorphisms were observed in some isolates. On the
other hand, allelic polymorphisms in the partial β-tubulin gene were problematical in
phylogenetic studies but allowed delimitation of genetic pools. Informative nucleotide
variation in partial sequences of the genes coding for translation elongation factor (tef1)
and RNA polymerase II (RPB2) were useful for phylogenetic analyses among the
varieties. Combined data sets of tef1 and RPB2 indicated that P. eryngii is a
monophyletic group. Varieties eryngii, elaeoselini and ferulae are closely related sharing a common ancestor. In all phylogenetic analyses, Pleurotus eryngii var. nebrodensis was
iii
placed in a distinct clade, clearly differentiated from the other varieties indicating that this group should be considered a distinct species. Limited nucleotide variation in the genomic regions of the varieties eryngii, ferulae and elaeoselini was indicative that P. eryngii is a taxon that recently diverged and that the speciation mechanism is a result of host adaptations rather than geographical isolation. Since distribution of var. nebrodensis
is restricted to elevations of 1,200 – 2000 m, altitude might also be important in its
speciation.
A second objective of this research was to elucidate cultural practices that might
be used to enhance the concentration of two important antioxidants found in mushrooms:
selenium (Se) and ergothioneine (ERGO). In order to enhance Se content in basidiomata,
substrates were supplemented with sodium selenite (Na2SeO3) at two levels (5 and 10
μg/g). Basidiomata of one commercial isolate of P. eryngii var. eryngii linearly
accumulated Se up to 4.6 and 9.3 μg/g. On the other hand, ERGO concentration was
enhanced in mushrooms produced on a substrate with 55% moisture content compared to
the commonly used 60% in commercial cultivation. Mushrooms produced on low-
moisture content substrate had ERGO concentrations up to 3.0 mg/g, while mushrooms
produced on high-moisture content substrate had less than 2.3 mg/g.
Commercial cultivation of P. eryngii in controlled environments usually involves
a single harvest; after that, the substrate is discarded. However, on some Italian and
Chinese farms, growers use a casing layer to obtain more than one break of mushrooms.
A third objective of this research, therefore, was to determine yield, biological efficiency
(BE) and number of mushrooms as influenced by casing and substrate supplementation.
Application of a casing overlay increased total yield by 141% compared to a non-cased
iv
substrate. Supplementation of substrate with delayed release nutrient (Remo’s at 4% d.w.) added at substrate fragmentation increased yield by 14% over non-supplemented substrate. When a casing overlay and nutrient supplement were used together, yields increased by 176%. These results may offer growers an opportunity to increase productivity and improve the nutritional and medicinal qualities of P. eryngii.
v
TABLE OF CONTENTS
List of Figures …………………………………………………………………... ix List of Tables …………………………………………………………………... xii Acknowledgements ……………………………………………………………... xvi
CHAPTER 1: Introduction 1.1 Pleurotus spp. ……………………………………….………………… 1 1.2 The Pleurotus eryngii species complex …………………………….… 2 1.2.1. Geographic and ecological distribution of the Pleurotus eryngii species complex ………………………………………………… 5 1.2.2. Nutritional components and medicinal value of Plerotus eryngii 6 1.3. Antioxidants in mushrooms: selenium and ergothioneine …………….. 7 1.4 Pleurotus eryngii var. eryngii cultivation ……………………………... 9 1.5 Commercial importance ………………………………………………. 11 1.6 Molecular systematics and phylogeny of fungi …...…………………... 13 1.6.1 Ribosomal RNA …………..…………………………………….. 14 1.6.2 β-tubulin ………..……………………………………………….. 15 1.6.3 Translation elongation factor 1 α (tef1) ……….………………… 17 1.6.4 RNA polymerase II (RPB2) …………………………………….. 18 1.7 Research statement ……………………………………………………. 19
CHAPTER 2: ITS sequence analysis and polymorphisms in isolates of Pleurotus eryngii and allied taxa 2.1 Introduction …………………………………………………………… 22 2.2 Materials and methods ………………………………………………... 24 2.3 Results ………………………………………………………………… 30 2.4 Discussion …………………………………………………………….. 41
vi
CHAPTER 3: Use of the β-tubulin gene to delimit varieties of Pleurotus eryngii species complex and phylogeny of the genus Pleurotus 3.1 Introduction ……………………………………………………..……… 46 3.2 Materials and methods ………………………………………..………... 48 3.3 Results ………………………………………………………...…...…… 54 3.4 Discussion ………………………………………………………...……. 64
CHAPTER 4: Use of the tef1 and RPB2 genes for phylogenetic reconstruction of the Pleurotus eryngii species complex and allied taxa 4.1 Introduction ………………………………………..…………………… 69 4.2 Materials and methods ……………………………….………………... 71 4.3 Results ………………………………………………………...…...…… 76 4.4 Discussion ………………………………………………………...……. 83
CHAPTER 5: Morphological and cultural characteristics of isolates of four vari- eties of Pleurotus eryngii 5.1 Introduction …………………………………………………………..… 89 5.2 Materials and methods ………………………………….……….……... 90 5.3 Results ………………………………………………………...…...…… 102 5.4 Discussion ………………………………………………………...……. 126
CHAPTER 6: Enhancement of the antioxidants ergothioneine and selenium in
Pleurotus eryngii var. eryngii basidiomata through cultural prac-
tices
6.1 Introduction ……………………………………………………...……… 130 6.2 Materials and methods ………………………………………….……... 133 6.3 Results ………………………………………………………...…...…… 144 6.4 Discussion ………………………………………………………...……. 158
vii
CHAPTER 7: Improvement of yield of Pleurotus eryngii var. eryngii using a
casing layer and substrate supplementation 7.1 Introduction ……………………………………………………...……… 164 7.2 Materials and methods ………………………………………….……... 166 7.3 Results ………………………………………………………...…...…… 174 7.4 Discussion ………………………………………………………...……. 181
CHAPTER 8: General conclusion ……………………………………………... 185
Appendix A: Sequence alignment of partial tef1 and RPB2 genes from the Pleurotus eryngii species complex …………………………...…... 188 Appendix B: Phylogenetic tree for the Pleurotus eryngii species complex based on combined sequences of the ITS regions and partial β-tubulin, tef- 1 and RPB2 genes …………………………………………….….. 194 Appendix C: Substrate supplementation with selenium and histidine ….……… 195 Appendix D: Chemical analyses of substrate and basidiomata ………………… 197
Literature cited …………………………………………….……………………. 199
viii
LIST OF FIGURES
Fig. 1.1. Pleurotus eryngii var. eryngii growing in association with Eryngium 4 campestre ……………………………………………………………... Fig. 1.2. Pleurotus eryngii var. ferulae growing in association with Ferula spp. 4 Fig. 1.3. Pleurotus eryngii var. nebrodensis found in the Madonie mountains, Sicily ………………………………………………………………….. 4 Fig. 1.4. Pleurotus eryngii var. elaeoselini. Basidiomata obtained from bottle production at the Mushroom Research Center, PSU ………………. 4 Fig. 1.5. Schematic structure of the ribosomal RNA gene ………..……………. 15 Fig. 1.6. Schematic structure of the β-tubulin gene of Schizophyllum commune 17 Fig. 1.7. Schematic structure of the translation elongation factor gene (tef1) of Schizophyllum commune ………………………………….…………... 18 Fig. 1.8. Schematic structure of the RPB2 gene ……………….………………... 18 Fig. 1.9. Conserved domains of the RPB2 gene ……………………….………... 19 Fig. 2.1. Primer location for amplification of the ITS1, 5.8S and ITS2 of the ribosomal RNA …….…………………………………………………. 28 Fig. 2.2. “Single” and “double” sequences and nucleotide additivity in the ITS regions of Pleurotus eryngii isolates ………………………………….. 31 Fig. 2.3. ITS sequence chromatogram (partial) for isolate WC957 …………….. 32 Fig. 2.4. Distribution of nucleotide sequence variation and indels in ITS1, 5.8S and ITS2 for clones and single spore isolate WC968 of P. eryngii var. eryngii ……………………………………………………….………... 34 Fig. 2.5. Phylogenetic analysis based on ITS1, 5.8S and ITS2 regions of rDNA of 18 heterogeneous sequences and a reference (Pe-AL1) ………….... 37 Fig. 2.6. Phylogenetic analysis based on the ITS1, 5.8S and ITS2 regions of the rDNA for four varieties of P. eryngii …………………………………. 38 Fig. 2.7. Phylogenetic analysis based on the ITS1, 5.8S and ITS2 regions of the rDNA for Pleurotus spp. …………...…………………………………. 39 Fig. 2.8. Phylogenetic analysis based on ITS1, 5.8S and ITS2 regions of rDNA
ix
for Pleurotus spp. ……………………………………..………………. 40 Fig. 3.1. Diagram of β-tubulin gene from Schizophyllum commune …………… 51 Fig. 3.2. Chromatograms (β-tubulin gene) showing nucleotide superimpositions at single sites in Pleurotus eryngii var. eryngii ………………….……. 56 Fig. 3.3. Phylogenetic tree constructed from distinct alleles (β-tubulin gene) found in three varieties of the P. eryngii species complex: eryngii (Er), ferulae (Fr) and elaeoselini (WC999) …….…………………………... 62 Fig. 3.4. Phylogenetic tree based on a portion of the β-tubulin gene for dikaryotic isolates of four varieties of Pleurotus eryngii: eryngii, ferulae, elaeoselini and nebrodensis …………………………………………... 62 Fig. 3.5. Phylogenetic tree based on a portion of the β-tubulin gene for four varieties of P. eryngii and other species within the genus Pleurotus …. 63 Fig. 4.1. Schematic diagram of the tef1 gene encoding for translation elongation factor (EF-1α) of Schizophyllum commune ...... ……………………… 75 Fig. 4.2. Schematic diagram of the RPB2 gene ……………………………….... 75 Fig. 4.3. Phylogenetic consensus tree constructed for four varieties of Pleurotus eryngii and other species within the genus Pleurotus based partial tef1 gene ……………………………………..…………………………….. 80 Fig. 4.4. Phylogenetic consensus tree constructed for four varieties of Pleurotus eryngii and other species within the genus Pleurotus based on two partial regions of the RPB2 gene …………..………………………….. 81 Fig. 4.5. Phylogenetic consensus tree constructed for four varieties of Pleurotus eryngii and other species within the genus Pleurotus based on combined partial sequences of the tef1 and RPB2 genes ……………... 82 Fig. 5.1. Classification of Pleurotus eryngii isolates according to the number of days from scratching to harvest ………………………………………. 97 Fig. 5.2. Isolate WC956 was classified as a non- producer ……….……………. 97 Fig. 5.3. Isolate WC949 was classified as a non-producer ……….…………….. 97 Fig. 5.4. Isolate WC931 was classified as non-producer ………….……………. 98 Fig. 5.5. Isolate WC955 was classified as a non-producer ………….………….. 98 Fig. 5.6. Distribution and cumulative distribution frequencies for L-values of the
x
pileus and stipe from mushrooms collected from Crops 1, 2 and 3 …... 99 Fig. 5.7. Primordial and mature stages of isolate WC958 and primordial stage of isolate WC-888 …………………………………………….…………. 109 Fig. 6.1. Pleurotus eryngii var. eryngii growing from substrate contained in dif- ferent containers ………………………………………………………. 138 Fig. 6.2. Pleurotus eryngii var. eryngii growing on cased and non-cased substrate 140 Fig. 6.3. Scatter plot showing a significant positive correlation between Se con- centration in the substrates and Se in P. eryngii var. eryngii basidiomata 145 Fig. 6.4. Influence of casing overlay on yield, production cycle length and solid content of Pleurotus eryngii var. eryngii ……………………………... 156 Fig. 6.5. Scatter plots for significant correlations ………………………………. 158 Fig. 7.1. Pleurotus eryngii var. eryngii primordia and basidiomata development in cased and uncased substrates ………………………………………. 171 Fig. 7.2. Second treatment ……………………………………………………… 172 Fig. 7.3. Mature basidiomata harvested from non-cased and cased substrate ….. 175
xi
LIST OF TABLES
Table 2.1. Pleurotus spp. isolates utilized in the study. Original source refers to the immediate isolate supplier. Geographic origin and host/substrate refers to the place and conditions where the isolates were found in nature …..………..... 26 Table 2.2. Number of clones and single spore isolates (SSI) obtained for four isolates of Pleurotus eryngii var. eryngii …………………………..… 34 Table 2.3: Site variation in the ITS1, 5.8S and ITS2 regions of the rDNA in four varieties of Pleurotus eryngii and six other species of Pleurotus ……. 35 Table 3.1. Source, geographic origin, culture collection code and host/substrate of dikaryotic isolates of Pleurotus spp. used in this study …………… 49 Table 3.2: Description of primers evaluated to amplify partial regions of the β- tubulin gene in Pleurotus eryngii var. eryngii and var. ferulae …………… 51 Table 3.3. Primer pairs evaluated for amplification of partial regions of the β- tubulin gene in Pleurotus eryngii var. eryngii and var. ferulae ………….. 55 Table 3.4. Variation within partial β-tubulin gene in five isolates of Pleurotus eryngii var. eryngii and three isolates of var. ferulae ………………... 57 Table 3.5. Distribution of sequence polymorphisms in a partial region of the β- tubulin gene (exon 5 to 8) for Pleurotus eryngii var. eryngii, ferulae, elaeoselini and nebrodensis isolates. Sequences of four alleles identified in var. eryngii (Er) and six alleles in var. ferulae (Fl) are also indicated ……………………….……………………………………... 59 Table 3.6. Genotype conformation for partial β-tubulin gene in Pleurotus eryngii var. eryngii, ferulae, elaeoselini and nebrodensis isolates …………... 60 Table 3.7. Sequence variation in partial β-tubulin gene (exon 5 to 8) in varieties of Pleurotus eryngii and Pleurotus spp. …………...…………………. 60 Table 4.1. Species, variety, isolate code, original source, geographic origin and host/substrate of isolates of Pleurotus spp. used in this study ……….. 72 Table 4.2. Sequence variation among varieties of the Pleurotus eryngii species complex and Pleurotus spp. for partial tef1 gene (Exons 4 to 6) …….. 77
xii
Table 4.3: Sequence variation among varieties of the Pleurotus eryngii species complex and Pleurotus spp. for two partial regions of the RPB2 gene (domains 5 to 11) ……………………………………………………... 79 Table 5.1. Species, varieties, isolate code, original source, geographic origin and host/substrate of Pleurotus eryngii used in this study ………………... 91 Table 5.2. Color categories and ranges for pilei and stipes based on data collected from isolates grown in Crops 1, 2 and 3 …………………… 100 Table 5.3. Crops and isolates used to evaluate production and morphological characteristics of four varieties (eryngii, ferulae, elaeoselini and nebrodensis) of Pleurotus eryngii …………………………………… 101 Table 5.4. Yield, biological efficiency (BE) and number of mushrooms produced by 16 isolates of Pleurotus eryngii var. eryngii (Crop 1) ……………. 104 Table 5.5. Yield, biological efficiency (BE) and number of mushrooms produced by 15 isolates of Pleurotus eryngii var. eryngii (Crop 2) ……………. 105 Table 5.6. Yield, biological efficiency (BE) and number of mushrooms produced by 11 isolates of Pleurotus eryngii var. eryngii and one P. eryngii var. elaeoselini (Crop 3) …………………………………………………... 106 Table 5.7. Yield, biological efficiency (BE) and number of mushrooms produced by 13 isolates of Pleurotus eryngii var. eryngii and 3 isolates of P. eryngii var. ferulae (Crop 4) …………………………………………. 107 Table 5.8. Isolates classified according to their basidiomata production capacity and to the length of the production cycle …………………………… 109 Table 5.9. Productivity, stipe/cap ratio, mushroom size and color of basidiomata for isolates of Pleurotus eryngii grown in Crop 1 ………………...…. 111 Table 5.10. Productivity, stipe/cap ratio, mushroom size and color of basidioma- ta for isolates of Pleurotus eryngii grown in Crop 2 ……………....…. 116 Table 5.11. Productivity, stipe/cap ratio, mushroom size and color of basidioma- ta for isolates of Pleurotus eryngii grown in Crop 3 ……………….… 120 Table 5.12. Productivity, stipe/cap ratio, mushroom size and color of basidioma- ta for isolates of Pleurotus eryngii grown in Crop 4 ……………….… 123 Table 6.1. Description of treatments to evaluate the influence of substrate frag-
xiii
mentation on ERGO concentration of Pleurotus eryngii var. eryngii basidiomata ……………………………...……………………………. 136 Table 6.2. Experimental parameters used to quantify ERGO concentration in Pleurotus eryngii var. eryngii basidiomata as a response to histidine supplementation, moisture content of the substrate, and use of a casing layer …………………………………………………………………... 139 Table 6.3. Selenium concentration in substrate, Pleurotus eryngii var. eryngii basidiomata, Se produced per bottle, per serving size of raw mushrooms (85 g) and percentage of the RDA (Recommended Dietary Allowances) ………………………………………….………………. 145 Table 6.4. Mineral and nitrogen content in basal and supplemented substrate (sodium selenite) and Pleurotus eryngii var. eryngii basidiomata …… 146 Table 6.5. Effects and mean comparisons (Tukey-Kramer HSD test) for yield, BE, number of mushrooms and solids of Pleurotus eryngii var. eryngii as affected by supplementation of substrate with sodium selenite …... 147 Table 6.6. Weights of the moist and dry substrates contained per polypropylene bottle (1050 ml) in Crop 1 ……………………………………………. 147 Table 6.7. Effects of moisture content (Crop 2) and fragmentation of the substrate (Crop 3) on ERGO concentration in one commercial isolate of Pleurotus eryngii var. eryngii basidiomata …………………………... 149 Table 6.8. Effects of substrate moisture content (Crop 2) on yield, BE, number of mushrooms, and production cycle length for one isolate of Pleurotus eryngii var. eryngii ………………………………………………….... 149 Table 6.9. Effects of substrate fragmentation (Crop 3) on yield, BE, number of mushrooms, and production cycle length for one isolate of Pleurotus eryngii var. eryngii …………………….……………………………... 150 Table 6.10: P-values obtained from analysis of variance for influence of three factors (casing, moisture content of substrate, and histidine supplementation of substrate) and their interactions on ERGO concentration, ERGO/bag and ERGO/kg of dry substrate in one commercial isolate of Pleurotus eryngii var. eryngii (Crop 4) ………. 151
xiv
Table 6.11: ERGO concentration and solids content in Pleurotus eryngii var. eryngii basidioma and estimated amount of solids and ERGO per bin and ERGO per kg of dry substrate …………………………………… 152 Table 6.12: P-values from the analysis of variance for three factors (casing, moisture of substrate and histidine supplementation of substrate) and their interactions on yield, BE, number of mushrooms, mushroom solids content, and production cycle length of Pleurotus eryngii var. eryngii (Crop 4) ………………………………………………………. 154 Table 6.13: Effects of casing, substrate moisture content, and histidine supplementation of substrate on yield, BE, and number of mushrooms of Pleurotus eryngii var. eryngii ………………………………..…….. 155 Table 6.14: Pearson correlation coefficients among moisture, ERGO, ERGO/bag (substrate unit), yield, solids/mushroom, solids/bag (substrate unit) … 157 Table 7.1. Design of factorial experiment used to evaluate the influence of a casing layer and delayed-release nutrient supplement (Remo’s) on yield, BE and number of mushrooms produced by one isolate of Pleurotus eryngii var. eryngii ………………………………………... 166 Table 7.2. Second set of treatments applied to spent non-cased substrates in order to induce subsequent breaks ………………………………………….. 170 Table 7.3. P-values from analysis of variance for casing layer, supplementation and their interactions influencing yield, BE, number of mushrooms, solids, and pileus color during first flush of Pleurotus eryngii var. eryngii ………………………………………………………………… 175 Table 7.4. Mean separation (Tukey-Kramer HSD test) for yield, BE, number of mushrooms, solids and color measured in the first break of Pleurotus eryngii var. eryngii …………………………………………………… 176 Table 7.5. Yield (g/bin), BE and number of mushrooms produced per bin during the second and third flush (subsequent flushes) for the later-cased treatments for Pleurotus eryngii var. eryngii ………………………… 178 Table 7.6. Yield (g/bin), BE and number of mushrooms for three production methods: “casing”, “non-casing”, “casing after first flush” ……...... 180
xv
ACKNOWLEDGEMENTS
I would like to thank Drs. Royse and Jimenez-Gasco, co-advisors of this work, for all their guidance, time, support and encouragement along these years of research. I am grateful to Drs. Peter Romaine, and Gary Moorman, members of my research committee for their useful suggestions and time. I want to thank Dr. Robert Beelman, also member of my research committee, for his cooperation and opportunity to use his laboratory equipment and supplies and Dr. Hyun-Ju Lee for her valuable assistance while performing the ergothioneine analyses. I also appreciate the suggestions regarding molecular techniques received from graduate students and postdocs from the Plant
Pathology department.
I wish to express my appreciation to Drs. Daniele Sisto and Teresa de Gioia,
Department of Biology and Plant Pathology, University of Bari; Dr. Solomon P. Wasser,
Institute of Evolution, University of HAIFA; Dr. Pompilio Rapana, Institute of Agro-
Environmental Biology and Forestry; Drs. Jacques Guinberteau and Philippe Callac,
MycSA, INRA Bordeaux France; Gourmet Mushrooms, Inc., Italspawn, Kennett Square
Specialties, and Far West Fungi for providing fungal cultures included in this study.
Special thanks are due to Vija Wilkinson for technical assistance in maintaining the culture collection.
Thanks to my all friends, especially Leila, Luz Marina, Leticia, Maria, Graciela,
Jean-Philippe, Shingo, Daniel and Andres for friendship, support and all the fun moments shared along these years. Finally, I want to thank my parents Alberto and Edith, my siblings Uriel and Irais and my nephew Pedro Alberto for their love and prayers.
xvi Chapter 1: Introduction
1.1 Pleurotus spp.
The genus Pleurotus includes several edible species that are known for their
excellent flavor and relatively inexpensive cultivation methods. This genus accounts for
approximately 14% of the world mushroom production, occupying third place after
Agaricus bisporus and Lentinula edodes (Chang 1999, 2006). Species identification of
Pleurotus is occasionally difficult because morphology and color of the basidiomata vary
considerably in response to environmental conditions. Another characteristic, spore size, overlaps between species impeding its use as a discriminating character (Zervakis et al.
2001b). Incorrect naming of commercial isolates also has contributed to ambiguity in the taxonomy of the genus. Mating tests (intercompatibility) with various isolates of
Pleurotus spp. have been used since the 70’s to elucidate boundaries between biological species. However, the reproductive barriers may not be absolute and partial incompatibility is well documented for P. eryngii and other species (Cailleux et al. 1981,
Bresinsky et al. 1987).
The use of molecular tools during the last decade has led to a better understanding of the identity, genetic variation and phylogeny of the genus Pleurotus and other
Basidiomycota. Intraspecific and interspecific relationships have been examined through
RFLP markers (restriction fragment length polymorphisms) and DNA sequencing of various regions of the nuclear and extrachromosomal genome (Vilgalys and Sun 1994,
Zervakis et al. 1994, Gonzalez and Labarere 2000, Bao et al. 2004a, Zervakis et al. 2004).
By utilizing morphological, intercompatibility and phylogenetic data, it is possible to
1 gain a better understanding of the identity, relatedness and evolutionary history of the
genus. All things considered, however, a clear delimitation between species often is
difficult. Therefore, the “species complex” concept is widely applied to define closely
related species that are completely or partially intercompatible (cross-fertile) and that may belong to a given intersterility group. In Pleurotus spp., several species complexes have been proposed (Bao et al. 2004b, Zervakis et al. 2001b).
1.2 The Pleurotus eryngii species complex
Pleurotus eryngii is known by different names according to the country where it
is produced and consumed: king oyster (United States), Pleorote du Panicaut (France), cardoncello (Italy), seta de cardo (Spain), and kruisdisteloesterzwam or krauterseitling
(Germany). Other common names include argonane, bouligoule, champignon de garrigue, and Boletus of the steppes (Rodriguez Estrada 2005, Rodriguez Estrada and
Royse 2005, Oei 2006).
The P. eryngii species complex includes: P. eryngii var. eryngii, P. eryngii var. ferulae, P. eryngii var. elaeoselini, P. eryngii var. nebrodensis, P. hadamardii, P. fossulatus (Venturella et al. 2000, Zervakis et al. 2001b) and the newly described variety
P. eryngii var. tingitanus (Lewinsohn et al. 2002). Originally, Quelet, Lanzi and Inzenga recognized P. eryngii (Agaricus eryngii - 1815), P. ferulae (A. ferulae - 1873) and P. nebrodensis (A. nebrodensis - 1863), respectively, as different species (as cited by
Candusso and Basso 1995). Studies based on mating tests have demonstrated a certain degree of intercompatibility between these three groups, suggesting and supporting the idea that members of these three groups may belong to a single biological species
2 (Lamoure 1981, Zervakis and Balis 1996). On the other hand, Urbanelli et al. (2002),
based on genetic and ecological observations, proposed P. eryngii var. eryngii and P. eryngii var. ferulae as two different biological species. Also, research based on molecular, qualitative (e.g. basidioma color, texture, presence of warts, etc.) and morphological traits has suggested that P. eryngii var. nebrodensis should be placed at the species level (Venturella 2000, Zervakis et al. 2001, De Gioia et al. 2005).
Some morphological traits may be useful to differentiate members of this species complex. For example, wild P. eryngii var. eryngii (Fig. 1.1) is characterized by its relatively small stipe (2–4 x 1–3 cm) and the usually brown color of the pileus. Pleurotus eryngii var. ferulae (Fig. 1.2) has a larger stipe (3–10 x 1–4 cm) than var. eryngii and the pileus color is always brown. The pileus of var. ferulae (6–25 cm) is also larger than var. eryngii (5–15 cm) (Boisselier-Dubayle 1983, Zervakis and Balis 1996, Urbanelli et al.
2002). Pleurotus eryngii var. elaeoselini (Fig. 1.4) has a pileus of 5–14 cm in diameter that is whitish to light beige in color. The stipe measures 4–7.5 x 1.2–2.8 cm. The spores
(10.1–14.0 x 5.2–7.1 μm) are slightly larger than var. eryngii and ferulae (Venturella et al. 2000, Zervakis et al. 2001b). Pleurotus eryngii var. nebrodensis (Fig. 1.3) is characterized by its white cream color, lamellae deeply decurrent and fused on the stipe and larger spores 13.2–17.4 x 5.5–8.2 μm (Zervakis et al. 2001b, Boisselier-Dubayle
1983).
Pleurotus eryngii var. elaeoselini was described by Venturella et al. in 2000. This variety resembles var. nebrodensis in regard to its macroscopic traits. However, they are differentiated by their microscopic characteristics (spores, cheilocystidia) and distinct
3
Fig. 1.1. Pleurotus eryngii var. eryngii growing Fig. 1.2. Pleurotus eryngii var. ferulae in association with Eryngium campestre. Causse growing in association with Ferula spp.. Mejean, France. Courtesy of Dr. J. Guinberteau. Photo by Celestino Gelpi.
Fig. 1.3. Pleurotus eryngii var. Fig. 1.4. Pleurotus eryngii var. elaeoselini. nebrodensis found in the Madonie Basidiomata obtained from bottle production at mountains, Sicily. Courtesy of Dr. G. the Mushroom Research Center, PSU. Venturella.
ecology. The variety elaeoselini grows in association with Elaeoselinum asclepium
subsp. asclepium while the variety nebrodensis grows on Opopanax chironium and
Cachrys ferulace (Venturella et al. 2000). Ambiguity of the identification of these two varieties can be traced back to the first description of A. nebrodensis in Italy. Venturella
et al. (2000) states that specimens of Pleurotus eryngii var. elaeoselini were considered
under the A. nebrodensis taxon described by Inzenga in 1863. Lewinsohn et al. (2002)
4 described a new variety: P. eryngii var. tingitanus that grows in association with Ferula
tingitana in Israel. Pleurotus hadamardii and P. fossulatus are taxa of uncertain validity,
and are probably misidentifications of P. eryngii var. elaeoselini and var. nebrodensis
(Zervakis et al. 2001b). Other names given to P. eryngii were Pleurotus fuscus (Batt.)
Bres. and P. cardarella (Fr.) Quel (Cailleux and Joly 1987).
1.2.1 Geographic and ecological distribution of the Pleurotus eryngii species
complex
The Pleurotus of the Umbellifers occupy an area in the Northern hemisphere between the 30 and 50º N (Zervakis and Balis 1996). These species are mainly found in the subtropical regions of the Mediterranean, Central Europe, Russia, Ukraine, Central
Asia and Iran. Pleurotus eryngii is found from the steppes and dry meadows up to the mountaineer zone. Pleurotus eryngii is unique in the genus for its ability to grow as a facultative biotroph on some members of the Umbelliferae (Eryngium campestre, E. maritimum, E. alpinum, E. moroccanum, E. planum, Ferula communis, F. sinkiangensis,
Laserpitium latifolium, L. siler, Elaeoselinum asclepium, Thapsia garganica, Cachrys ferulacea among others) and Compositae families (Zervakis and Balis 1996, Zadrazil
1974, Lewinsohn et al. 2000, Zervakis et al. 2001a,b). Pleurotus eryngii var. eryngii is generally found in association with Eryngium spp. Pleurotus eryngii var. ferulae grows on the roots of Ferula spp. found in the Mediterranean basin. Pleurotus eryngii var. nebrodensis usually is found in association with Cachrys from the sub-alpine zones of
Europe and Asia at 1,200 to 2,000 m and with F. sinkiangensis in China (Zervakis et al.
2001b, Boisselier-Dubayle and Baudoin 1986, Zhang et al. 2005).
5 1.2.2 Nutritional components and medicinal value of P. eryngii
Nitrogen and mineral composition of cultured basidiomata of P. eryngii in oven
dried samples are as follows: nitrogen 4.9%, phosphorus 1.3%, potassium 3.1%, calcium
0.006%, magnesium 0.2%, manganese 13.1 μg/g, iron 29.3 μg/g, copper 22 μg/g, boron
19.7 μg/g, aluminum 2.2 μg/g, zinc 89.3 μg/g and sodium 240 μg/g (Rodriguez Estrada
and Royse 2007). Nutritional composition per 100 g of dry matter includes: ash 4.3 g,
lipids 6.7 g, proteins 12.3 g, soluble carbohydrates 25.3 g, non-cellulosic polysaccharides
15.4 g, cellulosic polysaccharides 19.8 g and energy 272 kcal (Coli et al. 1988).
Pleurotus eryngii contains all the essential amino acids. The volatile flavor compounds in
P. eryngii include: 3-octanone, 1-octen-3-one, 3-octanol, 1-octen-3-ol, 1-octanol, 2- octen-1-ol and benzaldehyde. Soluble sugars such as galactose and sorbitol are present in low amounts (6.96 mg/g) (Mau et al. 1998). La Guardia et al. (2005) determined the chemical composition and nutritional value (vitamins and amino acids) of three varieties of P. eryngii (var. thapsiae, elaeoselini and eryngii) and P. nebrodensis (= var. nebrodensis). The most noticeable finding obtained by La Guardia et al. (2005) was that
P. nebrodensis had the highest content of vitamin B12 (cobalamin), B2 (riboflavin) and B7
(biotin) (1.93 μg, 0.29 mg and 18.3 μg per 100 g of dry weight respectively). Also important to consumers is the fact that the dietary fiber and fat content of P. eryngii and
P. nebrodensis is higher than A. bisporus.
Pleurotus eryngii is best known medicinally for its cardiovascular and cholesterol-modulating benefits. This mushroom contains mevinolin and related compounds that are potent competitive inhibitors of the major rate limiting enzyme in cholesterol biosynthesis (HMG CoA reductase). Pleurotus eryngii may facilitate liver and
6 kidney function, diminish gastrointestinal disorders, and may have anti-tumor, anti- inflammatory, immune response enhancers, antiviral and antibiotic properties
(Lewinsohn et al. 2000).
1.3 Antioxidants in mushrooms: selenium and ergothioneine
Mushrooms have known antioxidant properties provided by different compounds such as phenolics, ergothioneine (ERGO) and selenium (Se) (Mau et al. 2002, Werner and Beelman 2002, Beelman and Royse 2006, Dubost et al. 2007a). Selenium content in mushrooms is species specific (Stijve 1977). Boletus edulis for example, may have concentrations of up to 17 mg/kg (d.w.), while wild Agaricus spp. may contain 2.7 mg/kg
(d.w.) and P. cornucopiae and Grifola frondosa may have less than 0.5 mg/kg (d.w.)
(Piepponen et al. 1983, Beelman and Royse 2006). Researchers have found that supplementation of the substrate with sodium selenite (Na2SeO3) results in an increase in
the Se content in mushroom mycelium and basidiomata (Werner and Beelman 2002,
Stajic et al. 2005, Beelman and Royse 2006). Werner and Beelman (2002) demonstrated that Se accumulated in A. bisporus basidiomata when the substrate was supplemented with aqueous solutions of Na2SeO3 at different concentrations and that the Se uptake by
A. bisporus basidiomata was linearly related to concentration in the compost. Selenium enrichment of P. cornucopiae and Grifola frondosa was examined by Beelman and
Royse (2006). Basidiomata of P. cornucopiae accumulated 29.4 μg/g of Se while G.
frondosa accumulated 8.3–10.3 μg/g when the substrate was supplemented with 10 μg/g
d.w. of Na2SeO3. The authors proposed that Se-enriched mushrooms may be used as a
component in functional foods or as a selenium supplement (Werner and Beelman 2002).
7 In P. eryngii, Se content and absorption from the media was studied only in the
vegetative mycelium stage (Stajic et al. 2005).
Another important antioxidant found in mushrooms is ergothioneine (ERGO).
This compound is primarily produced by fungi and Mycobacterium (Melville et al. 1956,
Genghof and Van Damme 1964). Dubost et al. (2006) determined the ERGO content in
several edible mushrooms. Agaricus bisporus, either white or brown strains contained
less ERGO (0.4 – 0.7 mg/g d.w.) than the specialty species (P. eryngii, G. frondosa, P.
ostreatus and L. edodes with 1.7, 1.8, 2.0 and 2.1 mg/g d.w. respectively). Variation of the ERGO content in A. bisporus basidiomata was evaluated by Dubost et al. (2007a) in response to compost supplementation and cultural practices. ERGO concentration in
mushrooms harvested from phase II-compost supplemented with protein-rich corn-gluten
and the amino acids methionine and cysteine did not increased. On the other hand, ERGO
concentration was higher in basidiomata harvested during second and third flushes from
compost supplemented with histidine (5, 10 and 20 mM). In addition, cultural practices
such as fragmentation of the colonized compost at casing and lower moisture content of
the substrate improved ERGO content in mushrooms (Dubost et al. 2007a).
Phenolic compounds in mushrooms include a variety of compounds such as
tyrosine, catechol, phenolic acids, syringaldehyde, guaiacol, etc. (Choi and Sapers 1994,
Matila et al. 2001, Dubost et al. 2007b). Each mushroom species contains specific
combinations of these compounds. Dubost et al. (2007b) determined that total phenolics
found in mushrooms are significantly correlated to their antioxidant capacity, particularly
to the oxygen radical absorbance capacity (ORACtotal). The same authors also concluded
8 that brown strains of A. bisporus (portabella and crimini) contained higher antioxidant potential than L. edodes, G. frondosa and P. ostreatus (Dubost et al. 2007b).
1.4 Pleurotus eryngii var. eryngii cultivation
Four cultivation methods are generally used commercially to produce P. eryngii: bags, casing, bottles and outdoors (Tan et al. 2005).
Bag System: This cultivation method is mainly used in Europe. Polypropylene or polyethylene bags (with filters) of different capacities (0.5 – 3.0 kg) are used. Bags are filled with substrate at approximately one-half to two-thirds of their capacity. The substrate is sterilized (1.5 hours 121ºC) and then cooled overnight. Spawn is added to each bag, the bags are heat-sealed and then the spawn is thoroughly-mixed into the substrate by vigorously shaking the bags. Incubation may last 21 to 25 days at 23 to 25ºC and then the temperature is lowered to 18 – 21ºC to induce the formation of primordia that usually occurs after 4 to 5 weeks of incubation. The bags are opened after pins develop into more differentiated basidiomata. Mature mushrooms develop within 6 to 7 days after pin formation. Usually only one flush is obtained before the grower discards the substrate (Cailleux and Diop 1976, Rodriguez Estrada and Royse 2008).
Casing system: This method is utilized where mushrooms are grown in non-controlled environments. For example, in Italy, some production rooms may be simple buildings covered with shade cloth. Under these conditions, the surface of the substrate is prone to desiccation so a casing layer reduces water loss (Oei 2006). The substrate is compacted in blocks, wrapped with autoclavable plastic or bags and sterilized (1.5 hours at 121ºC) or pasteurized. Spawning then is carried out by inoculating both sides of the block with the
9 aid of a sharpened pipe, and closed with a plug (Oei 2006). Once the substrate is colonized, the casing (sandy or common soil watered to field capacity) is placed as a 1.5 to 3 cm overlay on the exposed substrate. Up to 3 flushes may be obtained, yielding from
700 to 1000 g per block. Two to three weeks are required between flushes (Oei 2006). In
China, plastic bags are completely removed after 6-10 days of colonization. The blocks are placed on beds and covered with casing soil. Some growers in China may case the bags after a second flush from the regular bag system (Tan et al. 2005).
Bottle system: Pleurotus eryngii cultivation in Japan, Korea, China, and to some extent in the USA is carried out on substrate contained in polypropylene bottles (850–1050 ml capacity). Aged sawdust and cottonseed hulls may be the main basal materials. Wheat and rice bran, ground soybean, corn powder, rye, millet and brewer’s grain are used as nutrient supplements (Rodriguez Estrada and Royse 2005). The substrates are mixed and the moisture content adjusted to 60–65%. Sixteen bottles are arranged in plastic trays, mechanically filled and capped. After compression of the substrate into the bottles, vertical holes (to the base of the bottles) are made for inoculation. The substrate is autoclaved (1.5 hours at 121ºC) and then cooled overnight at room temperature and inoculated with grain spawn. In Korea, a liquid spawn inoculation system for P. eryngii and Flammulina velutipes has become popular. The incubation period lasts from 28 to 35 days at 16–24°C. After colonization, lids are removed and the top layer (1–2 mm) of the colonized substrate is removed mechanically to induce uniform fructification over the surface. Water (20 to 30 ml) may be sprayed on the exposed substrate, followed by coverage of the bottles with a perforated plastic film that is removed after primordia formation. Several primordia are formed but only 3 to 4 develop to market-sized
10 mushrooms. Optimum relative humidity (RH) levels for primordia formation range from
90 to 95%, while development of basidiomata requires 85%. A single flush is obtained
when using the bottle system (Cailleux and Diop 1976, Rodriguez Estrada and Royse
2005).
Outdoor cultivation: The casing system described above is utilized for outdoor
cultivation. This system is mainly practiced in Italy. Substrate contained in plastic bags is
pasteurized, inoculated and incubated indoors. After the substrate is completely
colonized, the plastic bags are removed and the substrate placed in trenches dug in the
ground. The substrate is then cased with local soil. Metal frames supporting shade cloths
are placed over the buried substrate to provide additional protection. Irrigation is performed periodically (Zervakis and Venturella 2002). Although growing P. eryngii
under these conditions follows a seasonal schedule, a diverse array of growing locations
along an altitudinal gradient allows growers to harvest mushrooms for about 11 months during the year (Rodriguez Estrada and Royse 2008).
1.5 Commercial importance
For several reasons, P. eryngii var. eryngii is an exceptional candidate for cultivation. First, it is considered by many as the best flavored of all the oyster mushrooms. Other desirable characteristics include relatively long shelf life, reduced spore load and relatively high market price (Rodriguez Estrada and Royse 2005).
Commercial production of this species began in Italy in the mid 1970s. Presently, Japan,
China, Korea and Italy are the major producers. In China, P. eryngii production was
21,000 t in 2001 and increased to 114,000 t by 2003 (Chang 2005). The demand for P.
11 eryngii in Italy exceeds 2,000 t per year (Oei 2006). The king oyster was introduced in
Korea in 1995 and presently it comprises 30% of the mushroom market in that country
(Ro et al. 2007). Wild cardoncello also is collected and sold fresh in the local markets in
some European countries such as Spain and Italy. In the U.S., commercial production of
this species began in 2000 and by 2004, 85 tonnes were produced (Royse et al. 2005).
Fresh king oyster may be packed in over wrapped trays or sold in bulk. They also may be
dried in slices or sold as powder. Chinese producers sell the mushroom boiled and brined
and packed in plastic bags or cans. The retail price of king oyster varies considerably
among countries. In the U.S., fresh mushrooms may cost up to $16/kg. The price
dramatically increases up to $38.70/kg when labeled as an organic product (Rodriguez
Estrada 2005). In Italy, fresh mushrooms may cost up to $9 or more than $13/kg at the
end of the growing season (Oei 2006). In Germany, the retail price of the organic product
ranges from $27 to $34/kg and the wholesale price is around $16/kg (Kynast personal
communication). When sold dry, king oyster may reach prices of up to $62/kg in the U.S.
(Rodriguez Estrada 2005).
Consumer preferences for the morphology of P. eryngii var. eryngii vary
substantially. In Italy, a small and thin stipe and dark wide pileus are most preferred.
Consumers in Spain prefer lighter pilei. However, Chinese consumers have preference
for wide stipes (3.0– 5.0 cm) and small pilei (4.0–6.0 cm). In North America, Korea and
Japan, wide stipes (2.0–5.0 cm) and pilei (5.0–10.0 cm) are more frequently desired by
consumers (Rodriguez Estrada and Royse, in press).
Inzenga, who first described A. nebrodensis referred to this species as “the most delicious mushroom of the Sicilian mycological flora” (Venturella 2006). Wild P. eryngii
12 var. nebrodensis is rarely found in nature but still it is collected and sold fresh in northern
Sicily. However, since 2006, this species was considered a critically endangered species
by the IUCN (World Conservation Union) and was included on the red list of threatened
species. Still, no regulations have been implemented to forbid the harvest of this species
from its natural habitat. Since this species is usually collected in its young stages by
amateurs and professionals, it is estimated that only 250 basidiomata reach maturity every year in the north of Sicily. Due to its scarcity, the price of this mushroom ranges from $68 to $95/kg in Italy (Venturella 2006). Pleurotus eryngii var. nebrodensis has also been collected from the wild and consumed by indigenous people in China under the name “Tianshan holy mushroom”. Other common Chinese names for this species are:
Bailinggu, Baiaweiwo, and Tuolibianzhong (Shen et al. 2005). This mushroom was first domesticated in that country in 1987 (Zhang et al. 2005). Now it is commercially produced in China and Poland, where the wholesale prices for exportation of the fresh product fluctuates from $10 to $12/kg. However, the wholesale price within China can be as low as $2 to $3/kg; still, it is one of the highest priced mushrooms. The retail price of var. nebrodensis in China is approximately $5/kg while var. eryngii may cost $3 to $4/kg
(Hu 2003).
1.6 Molecular systematics and phylogeny in fungi
Various approaches have been used to classify fungi at the species level: morphology, mating compatibility and molecular phylogenetics. While morphology may be influenced by the environment and compatibility by experimental conditions in vitro, the genome is not affected. Moreover, the genetic composition and structure of fungi and
13 any other living organisms at different taxonomic levels can reveal their evolutionary
history (Kauserud and Schumacher 2003). In recent years, gene isolation and sequencing
in eukaryotes have played a main role in the study of molecular evolution in fungi.
Lutzoni et al. (2004) surveyed 560 papers published between 1990 and 2003 finding that
from 595 fungal phylogenetic trees, 499 (83.9%) were based on ribosomal RNA genes.
Protein coding genes such as β-tubulin, elongation factor (tef1) and the RNA polymerase
II subunit (RPB2) genes have been used to a much lesser extent, yet they increase support
for topologies inferred using certain regions of the ribosomal DNA genes [i.e. Internal
Transcribed Spacer (ITS), Large Subunit (LSU), Small Subunit (SSU), Intergenic Spacer
(IGS)]. Multilocus phylogenies still are not commonly used. From the same 595
phylogenetic trees surveyed by Lutzoni et al. (2004), 82.2 % (489) of the trees were
based on a single locus, 12.9% (77) on two combined loci, 3.2% (19) on three combined
loci and 1.7% (10) on four or more combined loci.
1.6.1 Ribosomal RNA genes
The genes encoding ribosomal RNA (rDNA) are extensively used for
reconstructing the phylogenetic history of eukaryotes. There are multiple copies of this
region constituting a multigene family composed in most cases of homologous genes.
However, two highly divergent nonorthologous ITS2 regions were reported in Fusarium
spp. (O'Donnell and Cigelnik 1997, Twyman 1998). The rDNA genes (Fig. 1.4) are
arranged in tandem and separated by non-transcribed spacers called Intergenetic spacers
(IGS). Each rDNA gene contains coding information for the three types of rRNA: 18S
(small subunit RNA-SSU), 5.8S and 28S (large subunit RNA-LSU) (Fig. 1.5). The two
14 internal transcribed spacers (ITS1 and 2) are non-coding, variable regions that can be
used to distinguish fungal species (Deacon 2006).
The ITS 1 and 2 regions of the ribosomal RNA genes (rDNA) have been widely
used to reconstruct the phylogenetic history of several fungi at the order and lower levels of relatedness (Vilgalys and Sun 1994, O'Donnell and Cigelnik 1997, Thon and Royse
1999a, b, Isikhuemhen et al. 2000, Shen et al. 2002, Stenroos et al. 2002). By January
2004, more than 21,000 ITS fungal sequences were available in GenBank (NCBI) versus
only 349 of the RPB2 gene. ITS sequences are the most popular ones used for population- level and single locus studies (Lutzoni et al. 2004).
5.8S
IGS1 5S IGS2 SSU ITS1 ITS2 LSU
Fig. 1.5. Schematic structure of the ribosomal RNA gene. Non coding regions: IGS= intergenic spacer; ITS=internal transcribed spacer. Coding regions: 5.8S, 5S, SSU (small subunit), and LSU (large subunit) (White et al. 1990).
1.6.2 β-tubulin genes
The cytoskeleton is an intracellular structural network in eukaryotic cells that aids organelle movement, cytoplasm streaming, chromosome separation, cell division and morphogenesis in fungi. The cytoskeleton is composed of microtubules, microfilaments
and intermediate filaments (Alexopoulos 1996, Deacon 2006). The microtubules consist
15 of two analogous proteins: α- and β-tubulins. In growing cells, the microtubules undergo continual polymerization and depolymerization by addition of tubulin subunits in a two stage process. First, the α- and β-tubulin combine to form a dimer that polymerizes to form tubulin chains (microtubules). Second, the kinesin and dynein, two motor proteins, act on the microtubules to aid transportation of organelles in the hypha (Nelson and Cox
2001, Deacon 2006).
The β-tubulin gene codes for the β-tubulin protein. In homobasidiomycetes, this gene has been isolated, cloned and sequenced for Schizophyllum commune (Russo et al.
1992), Pleurotus sajor-caju (syn. P. pulmonarius) (Kim et al. 1997) and Coprinus cinereus (Matsuo et al. 1999). The tub-2 genes in S. commune are composed of 1807 bp distributed in 8 introns and 9 exons encoding for a 445 amino acid protein. Length of introns varies from 48 to 107 nucleotides. All introns start with GT and end with AG
(Russo et al. 1992). The β-tubulin gene in P. pulmonarius is composed of 9 introns and
10 exons. It encodes for a protein of 446 amino acid residues (Kim et al. 2001). The benzamidazole fungicides bind to the β-tubulin protein promoting the disruption of the mitotic process fatally injuring the fungus. However, point mutations in the β-tubulin gene that cause amino acid changes (Ala165 to Val, Phe167 to Tyr and Glu198 to Gly) in
Aspergillus nidulans, Neurospora crassa and Saccharomyces cerevisiae, confer resistance to the benzamidazole fungicides. In P. pulmonarius and S. commune, a Cys165 residue confers insensitivity to benzamidazole fungicides (Kim et al. 1997).
The β-tubulin gene (Fig. 1.6) has been used to reconstruct phylogenetic relationships in Ascomycetes and Basidiomycetes (Thon et al. 1999a, b, Myllys et al.
2002, Shen et al. 2002, Thell et al. 2002). Although two paralogous versions of this gene
16 are known to exist in some species, this gene may be utilized at various taxonomic levels
and even below the species level (Landvik et al. 2001, Myllys et al. 2002). For example,
two independent studies have shown that partial β-tubulin gene sequences in G. frondosa
(exon 5 → 8) and L. edodes (exon 5 → 7) may contain enough information to separate
isolates according to their geographical origin (Thon and Royse 1999b, Shen et al. 2002).
1 2 3 4 5 6 7 8 9
Fig. 1.6. Schematic structure of the β-tubulin gene of Schizophyllum commune. Coding regions (exons) are indicated with numbers; non coding regions are in black bars (Russo et al. 1992).
1.6.3 Translation elongation factor 1 α (tef1) gene
The translation elongation factor (EF-1α) is a protein fundamental for synthesis
of ribosomal proteins in eukaryotes. It is a highly conserved protein and one of the most
abundant in the cells. The EF-1α in eukaryotes is encoded by the tef1 gene. Most eukaryotes posses more than 1 copy of the gene. However, S. commune only has one. In
this species, the EF-1α consists of 460 amino acids, seven introns and eight exons
(Wendland and Kothe 1997). The tef1 (Fig. 1.7) has been widely used for phylogenetic inferences in eukaryotes. Partial sequence of the translation elongation factor gene (exon
3 to 5) revealed nucleotide substitutions that were used to distinguish between P. eryngii
var. eryngii and P. eryngii var. ferulae (Marongiu et al. 2005).
17
1 2 3 4 5 6 7 8
Fig. 1.7. Schematic structure of the translation elongation factor gene (tef1) of Schizophyllum commune. Introns are indicated in black bars. Coding regions (exons) are indicated with numbers (Adapted from Wendland and Kothe 1997).
1.6.4 RNA polymerase II (RPB2) gene
The RPB2 gene (Fig. 1.8) encodes the second largest subunit of RNA polymerase
II, the enzyme that transcribes pre-mRNA (Liu et al. 1999, Matheny et al. 2007). This gene is found as a single copy in the genome and is useful for evolutionary studies in eukaryotes. Comparisons of the amino acid sequences among fungi, plants, and animals had shown that certain domains share more than 85% identity among kingdoms. These conserved domains were useful to design primers that amplify the RPB2 gene in a vast range of organisms (Fig. 1.9) (Liu et al. 1999). Only few studies that combine the RPB2
gene and other loci have been conducted to date (Lutzoni et al. 2004). Liu et al. (1999)
suggest that for closely related taxa of fungi, the variable regions between domain 6 and 7 are sufficient for phylogenetic inferences.
1 2 3 4 5
Fig. 1.8. Schematic structure of the RPB2 gene. Introns are indicated in black bold lines and
exons are numbered (Matheny 2006).
18
1 2 3a 3b 4 5 6 7 8 9 10 11 12
Fig. 1.9. Conserved domains of the RPB2 gene. The black segments represent the 12 conserved amino acid motifs (conserved domains) among eukaryotes (Liu et al. 1999).
1.7 Research Statement
Molecular characterization of P. eryngii and its varieties has been conducted
mainly by DNA fingerprints and allozyme analyses, mostly at the population level
(Lewinsohn et al. 2001, Urbanelli et al. 2002). Most of the genetic studies that involve P.
eryngii varieties usually do not include other members of the genus Pleurotus (Zervakis
et al. 2001b, Urbanelli et al. 2003, Marongiu et al. 2004, Tan et al. 2006, Urbanelli et al.
2007). Furthermore, phylogenetic studies of P. eryngii based on genes that are
traditionally used to elucidate relationships among taxa are completely absent. On the
other hand, phylogenetic studies of the genus Pleurotus that include P. eryngii do not refer to any specific variety (Vilgalys and Sun 1994, Zervakis et al. 1994, Bae et al. 1996,
Bao et al. 2004a, Bao et al. 2005). Uncertainty regarding placement of the members of the P. eryngii species complex as varieties or different species still remains. The fact that partial interfertility exists among the groups complicates the establishment of species
boundaries. To elucidate the evolutionary pathway and host adaptations of P. eryngii
species complex is of great relevance since this basidiomycete behaves in nature as a
facultative biotroph and as a saprophyte under controlled conditions. Therefore, if the
evolutionary pathway of this species follows a geographical pattern, we may expect that
19 this species might be easily adapted to grow and colonize new environments. On the
other hand, if this species follows a clear evolutionary pathway according to host
specialization, it could indicate that the distribution of this species might not be prone to
spread and being established in novel ecological niches. Since consumption and
cultivation of this species is becoming popular in different areas of the world, issues
regarding invasion of new environments might be a concern. The molecular approach of
the present study was to include, in a sole phylogenetic study, most varieties of P. eryngii
and several other Pleurotus spp. that have evolve as result of allopatric speciation
(geographic separation) (Vilgalys and Sun 1994, Isikhuemhen et al. 2000, Zervakis et al.
2004). Additionally, molecular characterization through direct DNA sequencing of
different genomic regions in P. eryngii might be useful to establish a standard and unequivocal way of variety identification.
Cultivars are often derived from only a few lines and are subject to genetic erosion (Urbanelli et al. 2007). Therefore, the identification of wild isolates and the evaluation of commercial isolates of P. eryngii with high productivity and good quality traits were essential. The high morphological diversity of P. eryngii is reflected in the consumer demand that varies substantially depending on the market and the country where the mushroom is consumed. Hence, part of this research characterized and identified wild and commercial isolates worldwide that possess desirable production traits such as high yield and short production cycles. Alternative methods of cultivation, such as the casing system and substrate supplementation, attempting to increase yields and biological efficiencies (BE) also were evaluated for one commercial cultivar of P. eryngii var. eryngii.
20 Nutritional aspects are important in order to valuate an edible product.
Mushrooms are especially known to contain nutritional and medicinal properties that are
beneficial for the consumer. Antioxidant properties provided by ERGO and Se, for example, are very important. High concentrations of those antioxidants in mushrooms of
P. eryngii might represent additional nutritional value that could also be reflected in higher prices in the market. Alternatively, extracts or powders made from these mushrooms might be used as dietary supplements. Therefore, this research also evaluated the influence of cultural practices on enhancement of ERGO and Se in mushrooms of a commercial isolate of P. eryngii var. eryngii.
21 Chapter 2: ITS sequence analysis and polymorphisms in isolates of
Pleurotus eryngii and allied taxa
2.1 Introduction
The genus Pleurotus includes several edible species that are known for their
exceptional flavor and their relatively low-cost methods of cultivation. Species
identification in this genus is at times difficult because the color and morphology of the
basidiomata vary considerably in response to environmental conditions. Incorrect naming
of commercial strains has also contributed to ambiguity in the taxonomy of the genus
(Buchanan 1993). The “species complex” concept is widely applied to define closely related species that are completely or partially intercompatible (Zervakis and Balis 1996,
Bao et al. 2004b, Zervakis et al. 2001b). The P. eryngii species complex includes: P. eryngii var. eryngii, P. eryngii var. ferulae, P. eryngii var. elaeoselini, P. eryngii var. tingitanus, P. hadamardii, P. fossulatus and P. eryngii var. nebrodensis (=syn. P. nebrodensis) (Venturella 2000, Zervakis et al. 2001b, Lewinsohn et al. 2002, Urbanelli et al. 2002, De Gioia et al. 2005). Genetic diversity studies of P. eryngii and its varieties has been carried out mainly through DNA fingerprints and allozyme analyses at the population level (Boisselier-Dubayle and Baudoin 1986, Lewinsohn et al. 2001, Zervakis et al. 2001b, Urbanelli et al. 2002 and 2007, Marongiu et al. 2004, De Gioia et al. 2005).
Genetic studies that involve most P. eryngii varieties do not include other members of the genus Pleurotus. Furthermore, phylogenetic studies of P. eryngii based on genes that are traditionally used to elucidate relationships among taxa are completely absent. On the other hand, phylogenetic studies of the genus Pleurotus that include P. eryngii do not
22 refer to most of the specific varieties (Vilgalys and Sun 1994, Zervakis et al. 1994 and
2001b, Bae et al. 1996, Urbanelli 2003, Bao et al. 2004b, Marongiu et al. 2004, Bao et al.
2005, Tan et al. 2006, Urbanelli et al. 2007). Therefore, the present study included in a sole phylogenetic study most varieties of P. eryngii and several other Pleurotus spp.
Elucidation of the evolutionary pathway of P. eryngii might aid in understanding
its behavior in nature and under controlled conditions when the host is absent. Pleurotus
eryngii var. eryngii is commercially cultivated in Asia, Europe and recently introduced in the United States. However, to date, cultivation of var. nebrodensis and var. ferulae still presents several difficulties. The fact that optimal cultivation methods developed for var. eryngii are only marginally useful for cultivation of other varieties is intriguing. In general, production methods are relatively easy to adapt among members of the genus
Pleurotus. A phylogenetic analysis might also be useful to determine the forces that drive speciation within this group (allopatric, sympatric speciation or microevolution). Thus, if members of the P. eryngii complex are different species that have long diverged and developed host specify, a well defined phylogeny might be observed. However, if members of this complex are varieties that have recently diverged, phylogenetic relationships might be unresolved or short branching patterns might be visualized in a tree (Doyle 1995, Zervakis et al. 2004).
The ITS 1 and 2 regions of the rRNA gene cluster (rDNA) have been widely used to reconstruct the phylogenetic history of several fungi at the order and lower levels of relatedness (Vilgalys and Sun 1994, O'Donnell and Cigelnik 1997, Thon and Royse
1999a, b, Isikhuemhen et al. 2000, Shen et al. 2002, Stenroos et al. 2002, Zervakis et al.
2004). As a first attempt to evaluate use of rDNA to reconstruct phylogenetic
23 relationships in P. eryngii, the author surveyed 16 isolates belonging to four varieties. It
was observed that the sequence chromatograms of about half of the P. eryngii var. eryngii
isolates had overlapped peak sequences after specific sites. Two highly divergent non-
orthologous and heterogeneous copies of the ITS regions have been reported in some
groups of fungi, plants and animals (O'Donnell and Cigelnik 1997, Twyman 1998,
Franzke and Mummenhoff 1997, Isikhuemhen et al. 2000, Zervakis et al. 2004).
Therefore, the present study sought to elucidate the source of sequence heterogeneity in
the ITS region of P. eryngii isolates by direct sequencing of cloned PCR products and
single spore isolate (SSI) sequence analysis. Sequencing cloned PCR products was useful
to identify different alleles, while sequencing SSI would give insight if the identified alleles were segregating and, therefore, produced in different nuclei and not a result of different copies of the rDNA within the same nucleus. As a second objective, the use of
ITS regions in phylogenetic studies of P. eryngii species complex was evaluated.
2.2 Materials and Methods
2.2.1 Dikaryotic Cultures
A total of 24 Pleurotus spp. isolates, representing five species (P. dryinus, P. ostreatus, P. sapidus, P. tuberregium, and P. pulmonarius) and four varieties (var. eryngii, ferulae, elaeoselini and nebrodensis) of the P. eryngii species complex were included in the study (Table 2.1). Isolates identified as “WC” are permanently maintained at The Pennsylvania State University Mushroom Culture Collection (PSUMCC). Isolates are maintained by both periodic transfers on potato dextrose agar (PDA) contained in slant tubes and by liquid nitrogen storage (-196 °C and glycerol at 10%).
24 2.2.2 Single Spore Isolates (SSI)
Direct sequence of the ITS region of isolate WC968 (var. eryngii) presented double peaks in the chromatogram. This isolate was cultured on a cottonseed hulls-based substrate contained in 1,050 ml polypropylene bottles according to protocols outlined by
Rodriguez Estrada and Royse (2007). Mature basidiomata were collected and spore prints obtained on sterile filter paper contained in glass cylinders. The filter paper containing the spores was cut into small strips (4 mm x 15 mm) and one small strip was placed into sterile water (10 ml) contained in a test tube (150 mm x 17 mm). The test tubes were vigorously agitated with a vortexer to dislodge the spores from the filter paper. Serial dilutions of the spore suspension were performed until an approximate concentration of
30 spores ml-1 was reached. The spore suspension (0.5 ml) was spread with a glass rod on
the surface of solidified PDA contained in 90 mm diameter Petri dishes. Assessments of spore germination were made under the microscope every three days until germination was observed. Individual germlings were transferred to PDA contained in Petri dishes.
Putative monokaryotic mycelia were evaluated for presence or absence of clamp
connections after 10 days. Monokaryons (no clamp connections) were transferred to slant
tubes for culture maintenance and liquid medium for nuclear DNA extraction.
25 Table 2.1. Pleurotus spp. isolates utilized in the study. Original source refers to the immediate isolate supplier. Geographic origin and host/substrate refers to the place and conditions where the isolates were found in nature. Isolates with codes of WC are permanently held in The Pennsylvania State University Mushroom Culture Collection.
Species Variety Isolate Original source Geographic Host/substrate code origin P. eryngii eryngii Pe-AL1 INRA1 Entre Deux E. campestre / Mers, Launay. calcareous soil France Pe-AL11 INRA Causse E. campestre / Mejean, limestone France plateau Pe-Al-20 INRA Oleron island, E. maritimun / France Litoral of dunes WC957 U. Bari2 Sicily, Italy Unknown WC984 IBAF3 Unknown Unknown WC968 IBAF Unknown Unknown WC827 PSU4 Unknown Unknown ferulae WC927 U. Haifa5 Menahemya, Ferula sp. Israel WC955 U. Bari Sicily, Italy Unknown WC933 U. Haifa Gevaot Merar, Ferula sp. Israel WC981 IBAF Sicily, Italy Unknown elaeoselini WC999 U. Palermo6 Unknown Unknown nebrodensis WC980 IBAF Sicily Unknown WC978 IBAF Sicily Unknown WC977 IBAF Sicily Unknown WC979 IBAF Sicily Unknown P. dryinus MW-84 Unknown Unknown Unknown P. ostreatus WC-632 ASI – Korea7 Unknown Unknown WC-444 USA MO Pecan tree WC-971 Italy Unknown Unknown P. sapidus WC-153 Unknown Unknown Unknown WC-529 Unknown State College, Unknown PA, USA P. tuberregium WC-823 Nigeria Nigeria Unknown P. WC-537 Italy Unknown Unknown pulmonarius
1 INRA – National Institute of Agronomic Research, MYCSA (Mycology and Food Security), Villenave D’Ornon, France. 2 U. Bari – University of Bari, Department of Biology and Plant Pathology, Bari, Italy. 3 IBAF – Institute of Biology, Agro-environment and Forestry, Rome, Italy. 4 PSU – The Pennsylvania State University Mushroom Culture Collection, University Park, USA. 5 U. Haifa – University of Haifa, Institute of Evolution, HAI Culture Collection, Haifa, Israel. 6 U. Palermo – University of Palermo, Department of Botany, Sicily, Italy. 7 ASI - Agriculture Science Institute, Suwon, Korea.
26 2.2.3 DNA extraction
Pleurotus spp. isolates were grown for 15 to 20 days in 30 ml of sterile potato
dextrose broth (DifcoTM) contained in 125 ml Erlenmeyer flasks. Broth and mycelia were
filtered through Miracloth (Calbiochem). Mycelia were rinsed with sterile-distilled water
and squeezed twice to eliminate excess water, placed in 2 ml eppendorf tubes, lyophilized
and stored in a glass desiccator at room temperature. Lyophilized mycelia were ground
with a micropestle in a 1.5 ml Eppendorf tube. DNA extractions were performed using
the DNeasy® plant mini kit (Qiagen) according to the manufacturer’s instructions. DNA
concentrations were visualized and measured by gel electrophoresis and a Beckman
DU®640B spectrophotometer, respectively. The DNA stock solutions were adjusted to
20 ng/µl with sterile-distilled water. DNA extracts were stored at -20 ºC until they were used.
2.2.4 PCR amplification of the ITS1, 5.8S and ITS2 rDNA
PCR amplification of the ITS1, 5.8S and ITS2 (Fig. 2.1) was carried out using the
fungal universal primers ITS1 (5’ TCCGTAGGTGAACCTGCGG 3’) and ITS4 (5’
TCCTCCGCTTATTGATATGC 3’) (White et al. 1990). PCR master mix from Promega
(Taq DNA polymerase) was used to carry out all PCR reactions as follows: 12.5 μl of
PCR master mix [Taq DNA polymerase (25 units/ml), dNTPs (200 μM each), MgCl2 (1.5
mM)], primers 2 µl (10 µM each), water 5.5 µl and DNA template 3.0 µl (20 ng/μl) in 25
µl volume reactions. The PCR cycle was carried out in a PTC-100 ™ Programmable
Thermal Controller (MJ Research): 94ºC/1 min; 35 cycles of 94ºC/15s, 60ºC/30s, 72ºC/1
min; and 72ºC/5 min. PCR products were visualized by electrophoresis in 1% agarose
27 gels stained with ethidium bromide (0.16 µl/ml). Two microliters of 5x DNA loading
buffer + 5 µl of PCR product were placed in the gel and ran for approximately 30 minutes
at 2.3 – 3.3 V/cm.
ITS1 ITS4
SSU 5.8 S LSU ITS 1 ITS 2
Fig. 2.1. Primer location for amplification of the ITS1, 5.8S and ITS2 region of the ribosomal RNA. SSU (small subunit), LSU (large subunit) and ITS (internal transcribed spacer) (White et al. 1990).
2.2.5 Cloning of PCR products
PCR products for isolates WC957, WC984 and Pe-Al20 (presenting overlapping
peaks in the chromatograms) were cloned in chemically competent Escherichia coli cells using the TOPO® TA Cloning kit accordingly to the manufacturer’s instructions. The
antibiotic kanamycin was used as a selective agent for chemical transformation.
Transformed bacterial colonies (25 per isolate) were arbitrarily selected and grown in
solid LB (Luria-Bertani)/kanamycin media (24 hours). From those, 10 - 13 transformants
per isolate were sequenced. PCR amplifications for the transformants were performed as
follows: PCR master mix 12.5 µl, primers 1 µl (10 µM each), water 9.5 µl. Bacteria
colonies were directly used to obtain the DNA template. Colonies were touched with a
sterile toothpick that was subsequently immersed in the PCR reaction mix. The PCR
28 cycle was as follows: 94ºC/5 min; 35 cycles of 94ºC/1 min, 55ºC/1 min, 72ºC/1.30 min; and 72ºC/10 min. PCR amplicons were visualized as stated above (2.2.4).
2.2.6 DNA sequencing
PCR reactions were purified using ExoSAP-IT® (USB Corp.) following the manufacturer’s instructions. The cleaned DNA template was concentrated (SPD1010
SpeedVac®System) or diluted to reach 40 ng/µl for sequencing. Primer ITS4 (1 µM) was used for sequencing since primer ITS1 failed to yield readable chromatograms. Both strands of the cloned PCR products were sequenced with primers M13Univ (5’
TGTAAAACGACGGCCAGT 3’) and M13Rev (5’ CAGGAAACAGCTATGACC 3’) (1
µM). DNA template and primer (2 µl each) were arranged in a 96-well µltraAmp™ PCR plate and sealed with ThermalSeal™. Sequencing was carried out in an ABI Hitachi
3730XL DNA Analyzer at the Nucleic Acid Facility at Penn State, University Park.
2.2.7 Sequence data analysis
Sequence chromatograms were visualized and edited with Sequencher version 4.7
(Gene Codes Corporation 2006) software. Additional sequence data for P. tuberregium,
P. cystidiosus, P. ostreatus and P. pulmonarius were retrieved from GenBank (accession numbers EF514250, EF514244, EF514248 and EF514243, respectively). Alignments were made using the clustal W algorithm in the MEGA (3.1) package and manually edited. Phylogenetic reconstruction for ITS1, 5.8S and ITS2 in Pleurotus spp. was performed based on the Neighbor-Joining and UPGMA methods (Nei and Kumar 2000) based on the p-distance (proportion of nucleotide sites where two compared sequences
29 are distinct) model in MEGA (3.1). Phenetic analysis confidence was assessed by
bootstrap tests with 1,000 replications.
2.3 Results
2.3.1 PCR amplification and chromatogram analyses
PCR products were visualized in agarose gels yielding single amplicons of
approximately 640 bp. Double sequences (Figs. 2.2a and 2.3) starting at specific points (~
211 in the chromatogram) were observed for four P. eryngii var. eryngii isolates: WC968,
Pe-Al20, WC957 and WC984. Double sequences continued until position ~ 449. From position 450 to position 522 in the chromatogram the sequences were normal, duplicating after position 523 until the end of the sequence (Fig. 2.3). Also, single nucleotide additivity (polymorphic positions where two overlapping bases are present) was observed at certain positions for most of the P. eryngii var. eryngii the isolates (Fig. 2.2b and c). In order to address the source of intra-isolate variation, clones of the PCR products for isolates WC957, WC984 and Pe-Al20 and SSI for isolate WC968 were obtained and sequenced.
2.3.2 ITS sequence analysis within P. eryngii var. eryngii isolates
Sequences for cloned PCR products for isolates WC957, WC984 and Pe-Al20 and for PCR products of SSI (WC968) were obtained (Table 2.2). Sequences of the cloned
PCR products for isolates WC957, PeAl20, WC984 and WC968 yielded 8, 4, 4 and 2
30 distinct sequences, respectively. The 18 heterogeneous sequences were arbitrarily numbered from I to XVIII (Table 2.2). The 18 sequences were aligned
a
Pe-AL11
WC957
b c
Fig. 2.2. a. Single (Pe-Al11) and double (WC957) sequences in the ITS regions of Pleurotus eryngii isolates. In all cases, sequence duplication began around nucleotide position 212. b and c. Nucleotide additivity in single sites in b. P. eryngii var. eryngii (Pe-AL1) and c. var. ferulae (WC927).
31
421
177 103-105
Fig. 2.3. ITS sequence chromatogram (partial) for isolate WC957. A double sequence starts at position 211 (arrow 421). Double sequence continued until position 449 (arrow 177). From position 450 to position 524 the sequence was normal, duplicating after position 523 (arrow 103-105) until the end of the sequence. Arrow numbers correspond to positions indicated in Fig. 2.4.
32 against the sequences corresponding to isolate Pe-AL1 that did not present multiple
overlapping peaks. Variable sites and indels found in the multiple alignment are shown in
Fig. 2.4. Position numbers are according to GenBank accession number EU395845
(isolate Pe-AL1). A comparison between the chromatograms (Fig. 2.3) and the sequence
alignments (Fig. 2.4) indicated that the overlapping peaks starting at positions 421
correspond to a tyrosine (T) insertion. The peaks revert to normal at position 177 where
an adenine (A) deletion occurs. The second set of overlapping peaks starts at position 103 that correspond to a 3-base pair deletion found in sequences VIII and IX. Besides indels, twelve more nucleotide variations were detected from the alignment (Fig. 2.4). Ten variations (positions 74, 99, 250, 279, 306, 354, 390, 431, 533, 120 based on isolate Pe-
Al1) were unique among the clones. However, variations found in positions 117 (T/C) and 137 (G/T) were found in nearly half of the 18 ITS sequence polymorphisms (alleles).
All unique variations originated in the cloned PCR products but not in the SSI direct sequences. Five of such variations were found in the 5.8S rRNA region where no variations were expected since it is a more conserved region. Four main groups of heterogeneous rDNA sequences were identified. Group A has TG in positions 117 and
137, respectively, and lacks a T in position 421. Group B has CT in positions 117 and
137, respectively, lacks an A in position 177 and has an additional T in position 421.
Group C has CT in positions 117 and 137 respectively; it has a 3-base pair deletion in
positions 103-105 and lacks a T in position 421. Group D has TG in positions 117 and
137, respectively, and has an extra T in position 421 (Fig. 2.4).
33 Table 2.2. Number of PCR clones and single spore isolates (SSI) obtained for four isolates of Pleurotus eryngii var. eryngii. Heterogeneous sequences were observed for each isolate yielding a total of 18 polymorphic sequences that were arbitrarily identified with Roman numerals (I-XVIII).
Strain No. of clones DNA Roman numeral and SSI heterogeneous assignment sequences WC957a 13 8 V, VI, VII, XI, XV, XVI, XVII, XVIII, Pe-Al20a 10 4 IV, IX, X, XIV WC984a 11 4 II, III, VIII, XII WC968b 13 2 I, XIII
a Sequences obtained from the cloned PCR product. b Sequences obtained from direct sequencing of the SSI.
Positions (vertical numbers) of the variable sites in the aligned sequences of the ITS1, 5.8S and ITS2 for P. eryngii var. eryngii clones and single spore isolates (SSI).
ITS1 5.8S ITS2
Positions 7 9 103- 1 1 1 1 2 2 3 3 3 4 4 5 Groups 4 9 105 1 2 3 7 5 7 0 5 9 2 3 3 DNA Polymorphisms 7 0 7 7 0 9 6 4 0 1 1 3 Pe-AL1 C A G T C T A G A A G T C T – A T WC968 - I ...... – . . A WC984 - II . G ...... – . . A WC984 - III ...... – . . A Pe-Al20 - IV ...... – . . A WC957 - V ...... – . . A WC957 - VI ...... G . . . . – . . A WC957 - VII T ...... T . – . . A WC984 - VIII . . – – – C . T ...... – G . C Pe-Al20 - IX . . – – – C . T . . A G . . – . . C Pe-Al20 - X ...... T . . D WC957 - XI ...... T . . D WC984 - XII . . . . . C . T – . . . . . T . . B WC968 - XIII . . . . . C . T – . . . . . T . . B Pe-Al20 - XIV . . . . . C . T – . . . . . T . . B WC957 - XV . . . . . C . T – . . . . C T . . B WC957 - XVI . . . . . C G T – . . . . . T . . B WC957 - XVII . . . . . C . T – . . . . . T . . B WC957 - XVIII . . . . . C . T – . . . . . T . C B
Fig. 2.4. Distribution of nucleotide sequence variation and indels in ITS1, 5.8S and ITS2 for clones and single spore isolates WC968. Position numbers are according to GenBank accession number EU395845 corresponding to isolate Pe-AL1 (reference).
34 2.3.3 ITS sequence variation of dikaryotic isolates of four P. eryngii
varieties
Sequence nucleotide variation of ITS1, 5.8S and ITS2 regions for four varieties of
P. eryngii (eryngii, ferulae, elaeoselini and nebrodensis) are shown in Table 2.3. Two variable sites in the ITS2 region were found among isolates of var. eryngii, ferulae and
elaeoselini. These sites do not differentiate between varieties and, in fact, some sites
showed nucleotide additivity (two peaks overlapping in a single site, Fig. 2.2b and c).
The ITS1 and 5.8S regions did not display variation among these varieties. When P.
eryngii var. nebrodensis isolates were included in the analysis, 13 and 3 variable sites were observed in the ITS1 and the ITS2 regions, respectively. Therefore, P eryngii var. nebrodensis and the other three varieties (eryngii, ferulae and elaeoselini) share a 97.6% identity and the groups are clearly distinguishable from each other. Among four isolates of var. nebrodensis, four nucleotide variations were found, including base changes and nucleotide additivities.
Table 2.3. Site variation in the ITS1, 5.8S and ITS2 regions of the rDNAa in four varieties of Pleurotus eryngii and six other species of Pleurotus.
ITS1 5.8S ITS2 Total Species No.b Var. Total Var. Total Var. Total Var. Total sites sites sites sites sites sites sites sites
P. eryngiic 8 0 232 0 156 2 202 2 590
P. eryngiic + var. nebrodensis 13 11 232 0 156 3 202 14 590
Pleurotus spp.d 25 98 244 0 156 89 209 187 609
a ITS1, 5.8S and ITS2 boundaries were based on GenBank accession EF514243 (P. pulmonarius). b Number of isolates included in the analysis. c P. eryngii var. eryngii (3 isolates), P. eryngii var. elaoselini (1 isolate) and P. eryngii var. ferulae (4 isolates). d P. ostreatus, P. cystidiosus, P. tuberregium, P. dryinus, P. pulmonarius and P. sapidus.
35 2.3.4 ITS sequence variation among isolates of Pleurotus spp.
Sequence alignments for seven species of Pleurotus included in this study showed an overall value of 69.3% sequence identity. The 5.8S region was 100% identical among all species and isolates. Nearly equal rates of variable sites for the ITS regions 1 and 2 were found among species of the genus (40.2% and 42.6%, respectively) (Table 2.3).
2.3.5 Phylogenetic analysis
A Neighbor-Joining (NJ) phylogenetic reconstruction was performed using the 18 heterogeneous sequences (polymorphisms I – XVIII) for isolates WC984, WC957,
PeAL1 and WC968 and the reference sequence PeAL1. Two clusters, one of them supported by a bootstrap value of 85% were found (Fig. 2.5). Both clusters include clones
and SSI sequences from the four isolates. Pe-AL1, the only isolate that did not show
sequence polymorphism was located in cluster 1. Cluster 1 includes all the sequences
belonging to groups A and D, sharing the tyrosine and guanine in position 117 and 137,
respectively. However, cluster 2 includes the sequences belonging to groups B and C that
have a cytosine and tyrosine in the same positions. A phylogenetic tree was constructed
with the 18 heterogeneous sequences plus the four P. eryngii varieties (Fig. 2.6). The tree obtained shows that var. eryngii, ferulae and elaeoselini are included in cluster 1 and a third cluster contained the variety nebrodensis. This result indicated that sequences retrieved from clones or SSI may not be reliable for use in phylogenetic reconstructions yet different clustering may be obtained for a single isolate composed of different alleles.
36
WC984 - III WC957 - XI WC957 - V Pe-Al20 - X Cluster 1 85 P. eryngii var. eryngii (Pe-Al1) ITS Group A WC957 - VI and D WC984 - II WC957 - VII WC968 - I Pe-Al20 - IV WC957 - XV WC984 - VIII Pe-Al20 - IX Cluster 2 WC957 - XVI WC957 - XVIII ITS Group B and C WC984 - XII WC968 - XIII Pe-Al20 - XIV WC957 - XVII
Fig. 2.5. Phylogenetic analysis based on ITS1, 5.8S and ITS2 regions of rDNA of 18 heterogeneous sequences and a reference (Pe-AL1). The Neighbor-Joining method and the p-
nucleotide model were used. Bootstrap values were based on 1,000 replications.
The ITS1, 5.8S and ITS2 rDNA phylogenetic tree based on Neighbor-Joining and
UPGMA methods for Pleurotus showed that two main clusters were observed (Fig. 2.7 and Fig. 2.8). Cluster A contained all varieties of P. eryngii, P. ostreatus, P. sapidus and
P. pulmonarius. Cluster B encompasses P. dryinus, P. cystidiosus and P. tuberregium. In
cluster A, two sub clusters were also identified. One included four varieties of P. eryngii
and a second cluster contains P. ostreatus, P. pulmonarius and P. sapidus. As expected from the sequence analysis, no separation for the varieties ferulae, eryngii and elaeoselini was observed (Table 2.3). However, a branch including the variety nebrodensis was highly supported (bootstrap value of 99%). The phylogenetic trees (Fig. 2.7 and 2.8)
37 WC984 - II WC957 - VI WC957 - XI var. eryngii (WC827) Pe-Al20 - X var. elaeoselini (WC999) var. eryngii (Pe-AL11) var. eryngii (Pe-Al1) 87 WC957 - VII Cluster 1 WC984 - III var. ferulae (WC927) WC957 - V var. ferulae (WC955) WC968 - I Pe-Al20 - IV var. ferulae (WC933) var. ferulae (WC981) WC957 - XV WC957 - XVI WC984 - XII WC957 - XVII WC968 - XIII Cluster 2 Pe-Al20 - XIV WC984 - VIII WC957 - XVIII Pe-Al20 - IX var. nebrodensis (WC979) var. nebrodensis (WC980) var. nebrodensis (WC976) Cluster 3 98 var. nebrodensis (WC977) var. nebrodensis (WC978)
Fig. 2.6. Phylogenetic analysis based on the ITS1, 5.8S and ITS2 regions of the rDNA for four varieties of P. eryngii. Eighteen sequences (I–XVIII) retrieved from clones and SSI and 13 sequences from dikaryotic isolates were included. The Neighbor-Joining method and the p- nucleotide model were used to construct the tree. Bootstrap values were based on 1000 replications.
show that P. ostreatus, P. pulmonarius and P. sapidus are placed in intercalated positions. This reflects the fact that P. ostreatus and P. pulmonarius are commonly misidentified and P. sapidus taxonomic classification has been problematic (Bresinsky et al. 1897, Hilbert 1989, Zervakis et al. 1994, Gonzalez and Labarere 2000, Bao et al.
2004a, 2005). In order to confirm identity of the isolates utilized in this study, BLAST searches (megablast) were performed for isolates WC444, WC632, WC153, WC529,
38 var. eryngii (Pe-Al1) var. ferulae (WC955) var. ferulae (WC927)
98 var. ferulae (WC933) var. eryngii (Pe-AL11) var. ferulae (WC981)
var. eryngii (WC827) 99 var. elaeoselini (WC999)
var. nebrodensis (WC976)
var. nebrodensis (WC978)
71 var. nebrodensis (WC979) Cluster A 99 var. nebrodensis (WC980)
var. nebrodensis (WC977)
70 P. sapidus (WC153)
P. ostreatus (WC444) 88 P. sapidus (WC529)
100 P. ostreatus (WC971)
87 P. ostreatus (EF514248)
P. pulmonarius (EF514243)
P. ostreatus (WC632) 100 P. pulmonarius (WC537)
97 P. cystidiosus (EF514244)
P. dryinus (WC84) Cluster B P. tuberregium (WC823)
100 P. tuberregium (EF514250)
Fig. 2.7. Phylogenetic analysis based on the ITS1, 5.8S and ITS2 regions of the rDNA for Pleurotus spp. The Neighbor-Joining method and the p-nucleotide model were used to construct the tree. Bootstrap values were based on 1000 replications.
WC397 and WC537. The searches usually retrieved more than one species presenting E values of 0.0 and 100% similarity. For example, ITS1, 5.8S and ITS2 sequences for
WC632 matched P. pulmonarius and P. ostreatus entries. The sequence for isolate
WC153 was similar to P. ostreatus, although accessions under P. floridianus, an unofficial name, were also obtained. Therefore, it is plausible that some isolates are misidentified. BLAST searches and phylogenies based on other genomic regions may
39 help to elucidate the identity and relationships of these isolates. Still it is clear that P. sapidus and P. ostreatus are closely related and P. eryngii, P. ostreatus, P. sapidus and P. pulmonarius share a common ancestor.
var. eryngii (Pe-Al1) var. elaeoselini (WC999) var. ferulae (WC933) 99 var. ferulae (WC981) var. eryngii (Pe-AL11) var. ferulae (WC927)
var. eryngii (WC827) 74 var. ferulae (WC955)
var. nebrodensis (WC980)
var. nebrodensis (WC978) 68 var. nebrodensis (WC976) Cluster A 99 var. nebrodensis (WC979) var. nebrodensis (WC977) 69 P. ostreatus (WC971) P. ostreatus (EF514248) 100 92 P. sapidus (WC529) P. ostreatus (WC444) 86 P. sapidus (WC153) P. ostreatus (WC632) P. pulmonarius (WC537) 100 P. pulmonarius (EF514243) 95 P. cystidiosus (EF514244) P. dryinus (WC84) Cluster B P. tuberregium (WC823) 100 P. tuberregium (EF514250)
F ig. 2.8. Phylogenetic analysis based on ITS1, 5.8S and ITS2 regions of rDNA for Pleurotus sp p. The Unweighted Pair Group Method with Arithmetic mean (UPGMA) and the p-nucleotide m odel were used to construct the tree. Bootstrap values were based on 1000 replications.
40 Cluster B located at the base of the tree (Fig. 2.7 and 2.8), includes P. dryinus, P. cystidiosus and P. tuberregium with P. dryinus and P. cystidiosus sharing a common ancestor.
2.4 Discussion
ITS sequence analyses of P. eryngii have been performed by Marongiu et al.
(2005) and Ro et al. (2007). However, none of those studies reported sequence heterogeneity in this species. Conversely, ITS polymorphisms have been reported for P. cystidiosus, P. tuberregium, Fusarium spp., Sclerotium rolfsii, S. delphinii and Glomus spp. (Sanders et al. 1995, O’Donell and Cigelnik 1997, Isikhuemhen et al. 2000, Okabe et al. 2001, Okabe and Matsumoto 2003, Zervakis et al. 2004). In this study, the author demonstrated that the ITS sequence heterogeneity in P. eryngii var. eryngii is not a result of non-orthologous copies of the rDNA. Furthermore, the ITS sequences within the same isolate differed only by indels and a few nucleotide substitutions (117 and 137 positions).
Unique base substitutions, found only in the cloned PCR products at positions 99, 120,
250, 279, 306, 354, 390, 431 and 533 (Fig. 2.4), did not reveal any specific pattern. In other words, those substitutions were found only once in different cloned products.
Therefore, our data supports Zervakis et al. (2004) idea that the unique variations may be caused by cloning errors of the PCR products. The author observed that indels causing mismatches in the sequences from dikaryotic isolates are responsible for producing overlapping peaks. Since both strands of DNA (alleles) within a diploid or dikaryotic isolate are supposed to be highly similar, a single chromatogram is generally observed.
However, in this case, deletions/insertions of one or few nucleotides caused the
41 corresponding sequences to be read at minuscule different times yielding overlapping
peaks. For example, a T insertion in position 421 may cause overlapping peaks until an A
is lacking in position 177. A second segment of overlapping peaks starts at position 103-
105 when three bases (GTC) are absent (Fig. 2.3 and 2.4). Based in nucleotide variations
and indels, the author identified four groups of ITS sequences (A, B, C, D) that may
originate in different nuclei, since direct sequences of the SSI were accurately readable.
In other words, different alleles segregated and were individually observed in the
monokaryotic progenies (polymorphism I and XIII for SSI of WC968). The ITS allelic
variants found in P. eryngii var. eryngii characterized by deletions in positions 103-105 and 177, a tyrosine insertion in position 421 and two base changes in positions 117 and
137 (T → C and G → T) were not observed in any other dikaryotic isolates. Therefore,
caution is necessary when a specific copy of the heterogeneous rDNA is selected to infer
phylogenetic relationships among taxa. If the sequence variants containing a CT in
positions 117 and 137 were selected to infer phylogenetic relationships, a bias may arise
because the two clusters contain haplotypes of the four isolates from which clones and
SSI were obtained (Fig. 2.5). ITS polymorphisms observed in Sclerotium rolfsii and S.
delphinii were attributed to hybridization events occurring between species or subgroups
carrying different ITS types (Okabe et al. 2001, Okabe and Matsumoto 2003). In plants,
speciation events may occur through hybridizations that may be traced back by
comparing the polymorphic ITS regions with putative parental strains (Campbell et al.
1997, Franzke and Mummenhoff 1999, Rauscher et al. 2002). In the present study, the
ITS variants were not found in any dikaryotic genetically related species (P. eryngii
varieties).
42 Ribosomal DNA is a multigene family with several copies arranged in tandem
repeats (Li 1997). In most cases, the copies are homologous. Therefore, rDNA is
extensively used for reconstructing the phylogenetic history of eukaryotes. Sequence
analysis (Table 2.3) and phylogenetic trees shown in Figs. 2.7 and 2.8 reveal that ITS
regions do not contain information regarding genetic variation between varieties or
isolates of the closest related varieties (ferulae, eryngii and elaeoselini) of the P. eryngii
complex. Lack of variation in the ITS regions for closely related organisms is not
surprising. Similar outcomes were observed by Bakkeren and colleagues (2000) for some
species of small grain-infected smuts (Ustilago kolleri, U. avenae, U. hordei, U.
aegilopsidis and U. nigra). These species do not have discriminatory morphological
traits, they are interfertile and share certain host range. These species were difficult to
distinguish in a phylogenetic analysis based on ITS. Bakkeren et al. (2000) proposed that
placement of this species at a varietal level might better define host range.
Although phylogenetic reconstructions were performed for Pleurotus by different
molecular methods, discrepancies still remain regarding relatedness of several species
(Vilgalys and Sun 1994, Zervakis et al. 1994, Gonzalez and Labarere 2000, Bao et al.
2004a, Bao et al. 2005). For example, the taxonomic position of P. sapidus remains
controversial. Morphological characteristics are very similar to P. pulmonarius.
However, P. sapidus was considered in the past as a synonym of P. cornucopiae and the
European P. ostreatus (Hilbert 1989). More recently, P. sapidus was considered more
closely related to P. pulmonarius (Zervakis et al. 1994, Bao et al. 2004a, b), although
Gonzales and Labarere (2000) determined that P. sapidus is closely related to P. columbinus. If it is assumed that isolates used in this study were correctly identified by
43 morphological criteria, the data would support the statement that P. sapidus is closely related to P. ostreatus.
As Vilgalys and Sun (1994) showed, in a phylogenetic tree based on the LSU rDNA sequences, short branching patterns were found for P. ostreatus, P. pulmonarius and P. eryngii. This suggests a recent origin for these species. The topologies found in this study are also in agreement with Bao et al. (2004a) who states that 1) a common ancestor is shared by P. eryngii and P. ostreatus, and b) the common ancestor diverged from the P. pulmonarius lineage in an earlier evolutionary event. This statement is different from Gonzalez and Labarere (2000) who found close relationships between P. pulmonarius and P. eryngii through phylogenies constructed from V4, V6 and V9 domains of the mitochondrial small subunit SSU rRNA. Genetic divergence between P. eryngii and P. cystidiosus is clearly supported, since both species are located in different main clusters. In this regard, it is important to mention that Vilgalys and Sun (1994) stated that P. cystidiosus and P. dryinus are distributed in the Northern and Southern hemispheres and pointed out that these species are of ancient origins. On the other hand,
P. eryngii distribution is limited to the Northern hemisphere, being of more recent origin.
Therefore, phylogenies showing long divergences between P. eryngii and P. cystidiosus are more accurate. However, this disagrees with Zervakis et al. (1994) who observed close associations between the two species using isozyme analysis.
It is clear that some species have been misidentified, especially some isolates that are widely distributed as commercial cultivars. A clear example of this is the fact that P. ostreatus and P. pulmonarius have been distributed under the name of “P. florida”
(Bresinsky et al. 1987, Buchanan 1993). Misidentified species that are included in
44 phylogenetic analyses create discrepancies in the results. Serious concerns have been raised regarding this issue. An estimate carried out by Bridge et al. (2003) pointed out that more than 20% of the sequences held in unrestricted databases [e.g. EMBL
(European Bioinformatics Institute) Nucleotide Sequence Database] may have originated from misidentified specimens. In the specific case of the genus Pleurotus, Stajic et al.
(2005) faced a similar situation to the one discussed here. In his taxonomic study, Stajic and colleagues stated that “cultivated strains with unknown morphologies were included in the study and caused serious difficulties in the interpretation of results”.
Ro et al. (2007) demonstrated that molecular methods such as RAPD fingerprinting analysis could be more useful to distinguish strains and varieties of P. eryngii. However, other genomic regions such as the beta tubulin gene, the elongation factor, the RPB2 and RPB1 are known to contain genetic information useful to elucidate phylogenetic relations between closely related species (Thon and Royse 1999b, Matheny et al. 2002, Shen et al. 2002, Froslev et al. 2005, Marongiu et al. 2005, Matheny 2005,
Matheny et al. 2007). In this study, P. eryngii var. nebrodensis was the only taxon clearly differentiated from other varieties of P. eryngii. These data support the separation of P. eryngii var. nebrodensis from the P. eryngii species complex as already suggested by other authors (Venturella 2000, Zervakis et al. 2001, De Gioia et al. 2005).
45 Chapter 3: Use of the β-tubulin gene to delimit varieties of the Pleurotus
eryngii species complex and phylogeny of the genus Pleurotus
3.1 Introduction
The β-tubulin (beta-tubulin) gene encodes for one of the two tubulin proteins
found in eukaryotic cells. In homobasidiomycetes, the β-tubulin gene was isolated,
cloned and sequenced for Schizophyllum commune, Pleurotus sajor-caju (syn. P.
pulmonarius) and Coprinus cinereus (Russo et al. 1992, Kim et al. 1997, Matsuo et al.
1999). This gene has been used to infer phylogenetic relationships in Ascomycetes and
Basidiomycetes. Two paralogous versions of β-tubulin gene exist in some species such as
P. pulmonarius, S. commune and Aspergillus nidulans (Weatherbee and Morris 1984,
Russo et al. 1992, Kim et al. 1997). Still, this gene has been successfully utilized to infer phylogenetic relationships at various taxonomic levels and even at intraspecific levels
(O’Donnell et al. 1998, Thon and Royse 1999a, b, Landvik et al. 2001, Myllys et al.
2002, Shen et al. 2002, Thell et al. 2002, Begerow et al. 2004). For example, two
independent studies revealed that portions of the β-tubulin gene in Grifola frondosa and
Lentinula boryana may contain enough information to separate isolates according to their
geographic origins (Thon and Royse 1999b, Shen et al. 2002). Therefore, the author
sought to utilize partial regions of the β-tubulin gene to elucidate phylogenetic
relationships in varieties within the P. eryngii species complex.
The Pleurotus eryngii species complex includes several varieties: eryngii, ferulae,
nebrodensis, elaeoselini, tingitanus, hadamardii and fossulatus (Hilber 1977, Candusso
and Basso 1995, Venturella 2000, Lewinsohn et al. 2002). Considerable controversy has
46 arisen regarding the taxonomic status of this group as to whether they should be considered varieties or closely related species. These fungi grow as facultative biotrophs on specific species of the Umbelliferae and Compositae families (Zervakis et al. 2001a).
Few morphological characteristics are useful to discriminate among varieties. In fact, some characteristics such as host specificity and color of basidiomata may overlap between taxa of this group, complicating their use for identification (Venturella et al.
2000, Zhang et al. 2006).
In this chapter, the author presents the results of an evaluation of primers to amplify regions of the β-tubulin gene and determine nucleotide variation between four of the subspecific groups within the species complex: P. eryngii var. eryngii, P. eryngii var. ferulae, P. eryngii var. elaeoselini and P. eryngii var. nebrodensis. Primers reported to amplify a portion of this gene in Grifola spp. and Lentinula spp. were evaluated (Thon and Royse 1999b, Shen et al. 2002). Also, new primers were designed based on conserved regions of the gene identified from alignments between complete sequences of
S. commune and P. pulmonarius (Russo et al. 1992, Kim et al. 1997). Intra-isolate sequence polymorphisms were identified for several isolates. The author sought to determine the source of sequence variation by sequencing cloned PCR products and single spore isolates (SSI). The data obtained from this approach was used to delimit allelic pools within P. eryngii. In addition, phylogenetic reconstruction of the genus
Pleurotus, based on portions of this gene, was performed.
47 3.2 Materials and Methods
3.2.1 Dikaryotic and monokaryotic cultures
A total of 35 P. eryngii dikaryotic isolates representing four varieties of the P.
eryngii species complex and three other species (P. ostreatus, P. sapidus, and P.
tuberregium) were used (Table 3.1). Cultures were maintained by periodic transfers to
potato dextrose agar (PDA) slants and in liquid nitrogen (-196 °C in 10% glycerol). To obtain single spore isolates (SSI), basidiomata (WC-973 and WC-984) were produced on cottonseed hulls-based substrate (Rodriguez Estrada and Royse 2007). Mature basidiomata were collected and spore prints obtained on sterile filter paper contained in glass cylinders. The filter paper containing the spores was cut into small strips (4 mm x
15 mm) and one small strip was placed into sterile water (10 ml) contained in a test tube
(150 mm x 17 mm). The test tubes were vigorously vortexed to dislodge spores from the filter paper. Serial dilutions of the spore suspension were performed until an approximate concentration of 30 spores ml-1 was reached. The spore suspension (500 μl) was spread
with a glass rod on the surface of solidified PDA contained in 90 mm diameter Petri
dishes. Assessments of spore germination were made under the microscope every three
days until germination was observed. Individual germlings were transferred to PDA
contained in Petri dishes. Putative monokaryotic mycelia were evaluated for presence or
absence of clamp connections after 10 days. Monokaryons (no clamp connections) were
transferred to slant tubes for culture maintenance and liquid medium for nuclear DNA
extraction. Monokaryons and original dikaryons were transferred to potato dextrose
liquid medium for DNA extraction.
48 Table 3.1. Source, geographic origin, culture collection code and host/substrate of dikaryotic isolates of Pleurotus spp. used in this study.
Species Variety Isolate Original source Geographic Host/substrate/ code origin usage P. eryngii eryngii Pe-AL1 INRAb Entre Deux E. campestre / Mers, Launay, calcareous soil France Pe-AL11 INRA Causse E. campestre / Mejean, limestone France plateau Pe-Al7 INRA Olonne forest, E. maritimun / France Litoral of dunes Pe-Al33 Commercial farm, Unknown Commercial USA via Japan WC957a U. Barib Sicily, Italy Unknown WC984 IBAFc Unknown Unknown WC968 IBAF Unknown Unknown WC888a SEFId Unknown Unknown WC945 U. Bari Bari, Italy Unknown WC973a IBAF Unknown Commercial WC989 Italspawn Unknown Commercial WC514 PSUe Unknown Unknown PK2 Commercial farm, Unknown Unknown USA ferulae WC927 U. Haifaf Menahemya, Ferula sp. Israel WC926 U. Haifa Tabor Mt., Ferula sp. Israel WC933a U. Haifa Gevaot Merar, Ferula sp. Israel WC949 U. Bari Scily Unknown WC956 U. Bari Bari Unknown WC966 IBAF Sardegna Unknown elaeoselini WC999 U. Palermog Unknown Unknown nebrodensis WC980 IBAF Sicily Unknown WC978 IBAF Sicily Unknown WC977 IBAF Sicily Unknown WC976 IBAF Sicily Unknown WC979 IBAF Sicily Unknown * WC958 U. Bari, Italy Unknown Unknown P. fuscus ferulae WC994 CBSh Unknown Unknown P. ostreatus WC632 ASIi Unknown Unknown WC819 Italspawn Unknown Unknown WC739 Italspawn Unknown Unknown WC971 Italy Unknown Unknown P. sapidus WC153 Unknown Unknown Unknown P. tuberregium WC823 Nigeria Nigeria Unknown a Isolates used to evaluate B36F/B12R and BTG5F/BTG8R primers for β-tubulin amplification. b U. Bari – University of Bari, Department of Biology and Plant Pathology, Bari, Italy. c IBAF – Institute of Biology, Agro-environment and Forestry, Rome, Italy. d SEFI – Shanghai Edible Fungi Institute, Shanghai, China.
49 e PSU – The Pennsylvania State University, Mushroom Culture Collection, University Park, PA USA. f U. Haifa – University of Haifa, Institute of Evolution, HAI Culture Collection, Haifa, Israel. g U. Palermo – University of Palermo, Department of Botany, Sicily, Italy. h CBS – The Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands. i ASI - Agriculture Science Institute, Suwon, Korea. * These isolate was misidentified according to the results of this study.
3.2.2 DNA extraction
Cultures were grown for 15 to 20 days in 30 ml potato dextrose broth in 125 ml
Erlenmeyer flasks. Broth and mycelium were filtered through miracloth (Calbiochem®).
The mycelium was rinsed with sterile-distilled water and squeezed twice, placed in 2 ml
Eppendorf tubes, lyophilized and stored in a glass desiccator at room temperature. DNA
was extracted using the DNeasy® Plant mini kit (Qiagen) according to manufacturer’s
instructions. Original concentration of DNA was visualized by gel electrophoresis and
estimated with a Beckman DU®640B spectrophotometer. DNA extractions were adjusted
to a concentration of 20 ng/µl with sterile-distilled water. DNA extractions were stored at
-20 ºC until used.
3.2.3 Primers
Two primer pairs used to amplify portions of the β-tubulin gene in Lentinula spp. and Grifola spp. were tested using DNA of four isolates (see Table 3.2) (Thon and Royse
1999a, Shen et al. 2002). Also, new primers were designed based on conserved regions
identified from the alignment between the complete β-tubulin genes of S. commune and
P. pulmonarius (Russo et al. 1992, Kim et al. 1997). The software CLC Gene Workbench
version 2.2.1 (2006) was used to design 6 primers (3 forward and 3 reverse) specified in
50 Table 3.2 and Figure 3.1. Primers were evaluated in all possible combinations (see Table
3.3 in results).
BTG5F/BTG8R
B36F/B12R
1 2 3 4 5 6 7 8 9
BtF1 BtF3 BtR1 BtF2 BtR3 BtR2
Fig. 3.1. Diagram of the β-tubulin gene from Schizophyllum commune. Above diagram: B36F/B12R primers utilized for phylogenetic studies in Lentinula spp. BTG5F/BTG8R primers used for phylogenetic studies in Grifola spp. Below diagram: forward and reverse primers designed from alignment of the complete β-tubulin gene between S. commune and P. pulmonarius (Rodriguez Estrada et al. 2008).
3.2.4 PCR amplification
PCR master mix from Promega (Taq DNA polymerase) was used to carry out all
PCR reactions as follows: 12.5 μl of PCR master mix [Taq DNA polymerase
(25units/ml), dNTP’s (200 μM each), MgCl2 (1.5 mM)], primers 2 µl (10 µM each), water 5.5 µl and DNA template 3.0 µl (20 ng/μl) in 25 µl volume reactions. PCR cycles for primer sets B36F/B12R and BTG5F/BTG8R were the same as specified by Thon and
Royse (1999a) and Shen et al. (2002), respectively. For primers designed in this study,
PCR conditions were as follows: 94ºC/1 min; 35 cycles of 94ºC/30s, optimal annealing temperature/30s (Table 3.3), 72 ºC/30s; 72 ºC/7 minutes. The PCR reactions were carried
51 out in a PTC-100™ Programmable Thermal Controller (MJ Research). Amplicons were
visualized under UV light on 1% electrophoresis gels stained with ethidium bromide.
3.2.5 Cloning of PCR products
PCR products for three P. eryngii var. eryngii isolates (WC984, WC888, and
PeAl-33) and three var. ferulae isolates (WC949, WC926, and WC966) were cloned in chemically competent Escherichia coli cells using the TOPO® TA Cloning kit according
to the manufacturer’s instructions. The antibiotic kanamycin was used as a selective
agent for chemical transformation. Transformed colonies (20-25 per isolate) were
arbitrarily selected. Transformants were grown for 24 hr on solid LB/kanamycin medium.
Arbitrarily selected clones (5 per each isolate, 30 total) were sequenced. PCR
amplifications for the transformants were performed as follows: PCR master mix 12.5 µl,
primers 1 µl (10 µM each), water 9.5 µl. Bacterial colonies were directly used to obtain
the DNA template. Colonies were touched with an autoclaved toothpick that was
subsequently immersed in PCR reaction mix. PCR cycle was as follows: 94ºC/5 min; 35
cycles of 94ºC/1 min, 55ºC/1 min, 72ºC/1.30 min; and 72ºC/10 min.
3.2.6 PCR purification and Sequencing
PCR products were purified with ExoSAP-IT® (USB Corp.) according to the
manufacturer’s instructions. Cleaned DNA template was concentrated (SPD1010
SpeedVac®System) or diluted with sterile-distilled water to achieve 40 ng/µl for
sequencing. Both reverse and forward primers at 1 µM were used for sequencing (Table
3.2). Primers M13Univ (5’ TGTAAAACGACGGCCAGT 3’) and M13Rev (5’
52 CAGGAAACAGCTATGACC 3’) were used to sequence the cloned PCR products. Two
µl of DNA template and 2 µl of primer (forward or reverse) were arranged in a 96-well
µltraAmp™ PCR plate and sealed with ThermalSeal™. Sequencing was carried out in an
ABI Hitachi 3730XL DNA Analyzer at the Nucleic Acid Facility at The Pennsylvania
State University, University Park.
Table 3.2: Description of primers evaluated to amplify partial regions of the β-tubulin gene in Pleurotus eryngii var. eryngii and var. ferulae (Rodriguez Estrada et al. 2008).
Primer Primer Location in S. name Sequence 5’ to 3’ length commune Target (bases) sequence region B36Fa CACCCACTCCCTCGGTGGTG 20 833 Exon 5 B12Ra CATGAAGAAGTGAAGACGCGGGAA 24 1309 Exon 7 BTG5Fb CGTTGTGCCCAGTCCTAAGGTG 22 N/A d Exon 5 BTG8Rb GTTCTTGCTCTGCACGTTCTG 21 N/A d Exon 8 BTF1c TTCCAGATCACCCACTCYCT 20 825 Exon 5 BTF2c CCCGACCGAATGATGTGC 18 906 Exon 5 BTF3c CTCTACGACATCTGYTTCCG 20 1099 Exon 6 BTR1c ACCTCCATCTCGTCCATAC 19 1786 Exon 8 BTR2c CCTCCATCTCGTCCATAC 18 1786 Exon 8 BTR3c TTRGCTCRTCGACRTCCTT 19 1551 Exon 7 a From Thon and Royse 1999a. b From Shen et al. 2002. c Designed in this study based on S. commune and P. sajor-caju (P. pulmonarius) alignments. d N/A : Non-applicable.
3.2.7 Sequence data analysis and phylogenetic reconstruction
Sequence chromatograms were visualized and edited with Sequencher version 4.7
(Gene Codes Corporation 2006) software. Additional sequence data for P. sajor-caju (P.
53 pulmonarius) was retrieved from GenBank (accession number ASI2070). Alignments
were carried out using Clustal W algorithm in the MEGA version 3.1 (Kumar et al.
2004). Phylogenetic reconstruction of Pleurotus spp. based on a for a portion of the β- tubulin gene was performed using the Neighbor-Joining method (Nei and Kumar 2000) based on the p-distance (proportion of nucleotide sites where two compared sequences are distinct) model in MEGA (3.1). Phenetic analysis confidence was assessed by bootstrap tests with 1,000 replications.
3.3 Results
3.3.1 Sequence analysis of partial β-tubulin gene
For the primer pairs BTG5F/BTG8R and B36F/B12R (Thon and Royse 1999a,
Shen et al. 2002) no amplifications were observed with the exception of isolate WC933 for the primer pair B36F/B12R. A sharp band of approximately 500 bp and a light band of approximately 100 bp were obtained. Therefore, the PCR reaction for both sets of primers was optimized through a gradient temperature test (45-57ºC). The optimal annealing temperature to amplify the portion of the β-tubulin gene was 47ºC for both sets
of primers. However, the sequences were not completely readable yielding
chromatograms with multiple overlapping peaks. Six of the nine primer pairs designed in
this study yielded positive amplifications (Table 3.3). Pair BTF2/BTR1 spanning exons 5
to 8 (880 bp) was selected for further amplification and sequencing of isolates (Table
3.1). The PCR cycle was slightly modified to 30 cycles instead of 35 and the forward and reverse primers were used for sequencing. Sequences and chromatograms were assembled (Sequencher 4.7) and analyzed visually. In some cases more than one peak
54 Table 3.3. Primer pairs evaluated for amplification of partial regions of the β-tubulin gene in Pleurotus eryngii var. eryngii and var. ferulae. Success or failure of the attempted amplification is indicated with + or -, respectively.
Primer pair Annealing Expected Amplification temperature fragment size (ºC) Base pairs B36F/B12Ra 55 ~ 500 - BTG5F/BTG8Rb 57 ~ 680 - BTF1/BTR1c 53 ~ 959 + BTF2/BTR1c 53 ~ 880 + BTF3/BTR1c 53 ~ 680 + BTF1/BTR2c 55 ~ 958 + BTF2/BTR2c 53 ~ 879 + BTF3/BTR2c 55 ~ 679 + BTF1/BTR3c 52 ~ 724 - BTF2/BTR3c 52 ~ 645 - BTF3/BTR3c 52 ~ 445 -
a From Thon and Royse 1999a. b From Shen et al. 2002. c Designed in this study based on S. commune and P. sajor-caju (P. pulmonarius) alignments.
was present with identical heights and detected as an ambiguous site (N, S, Y, etc.) (Fig.
3.2b). In other cases, the peak heights were different but still above the background level.
These sites were not recognized as ambiguous bases and manual editing was necessary
(Fig. 3.2a and c). The specific sites that revealed this sort of nucleotide additivity were numerous for P. eryngii var. eryngii and to a lesser extent for var. ferulae. Only two isolates of var. nebrodensis contained nucleotide superimposition at a single site.
55
a b
Fig. 3.2. Chromatograms (β-tubulin gene) c showing nucleotide superimpositions at single sites in Pleurotus eryngii var. eryngii. a. and b. Isolate WC973 Forward (a) and Reverse (b) chromatogram showing superimposition at the same site (arrows). c. Isolate PeAl-33. Chromatogram showing double peaks with different heights (arrows) (Rodriguez Estrada et al. 2008).
Table 3.4. Variation within partial β-tubulin gene in five isolates of P. eryngii var. eryngii and three isolates of P. eryngii var. ferulae. Position numbers from the 5’ end are according to GenBank accession no. EU004148 and EU126930 (Rodriguez Estrada et al. 2008).
Exon/Introna Position Total sites Number of Variation (%) polymorphic sites Exon 5 1 - 9 9 0 0 Intron 5 10 - 64 55 7 13 Exon 6 65 - 293 229 7 3 Intron 6 294 - 343 50 3 6 Exon 7 344 - 507 164 4 2 Intron 7 508 - 562 55 1 2 Exon 8 563 - 772 210 8 4
a Exons and Introns were identified from the reported locations in P. pulmonarius (Kim et al. 1997) and by identification of the splicing junctions GT --- AG of the intros.
56 Alignments of the partial β-tubulin gene of dikaryotic isolates of the var. eryngii
and ferulae revealed a total of 30 polymorphic sites, all represented by nucleotide
superimpositions (Table. 3.5). Two exceptions were isolates WC933 and WC927 where
no superimposition was observed. Most of the variation occurred in introns 5 and 6 (13%
and 6%, respectively) and less in exons 6 (3%) and exon and intron 7 (2%). Intron and
exon lengths, positions and percentages of polymorphism of the partial β-tubulin gene in
P. eryngii are shown in Table 3.4.
To elucidate possible sources of variation, PCR products for var. eryngii (WC984,
WC888, and PeAl-33) and ferulae (WC949, WC926, and WC966) isolates were cloned.
A total of 30 clones, five from each isolate were sequenced (M13Univ, M13Rev).
Additionally, PCR amplifications and sequencing for the β-tubulin gene (exon 5 to 8) was
performed for six SSI obtained from isolates WC984 and WC973 (var. eryngii). No
nucleotide additivity was observed for either the clones or the SSI. Gene sequence for
isolates WC927 and WC973 were deposited in GenBank under accession numbers
EU004148 and EU126930, respectively.
3.3.2 Allelic polymorphism of the β-tubulin gene
Sequence alignments among the SSI and clones revealed the presence of well- defined haplotypes. Four alleles (arbitrarily designated Er-I to IV) were identified for var. eryngii and six alleles (arbitrarily designated Fl-I to VI) for var. ferulae (Table 3.5 and
3.6). The single isolate belonging to the variety elaeoselini did not posses nucleotide superimposition and its corresponding sequence was dissimilar from the alleles Er and Fl
(Table 3.5). Three isolates of the variety nebrodensis (WC980, WC979, WC978) did not
57 display any superimposition, while two isolates had only one (WC976 and WC977). With that exception, the rest of the nebrodensis sequences were 100% identical. Therefore, inference of two alleles Nb-I and Nb-II was made. The varieties nebrodensis and elaeoselini also presented additional polymorphic sites than the sites specified in Table
3.5. Allele Er-II was found in all isolates of the variety eryngii. Alleles within P. eryngii var. ferulae isolates were highly polymorphic and only one allele (Fl-I) was shared among three isolates. Allele Fl-V was identical to the sole allele found in isolate WC-958.
Amino acid sequences of the SSI, clones and homoallelic isolates for P. eryngii did not translate in amino acid changes. Nucleotide variation in terms of number of sites and percentages were calculated (Table 3.7). In order to estimate sequence dissimilarity among varieties of Pleurotus eryngii, the heterozygous sites (nucleotide additivity) were removed from the alignment. The isolate of uncertain identity (WC958) was also removed from the analysis. To compare nucleotide variation among species within
Pleurotus spp., heterozygous sites were included since nucleotide variation for other species were located in the sites. Only one nucleotide change was found among 20 isolates belonging to var. eryngii and ferulae. Six and 23 variable sites were found when var. elaeoselini and var. nebrodensis, respectively, were included in the analysis.
Sequence dissimilarity of 30.1% was found when other species of the genus were compared (Table 3.7).
58
Table 3.5. Distribution of sequence polymorphisms in a partial region of the β-tubulin gene (exon 5 to 8) for Pleurotus eryngii var. eryngii, var. ferulae, elaeoselini, and nebrodensis isolates. Sequences of four alleles identified in var. eryngii (Er) and six alleles in var. ferulae (Fl) are also indicated. Position numbers are according to GenBank accession numbers EU126930 corresponding to isolate WC- 973 (reference). Y = C+T, R = A+G, S = G+C, K = G+T (Modified from Rodriguez Estrada et al. 2008).
Positions (vertical numbers) of the polymorphic sites in aligned sequences of a portion of the β-tubulin gene.
Intron 5 Exon 6 Intron 6 Exon 7 Intron 7 Exon 8 Species Variety Posi-tions 2 4 5 5 5 5 5 9 1 1 1 1 2 2 3 3 3 3 3 4 4 4 5 5 6 6 6 6 7 7 7 7 1 9 0 2 4 7 8 1 1 6 7 7 5 6 0 0 1 8 9 0 7 8 2 6 0 1 4 6 0 0 5 7 Isolate 2 3 5 8 6 5 0 7 8 7 3 2 7 0 9 8 4 0 3 4 3 6 1 2 P. eryngii eryngii WC973 TGCGYTYYCTGRRYCC Y GCRYAYTCRKCYAAY WC984 ...... R...... WC957 ...... WC888 . R. . T. CTYYS . . . YY . . . . . R. Y. GT. . . . . PeAl-33 . R. . T. CTYYS . . . YY . . . . . R. Y. GT. . . . . ferulae WC933 . A . . T . C T . C . G A T T . C . . A T C C . . G T . T . . T WC927 . A . . T . C T . C . G A T T . C . . A T C C . . G T . T . . T WC949 Y . S R T Y C T . C . G A T . . C . . A T G C . . G T Y T R G T WC926 . R S . T . C T . C . G A T Y . C . . A T S C . . G T . T . A T WC966 . . G . T Y C T . C . G A T . . C . Y A T G C . Y G T . . . R T elaeoselini WC999 . . . . T . C C . . . G A T . . C . . A T . C . . A T . T . . T nebrodensis WC958 (?) . . G . T . C T . C . G A T . . C . T A T G C . T G T . T . . T WC976 . . . . A . C T . . . A A C . T C . . A T . C . . G T . T . . T WC980 . . . . A . C T . . . A A C . T C . . A T . C . . G T . T . . T P. fuscus ferulae WC994 . . G . T C C T . C . G A T . . C . . A T G C . . G T . T . G T
Alleles
P. eryngii eryngii Er-I TGCGCTTCCTGGATCC C ACATACTCAGCTAAT Er-II T GCGTTCTCTGAGCCC T GCGCATTCGTCCAAC Er-III T ACGTTCTTCCGA T TT C G CAT GCCCGTCTAAT Er-IV T GCGCTTCCTGGA T CC C G CAT ACTCAGCTAAT ferulae Fl-I T A C G T T C T C C G G A T T C C G C A T C C T C G T C T A A T Fl-II T G G G T C C T C C G G A T C C C G C A T G C T C G T C T A G T Fl-III C G C A T T C T C C G G A T C C C G C A T G C T C G T T T G G T Fl-IV T G G G T T C T C C G G A T C C C G C A T G C T C G T C T A A T Fl-V T G G G T T C T C C G G A T C C C G T A T G C T T G T C T A A T Fl-VI T G G G T C C T C C G G A T C C C G C A T G C T C G T C C A G T
59 Table 3.6. Genotype conformation for partial β-tubulin gene for Pleurotus eryngii var. eryngii, ferulae, elaeoselini and nebrodensis isolates.
Isolate Variety Genotype WC-973 eryngii Er-II / Er-IV Heteroallelic WC-984 eryngii Er-II / Er-I Heteroallelic WC-957 eryngii Er-II / Er-IV Heteroallelic WC-888 eryngii Er-II / Er-III Heteroallelic PeAl-33 eryngii Er-II / Er-III Heteroallelic WC-933 ferulae Fl-I / Fl-I Homoallelic WC-927 ferulae Fl-I / Fl-I Homoallelic WC-949 ferulae Fl-II / Fl-III Heteroallelic WC-926 ferulae Fl-I / Fl-IV Heteroallelic WC-966 ferulae Fl-V / Fl-VI Heteroallelic WC-958 ? Fl-V / Fl-V Homoallelic WC-999 elaeoselini Ela-I / Ela-I Homoallelic WC-979 nebrodensis Nb-I / Nb-I Homoallelic WC-980 nebrodensis Nb-I / Nb-I Homoallelic WC-978 nebrodensis Nb-I / Nb-I Homoallelic WC-976 nebrodensis Nb-1 / Nb-IIa Heteroallelic WC-977 nebrodensis Nb-1 / Nb-II Heteroallelic
a Alleles not determined from cloning or SSI since only one site revealed additivity.
Table 3.7. Sequence variation in partial β-tubulin gene (exon 5 to 8) in varieties of Pleurotus eryngii and Pleurotus spp. Variation is given by number of variable sites and percentages.
No. Variable Total Variation Taxa isolatesa sites sites % P. eryngii var. eryngii / ferulaeb 20 1 742 0.1
P. eryngii var. elaeoselini 21 6 742 0.8
P. eryngii var. nebrodensis 25 23 742 3.1
Pleurotus spp. c 30 237 787 30.1
a Number of isolates included in the sequence comparison. Numbers are cumulative. b Pleurotus fuscus var. ferulae was included. c Pleurotus ostreatus, P. pulmonarius, P. tuberregium, P. sapidus.
60 3.3.3 Phylogenetic analysis based on partial sequences of the β-tubulin gene
In order to evaluate the use of the β-tubulin gene in phylogenetic reconstruction of the P. eryngii species complex and allied taxa, two approaches were undertaken. First, one tree was constructed based on the NJ method for all the distinct alleles or haplotypes of the closest varieties: ferulae, eryngii and elaeoselini (Fig. 3.3). Second, two trees were
constructed utilizing the sequences obtained from the dikaryotic isolates. One tree
included all the varieties within the complex (Fig. 3.4) and a second tree included other
taxa within the genus Pleurotus (Fig. 3.5).
Alleles of a single variety were not clustered together (Fig. 3.3). The single allele
for var. elaeoselini was placed within most of the Er alleles. Er III was placed among
most of the Fl alleles. A tree including dikaryotic isolates for the P. eryngii species
complex is shown in Fig. 3.4. Two main clusters were well differentiated. Cluster 1
includes P. eryngii var. nebrodensis and cluster 2 includes var. eryngii, ferulae,
elaeoselini and P. fuscus var. ferulae (= P. eryngii var. ferulae). Although a sub-cluster
(top part of the tree) clearly includes only isolates of the ferulae variety, the second sub-
cluster includes a mixture of ferulae, eryngii and elaeoselini isolates (Fig. 3.4). Isolate
WC958, originally identified as P. eryngii var. nebrodensis, clearly clustered out of the
well delimited nebrodensis cluster. Additionally, this isolate is homoallelic for the β- tubulin gene which nucleotide sequence is nearly identical to allele Fl-V. Apparently, this
isolate was misidentified and might be closely related to P. eryngii var. ferulae. Still,
additional sequences analyses are required in order to confirm this finding. As mentioned
above, β-tubulin sequence of the elaeoselini isolate (WC999) had additional polymorphic
61 83 FL-II
61 Fl-VI
50 Fl-IV 49 FL-V 81 Fl-III Er-III
84 Fl-I var. elaeoselini (WC999)
95 Er-I 97 Er-IV
Er-II
Fig. 3.3. Phylogenetic tree constructed from distinct alleles (β-tubulin gene) found in three varieties of the P. eryngii species complex: eryngii (Er), ferulae (Fr) and elaeoselini (WC999). The Neighbor-Joining method and the p-nucleotide model were used to construct the tree. Bootstrap values were based on 1000 replications.
WC958 var. ferulae (WC966) 62 var. ferulae (WC926) var. ferulae (WC956) var. ferulae (WC949) 66 P. fuscus var. ferulae (WC994) var. eryngii (WC984) var. ferulae (WC927) Subcluster var. eryngii (WC945) var. eryngii (WC957) var. eryngii (Pe-Al7) Cluster 2 var. eryngii (WC989) var. eryngii (Pe-Al11) var. eryngii (WC514) var. elaeoselini (WC999) var. eryngii (Pe-Al1) var. eryngii (WC968) var. eryngii (WC973) var. eryngii (WC888) var. ferulae (WC933) var. eryngii (Pe-Al33) var. eryngii (PK2) var. nebrodensis (WC977) var. nebrodensis (WC978) var. nebrodensis (WC979) Cluster 1 var. nebrodensis (WC980) var. nebrodensis (WC976)
Fig. 3.4. Phylogenetic tree based on a portion of the β-tubulin gene for dikaryotic isolates of four varieties of Pleurotus eryngii: eryngii, ferulae, elaeoselini and nebrodensis. The Neighbor- Joining method and the p-nucleotide model was used to construct the tree. Bootstrap values were based on 1000 replications.
62
var. ferulae (WC949) var. ferulae (WC956) 63 var. ferulae (WC926) var. ferulae (WC966) WC958 60 P. fuscus var. ferulae (WC994) var. eryngii (WC888)
var. ferulae (WC927) var. ferulae (WC933) 100 var. eryngii (Pe-Al11) var. eryngii (Pe-Al33) var. elaeoselini (WC999) var. eryngii (WC945) var. eryngii (WC973)
62 var. eryngii (Pe-Al1) var. eryngii (Pe-Al7)
99 var. eryngii (WC968) var. eryngii (PK2) var. eryngii (WC957) var. eryngii (WC989) var. eryngii (WC984)
var. eryngii (WC514) 100 var. nebrodensis (WC979)
var. nebrodensis (WC977) var. nebrodensis (WC980) 100 var. nebrodensis (WC978) var. nebrodensis (WC976) P. ostreatus (WC819) P. ostreatus (WC971) 100 P. ostreatus (WC739) Psajor-caju (pulmonarius ASI2070) P. ostreatus (WC632) 100 99 P. sapidus (WC153) P. tuberregium (WC823)
Fig. 3.5. Phylogenetic tree based on a portion of the β-tubulin gene for four varieties of P. eryngii and other species within the genus Pleurotus (dikaryotic isolates). The Neighbor-Joining method and the p-nucleotide model were used to construct the tree. Bootstrap values were based on 1000 replications.
63 sites compared to those specified in Figure 3.3 and Table 3.6. This sequence variation was reflected in the tree constructed from dikaryotic sequences, where a long branch supports this isolate (Fig. 3.4).
A phylogenetic reconstruction for five Pleurotus spp. including four varieties of the P. eryngii complex is shown in Figure 3.5. Sequence for P. sajor-caju (P. pulmonarius) was retrieved from GenBank (accession: ASI2070). A cluster supported by
100% bootstrap comprises three varieties of the P. eryngii (ferulae, eryngii and elaeoselini). However, phylogenies among these taxa are not resolved. On the other hand, isolates of the var. nebrodensis are located in a separate cluster supported by 100% bootstrap. Isolates of P. ostreatus are found also in a cluster supported by high bootstrap values, however, isolate WC632, listed as P. ostreatus in the culture collection, was grouped along with isolate WC153 registered as P. sapidus. Pleurotus tuberregium, it is located at the base of the tree.
3.4 Discussion
The β-tubulin gene has been used to examine phylogenetic relationships in fungi at various taxonomic levels including sub-species (Thon and Royse 1999a and b, Shen et al. 2002, Begerow et al. 2004, Kauserud et al. 2007). In those studies, intra-isolate polymorphism (allelic variation) of the gene was not reported. However, it is known that point mutations and the alleles developed in the β-tubulin gene may produce amino acid changes in A. nidulans, Neurospora crassa, Venturia spp. and Penicillium spp., conferring resistance to the benzamidazole fungicides (Orbach et al. 1986, Jung and
Oakley 1990, Koenraadt et al. 1992, Matsuo et al. 1999). In organisms other than fungi,
64 allelic variation of the β-tubulin gene within a single individual has been documented.
For example, in the protozoan Cryptosporidum parvum, several alleles exist in intron and adjacent exon 2 of the β-tubulin gene (Widmer et al. 1998). In the nematode Haemonchus contortus, benzamidazole anthelmintics resistance was attributed to changes in the allelic frequency of two β-tubulin genes (Beech et al. 1994). In the present study, numerous intra-isolate polymorphisms were detected for the β-tubulin gene in two varieties of P. eryngii: eryngii and ferulae. Although paralogous versions of this gene are known to exist in some species of fungi, the polymorphisms found in this study were not attributed to a second copy of the gene because the alleles were produced in different nuclei and segregated in a Mendelian fashion as indicated by direct sequencing of SSI. The author identified four alleles within P. eryngii var. eryngii and six alleles in P. eryngii var. ferulae. The alleles are not shared between the two varieties and allele Er-II was found in all P. eryngii var. eryngii isolates evaluated. Among the six alleles identified in isolates of the ferulae variety, only one allele (Fl-I) was found in more than one isolate.
Nonetheless, allele Fl-V was also found in isolate WC958 that was originally identified as P. eryngii var. nebrodensis. Uncertainty as to the identification of this isolate arose from observed differences in performance between this and other known isolates of nebrodensis and ferulae (personal observation). The white color of the basidioma is one of the most distinctive characteristics of var. nebrodensis (Candusso and Basso 1995,
Venturella 2000). Basidiomata of isolate WC958 are white and this might have lead to the misidentification of this isolate as var. nebrodensis. In fact, Zhang et al. (2006) reports that P. eryngii var. ferulae growing in association with Ferula sinkiangensis in
Xinjiang, China produces white basidiomata. Interestingly, Zhang et al. (2006) reported
65 that P. nebrodensis is also found in the same area in association with the same host.
These similarities were the main reasons these two taxa were identified as P. nebrodensis
in Xinjiang. However, studies based on molecular markers and mating tests, revealed a
clear separation of the two groups: var. ferulae and P. nebrodensis (Zhang et al. 2006).
Isolate WC958 was homoallelic for the partial β-tubulin gene analyzed here and its
sequence vas identical to allele Fl-V. Therefore, it is affirmed that WC958 has been misidentified and it might be assumed that this isolate could be close related to P. eryngii var. ferulae although sequence analyses of other regions are needed in order to confirm this hypothesis.
The heteroallelism in the β–tubulin gene found in two varieties of P. eryngii may confound the use of this gene for phylogenetic inferences in this species complex.
However, this gene was suitable for delimitation of species boundaries based on a non- topological approach (Doyle 1995). The author expected to find clear phylogenetic
relationships within P. eryngii species complex, similar to studies that used the β-tubulin
gene in Basidiomycetes at the species levels (Thon and Royse 1999b, Shen et al. 2002).
However, in P. eryngii, Doyle’s (1995) affirmation may apply: “below the level of what
is commonly accepted as the species in sexual organisms there may be no phylogeny,
only reticulate relationships (tokogeny) among individuals”. Reproductive isolation in
vivo between populations of var. eryngii and ferulae was observed by Urbanelli et al.
(2002). Those researchers stated that pre-mating barriers given by the fact that eryngii
and ferulae are adapted to different hosts and fructify at different times, are well
established and therefore they consider these groups as different biological species.
However, partial interfertility observed in vitro might suggest that this species is in a
66 speciation process as suggested by Zervakis et al. (2001b). Therefore, In agreement with
other authors (Candusso and Basso 1995, Venturella 2000, Zervakis et al. 2001b), the
author concludes that P. eryngii var. ferulae and var. eryngii should be considered
varieties and not different species as proposed by Urbanelli et al. (2002). On the other
hand, the data presented in this study supports the idea that that P. eryngii var. nebrodensis should be considered a different phylogenetic species since excellent bootstrap support (100%) separated this taxon from the rest of the varieties (Candusso and Basso 1995, Venturella 2000, Zhang et al. 2006). The author also confirms that var. elaeoselini is more closely related to var. ferulae and eryngii than is to var. nebrodensis.
When P. nebrodensis was described by Inzenga in 1863, P. eryngii var. elaeoselini was
considered within the same taxon (Venturella et al. 2000). In nature, the varieties
elaeoselini and ferulae are found in similar and often identical habitats (Venturella et al.
2000) and this situation could might also contribute to erroneous identifications.
Three P. ostreatus isolates (WC739, WC971 and WC819) clustered together but
isolate WC632, also identified as P. ostreatus was placed in a different cluster.
Previously, the author emphasized that many isolates included in culture collections may
be incorrectly identified, especially in a genus containing species that are widely
distributed due to their edible properties. In many cases, cultures were received from
sources that contain little or no background information on the isolates. Unless molecular
or morphological confirmation of the identity of the cultures is completed, the original
designation would remain. Suspicions about wrong identification of isolate WC632
became clear when a phylogeny, based on ITS sequences, placed this isolate within a P.
pulmonarius cluster (see Chapter 2). In fact WC632, a sequence retrieved from GenBank
67 (ASI2070) identified as P. sajor-caju (P. pulmonarius) and isolate WC153 (P. sapidus)
cluster together. Therefore, WC-632 may be a misidentification of P. pulmonarius or P.
sapidus. The taxonomic position of P. sapidus is controversial. A close relationship of
this species with P. pulmonarius, P. cornucopiae, P. columbinus and P. ostreatus was
suggested by several researchers (Hilber 1989, Zervakis et al. 1994, Gonzales and
Labarere 2000, Bao et al. 2004a, b). In this study, WC153, presumably P. sapidus, shows a close relationship with P. pulmonarius.
In conclusion, the present study illustrates that the partial β-tubulin gene examined does not resolve phylogenetic relationships within three varieties of P. eryngii, a group that is geographically restricted to the northern hemisphere and the Old World.
However, the portion of the gene examined provides useful genetic information to delimit gene pools within those groups. On the other hand, β-tubulin clearly differentiated P. eryngii var. nebrodensis from the other varieties of P. eryngii and species within the genus Pleurotus.
68 Chapter 4: Use of the tef1 and RPB2 genes for phylogenetic
reconstruction of the Pleurotus eryngii species complex and allied taxa
4.1 Introduction
The Pleurotus eryngii species complex consists of several varieties: eryngii, ferulae, elaeoselini, tingitanus, nebrodensis, P. hadamardii and P. fossulatus (Hilber
1977, Candusso and Basso 1995, Venturella 2000, Lewinsohn et al. 2002). In nature, this group functions as facultative biotroph of some members of the Umbelliferae and
Compositae families (Zervakis et al. 2001a). Morphological characteristics used to differentiate individuals within these groups may be ambiguous because of environmental influences or overlap of traits of interest. For example, it was reported recently that white basidiomata, a feature considered distinctive of the var. nebrodensis, may also be found in some isolates of the variety ferulae growing on Ferula sinkiangensis in Xinjiang,
China (Zhang et al. 2006). As it is true for other fungi, incomplete reproductive barriers exist within the P. eryngii group (Bresinsky et al. 1987, Zervakis and Balis 1996).
Therefore, biological species delimitation is often difficult to establish.
The author previously evaluated the utility of the ITS region of the rDNA gene
cluster and partial β-tubulin gene to infer phylogenetic relationships among varieties of P.
eryngii. Allelic polymorphisms (intra-isolate polymorphisms) within these two regions were found especially for the β-tubulin gene. Therefore, the ITS region and the partial β- tubulin gene were not useful to infer infraspecific phylogenetic relationships.
Other protein-coding regions that may be useful to determine phylogenetic relationships among closely related taxa are the genes coding for the translation
69 elongation factor (tef1) and the second largest subunit of the RNA polymerase II (RPB2)
(Liu et al. 1999, Roger et al. 1999, Matheny et al. 2002, Tanabe et al. 2004, Froslev et al.
2005, Matheny 2005, Matheny et al. 2006).
The translation elongation factor (EF-1α) is a binding protein required for ribosomal protein synthesis in eukaryotes. The acceptor site in the ribosome and the aminoacyl-tRNA are bind through this protein during elongation of the peptide chain.
EF-1α is a highly conserved protein and one of the most abundant in cells. Most eukaryotes posses more than one copy of the tef1 gene (Fig. 4.1). Schizophyllum commune has only one copy (Wendland and Kothe 1997). A study performed by
Marongiu et al. (2005) revealed that the tef1 gene contains nucleotide substitutions that are useful to distinguish two varieties of P. eryngii: ferulae and eryngii.
The RPB2 is a single copy gene that encodes the second largest subunit of the
RNA polymerase II, the enzyme that transcribes pre-mRNA (Liu et al. 1999, Matheny et al. 2007). This gene is found as a single copy in the genome and is useful for evolutionary studies in eukaryotes. The RPB2 gene possesses twelve highly conserved domains (Fig. 4.2) across kingdoms that have been used to design PCR primers (Liu et al.
1999). The RPB2 gene was used in combination with other genomic regions to infer phylogenetic relationships at the species level for the genus Cortinarius and Inocybe
(Froslev et al. 2005, Matheny 2005). In the genus Cortinarius, RPB2 gene was used along with RPB1 gene and ITS region. Results revealed high resolution and nodal support for closely related taxa that in previous studies were difficult to determine (Froslev et al.
2005). Therefore, in the present study, the author explored the use of the tef1 and RPB2
70 genes to infer phylogenetic relationships among members of the P. eryngii species complex and related taxa.
4.2 Materials and Methods
4.2.1 Dikaryotic Cultures
A total of 39 Pleurotus spp. isolates were used, representing six species (P.
dryinus, P. ostreatus, P. sapidus, P. tuberregium, P. cornucopiae and P. cystidiosus) and
four varieties (eryngii, ferulae, elaeoselini and nebrodensis) of the P. eryngii species
complex (Table 4.1). Isolates with codes “WC” were from The Pennsylvania State
University Mushroom Culture Collection (PSUMCC). Strains were maintained by
periodic transfers to potato dextrose agar medium (PDA) (DifcoTM) contained in test
tubes. Cultures are also stored in liquid nitrogen (-196 °C and 10% glycerol).
4.2.2 Culture conditions and extraction of DNA
Pleurotus spp. isolates were grown for 15 to 20 days in 30 ml sterile potato
dextrose broth (PDB) contained in 125 ml Erlenmeyer flasks. Broth and mycelium were
filtered through miracloth (Calbiochem®). The mycelium was rinsed with sterile-distilled water and squeezed twice, placed in 2 ml eppendorf tubes, lyophilized, and then stored in
a glass desiccator at room temperature. Lyophilized mycelium was ground with a
micropestle in a 1.5 ml Eppendorf tube. DNA extractions were performed using a
DNeasy® plant mini kit (Qiagen) according to the manufacturer’s instructions. DNA
concentrations were visualized and estimated by gel electrophoresis and a Beckman
71 DU®640B spectrophotometer, respectively. DNA stock solutions were adjusted to 20 ng/µl with sterile-distilled water and then stored at -20 ºC until use.
Table 4.1. Species, variety, isolate code, original source, geographic origin and host/substrate of isolates of Pleurotus spp. used in this study.
Species Variety Isolate Original Geographic Host/substrate2 code Source1 origin2 Pe-AL1 INRA3 Entre Deux Eryngium P. eryngii eryngii Mers, Launay, campestre / France calcareous soil Pe-Al11 INRA Causse E. campestre / Mejean, limestone plateau France Pe-Al20 INRA Oleron island, E. maritimun / France Litoral of dunes WC888 SEFI4 Unknown Commercial Pe-Al32 Commercial Unknown Commercial Farm WC968 IBAF5 Unknown Commercial WC967 IBAF Unknown Commercial WC957 U. Bari6 Sicily, Italy Unknown WC984 IBAF Unknown Commercial Unknown P. eryngii ferulae WC966 IBAF Sardegna, Italy WC955 U. Bari Sicily, Italy Unknown WC929 U. Haifa7 Gilboa Mt., Ferula sp. Israel WC933 U. Haifa Gevaot Merar, Ferula sp. Israel WC926 U. Haifa Tabor Mt., Ferula sp. Israel WC927 U. Haifa Menahemya, Ferula sp. Israel WC981 IBAF Sicily, Italy Unknown WC970 IBAF Puglia, Italy Unknown WC982 IBAF Sardegna, Unknown Italy WC956 U. Bari Bari, Italy Unknown WC850 China Unknown Unknown WC954 U. Bari Taranto, Italy Unknown WC969 IBAF Sardegna, Unknown Italy WC994 CBS8 Unknown Unknown
72 Table 4.1 cont.
Species Variety Isolate Original Geographic Host/substrate2 code Source1 origin2 P. eryngii elaeoselini WC999 U. Palermo9 Unknown Unknown P. eryngii nebrodensis WC777 IBAF Sicily, Italy Unknown WC979 IBAF Sicily, Italy Unknown WC980 IBAF Sicily, Italy Unknown * WC958 U. Bari Unknown Unknown P. dryinus MW-84 Unknown Unknown Unknown P. ostreatus WC632 ASI10 Unknown Unknown WC739 Italspawn Unknown Unknown WC971 IBAF Italy Basilicata P. sapidus WC153 Unknown Unknown Unknown WC529 PSU11 State College, Unknown PA, USA P. tuberregium WC823 Nigeria Nigeria Unknown P. cystidiosus WC609 ASI Unknown Unknown P. cornucopiae WC608 ASI Unknown Unknown WC397 Unknown Toronto Unknown
1 Original source refers to the immediate isolate supplier. 2 Geographic origin and host/substrate refers to the place and conditions where the isolates were found in nature. Commercial usage of the isolates is specified under host/substrate. 3 INRA – National Institute of Agronomic Research, MYCSA (Mycology and Food Security), Villenave D’Ornon, France. 4 SEFI – Shanghai Edible Fungi Institute, Shanghai, China. 5 IBAF – Institute of Biology, Agro-environment and Forestry, Rome, Italy. 6 U. Bari – University of Bari, Department of Biology and Plant Pathology, Bari, Italy. 7 U. Haifa – University of Haifa, Institute of Evolution, HAI Culture Collection, Haifa, Israel. 8 CBS - The Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands. 9 U. Palermo – University of Palermo, Department of Botany, Sicily, Italy. 10ASI - Agriculture Science Institute, Suwon, Korea. 11PSU – The Pennsylvania State University, Mushroom Culture Collection, University Park, USA. * These isolate was misidentified according to the results of this study.
4.2.3 PCR amplification of partial tef1 and RPB2 genes
One set of primers EF116OR (5’ CCGATCTTGTAGACGTCCTG 3’) and
EF595F (5’ CGTGACTTCATCAAGAACATG 3’) was used to amplify a portion of the tef1 gene (Wendland and Kothe 1997, Marongiu et al. 2005). The structure of the gene
73 and the target sections for primer recognition are shown in Figure 4.1. Two sets of
primers were used to amplify portions of the RPB2 gene. Primer bRPB2 7.1R is specific
for basidiomycetes (5’ CCCATRGCYTGYTTMCCCAT DGC 3’) while primer fRPB2
5F is specific for fungi (5’ GAYGAYMGWGATCAYTTYGG 3’). These primers were
used to amplify a gene fragment of ~ 1100 bp located between domains 5 and 7 (Fig. 4.2)
(Matheny 2006). A second set of primers was used to amplify a fragment of ~1100
spanning a region between domain 7 and 11 (Fig. 4.2). Primer b11R1 (5’
TGGATYTTGTCRTCCACCACCAT 3’) is specific for Basidiomycetes while b6.9F (5’
TGGACNCAYTGYGARATY CAYCC 3’) is specific for fungi (Liu et al. 1999, Matheny
2006). The PCR master mix from Promega (Taq DNA polymerase) was used to carry out
PCR reactions as follows: PCR master mix 12.5 µl [Taq DNA polymerase (25 units/ml),
dNTPs (200 μM each), MgCl2 (1.5 mM)], primers 3 µl (10 µM each), water 3.5 µl and
DNA template 3.0 µl (20 ng/μl) in 25 µl volume reactions. PCR cycling was carried out
in a PTC-100 ™ Programmable Thermal Controller (MJ Research). PCR cycle
conditions for the tef1 amplifications were: 94ºC/4 min; 36 cycles of 94ºC/1 min, 55ºC/1
min, 72 ºC/1 min; 72 ºC/10 minutes. PCR conditions for amplification of the RPB2 gene
were: 94ºC/5 min; 35 cycles of 94ºC/1 min, 57ºC/1 min, 72 ºC/90 s; 72 ºC/10 minutes.
PCR products were visualized by electrophoresis in 1% agarose gels stained with
ethidium bromide (0.16 µl/ml). DNA loading buffer (5x; 2 µl) + 5 µl PCR product were
loaded on the gel and electrophoresed for approximately 30 minutes at 2.3 – 3.3 V/min.
74 EF595F EF1160R 1 2 3 4 5 6 7
Fig. 4.1. Schematic diagram of the tef1 gene encoding for translation elongation factor (EF-1α) of Schizophyllum commune. Forward and reverse primers that amplify a portion of the gene (Exon 4 to 6) are indicated with purple arrows. Numbers indicate introns (adapted from Wendland and Kothe 1997).
b6.9F b11R1 f5F b7.1R 1 2 3a 3b 4 5 6 7 8 9 10 11 12
Fig. 4.2. Schematic diagram of the RPB2 gene. Black segments represent the 12 conserved
amino acid motifs among eukaryotes. Primers that amplify the region between conserved domains 5 to 7 are indicated in blue arrows. Primers that amplify the region between conserved domains 7 to 11 are indicated in orange arrows (adapted from Liu et al. 1999, Matheny 2006).
4.2.4 DNA sequencing
PCR products were purified using ExoSAP-IT® (USB) according to the manufacturer’s instructions. Purified DNA template was concentrated (SPD1010
SpeedVac®System) or diluted to 40 ng/µl for sequencing. Forward primer EF595F and reverse primers b11R1 and b7.1R (1 µM each) were used for sequencing reactions.
Primers b6.9F and f5F failed to produce readable chromatograms. DNA template and primer (2 µl each) were transferred to 96-well µltraAmp™ PCR plates and sealed with
75 ThermalSeal™. Sequencing was carried out in an ABI Hitachi 3730XL DNA analyzer located in the Nucleic Acid Facility at PSU.
4.2.5 Sequence data analysis
Sequence chromatograms were visualized and edited with Sequencher version 4.7
(Gene Codes Corporation 2006) software. Sequence alignments were made using the clustal W algorithm in MEGA (3.1) and manually edited. Sequence alignments were performed for tef1, two portions of the RPB2 gene and the two data sets combined. Data retrieved from GenBank [accession numbers AY883432 (tef1) and AY786062 (RPB2)] for P. ostreatus were included in the analysis. Nucleotide differences among varieties and species within the genus were calculated. Phylogenetic reconstructions for the tef1,
RPB2, and combined data sets were performed based on the Neighbor-Joining method
(Nei and Kumar 2000) and the p-distance (nucleotide substitution) model in MEGA (3.1).
The phenetic analysis confidence was assessed by bootstrap tests with 1,000 replications.
4.3 Results
4.3.1 Sequence data analysis for partial tef1 gene in Pleurotus spp.
Amplification of the tef1 gene yielded a single band of approximately 583 bp in agarose gel. A segment of ~548 bp remained after sequences were edited and trimmed.
Sequence variation among var. ferulae, eryngii and elaeoselini was < 1% (Table 4.2).
Inclusion of isolates of var. nebrodensis in the analysis resulted in 1.5% variation corresponding to eight nucleotide changes. In contrast, alignment of 38 isolates of seven species of Pleurotus showed 34.9% variation (Table 4.2). As reported by Marongiu et al.
76 (2005), three nucleotide substitutions unequivocally distinguish P. eryngii var. eryngii
from P. eryngii var. ferulae. However, base substitutions indicative of var. ferulae were also found in the var. elaeoselini and the isolate of uncertain identity WC958 (received as var. nebrodensis). Base substitutions at positions 95, 116, 188, and 271 discriminated var. nebrodensis from the rest (See appendix A, section a). No unique variable sites that allowed discrimination of var. elaeoselini from the other groups were found.
Table 4.2. Sequence variation among varieties of the Pleurotus eryngii species complex and Pleurotus spp. for a portion of the tef1 gene (Exons 4 to 6).
No. Variable Total Variation Taxa isolatesa sites sites % P. eryngii var. eryngii / ferulaeb 21 4c 536 0.75
P. eryngii var. elaeoselini 22 5 536 0.9
P. eryngii var. nebrodensis 27 8 536 1.5
Pleurotus spp. d 38 191 548 34.9
a Number of isolates included in the sequence comparison. Therefore, numbers are accumulative. b Pleurotus fuscus var. ferulae was included. c Three sites were discriminatory for var. eryngii and ferulae (Marongiu et al. 2005). A fourth nucleotide change was found only in one ferulae isolate. d Pleurotus ostreatus, P. sapidus, P. cornucopiae, P. tuberregium, P. cystidiosus and P. dryinus were included.
4.3.2 Sequence analysis of the RPB2 gene in Pleurotus spp.
Sequences were edited and trimmed for the two portions of the RPB2 gene for
each isolate. For primer set f5F/b7.1R, a region of 521 bases remained. This region was
referred as RPB2-1 in this paper. For the primer set b6.9F/b11R1, a region of 731 bases
77 remained. This region was named here as RPB2-2. These segments correspond to
position 370-890 (RPB2-1) and 1260-1990 (RPB2-2) of the P. ostreatus sequence
retrieved from GenBank under accession number AY786062. Multiple alignments were
performed in separate data sets for each portion of the gene. A total of thirteen
nucleotides were different between isolates of the varieties ferulae and eryngii for the two segments (Table 4.3). However, only 5 sites (410 in RPB2-1 and 75, 84, 221 and 611 in
RPB2-2) were able to distinguish the two varieties from each other. Base substitutions at positions 6, 152, 269, 296, 478, 488 and 494 (RPB2-1) and 209, 218, 254, 407, 527, 604
and 607 (RPB2-2) allowed discrimination between nebrodensis and other members of the
species complex (See Appendix A, sections b and c). Variety elaeoselini shared a 100%
identity with the misidentified isolate WC958. A total of three sites differentiated these
two isolates from the other members of the eryngii complex (11 in RPB2-1 and 11 and
344 in RPB2-2, Appendix A section b and c).
4.3.3 Phylogenetic analysis based on partial sequences of tef1 and RPB2
genes
Phylogenetic reconstruction for Pleurotus species based on the tef1 gene is shown
in Figure 4.3. Members of the P. eryngii species complex were divided into three
clusters. Cluster 1 contains varieties ferulae, elaeoselini, and the misidentified isolate
WC958. This cluster is well supported by a bootstrap value of 93%. Cluster 2 contains
only isolates of the variety eryngii and is supported by bootstrap value of 95%. A third
cluster, with 97% bootstrap value support, includes isolates of the variety nebrodensis.
78 Table 4.3. Sequence variation among varieties of the Pleurotus eryngii species complex and Pleurotus spp. for two partial regions of the RPB2 gene (domains 5 to 11).
RPB2-1 RPB2-2 No. f5F / b7.1R b6.9F / b11R1 Taxa a isol. Var. Total Var. Var. Total Var. Sitesb sites %c Sitesb sites %c P. e d. var. eryngii 9 0 521 0 3 731 0.41
P. e. var. ferulae 14 2 521 0.38 1 731 0.13
P. e. var. eryngii / ferulaee 24 5 521 0.96 8 731 1.1
P. e. var. elaeoselini 25 6 521 1.2 10 731 1.4
P. e. var. nebrodensis 28 14 521 2.7 17 731 2.3
Pleurotus spp.f 34 209 521 40.1 222 732 30.3
a Number of isolates included in the sequence comparison. Therefore, numbers are accumulative. b Number of variable sites c Percentages of variation d Pleurotus eryngii. e Pleurotus fuscus var. ferulae was included. f Pleurotus ostreatus, P. sapidus, P. cornucopiae, P. cystidiosus and P. dryinus were included.
As explained above, var. elaeoselini and isolate WC958 share nucleotide substitutions with the ferulae group. Therefore var. elaeoselini and WC958 isolate clustered along with var. ferulae in the tree based on the tef1 gene (Fig. 4.3). On the other hand, the tree generated from RPB2 sequences (Fig. 4.4) clustered the elaeoselini and WC958 isolates along with the eryngii group with 98% bootstrap support. In this tree (RPB2 based) the ferulae cluster is supported by a bootstrap value of 99% while the nebrodensis cluster is supported by a bootstrap value of 100%. The phylogenetic tree based on combined tef1 and RPB2 data sets (Fig. 4.5) shows that the varieties eryngii, ferulae, elaeoselini and
nebrodensis are grouped in different clusters, each well supported by bootstrap values of
79 var. ferulae (WC969)
var. ferulae (WC929)
var. ferulae (WC956) var. ferulae (WC933) var. ferulae (WC927) var. ferulae (WC966) 93 P. fuscus var. ferulae (WC994) var. ferulae (WC982) Cluster 1 WC958 var. ferulae (WC955) var. ferulae (WC981)
var. ferulae (WC850) 80 var. ferulae (WC970) var. elaeoselini (WC999) var. eryngii (Pe-Al11) var. eryngii (Pe-Al32) var. eryngii (WC967) var. eryngii (Pe-AL1) 94 var. eryngii (WC984) 95 Cluster 2 var. eryngii (WC968) var. eryngii (WC989)
var. eryngii (WC957)
var. eryngii (WC888)
var. nebrodensis (WC777) 74 var. nebrodensis (WC976) Cluster 3 97 var. nebrodensis (WC979) var. nebrodensis (WC980) P. sapidus (WC529) 99 94 WC397 Pleurotus ostreatus (AY883432) P. ostreatus (WC739) 99 P. ostreatus (WC971)
P. sapidus (WC153)
99 WC632 WC608 53 P. cystidiosus (WC609) P. dryinus (WC84) 99 P. tuberregium (WC823)
Fig. 4.3. Phylogenetic consensus tree constructed for four varieties of Pleurotus eryngii and other species within the genus Pleurotus based on partial tef1 gene. The Neighbor-Joining method and the p-nucleotide model were used to construct the tree. Bootstrap values were based on 1,000 replications.
80
var. ferulae (WC926)
var. ferulae (WC966)
var. ferulae (WC933)
var. ferulae (WC956) var. ferulae (WC927) var. ferulae (WC850) 99 var. ferulae (WC955) Cluster var. ferulae (WC970) 1 var. ferulae (WC929) var. ferulae (WC982) P. fuscus var. ferulae (WC994) var. ferulae (WC954) var. ferulae (WC969) 100 var. ferulae (WC981)
95 WC958 var. elaeoselini (WC999) var. eryngii (Pe-Al11) var. eryngii (WC984) var. eryngii (WC888) 100 var. eryngii (Pe-Al32) Cluster 2 98 var. eryngii (Pe-Al20) var. eryngii (WC968) var. eryngii (WC967) var. eryngii (Pe-AL1) 97 var. eryngii (WC957)
var. nebrodensis (WC777) var. nebrodensis (WC979) Cluster 3 100 100 var. nebrodensis (WC980) P. ostreatus (AY786062)
100 P. ostreatus (WC739) 100 P. ostreatus (SMR227) P. sapidus (WC153) P. cystidiosus (WC609) WC608 78 P. dryinus (WC84)
Fig. 4.4. Phylogenetic consensus tree constructed for four varieties of Pleurotus eryngii and other species within the genus Pleurotus based on two partial regions of the RPB2 gene. The
Neighbor-Joining method and the p-nucleotide model were used to construct the tree. Bootstrap values were based on 1,000 replications.
81
var. ferulae (WC955) var. ferulae (WC982) var. ferulae (WC970) P. fuscus var. ferulae (WC994) var. ferulae (WC966) var. ferulae (WC850) Cluster 1 var. ferulae (WC969) 99 var. ferulae (WC956)
var. ferulae (WC981) var. ferulae (WC927) var. ferulae (WC933) 99 var. ferulae (WC929) 99 WC958 Cluster 4 var. elaeoselini (WC999) var. eryngii (Pe-Al20) var. eryngii (WC967)
90 var. eryngii (Pe-Al11) Cluster 2 99 var. eryngii (WC968) var. eryngii (WC888) 99 var. eryngii (Pe-Al32) var. eryngii (WC984) var. eryngii (Pe-AL1) 98 var. eryngii (WC957) var. nebrodensis (WC777) var. nebrodensis (WC979) Cluster 3 99 99 var. nebrodensis (WC980)
P. ostreatus (WC739) 99 P. ostreatus (WC971) P. sapidus (WC153) P. cystidiosus (WC609) WC608 72 P. dryinus (WC84)
Fig. 4.5. Phylogenetic consensus tree constructed for four varieties of Pleurotus eryngii and other species within the genus Pleurotus based on combined partial sequences of tef1 and RPB2 genes. The Neighbor-Joining method and the p-nucleotide model were used to construct the tree.
Bootstrap values were based on 1,000 replications.
82 99%. Therefore, when both genes are combined in a phylogenetic analysis, all four
varieties eryngii, ferulae, elaeoselini and nebrodensis are monophyletic and clearly
distinct from each other although closely related, with nebrodensis being the most distant.
4.4 Discussion
The tef1 and RPB2 genes have been used separately or in combination to
elucidate evolutionary relationships at high and low levels of relatedness in phylogenetic
studies of fungi (Roger et al. 1999, Tanabe et al. 2004, Froslev et al. 2005, Matheny
2005, Matheny et al. 2007). In the present study, the author sought to examine
phylogenies of the P. eryngii species complex and allied taxa by using portions of these
genes individually and in combination. Three varieties (eryngii, ferulae and nebrodensis)
were clearly separated in the RPB2 and tef1 individual and combined analyses. However,
placement of the var. elaeoselini (WC999) and isolate WC958 (erroneously identified as
var. nebrodensis) was ambiguous. Marongiu et al. 2005 showed that nucleotide
substitutions at positions 241 (C), 271 (T) and 393 (C) in tef1 were discriminatory for
varieties ferulae and eryngii (Appendix A, section a). However, in this study the author
demonstrated that var. elaeoselini and isolate WC958 shared the same bases that
distinguish the ferulae group from eryngii. As a consequence, the phylogenetic tree groups the ferulae and elaeoselini taxa together (Fig. 4.3). Regarding this result, the author stresses out that extreme caution should be exercised when designing molecular markers to differentiate varieties within this species complex. As we found in this research, sites within the tef1 gene that should be able to differentiate the group eryngii and ferulae (Urbanelli et al. 2005) are unable to differentiate the var. elaeoselini resulting
83 in a misleading placement of this group within the ferulae group. Therefore, attempts to design molecular markers should include the analysis of the three closest related varieties within the P. eryngii complex (eryngii, ferulae and elaeoselini). Still, direct sequencing of the tef1 gene and identification of the three nucleotides reported by Marongiu et al.
(2005) were extremely useful here to perform a first screening and confirm identification of the isolates included in this and previous studies.
The RPB2 phylogeny (Fig. 4.4) placed isolates WC958 and WC999 within the P.
eryngii var. eryngii cluster. However, when the tef1 and RPB2 data sets were combined, a
cluster supported by a bootstrap value of 99% emerged (Fig. 4.5). Zervakis et al. (2001b)
states that var. elaeoselini possesses an intermediate position since successful mating
between this group and var. eryngii and ferulae were higher (45-70%) than positive
mating between var. ferulae and eryngii (40%). In this study, the author supports the idea
of an intermediate position for var. elaeoselini since this taxon clustered with either eryngii or ferulae varieties. This intermediate position of var. elaeoselini and higher ability to mate successfully with var. eryngii and ferulae may be an indication that elaeoselini could be the result of a hybridization event between the two varieties eryngii and ferulae. In fact, the analysis of a portion of the β-tubulin gene (Chapter 3) showed that the sequence of isolate WC958 was identical to one of the alleles found in var. ferulae. In previous studies, the author questioned the identity of isolate WC958. This isolate was originally identified as P. eryngii var. nebrodensis and, in fact, this isolate produces white basidiomata (personal observation). Venturella (2002) states that entirely white mushrooms growing on Elaeoselinum gummiferum and Thapsia villosa in
Salamanca, Spain were misidentified as var. P. nebrodensis by several mycologist
84 without adequate taxonomic training. However, microscopic features indicated that such
isolates are in fact P. eryngii var. elaeoselini. Therefore, it is not surprising that isolate
WC958 is placed in the same cluster with isolate WC999 suggesting that it belongs to the var. elaeoselini. The isozyme and RAPD analyses performed by Zervakis et al. (2001b) showed a relative affinity of var. elaeoselini especially to the var. ferulae. In the present study, however, the tree constructed from the combined data sets revealed that P. eryngii
var. elaeoselini may be more closely related to var. eryngii than to ferulae.
Varieties eryngii and ferulae appear not to be regularly mating in nature since both tef1 and RPB2 clearly differentiate both groups and tree topologies are congruent.
De Gioia et al. (2005) performed a genetic study of the P. eryngii complex based on qualitative morphological features (i.e. color of pileus and cuticle, pileus shape, stipe position and surface, etc.) and molecular markers (RAPD and minisatellite profiles). De
Gioia et al. (2005) suggest that the eryngii and ferulae groups should remain as varieties since low genetic distances (d=0.043) observed between these groups supported a categorization below the species level.
It has been demonstrated, through in vitro experiments, that individuals from different hosts retain the ability to interbreed, but hybridization and development of dikaryons produced by individuals from different ecotypes may be reduced (Cailleux et al. 1981, Zervakis and Balis 1996). Hybrids between closely related species of fungi are rarely found in nature since adaptations to substrates may generate low rates of hybrid survival (Kauserud et al. 2007). In the case of P. eryngii, it was observed in vitro and in vivo that var. eryngii is a better competitor than var. ferulae. Culture assays, where var. eryngii and ferulae were inoculated at opposite poles in a petri dish in PDA medium
85 indicated that mycelial growth of var. eryngii overcame the growth of var. ferulae
(Urbanelli et al. 2002). The spatial distribution of P. eryngii is roughly restricted and
overlaps of the ecological niches might be found. In Sicily, for example, P. eryngii var.
eryngii is found between 0 and 1,500 meters while P. eryngii var. ferulae is distributed below 1,300 m. These two varieties can be found in sympatric populations. In contrast, P. nebrodensis grows at 1,200 – 2,000 m and P. eryngii var. elaeoselini is found between 0
– 1,200 m (Venturella 2000, Zervakis et al. 2001b). Zhang et al. (2006) recently reported
that P. eryngii var. ferulae and P. nebrodensis both grow in association with F.
sinkiangensis in sympatric populations in Xinjiang, China.
The phylogenetic trees constructed in the present study suggest that a common
ancestor is shared by var. eryngii, ferulae, elaeoselini and nebrodensis. Divergence among these groups is recent since limited genetic variation exists in regions of the genome that are usually used to elucidate phylogenetic relationships between and among species. However, var. nebrodensis diverged at an earlier time from the rest of the varieties. Some phylogenetic studies on the genus Pleurotus have shown that evolution of the species is driven by geographical separation (allopatric speciation) (Vilgalys and Sun
1994, Zervakis et al. 2004). However, P. eryngii is not distributed world wide, but
confined to the Mediterranean and surrounding areas. Since not obvious geographic
barriers exist within the area of distribution of P. eryngii, it may be possible to
hypothesize that altitude is playing an important role in speciation of var. nebrodensis.
Speciation in other basidiomycetes such as Collybia dryophila, P. cystidiosus complex,
P. tuberregium, S. commune, Lentinula spp. and Grifola spp. is driven by isolation of populations by allopatry (geographic separation) (Vilgalys 1991, Thon and Royse 1999b,
86 Isikhuemhen et al. 2000, James et al. 2001, Shen et al. 2002, Zervakis et al. 2004). In the
case of P. tuberregium, for example, It was estimated that divergence of the African and
Australasian-Pacific populations occurred as consequence of the separation of the land
150 million years ago (Isikhuemhen et al. 2000). In contrast to this, the geological and climatic history of the Mediterranean area points out to a relatively recent establishment of the current scenario dates only from 5 million years ago (Blondel and Aroson 1999).
Grove and Rackman (2001) stated that the ecology in the Mediterranean is dominated by environmental alterations rather than evolution since most conditions have not existed long enough in evolutionary terms. For instance, the climate in that region has prevailed only for few thousands of years.
The phylogenetic trees constructed in this study resembles to some extent the outputs presented by Vilgalys and Sun (1994) where Pleurotus speciation follows a pattern of ancient origins in the Southern hemisphere and a recent divergence for species distributed in the Northern hemisphere. In this regards, P. dryinus and P. cystidiosus are
found in both hemispheres while P. tuberregium is distributed in the majority of the
equatorial areas of Africa, India, Sri Lanka, Southeastern Asia, Northern Australia and
Southern Pacific (Corner 1981, Pegler 1983, Singer 1986). Those three species are placed
at the base of the phylogenetic trees. The genus Pleurotus is a unique basidiomycete that
presents particularly interesting modes of speciation: allopatric and sympatric speciation.
The last is represented only by P. eryngii species complex that have developed a certain
degree of host specificity. In addition, speciation in this taxon resembles evolutionary
pathways found usually in plant pathogenic fungal species (Jimenez-Gasco et al. 2004).
Of special interest is the case of Ustilago spp., a taxa composed of plant pathogenic
87 basidiomycetes causing smuts. In this group, co-evolution of host and pathogen was suggested by Bakkeren et al. (2000).
In conclusion, according to the results obtained from this and previous research
(See appendix B for combined phylogeny based on ITS, partial β-tubulin, tef-1, and
RPB2) the author supports the idea that 1) the P. eryngii species complex is currently under a speciation process as stated by Zervakis et al. (2001b); 2) the varieties ferulae, elaeoselini and eryngii should be still considered varieties and not different species of the complex, and 3) P. eryngii var. nebrodensis should be considered a different species.
88 Chapter 5: Morphological and cultural characterization of isolates of
four varieties of Pleurotus eryngii
5.1 Introduction
The genus Pleurotus includes several edible species that are known for their
excellent flavor and for their relatively inexpensive methods of cultivation. This genus
accounts for approximately 14% of the world’s production of mushrooms, occupying
third place after Agaricus bisporus and Lentinula edodes (Chang 1999, 2006). Pleurotus
eryngii is an important edible species in the Mediterranean and Asian regions and it has
been recently introduced to The United States (Royse et al. 2005). For various reasons, P. eryngii is an exceptional candidate for cultivation. First, this mushroom is considered by many as the best flavored of all the oyster mushrooms. Other desirable characteristics include relatively long shelf life, reduced spore load and relatively high market price
(Rodriguez Estrada and Royse 2005). The high morphological diversity of P. eryngii is reflected in the consumer demand that varies substantially depending on the market and the country where the mushroom is consumed. For example, in Italy, a small, thin stipe and dark wide cap are most preferred. Consumers in Spain prefer lighter caps. However,
Chinese consumers have a preference for wide stipes (3.0 – 5.0 cm) and small caps (4.0 –
6.0 cm). In North America, Korea and Japan, wide stipes (2.0 – 5.0 cm) and caps (5.0 –
10.0 cm) are more frequently desired by consumers (Rodriguez Estrada and Royse, in press). Several cultivation methods may be adapted to produce this species. In general, four systems are commonly used: bags, casing, bottles and outdoor or semi-outdoor cultivation (Rodriguez Estrada and Royse 2008).
89 Mushroom cultivars are often derived from only a few lines and are subject to
genetic erosion (Urbanelli et al. 2007). Therefore, the identification of wild isolates and
the evaluation of commercial cultivars of P. eryngii with high productivities and
mushroom quality is essential. Hence, this study aimed to characterize and identify wild
and commercial isolates of P. eryngii that possess desirable production traits such as high
yield, biological efficiency and short production cycles. The information retrieved from
this study might be useful to select isolates for commercial cultivation or breeding
programs.
5.2 Materials and Methods
5.2.1 Pleurotus eryngii isolates
A total of 100 isolates representing four varieties (eryngii, ferulae, elaeoselini and
nebrodensis) of the P. eryngii species complex were evaluated and characterized (Table
5.1). Isolates are maintained by both periodic transfers on potato dextrose agar (PDA) in
test tube slants and by liquid nitrogen storage (-196 °C and glycerol at 10%). Cultures
used for spawn production were transferred to PDA in Petri dishes (90 mm) and
incubated for 2 weeks.
5.2.2 Spawn
Spawn carrier of Pleurotus eryngii var. eryngii (WC888) was prepared in 500 ml
flasks by autoclaving a mixture of Hesco mushroom rye grain (91 g), hardwood sawdust
(13 g) , CaSO4 (3 g) and 120 ml of warm tap water. After the ingredients cooled, five mycelial-agar plugs (5 mm diameter) were placed into the grain mixture and then
90 incubated for 1 week at room temperature. The spawn then was shaken in order to evenly distribute the mycelia on the grain. The spawn was incubated for an additional week then stored at 4°C until it was used.
Table 5.1. Species, varieties, isolate code, original source, geographic origin and host/substrate of Pleurotus eryngii used in this study.
Species Variety Isolate Original Geographic Host/substrate2 code Source1 origin2 Pe-Al1 INRA3 Entre Deux E. campestre / Pleurotus eryngii eryngii Mers, Launay, calcareous soil France Pe-Al2 INRA Agen, France Unknown Pe-Al3 INRA Provence- E. campestre Alpes-cote d’azur, France Pe-Al4 INRA Quercy, E. campestre / France limestone plateau Pe-Al5 INRA Olonne forest, E. maritimum / France Littoral of dunes Pe-Al6 INRA La sauvetat, E. campestre / France calcareous soil Pe-Al7 INRA Olonne forest E. maritimun / Littoral of dunes Pe-Al8 INRA Baie de E. maritimun / Somme, St. Litoral of dunes Valery, France Pe-Al9 INRA Causse E. campestre / Mejean, limestone plateu France Pe-Al10 INRA Causse E. campestre / Mejean, limestone plateu France Pe-Al11 INRA Causse E. campestre / Mejean, limestone France plateau Pe-Al12 INRA Causse E. campestre / Mejean, limestone plateu France Pe-Al13 INRA Causse E. campestre / Mejean, limestone plateu France Pe-Al14 INRA Crete island, Eryngium spp. / Greece Relic forest Pe-Al15 INRA Crete island, Eryngium spp. / Greece Relic forest Pe-Al16 INRA Crete island, Eryngium spp. / Greece Relic forest
91 Table 5.1. Cont.
Species Variety Isolate Source Geographic Host/substrate code origin Pe-Al17 INRA Crete island, Eryngium spp. / Greece Relic forest Pleurotus eryngii eryngii Pe-Al18 INRA Crete island, Eryngium spp. / Greece Relic forest Pe-Al19 INRA Crete island, Eryngium spp. / Greece Relic forest Pe-Al20 INRA Oleron island, E. maritimun / France Litoral of dunes Pe-Al21 INRA Oleron island, E. maritimun / France Litoral of dunes Pe-Al22 INRA Oleron island, E. maritimun / France Litoral of dunes Pe-Al30 Commercial Unknown Unknown farm, USA Pe-Al31 Commer- Unknown Unknown cial farm, USA Pe-Al32 Commer- Unknown Unknown cial farm USA Pe-Al33 Commercial Unknown Unknown farm, USA Pe-Al34 Commercial Unknown Unknown farm, USA Pe-Al35 Commercial Unknown Unknown farm, USA Pe-Al36 Commercial Unknown Unknown farm, USA Pe-Al37 Commer- Unknown Unknown cial farm WC515 PSU4 Unknown Unknown WC514 PSU Unknown Unknown WC844 South Africa Unknown Unknown WC846 PSU Unknown Unknown WC827 Russia Unknown Unknown WC845 Belgium Unknown Unknown WC888 SEFI5 Unknown Unknown, Commercial WC936 China Unknown Unknown Commercial WC937 China Unknown Unknown Commercial WC938 China Unknown Unknown Commercial WC939 China Unknown Unknown / commercial WC940 China Unknown Unknown / commercial WC941 China Unknown Unknown / commercial
92 Table 5.1. Cont.
Species Variety Isolate Source Geographic Host/substrate code origin WC942 China Unknown Unknown / commercial Pleurotus eryngii eryngii WC943 China Unknown Unknown / commercial WC944 China Unknown Unknown / commercial WC945 U. Bari6 Bari, Italy Unknown WC946 U. Bari Brindisi, Italy Unknown WC947 U. Bari Lecce, Italy Unknown WC948 U. Bari Taranto, Italy Unknown WC950 U. Bari N/A Unknown WC952 U. Bari Brindisi, Italy Unknown WC957 U. Bari Sicily, Italy Unknown WC959 NIAST7 Unknown Unknown / commercial WC960 NIAST Unknown Unknown / commercial WC961 NIAST Unknown Unknown / commercial WC963 NIAST Unknown Unknown / commercial WC964 NIAST Unknown Unknown / commercial WC965 IBAF8 Sicily, Italty Unknown WC967 IBAF Italy Unknown / commercial WC968 IBAF Italy Unknown / commercial WC969 IBAF Sardegna, Italy Unknown WC972 IBAF Italy Unknown / commercal WC973 IBAF Italy Unknown / commercial WC974 IBAF Unknown Unknown / commercial WC984 Somycel / Unknown Unknown / IBAF commercial WC985 IBAF Puglia, Italy Unknown WC986 IBAF Matera, Italy Unknown WC987 Ital-Spawn Italy Unknown / commercial WC989 Ital-Spawn Italy Unknown / commercial WC925 U. Haifa9 Golan, Israel Ferula sp. Pleurotus eryngii ferulae WC926 U. Haifa Tabor Mt., Ferula sp. Israel WC927 U. Haifa Menahemya, Ferula sp. Israel
93
Table 5.1. Cont.
Species Variety Isolate Source Geographic Host/substrate code origin WC928 U. Haifa Gilboa Mt., Ferula sp. Pleurotus eryngii ferulae Tel-Bet Shean, Israel WC929 U. Haifa Gilboa Mt., Ferula sp. Israel WC930 U. Haifa Sataf, Israel Ferula sp. WC931 U. Haifa Zorah, Israel Ferula sp. WC932 U. Haifa Har’el, Israel Ferula sp. WC933 U. Haifa Gevaot Merar, Ferula sp. Israel WC934 U. Haifa Amazya- Ferula sp. Lachish, Israel WC935 U. Haifa Lahav-Devira, Ferula sp. Israel WC949 U. Bari Sicily, Italy Unknown WC951 U. Bari Bari, Italy Unknown WC953 U. Bari Foggia, Italy Unknown WC954 U. Bari Taranto, Italy Unknown WC955 U. Bari Sicily, Italy Unknown WC956 U. Bari Bari, Italy Unknown WC966 IBAF Sardegna, Italy Unknown WC970 IBAF Puglia, Italy Unknown WC975 IBAF Puglia, Italy Unknown WC981 IBAF Sicily, Italy Unknown WC982 IBAF Sardegna, Italy Unknown WC983 IBAF Sardegna, Italy Unknown WC976 IBAF Sicily, Italy Unknown Pleurotus eryngii nebrodensis WC977 IBAF Sicily, Italy Unknown WC978 IBAF Sicily, Italy Unknown WC979 IBAF Sicily, Italy Unknown WC980 IBAF Sicily, Italy Unknown * WC958 U. Bari Italy Unknown Pleurotus eryngii elaeoselini WC999 U. Palermo10 Unknown Unknown
1 Original source refers to the immediate isolate supplier. 2 Geographic origin and host/substrate refers to the place and conditions where the isolates were found in the wild. Commercial usage of the isolates is specified under host/substrate. 3 INRA – National Institute of Agronomic Research, MYCSA (Mycology and Food Security), Villenave D’Ornon, France. 4 PSU – The Pennsylvania State University, Mushroom Culture Collection, University Park, PA USA. 5 SEFI – Shanghai Edible Fungi Institute, Shanghai, China. 6 U. Bari – University of Bari, Department of Biology and Plant Pathology, Bari, Italy. 7 NIAST- National Institute of Agricultural Science and Technology, Suwon, Korea. 8 IBAF – Institute of Biology, Agro-environment and Forestry, Rome, Italy. 9 U. Haifa – University of Haifa, Institute of Evolution, HAI Culture Collection, Haifa, Israel. 10U. Palermo – University of Palermo, Department of Botany, Sicily, Italy. * This isolate was misidentified according to the results obtained in molecular studies. This isolate should be named P. eryngii var. elaeoselini.
94 5.2.3 Substrate preparation and cultivation conditions
Isolates were grown on sterilized substrate composed of the following ingredients: cottonseed hulls (56%), sawdust (27%), ground soybean (12%), corn distillers (4%), and calcium sulfate (1%). Dry ingredients were mixed for 2 minutes in a paddle mixer at the
Mushroom Research Center (MRC), PSU. Water was added to the substrate to reach a moisture content of 60%. The wetted substrate was subsequently mixed for 5 additional minutes. The substrate was transferred to a bottle-filling machine (See Rodriguez Estrada
2005 for details). Eight replicates (bottles) were used per isolate. Bottles were placed in plastic trays (16 bottles per tray) and sterilized for 90 min at 121°C. After cooling, the bottles were weighed and the values recorded. Bottles were inoculated with 6.4 g (± 1 g) of grain spawn and then transferred to an incubation room (9 m2) at the MRC. The
substrate was incubated at 21ºC with a light/dark cycle of 8 h light/16 h dark using cool-
white fluorescent lights. After incubation, 2 mm of the colonized substrate and aerial
mycelium was removed with a scratching machine. The bottles were moved to a
production room where 15 ml of tap water was added to the exposed substrate for each
bottle. A perforated plastic sheet (holes 7 mm in diameter, separated by 44 mm x 94 mm
space) was placed on top of the bottles in order to minimize desiccation. The production
room was maintained at a relative humidity of 90%, temperature of 16ºC and a light/dark
cycle of 8 h light/16 h dark. The plastic cover was removed after the primordia had
enlarged enough to reach the plastic.
95 5.2.4 Isolate evaluation
Basidiomata were harvested when the largest basidioma in each bottle was fully mature and the pileus and margin were flat (stage 6 according to Rodriguez Estrada and
Royse 2006). Isolates were characterized according to performance and morphological
characteristics as follows:
Performance
1. Yield
Total fresh mushroom weight (g) per bottle
2. Biological efficiency (BE)
Weight of fresh basidiomata per bottle (g) / Weigh of dry substrate per bottle
(g) x 100
3. Number of mushrooms
Per bottle
4. Mushroom size
Small (4 – 21.2 g), medium (21.3 – 42.3 g) and large (42.4 g and up)
(according to Rodriguez Estrada and Royse 2007)
5. Producers vs. non-producers
Production refers to the capacity and timeframe of generation of basidiomata.
Isolates that did not produce mature basidiomata were classified as “non
producers” (Fig. 5.2, 5.3, 5.4 and 5.5). Isolates that produced mushrooms in
less than 4 bottles (out of 8) were categorized as “poor producers”. Isolates that
produced basidiomata in 4 or more bottles were characterized as “good
producers”. Good producers then were classified as early, mid or late producers
96 according to the number of days that elapsed from surface scratching to
harvesting (Fig. 5.1).
Early producers Non-producers 12 – 16 days 0%
Mid producers Good producers 17 – 21 days Poor producers
≤ 4 units Late producers ≤ 50% 22 – 26 days
Fig. 5.1. Classification of Pleurotus eryngii isolates according to the number of days from scratching to harvest. Isolates that were able to produce basidiomata in 5 of 8 or more bottles were considered good producers.
Fig. 5.2. Isolate WC956 was classified as a Fig. 5.3. Isolate WC949 was classified as a non-producer. The mycelium completely non-producer. The mycelium completely colonized the substrate but produced only a colonized the substrate but never produced few tiny primordia (arrows) that never primordia. developed into mature basidiomata.
97
Fig. 5.4. Isolate WC931 was classified as Fig. 5.5. Isolate WC955 was classified as a non-producer. In a few bottles, pins were non-producer. Mycelium completely colo- formed and grew until they reached 3 cm in nized the substrate where pins formed but height. Pins never developed into mature never developed into mature basidiomata. basidiomata.
Morphological characteristics
1. Color
L-value (lightness) was measured with a chromameter Minolta. For each
isolate, seven basidiomata were arbitrarily selected for color evaluations. Three
measurements were taken for each pileus and stipe. Subsequently, a total of 21
measurements were available per isolate. Preliminary data of the L-values were
collected for the isolates grown in Crops 1, 2 and 3. Distribution of the L-
values for pileus and stipe are shown in Figure 5.6 a and b. Ranges for pileus
color were broader (45–94) than ranges for stipe (69–96). Therefore, three
categories were determined for pileus: light, medium and dark. These
categories were delimited by fractioning the raw data in 33.3 and 66.6%
quantiles. Two categories, light and dark, were established for the L-values
98 collected from the stipe. In this way, boundaries for each group were based in
the 50% quantile. The cumulative distribution function in Minitab (version
14.0) was used to determine the ranges for each category (Fig. 5.6 c and d,
Table 5.2).
120 140
a 120 b F 100 r e 100 q 80 u 80 e 60 60 n c 40 40 y 20 20
0 0 48 56 64 72 80 88 72 76 80 84 88 92 96 L-values for pileus L-values for stipe
100 100 c d P 80 80 e r 66.6 c 60 60 e 50 n 40 40 t 33.3 20 20
0 0 91.39 70.76 76.76 40 50 60 70 80 90 100 70 75 80 85 90 95 100 L-values for pileus L-valuesSt ifor stipe
Fig. 5.6. Distribution and cumulative distribution frequencies for L-values of the pileus and stipe from mushrooms collected from Crops 1, 2 and 3. a. Histogram showing the distribution of L- values for pileus (749 measurements). b. Histogram showing the distribution of L-values for stipe (743 measurements). c. Cumulative distribution of L-values for pileus. The 33.3 and 66.6 % quantiles were used to delimit ranges for color categories. d. Cumulative distribution of L-values for stipes. The 50% quantile was used to delimit ranges for color categories.
99 Table 5.2. Color categories and ranges for pilei and stipes based on data collected from isolates grown in Crops 1, 2 and 3.
Pileus Stipe
L-values Category L-value Category
45.26 – 70.76 Dark 69.23 – 91.39 Dark
70.77 – 76.76 Medium 91.40 – 96.19 Bright 76.77 – 93.97 Bright
2. Stipe-pileus ratio: Diameter of the widest portion of the stipe divided by the
pileus diameter.
5.2.5 Statistical analysis
Isolates used in this work were received from several research institutions at
different times for a period of approximately one year. Therefore, isolates were grown as
they were received by our laboratory. A total of four crops were produced independently but under the conditions specified above (Table 5.3). A control isolate (WC888) was always included in each crop. Statistical analysis for yield, biological efficiency and number of mushrooms was performed independently for each crop. The analysis of variance (ANOVA) and mean separation (Tukey-Kramer Honestly Significant Difference
P<0.05 test) was carried out using the JMP software version 7.0. Isolate WC999 was
received after completion of the four crops. Therefore, it was not included in the
evaluations.
100 Table 5.3. Crops and isolates used to evaluate production and morphological characteristics of four varieties (eryngii, ferulae, elaeoselini and nebrodensis) of Pleurotus eryngii produced on substrate contained in bottles at the Mushroom Research Center at The Pennsylvania State University
Crop 1a Crop 2a Crop 3a Crop 4a WC888 WC888 WC888 WC888 Pe-Al1 Pe-Al35 WC945 WC972 Pe-Al2 Pe-Al36 WC946 WC970 Pe-Al3 Pe-Al37 WC947 WC983 Pe-Al4 WC930 WC948 WC966 Pe-Al5 WC932 WC949 WC984 Pe-Al6 WC934 WC950 WC985 Pe-Al7 WC926 WC951 WC977 Pe-Al8 WC927 WC952 WC978 Pe-Al9 WC933 WC953 WC981 Pe-Al10 WC931 WC954 WC965 Pe-Al11 WC925 WC955 WC982 Pe-Al12 WC929 WC956 WC976 Pe-Al13 WC935 WC957 WC969 Pe-Al14 WC928 WC958 WC979 Pe-Al15 WC936 WC960 WC968 Pe-Al16 WC938 WC961 WC980 Pe-Al17 WC939 WC937 WC975 Pe-Al18 WC940 WC986 Pe-Al19 WC941 WC973 Pe-Al20 WC942 WC974 Pe-Al21 WC943 WC967 Pe-Al22 WC944 WC989 WC514 Pe-Al32 WC987 WC515 Pe-Al33 WC964 WC827 Pe-Al34 WC959 WC844 WC963 WC845 WC846 Pe-Al30 Pe-Al31 31 26 18 27 TOTAL aSee Table 1 for isolate source and geographic origin.
101 5.3 Results
Significant differences (P<0.05) were found for yield, BE and number of
mushrooms in the four crops. Averages for yield, biological efficiency and number of
mushrooms per bottle for each isolate are shown in Tables 5.4, 5.5, 5.6, and 5.7.
Classification of isolates accordingly to their production cycle, including isolates that did
not produce basidiomata, is presented in Table 5.8. Information regarding color, stipe-
pileus ratio, size of the mushrooms, production length and a photograph of the
basidiomata for each isolate are presented in Tables 5.8, 5.9, 5.10, 5.11 and 5.12. Five
out of 23 isolates of P. eryngii var. ferulae produced basidiomata. In all cases, the isolates
(WC954, WC981, WC983, WC970, and WC966) were categorized as poor, late or very
late producers (Tables 5.12 and 5.13). Only 1 out of 5 isolates of P. eryngii var.
nebrodensis (WC979) produced basidiomata under these experimental conditions and
this isolate was categorized as a late producer. Isolate WC958 was originally classified as
var. nebrodensis. In fact, the color of the basidiomata is white, which is generally
associated with var. nebrodensis (Fig. 5.7 b and c). However, phylogenetic placement of
this isolate based on combined data of tef1 and RPB2 genes indicates that it belongs to the variety elaeoselini. Morphogenesis of WC958 was unique in that primordia formed from the mycelium surface as thin and elongate projections with a flatted tip (see Fig. 5.7 a). Primordia for the eryngii varieties always formed as short, broad projections with a rounded tip (Fig. 5.7 d). In WC958, 2 to 4 primordia elongated until they reached a height of 4 - 5 cm. At that point, growth stopped and only one primordium developed into a mature basidioma. A second elaeoselini isolate (WC999) also was able to produce
102 basidiomata on only two bottles of substrate (Table 5.12). In contrast, most P. eryngii
var. eryngii isolates (51 out of 69) were able to produce mature basidiomata.
Isolates varied substantially in morphology and performance traits. Biological
efficiencies ranged from 8.3 to 80.3%. The highest BEs were found for isolates that were
designated as “commercial” in origin. However, isolates WC957 and WC973 yielded similar to the control cultivar (WC888). Moreover, both wild isolates produced more than
3 mushrooms per bottle and were categorized as early and medium producers,
respectively. Isolates that were categorized as late and very late producers had low BEs
(<35%), with the exception of isolate WC984, a late producer with a 42.7% BE. As
previously mentioned, consumer preferences vary substantially so it is difficult to
establish parameters that may described a good or excellent commercial cultivar.
However, isolates with high BEs and categories of early and mid producer are the most
desirable for growers. It is also important to keep in mind that isolate performance may
also vary in relation to cultivation environments. Isolate WC888, for example, had BEs
ranging from 50 to 80% across the four crops, indicating certain degree of deviation in
isolate performance as result of non-controlled variables.
103
Table 5.4. Yield, biological efficiency (BE) and number of mushrooms produced by 16 isolates of Pleurotus eryngii var. eryngii (Crop 1).
Isolate Yielda BE (%)a No. Mush.a Pe-Al31 123.5 a 60.2 a 2.1 ab WC888 101.9 ab 48.8 ab 1.3 abcd Pe-Al30 91.0 abc 42.7 abc 1.3 abcd Pe-Al14 89.0 abc 41.8 abc 2.0 abc Pe-Al20 75.1 abcd 36.2 abcd 1.6 abcd WC515 75.4 abcd 36.0 abcd 2.9 a Pe-Al6 60.5 bcd 28.9 bcd 2.1 ab WC846 58.0 bcd 27.2 bcd 1.5 abcd Pe-Al19 54.4 bcd 25.5 bcd 2.8 a WC514 43.0 bcd 21.1 bcd 1.0 bcd PeAl-9 39.0 cd 18.7 cd 1.5 abcd WC844 24.8 d 11.3 d 0.3 d WC845 20.4 d 10.0 d 0.6 bcd Pe-Al3 19.3 d 9.1 d 0.4 cd WC827 17.5 d 8.3 d 0.4 cd a Values followed by different letters are significantly different according to the Tukey Kramer Honestly Significant Difference test (P<0.05).
104
Table 5.5. Yield, biological efficiency (BE) and number of mushrooms produced by 15 isolates of Pleurotus eryngii var. eryngii (Crop 2).
Isolate Yielda BEa No. Mush.a WC944 133.3 a 63.9 a 3.3 abc WC888 130.2 a 62.3 a 2.0 bcd WC938 127.4 a 61.7 a 2.0 bcd Pe-Al34 124.7 ab 60.2 a 2.5 bcd Pe-Al35 121.4 ab 59.6 a 2.5 bcd Pe-Al33 120.2 ab 58.3 ab 1.9 bcd Pe-Al36 119.2 ab 57.4 ab 1.4 cd Pe-Al32 119.8 ab 57.2 ab 2.0 bcd WC942 118.2 abc 57.1 ab 5.3 a WC939 114.9 abc 54.5 abc 2.5 bcd Pe-Al37 112.2 abc 53.8 abc 1.4 cd WC943 110.3 abc 53.3 abc 3.9 ab WC941 94.0 bc 45.1 bc 5.0 a WC940 87.0 c 41.8 c 4.9 a WC936 49.3 d 23.7 d 1.1 d a Values followed by different letters are significantly different according to the Tukey Kramer Honestly Significant Difference test (P<0.05).
105
Table 5.6. Yield, biological efficiency (BE) and number of mushrooms produced by 11 isolates of Pleurotus eryngii var. eryngii and one P. eryngii var. elaeoselini (Crop 3).
Isolate Yielda BEa No. Mush.a WC888 151.6 a 71.1 a 1.8 bcd WC937 137.3 ab 63.1 ab 1.9 bcd WC957 130.2 abc 58.5 abc 3.4 ab WC947 103.6 bcd 47.3 bcd 2.9 bcd WC946 97.9 cd 45.5 cd 2.0 bcd WC960 94.8 cd 43.7 cd 2.0 bcd WC952 89.1 d 40.9 d 5.0 a WC945 79.9 de 36.5 d 1.3 d WC948 78.3 de 36.0 de 3.1 bc WC961 75.8 de 35.4 de 1.7 bcd WC958b 69.3 de 31.7 de 1.3 d WC950 45.2 e 20.3 e 1.5 cd a Values followed by different letters are significantly different according to the Tukey Kramer Honestly Significant Difference test (P<0.05). b Pleurotus eryngii var. elaeoselini.
106
Table 5.7. Yield, biological efficiency (BE) and number of mushrooms produced by 13 isolates of Pleurotus eryngii var. eryngii and 3 isolates of P. eryngii var. ferulae (Crop 4).
Isolate Yielda BEa No. Mush.a WC888 171.0 a 80.3 a 3.5 a WC964 130.0 ab 61.5 ab 4.5 a WC973 124.1 ab 58.2 ab 3.9 a WC963 121.8 b 57.8 ab 2.6 abcd WC984 91.3 bc 42.7 bc 3.1 ab WC968 84.8 bc 40.7 bc 3.1 ab WC970b 69.4 cd 32.6 cd 1.1 bcd WC959 67.6 cd 31.9 cd 3.0 ab WC987 66.0 cd 31.4 cd 3.3 ab WC967 64.1 cd 30.1 cd 2.8 abcd WC989 59.5 cd 28.2 cd 2.4 abcd WC972 58.5 cd 27.5 cd 3.5 a WC986 54.0 cd 25.6 cd 2.5 abcd WC974 53.4 cd 25.7 cd 2.9 abc WC981b 48.6 cd 23.2 cd 0.6 d WC983b 32.9 d 15.4 d 0.8 cd a Values followed by different letters are significantly different according to the Tukey Kramer Honestly Significant Difference test (P<0.05). b Pleurotus eryngii var. ferulae.
107
a b
c d
Fig. 5.7. Primordial and mature stages of isolate WC958 and primordial stage of isolate WC888. a. Isolate WC958. Narrow and elongated primordia with flat immature pileus. b and c Mature basidiomata of isolate WC958 and d. Isolate WC888 showing broad and short primordia with round immature pilei.
108 Table 5.8. Isolates classified according to their basidiomata production capacity and to the length of the production cycle (from scratching to harvest).
Good producersc Non- Poor Early Mid Late Very late producera producerb producersd producere producerf producerg
Crop 1 Crop 1 Crop 1 Crop1 Crop 1 Crop 4 Pe-Al1 Pe-Al3 Pe-Al20 Pe-Al6 Pe-Al9 WC970 Pe-Al2 WC827 Pe-Al31 Pe-Al14 WC846 WC981 Pe-Al4 WC844 Pe-Al19 WC989 Pe-Al5 WC845 Crop 2 WC514 Crop 3 Pe-Al7 WC888 WC515 WC958 Pe-Al8 Crop 3 Pe-Al32 Pe-Al30 Pe-Al10 WC954 Pe-Al33 Crop2 Crop 4 Pe-Al11 Pe-Al35 Pe-Al34 WC972 Pe-Al12 Crop 4 Pe-Al36 WC936 WC983 Pe-Al13 WC966 Pe-Al37 WC984 Pe-Al15 WC979 WC938 Crop 3 WC986 Pe-Al16 WC939 WC945 WC974 Pe-Al17 WC940 WC950 WC967 Pe-Al18 WC941 WC952 WC987 Pe-Al21 WC942 WC960 WC959 Pe-Al22 WC943 WC961 WC944 Crop 2 Crop 4 WC930 Crop 3 WC968 WC932 WC937 WC973 WC934 WC946 WC964 WC926 WC947 WC927 WC957 WC933 WC948 WC931 WC925 Crop 4 WC929 WC963 WC935 WC888 WC928
Crop 3 WC949 WC951 WC953 WC955 WC956
Crop 4 WC985 WC977 WC978 WC965
109 Table 5.8. Cont.
Good producersc Non- Poor Early Mid Late Severe late producera producerb producerd producere producerf producerg WC982 WC976 WC969 WC980 WC975 Total (%) 41 7 21 16 11 3 41.4 7.1 21.2 16.2 11.1 3.0
a Non-producers: Isolates not developing mature basidiomata. b Poor producers: Isolates that produced basidiomata in four or less bottles. c Good producers: Isolates that produced mushrooms in 5 or more bottles. Category further divided into early, medium and late producers according to the number of days that elapsed from scratching to harvest. d Early producers: basidiomata harvested 12 – 16 days after scratching. e Mid producers: basidiomata harvested between 17 – 21 days after scratching. f Late producers: basidiomata harvested between 22 – 26 days after scratching. g Severe late producer: basidiomata harvested 26 days after scratching. * Colors represent different crops.
110 Table 5.9. Productivity, stipe/cap ratio, mushroom sizea and color of basidiomata for isolates of Pleurotus eryngii grown in Crop 1. Isolates were produced on a cottonseed hull-based substrate.
Isolate/ Photo Production Mushroom Color variety type sizea
Pe-Al31 Producer: Early Large: 70.6% Pileus: eryngii Yield: 123.5 g Medium: 23.5% Medium
BE: 60.2% Small: 5.9% Stipe: Light
No. mushrooms: 0.4 0.5 0.6 0.5 0.5 0.7 2.1
Pe-Al20 Producer: Early Large: 43% Pileus: eryngii Yield: 75.1 g Medium: 36% Medium
BE: 36.2% Small: 21% Stipe: Dark
No. mushrooms: 0.5 0.5 0.5 0.5 0.4 0.4 1.6
Pe-Al30 Producer: Mid Large: 90% Pileus: eryngii Yield: 91.0 g Medium: 0% Medium
BE: 42.7 Small: 10% Stipe: Dark
No. mushrooms: 0.6 0.5 1.3
WC514 Producer: Mid Large: 37.5% Pileus: eryngii Yield: 43.0 g Medium: 50% Medium
BE: 21.1% Small: 12.5% Stipe: Dark
No. mushrooms: 1 0.6 0.4 0.7 0.5 0.8 0.5
111 Table 5.9. Cont.
Isolate/ Photo Production Mushroom Color variety type sizea
WC515 Producer: Mid Large: 17.4% Pileus: eryngii Yield: 75.4 g Medium: 39.1% Dark
BE: 36.0% Small: 43.5% Stipe: Dark
No. mushrooms: 0.5 0.4 0.4 0.4 0.4 0.4 0.4 2.9
Pe-Al14 Producer: Mid Large: 50.0% Pileus: eryngii Yield: 89 g Medium: 18.8% Medium
BE: 41.8% Small: 31.2% Stipe: Dark
No. mushrooms: 2
0.5 0.4 0.5 0.5 0.4 0.4
WC844 Producer: Poor Not applicable Pileus: eryngii Yield: 24.8 g Medium
BE: 11.3% Stipe: Bright No. mushrooms: <1 0.6
Pe-Al19 Producer: Mid Large: 5.6% Pileus: eryngii Yield: 54.4 g Medium: 33.3% Dark
BE: 25.5% Small: 61.1% Stipe: Dark
0.5 0.6 0.5 0.5 0.5 0.5 No. mushrooms: 2.8
WC827 Producer: Poor Not applicable Pileus: eryngii Yield: 17.5 g Medium
BE: 8.3% Stipe: Bright No. mushrooms: 0.6 0.6 0.4
112 Table 5.9. Cont.
Isolate/ Photo Production Mushroom Color variety type sizea
PE-Al6 Producer: Mid Large: 17.6% Pileus: eryngii Yield: 60.5 g Medium: 53% Bright
BE: 28.9% Small: 29.4% Stipe: Bright No. mushrooms: 0.4 0.4 0.4 0.5 0.4 0.3 2.1
Pe-Al3 Producer: Poor Not applicable Pileus: eryngii Yield: 19.3 g Dark
BE: 9.1% Stipe: Dark
No. mushrooms: 0.6 0.7 0.8 0.4
WC846 Producer: Late Large: 37.5% Pileus: eryngii Yield: 58.0 g Medium: 37.5% Bright
BE: 27.2% Small: 25% Stipe: Bright No. mushrooms: 0.3 0.4 0.3 0.4 1.5
WC845 Producer: Poor Not applicable Not eryngii Yield: 20.4 g available
BE: 10%
No. mushrooms:
0.4 0.5 0.6
113 Table 5.9 Cont.
Isolate/ Photo Production Mushroom Color variety type sizea
Pe-Al9
eryngii Producer: Late Large: 16.7% Pileus: Yield: 39.0 g Medium: 50% Dark
BE: 18.7% Small: 33.3% Stipe: Dark
No. mushrooms:
0.4 0.5 0.4 0.4 0.4 1.5
WC888
Producer: Early Large: 69.2% Pileus: eryngii Yield: 127.9 g Medium: 23.1% Dark
BE: 60.7% Small: 7.7% Stipe: Dark
No. mushrooms: 0.4 0.4 0.4 0.5 0.5 1.7 a Mushroom size is based on mushroom weight: small (4 – 21.2 g), medium (21.3 – 42.3 g), and large (42.4 g and up).
114 Table 5.10. Productivity, stipe/cap ratio, mushroom size and color of basidiomata for isolates of Pleurotus eryngii grown in Crop 2. Isolates were produced on a cottonseed hull-based substrate.
Isolate/ Photo Production Mushroom Color variety type sizea
WC943 Producer: Early Large: 19.4% Pileus: eryngii Yield: 110.6 g Medium: 25.8% Bright
BE: 53.3% Small: 54.8% Stipe: Bright No. mushrooms: 0.6 0.5 0.7 0.5 0.6 3.9
WC944 Producer: Early Large: 42.3% Pileus: eryngii Yield: 133.3 g Medium: 23.1% Medium
BE: 63.9% Small: 34.6% Stipe: Bright No. mushrooms: 0.4 0.5 0.4 3.3
WC940 Producer: Early Large: 2.4% Pileus: eryngii Yield: 87.0 g Medium: 23.8% Bright
BE: 41.8% Small: 73.8% Stipe: Bright No. mushrooms:
0.4 0.4 0.4 0.6 0.4 4.9
WC941 Producer: Early Large: 7.5% Pileus: eryngii Yield: 94 g Medium: 25% Medium
BE: 45.1% Small: 67.5% Stipe: Bright No. mushrooms: 0.7 0.9 0.8 0.6 0.6 5.0
115 Table 5.10. Cont.
Isolate/ Photo Production Mushroom Color variety type sizea
Pe-Al36 Producer: Early Large: 69.2% Pileus: eryngii Yield: 119.2 g Medium: 23.1% Medium
BE: 57.4% Small: 7.7% Stipe: Dark
No. mushrooms: 0.5 0.4 0.5 0.6 1.6
WC942 Producer: Early Large: 14.3% Pileus: eryngii Yield: 118.2 g Medium: 23.8% Medium
BE: 57.1% Small: 61.9% Stipe: Bright No. mushrooms: 0.7 0.7 0.6 0.8 0.8 0.8 5.3
Pe-Al33 Producer: Early Large: 80% Pileus: eryngii Yield: 120.2 g Medium: 13.3% Medium
BE: 58.3% Small: 6.7% Stipe: Dark
No. mushrooms: 0.5 0.4 0.4 0.4 1.9
Pe-Al37 Producer: Early Large: 72.72% Pileus: eryngii Yield: 112.2 g Medium: 0% Dark
BE: 53.8% Small: 27.3% Stipe: Dark
No. mushrooms: 0.5 0.4 0.4 0.5 1.4
116 Table 5.10. Cont.
Isolate/ Photo Production Mushroom Color variety type sizea
Pe-Al35 Producer: Early Large: 35% Pileus: eryngii Yield: 121.4 g Medium: 35% Dark
BE: 59.6% Small: 30% Stipe: Bright No. mushrooms: 0.5 0.6 0.4 0.5 0.5 2.5
Pe-Al32 Producer: Early Large: 68.8% Pileus: eryngii Yield: 119.8 g Medium: 12.5% Medium
BE: 57.2% Small: 18.7% Stipe: Dark
No. mushrooms: 2 0.6 0.5 0.5 0.5 0.5
WC939 Producer: Early Large: 55% Pileus: eryngii Yield: 114.9 g Medium: 30% Medium
BE: 54.5% Small: 15% Stipe: Bright 0.5 0.5 0.4 0.3 0.6 0.4 No. mushrooms: 2.5
Pe-Al34 Producer: Mid Large: 75% Pileus: eryngii Yield: 124.7 g Medium: 6.3% Medium
Stipe: Dark BE: 60.2% Small: 18.7% No. mushrooms: 0.4 0.5 0.5 0.4 0.5 2.5
117 Table 5.10. Cont.
Isolate/ Photo Production Mushroom Color variety type sizea
WC936 Producer: Mid Large: 44.4% Pileus: eryngii Yield: 49.3 g Medium: 55.5% Medium
BE: 23.7% Small: 0% Stipe: Dark
No. mushrooms: 0.4 0.5 0.6 0.4 0.4 0.7 1.1
WC938 (Picture not available) Producer: Early Large: 56.2% Pileus: eryngii Yield: 127.4 g Medium: 25% Medium
BE: 61.7% Small: 18.8% Stipe: Bright No. mushrooms: 2.0 a Mushroom size is based on mushroom weight: small (4 – 21.2 g), medium (21.3 – 42.3 g), and large (42.4 g and up).
118 Table 5.11. Productivity, stipe/cap ratio, mushroom size and color of basidiomata for isolates of Pleurotus eryngii grown in Crop 3. Isolates were produced on a cottonseed hull-based substrate.
Isolate/ Photo Production Mushroom Color variety type sizea
WC948 Producer: Early Large: 12% Pileus: eryngii Yield: 78.3 g Medium: 44% Dark
BE: 36% Small: 44% Stipe: Bright 0.4 0.6 0.4 0.4 0.4 0.4 No. mushrooms: 3.1
WC946 Producer: Early Large: 68.7% Pileus: eryngii Yield: 97.9 g Medium: 6.3% Medium
BE: 45.5% Small: 25% Stipe: Dark
No. mushrooms: 2 0.4 0.4 0.5 0.4 0.4
WC937 Producer: Early Large: 73.4% Pileus: eryngii Yield: 137.3 g Medium: 13.3% Medium
BE: 63.1% Small: 13.3% Stipe: Dark
No. mushrooms: 0.7 0.5 0.4 0.5 1.9
WC957 Producer: Early Large: 33.3% Pileus: eryngii Yield: 130.2 g Medium: 40.8% Medium
BE: 58.5% Small: 25.9% Stipe: Bright No. mushrooms: 0.6 0.5 0.4 0.5 0.4 0.4 3.4
119 Table 5.11. Cont.
Isolate/ Photo Production Mushroom Color variety type sizea
WC952 Producer: Mid Large: 7.5% Pileus: Dark eryngii Yield: 89.1 g Medium: 27.5% BE: 40.9% Small: 65% Stipe: Bright No. mushrooms: 5 0.4 0.4 0.4
WC950 Producer: Mid Large: 8.4% Pileus: eryngii Yield: 45.2 g Medium: 58.3% Dark
BE: 20.3% Small: 33.3% Stipe: Dark
No. mushrooms: 0.3 0.4 0.3 0.4 1.5
WC945 Producer: Mid Large: 80% Pileus: eryngii Yield: 36.5 g Medium: 20% Dark
BE: 79.9% Small: 0% Stipe: Dark
No. mushrooms: 0.6 0.4 0.4 0.4 0.4 0.5 1.3
WC947 Producer: Early Large: 30.4% Pileus:
eryngii Yield: 103.2 g Medium: 39.2% Dark BE: 47.3% Small: 30.4% Stipe: Bight
No. mushrooms: 0.4 0.3 0.3 0.3 0.4 0.4 2.9
120 Table 5.11. Cont.
Isolate/ Photo Production Mushroom Color variety type sizea
WC961 Large: 58.3% Pileus: Producer: Mid Medium: 33.3% Medium eryngii Yield: 66.3g Small: 8.4% Stipe: Dark BE: 31.0%
0.4 0.4 0.5 0.4 0.3 No. mushrooms: 1.5
WC960 Producer: Mid Large: 56.3% Pileus: eryngii Yield: 94.8 g Medium: 18.7% Medium
BE: 43.7% Small: 25% Stipe: Dark
0.3 0.3 0.3 0.3 0.3 0.3 No. mushrooms: 2
WC958 Producer: Late Large: 70% Pileus: elaeo- Yield: 69.3 g Medium: 30% Bright selini BE: 31.7% Small: 0% Stipe: Dark 0.3 0.4 0.2 0.2 0.3 0.2 No. mushrooms: 0.3 0.4 0.3 0.4 1.3
WC954 Producer: Poor Not applicable Not ferulae Yield: 3.1 g available
BE: 1.4%
No. mushrooms: 0.2 0.2 0.3 a Mushroom size is based on mushroom weight: small (4 – 21.2 g), medium (21.3 – 42.3 g), and large (42.4 g and up).
121 Table 5.12. Productivity, stipe/cap ratio, mushroom size and color of basidiomata for isolates grown in Crop 4. Isolates were produced on a cottonseed hull-based substrate.
Isolate/ Photo Production Mushroom Color variety type sizea
WC963 Large: 33.3% Pileus: Producer: Early Dark Medium: 23.8% eryngii Yield: 121.8 g Stipe: Dark Small: 42.9% BE: 57.8%
0.5 0.4 0.4 0.3 0.3 No. mushrooms: 2.6
WC968 Producer: Mid Large: 12.5% Pileus: eryngii Yield: 84.8g Medium: 33.3% Dark
BE: 40.7% Small: 54.2% Stipe: Bright 0.5 0.7 0.6 No. mushrooms: 3.1
WC967 Producer: Late Large: 30% Pileus: eryngii Yield: 64.1 g Medium: 25% Dark
BE: 30.1% Small: 45% Stipe: Dark
No. mushrooms: 0.4 0.4 0.4 0.2 0.3 2.4
WC989 Producer: Very Large: 15.8% Pileus: eryngii late Medium: 36.8% Medium
Yield: 59.5 g Small: 47.4% Stipe: Bright BE: 28.2% 0.3 0.4 0.4 0.4 0.3 No .mushrooms 2.4
122 Table 5.12. Cont.
Isolate/ Photo Production Mushroom Color variety type sizea
WC964 Producer: Mid Large: 27.8% Pileus: eryngii Yield: 130.0 g Medium: 33.3% Dark
BE: 61.5% Small: 38.9% Stipe: Dark
0.3 0.4 0.3 0.4 0.3 No. mushrooms: 4.5
WC973 Producer: Mid Large: 19.3% Pileus: eryngii Yield: 124.1 g Medium: 48.4% Dark
BE: 58.2% Small: 32.3% Stipe: Bright No. mushrooms: 0.6 0.5 0.5 0.6 0.5 3.9
WC984 Producer: Late Large: 20% Pileus: eryngii Yield: 91.3 g Medium: 40% Dark
BE: 42.7% Small: 40% Stipe: Dark
0.4 0.5 0.6 0.5 0.4 No. mushrooms: 3.1
WC972 Producer: Late Large: 3.6% Pileus: eryngii Yield: 58.5 g Medium: 25% Dark
BE: 27.5% Small: 71.4% Stipe: Bright 0.3 0.3 0.3 0.3 0.3 No. mushrooms: 3.5
123 Table 5.12. Cont.
Isolate/ Photo Production Mushroom Color variety type sizea
WC981 Producer: Very Large: 80% Pileus: ferulae late Medium: 20% Medium
Yield: 48.6 g Small: 0% Stipe: Dark
BE: 23.3% 0.2 0.3 No. mushrooms: 0.6
WC987 Producer: Late Large: 3.8% Pileus: eryngii Yield: 66.0 g Medium: 30.8% Dark
BE: 31.4% Small: 65.4% Stipe: Dark
No. mushrooms: 0.3 0.4 0.3 3.3
WC986 Producer: Late Large: 5.0% Pileus: eryngii Yield: 54 g Medium: 45% Dark
BE: 25.6% Small: 50% Stipe: Bright 0.4 0.4 0.3 0.3 0.3 No. mushrooms: 2.5
WC959 Producer: Late Large: 16.7% Pileus: eryngii Yield: 67.6 g Medium: 12.5% Dark
BE: 31.9% Small: 70.83% Stipe: Bright No. mushrooms: 3 0.4 0.4
124 Table 5.12. Cont.
Isolate/ Photo Production Mushroom Color variety type sizea
WC974 Producer: Late Large: 8.7% Pileus:
eryngii Yield: 53.4 g Medium: 30.4% Dark
BE: 25.7% Small: 60.9% Stipe: Dark
No. mushrooms: 0.4 0.3 0.4 0.3 0.4 2.9
WC983 Producer: Late Large: 50% Pileus:
ferulae Yield: 32.9 g Medium: 33.3% Dark
BE: 15.4% Small: 16.7% Stipe: Bright No. mushrooms: 0.4 0.5 0.4 0.5 0.8
WC970 Producer: Very Large: 77.8% Pileus: ferulae late Medium: 11.1% Bright
Yield: 69.4 g Small: 11.1% Stipe: Bright BE: 32.6% 0.3 0.4 No. mushrooms: 1.1
WC966 Producer: Poor Not applicable Pileus: ferulae Yield: 13 g Bright
BE: 5.9% Stipe: Dark
No. mushrooms: 0.3 0.2 0.3
125 Table 5.12 Cont.
Isolate/ Photo Production Mushroom Color variety type sizea
WC979 Producer: Poor Not applicable Pileus: nebro- Yield: 4.25 g Bright densis BE: 1.9% Stipe: Dark
0.2 No. mushrooms: 0.1
WC999 Not applicable Not applicable Not elaeose- available lini
a Mushroom size is based on mushroom weight: small (4 – 21.2 g), medium (21.3 – 42.3 g), and large (42.4 g and up).
5.4 Discussion
The morphology and production condition requirements among members of the
P. eryngii species complex vary enormously. Different methods of cultivation for a single
variety (i.e. P. eryngii var. eryngii) have been developed, and adaptations to specific
conditions existing in different mushroom farms are very common. However, culture conditions that are conducive for mushroom production of P. eryngii var. eryngii may not be optimum for mushroom production of the other varieties. For example, the major differences between var. nebrodensis and eryngii are air temperature fluctuations and the volume of the substrate used for production. Tan et al. (2005) report that mycelial
126 colonization of the substrate by var. nebrodensis should be conducted within a range of
25-28ºC and primordia formation should be induced by dropping the temperatures to 10-
15ºC. However, Kang (2004) states that pinning in var. nebrodensis may be induced by placing the colonized substrate in cold rooms at temperatures close to 0ºC. On the other hand, mycelial colonization and primordia formation in the var. eryngii may be carried out at 23-25ºC and 12-15ºC, respectively (Tan et al. 2005). However, if mushrooms are grown in bags that remain closed, a milder change in temperature (16-19ºC) is enough to induce primordia formation. Pleurotus eryngii var. nebrodensis is grown in bags containing 500 to 1000 g of moist substrate, while the var. eryngii may be grown in bags containing up to 2.5 kg substrate (Kang 2004, Shen et al. 2005, Tan et al. 2005). Within this study, the culture conditions utilized were optimized for P. eryngii var. eryngii. This may be the primary reason why 78% and 80% of the ferulae and nebrodensis isolates failed to produce basidiomata, respectively.
The fact that P. eryngii, a facultative biotroph, can be grown without the presence of the host is intriguing. It is clear that differences in adaptation to production conditions are easily overcome by the var. eryngii. Biology of the host-fungus interactions have not been studied in detail. Urbanelli et al. (2002) observed that mycelium of the var. eryngii tends to colonize the substrate faster than var. ferulae. Although mycelial growth rates were not evaluated in the present study, it was observed that the mycelium of the var. ferulae and nebrodensis was able to entirely colonize the sterilized substrate. Therefore, failure of the isolates to produce mature mushrooms is related to primordium formation and maturation of the basidiomata and not to inadequate mycelial colonization. Grenetti
(1987) evaluated the stimulating effect of ferulic acid on mycelial growth rates for P.
127 eryngii, P. ferulae and P. nebrodensis. Ferulic acid is a phenolic compound that is a constituent of lignocellulose found in plant cell walls. Grenetti (1987) determined that higher concentrations of ferulic acid were needed to promote higher growth rates in P. ferulae and P. nebrodensis (8 x 103 M/l) compared to the amounts needed for P. eryngii
(2 x 103 M/l). Therefore, Grenetti suggested that variation in the ferulic acid quantities present in the specific host may be important to the specificity of the host-fungus interaction. Ubanelli et al. (2007) suggested that the host-fungus interactions may be dependant upon diversity of laccase and manganese peroxidase genes among the varieties
(Urbanelli et al. 2007). Laccase and manganese peroxidase enzymes are involved in substrate degradation, but there are many other enzymes that are essential for primordia formation and mushroom development that have not been studied. The genome of P. ostreatus is currently being sequenced by an international group of researchers from 19
Research Centers and Universities from Japan, Europe, Canada, Israel and the United
States (Elhuyar Fundazioa 2006). The information retrieved from that project might open numerous opportunities to explore the biology and physiology not only of P. ostreatus but also other basidiomycetes. In the particular case of P. eryngii, the physiology and specificity of the host-fungus interaction might be studied in more depth. Once the mechanisms of host specify and morphogenesis are revealed and understood, cultivation techniques may be improved and adapted for this species.
Besides the obvious necessity to develop production methods adapted to commercial scale production, a search and evaluation of wild isolates that may be useful to farmers is highly desirable. Research efforts are currently underway, especially in the
Mediterranean and Asian countries, to select and breed isolates of P. eryngii for high
128 yields and improved mushroom quality (Peng et al. 2001, Zervakis and Venturella 2002).
A first step in the development of new cultivars is to carefully characterize the existent
available genotypes. High yields and BEs and short production cycles are among the most desirable features for selection. Morphological characteristics also are important, but these are dependent on consumer demands that vary from country to country. For example, isolates WC967 and WC972 were received as commercial isolates from IBAF
(Institute of Biology, Agro-environment and Forestry), Italy. Pilei of this isolates are dark and stipes are narrow in relation to their pileus (pileus/stipe ratio 0.2-0.4). Isolate WC967 performed poorly attaining a BE of 30.1% and being a late producer. Isolate WC972 also had low BE (27.5%) and it fitted in the late producer category. On the other hand, isolate
WC952 has similar characteristics to WC967 and WC972 (i.e. dark pileus and pileus/stipe ratio of 0.4). However, isolate WC952 has the advantage of being a mid producer reaching BEs of 41%, and producing an average of 5 mushrooms per bottle.
Therefore, this isolate might be successfully used at commercial scale in Italy. WC947 with BEs of 47%, dark pileus, and pileus/stipe ratio of 0.3-0.4 is an early producer and also a good candidate.
In the present research, characterization of wild and commercial isolates of P. eryngii was performed. Cultural and morphological information collected in these experimental crops may be of great importance to growers interested in commercially producing this species. Also, breeders, selecting isolates with desirable morphological and cultural characteristics, may benefit from the information provided here.
129 Chapter 6: Enhancement of the antioxidants ergothioneine and selenium in Pleurotus eryngii var. eryngii basidiomata through cultural
practices
6.1 Introduction
Mushrooms have powerful antioxidant properties derived from compounds such as selenium (Se), ergothioneine (ERGO), and phenolics. Selenium is an essential micronutrient in humans being important in health because it is part of the antioxidant enzymes called selenoproteins. These proteins aid in the prevention of cellular damage caused by free radicals. The Recommended Daily Allowance (RDA) of Se established by the Institute of Medicine is 55 µg for the adult population, 60 µg for pregnant females and 70 µg for breast-feeding females. Studies have shown that oral intakes of 200 μg/day of Se (Se-enriched yeast) might reduce the risk of colorectal, lung and prostate cancer in humans (Combs et al. 1997). Tolerable Upper Intake Levels (UL) of Se in adults is 400
μg/day (IOM 2000). Se is found in plants, meats, seafood and nuts (ODS 2004). For instance, a serving size (28.3 g) of Brazilian nuts would provide 544 μg of Se, while a serving size of drained tuna (85 g) and cooked beef (99.2 g) would provide 63 μg and 35
μg of Se, respectively. Main sources of Se in the United States population are obtained from meats and grain products (Pennington and Young 1991, Pennington and Schoen
1996). ERGO is a thiol compound, a natural antioxidant of biological origin. In animals,
ERGO provides several physiological benefits such as enhancement of the metabolic energy, protection against formation of cataracts, molecular regulation of the anti- inflamatory mechanism in lungs, etc. (Shukla et al. 1981, Kawano et al. 1982, Rahman et
130 al. 2003). Although ERGO is found in fungi, animals and plants, synthesis of ERGO in
nature is restricted to fungi and Mycobacterium (Melville et al. 1956, Genghof and Van
Damme 1964, Hartman 1990, Akanmu et al. 1991). However, ERGO synthesized by
those organisms is taken by plants from the soil and then passed to animals and humans
where it accumulates at different concentrations in tissues and blood (Melville 1958).
Ergothioneine concentration in natural foods varies enormously. Ey and colleagues
(2007) analyzed several foods finding that Boletus edulis and Pleurotus ostreatus had the
highest concentration (528.1 and 118.9 mg/kg wet weight, respectively). Chicken and
pork liver, pork kidney and black turtle beans followed in the list with 10.8, 8.7, 7.7 and
13.5 mg/kg (w. w.), respectively. Synthetic forms of ERGO available in the marketplace
are extremely expensive (Dubost et al. 2007a).
In recent years, general concerns regarding human health issues have promoted
consumption of foods or supplements rich in antioxidants. Therefore, research efforts
have focused on developing cost-efficient synthetic or natural production of antioxidants
readily available in the human diet. Lately, mushroom scientists have focused their
efforts on enhancement of ERGO and Se concentration in edible and medicinal species of
mushroom-forming fungi. ERGO- and Se- enriched mushrooms may be used as
components in functional foods or as dietary supplements (Werner and Beelman 2002,
Beelman and Royse 2006, Dubost et al. 2007a).
Selenium: Boletus edulis is one of the edible mushrooms that contain the highest
amounts of natural Se (up to 20 μg/g of dry weight; Stijve 1977). Wild Agaricus spp.
contain ca. 2.7 μg/g Se while Pleurotus cornucopiae and Grifola frondosa less than 0.5
μg/g (Piepponen et al. 1983, Beelman and Royse 2006). Some studies have found that
131 supplementation of the substrate with Se compounds results in an increase of the element in the mycelium and basidiomata (Werner and Beelman 2002, Stajic et al. 2005, Beelman and Royse 2006). Werner and Beelman (2002) demonstrated that Se was absorbed and accumulated by A. bisporus basidiomata when the substrate was supplemented with aqueous solutions of sodium selenite (Na2SeO3) at different concentrations. The authors found that Se uptake by A. bisporus basidiomata was linearly related to concentration in the compost. Beelman and Royse (2006) demonstrated Se enrichment of P. cornucopiae and G. frondosa, but the former species accumulated Se better than the latter. For P. eryngii, Se accumulation was examined only during the vegetative mycelial stage by
Stajic et al. 2005. Those authors evaluated Se absorption by mycelium when the element was added to the growing media as sodium selenite (Na2SeO3), sodium selenate
(Na2SeO4) and selenium dioxide (SeO2.). Of the three compounds, sodium selenite was the best source of Se since it was easily absorbed and accumulated in mycelia.
Ergothioneine: Few research efforts have been devoted to ERGO enhancement in mushrooms, but the most comprehensive work to date was conducted by Dubost et al.
(2006, 2007a). Those authors determined ERGO content in several edible mushrooms including A. bisporus, G. frondosa, Lentinula edodes, P. eryngii, and P. ostreatus. White or brown strains of A. bisporus contained considerably less ERGO (0.4 – 0.7 mg/g d.w.) than the specialty species (P. eryngii, G. frondosa, P. ostreatus and L. edodes with 1.7,
1.8, 2.0 and 2.1 mg/g dry weight, respectively) (Dubost et al. 2006). ERGO content of A. bisporus basidiomata was evaluated in response to substrate supplementation and cultural practices by Dubost and colleagues (2007a). Supplementation of substrate with protein- rich corn-gluten and amino acids (methionine, cysteine and histidine) did not affect the
132 ERGO content in the basidiomata with the exception of histidine. Supplementation of the
substrate with 5, 10 and 15 ppm histidine increased ERGO content in mushrooms during
the second and third flushes. Fragmentation of colonized compost at casing and lower
moisture content of substrate improved ERGO content in the mushrooms. It was also
demonstrated that ERGO increased from 1st to 3rd flushes (Dubost et al. 2007a).
The aim of this study was to enhance concentration of Se and ERGO in basidiomata of P. eryngii var. eryngii by modifying cultural practices used for
commercial production of this species. Se concentration in basidiomata was enhanced by
supplementation of substrates with sodium selenite. On the other hand, substrate moisture
content, substrate fragmentation, histidine supplementation and use of a casing layer were evaluated in an attempt to enhance ERGO concentration in basidiomata.
6.2 Materials and Methods
6.2.1 Spawn
Grain spawn of a commercial isolate of P. eryngii var. eryngii (WC-888) was prepared with 91 g mushroom rye grain (Hesco, Watertown, ND), 13 g hardwood sawdust, 3 g CaSO4, and 120 ml warm tap water. The ingredients were placed in 500 ml
flasks and autoclaved for 45 minutes at 121°C. Upon cooling, the grain was inoculated
with five mycelial agar plugs (5 mm diameter). Spawn was incubated at room
temperature for one week and then shaken to redistribute partially colonized grain.
Spawn was incubated for an additional week, and then shaken again before storage at 4°C
until use.
133 6.2.2 Substrate preparation, inoculation and incubation
Mushrooms were produced on sterilized substrate composed of the following ingredients: cottonseed hulls (56%), corn distiller’s waste (4%), calcium sulfate (1%), ground soybean (12%) and oak sawdust (27%). The dry weight of each component of the substrate, with the exception of CaSO4, was determined in triplicate with an Ohaus
moisture analyzer (model MB35). Quantities of ingredients were adjusted to meet the
desired percentages. Dry ingredients were mixed for two minutes with a paddle mixer at
the Mushroom Research Center (MRC). Warm tap water (ca 40°C) was added to the
substrate to reach the target moisture content (55 or 60%). After the substrate was packed
into either bags or bottles, it was autoclaved for 90 min at 121°C. Cooled substrate was
inoculated with grain spawn and transferred to an incubation room (9 m2) at the MRC.
The substrate was incubated at 21ºC with a cycle of 8 h light/16 h dark using cool-white fluorescent bulbs. Final moisture content of substrates for each treatment was determined in triplicate with an Ohaus moisture analyzer (model MB35).
6.2.3 Selenium supplementation (Crop 1)
A completely randomized design was used to evaluate the effects of supplementation on concentration of Se in P. eryngii basidiomata. Two levels of anhydrous sodium selenite (Na2SeO3) were added to the production substrate (5 and 10
μg/g of dry substrate weight, see appendix C section a for calculations). Na2SeO3 was
dissolved in warm tap water prior to addition to the substrate and subsequently mixed for
10 minutes. Polypropylene (PP) bottles (1050 ml capacity, 9 cm diameter x 15.5 cm
deep) were used as containers. Bottles (8 per treatment) were filled with a machine that
134 automatically stopped substrate flow when the container was full. Then, holes (top to bottom) were made with a rotating metallic shaft and residual substrate was removed mechanically from the neck of the bottles. Bottles were capped manually with PP lids containing a filter. After autoclaving and cooling, the substrate was inoculated with 6.4 g
(± 0.1 g) grain spawn placed into each hole. Following incubation for 27 days, 2 mm of the colonized substrate and aerial mycelium was removed with a scratching machine. The bottles were then transferred to a production room (RH 90%, 16ºC and 8 h light/16 h dark) where tap water (ca 15 ml) was sprayed onto the exposed substrate in each bottle. A perforated plastic sheet (holes 7 mm diameter, spaced 44 mm x 94 mm) was placed on top of the bottles to prevent desiccation. Mushrooms were harvested when the largest mushroom in each bottle reached maturity (approximately 42 days after inoculation).
Two mushrooms harvested from one bottle comprised one replicate. Two replicates were obtained per treatment. Mushrooms were chopped, freeze dried (48 hours), ground to a fine powder, placed in sample bags (20 g), and stored in a glass desiccator as described in the sample preparation section (6.2.6). Substrate samples were obtained prior to sterilization and processed in the same manner. Substrates and mushroom powders were analyzed for nitrogen, minerals and Se.
6.2.4 ERGO concentration as response to moisture content (Crop 2) and
fragmentation of the substrate (Crop 3)
Two crops were carried out in order to investigate factors that might influence
ERGO concentration in the basidiomata. Crop 2 was designed to determine the influence of two moisture contents (55 and 60%) in the substrate packed in PP bottles. Substrates
135 were prepared, inoculated and incubated as explained in section 6.2.2. Crop 3 examined
the influence of substrate fragmentation on ERGO concentration of the basidiomata
produced on substrate incubated in PP bags and then fragmented and transferred to
plastic bins (60% moisture of the substrate). Three treatments were included in Crop 3: 1)
substrate contained in bags without fragmentation, 2) substrate contained in bags during
incubation and subsequently fragmented and transferred to plastic bins, and 3) same as
treatment 2 with addition of a casing layer after substrate fragmentation (Table 6.1).
Polypropylene bags (20 cm x 48.5 cm) with medium porosity filters (Unicorn Import and
Manufacturing, Commerce, TX) were used as containers. Each bag (4 bags/treatment)
was filled with 2.5 kg moist substrate. The substrate contained in bags was autoclaved for
90 min at 121°C. After overnight cooling, substrates were inoculated with 30 g grain
spawn, thoroughly mixed, and then the bags were heat-sealed. After incubation (27 days),
Table 6.1. Description of treatments to evaluate the influence of substrate fragmentation on ERGO concentration of Pleurotus eryngii var. eryngii basidiomata.
Treatment Container Substrate Substrate per Moisture unit (kg w.w.) Primordium induction content (%) 1. Bagsa PP bags 60 2.5 Bags closed until primordia formed 2. Binsb Plastic bins 60 2.5 Fragmentation 3. Cased Substrate Plastic bins 60 2.5 Fragmentation and in Binsc casing a Mycelium was incubated and mushrooms produced in PP bags. Substrate was not fragmented. b Mycelium was incubated in PP bags. After incubation, bags were removed and the substrate fragmented and placed in plastic bins for fruiting. c Mycelium was incubated in PP bags. After incubation, bags were removed, the substrate fragmented, placed in PE bins and cased for fructification.
136 bags were transferred to a production room. Bags for treatment 1 (Fig. 6.1 b) remained
unopened until primordia formed (approximately 6 days after transfer to the production
room). However, bags for treatments 2 and 3 were immediately opened; the substrate was
manually fragmented and placed into 6.1 L plastic bins (33 cm long x 18.5 cm wide x 12
cm deep). Bins that remained uncased (Fig. 6.1c) were covered with a plastic sheet that
was removed after primordia formation. Cased substrates (Fig. 6.1d) were covered with 1
kg of casing soil (2:1 d.w. peat moss and calcium carbonate at 78.7% moisture). The
production room was maintained at a relative humidity of 90%, temperature 16ºC, and a
light cycle of 8 h light/16 h dark. Mushrooms were harvested (approximately 40 days after inoculation) for a period of 2 to 3 days, since mushrooms matured at slightly different times. Fresh mushrooms were chopped, weighed, freeze dried, ground to fine power and stored in sample bags for ERGO analysis (see sample preparation and ERGO analysis below). Three whole mushrooms, obtained from one experimental unit, made up one replicate. Three replicates were obtained per treatment.
6.2.5 Influence of moisture content, histidine supplementation and use of a
casing layer on ERGO concentration (Crop 4)
Crop 4 was designed as a 2 x 2 x 2 factorial with four replicates per treatment
(Table 6.2). Three factors were evaluated at two levels: 1) moisture content of the substrate (55 and 60%), 2) histidine supplementation (0 and 10 mM), and 3) casing layer
(cased and uncased bags). Histidine (C6H9N3O2, Sigma Chemical Co.) was dissolved in
warm tap water prior to addition to the substrate (10 mM w. w., see appendix C, section b for calculations). The substrate was packed in PP bags with medium porosity filters (2.5
137
a b
c d
Fig. 6.1. Pleurotus eryngii var. eryngii growing from substrate contained in different containers. a. Bottles . Plastic sheet was removed to allow development of the primordia to mature basidiomata. b. Bags. After formation of primordia, bags were opened to allow development into mature basidiomata. Substrate remained undisturbed. c. Uncased bins. Completely colonized substrate was removed from the bags. After manual fragmentation of the substrate, it was placed into plastic bins and covered with a plastic sheet. After primordia formation, the plastic sheet was removed to allow development into mature basidiomata. d. Cased bins. Substrate was treated as in c, but 1 kg of casing layer was placed on the exposed substrate surface.
kg per bag) and then sterilized for 90 minutes at 121ºC. After overnight cooling, the substrate was inoculated with 30 g of grain spawn, thoroughly mixed, and the bags heat-
sealed. Bags for uncased treatments (1, 3, 5 and 7) remained closed until primordia were
formed. Bags for treatments 2, 4, 6 and 8 were opened (25 days after spawning) and
138 Table 6.2. Experimental parameters used to quantify ERGO concentration in Pleurotus eryngii var. eryngii basidiomata as a response to histidine supplementation, moisture content of the substrate, and use of a casing layer. Polypropylene bags with medium porosity patches were used to hold 2.5 kg of moist substrate.
Histidine Substrate moisture a b c Treatment supplementation content Casing (mM) (%) 1. NC55H10 10 55 No 2. C55H10 10 55 Yes 3. NC60H10 10 60 No 4. C60H10 10 60 Yes 5. NC55 0 56 No 6. C55 0 56 Yes 7. NC60 0 61 No 8. C60 0 61 Yes
a NC55H10: non-cased, 55% moisture and 10 mM histidine supplementation; C55H10: cased, 55% moisture and 10 mM histidine supplementation; NC60H10: non-cased, 60% moisture and 10 mM histidine supplementation; C60H10: cased, 60% moisture and 10 mM histidine supplementation; NC55: non-cased and 55% moisture; C55: cased and 55% moisture; NC60: non-cased and 60% moisture; C60: cased and 60% moisture. b Based on wet weight c Moisture content achieved in the substrate
cased with 550 g of casing soil composed of peat moss and calcium carbonate (2:1 d.w.)
(Fig. 6.2). Mushrooms were harvested, chopped, weighed, freeze dried, ground and bagged in sample bags (~20 g). Samples were stored in a desiccator at room temperature for less than one week prior to quantification of ERGO.
139
Fig. 6.2. Pleurotus eryngii var. eryngii growing on cased and non-cased substrate. Cotton seed hulls-based substrate (2.5 kg) was incubated for 25 days in polypropylene bags. After colonization, bags were opened and cased with 550 g of casing soil. Non- cased bags remained closed until primordia were formed.
6.2.6 Sample preparation and solids
Fresh, whole, mature mushrooms were weighed, chopped (10 – 15 mm3 cubes), placed in polystyrene weight boats, and frozen at -80ºC for 24 hours in a ThermoForma freezer (model 721). Mushrooms then were freeze-dried (lyophilizer model 15 SRC-X;
Virtis Genesis Co., Gardiner, NY) for 48 hours. Freeze-dried mushrooms were transferred to new weight boats and weighed immediately to minimize moisture absorption. Percentage of solids in basidiomata was calculated by dividing dry and fresh mushroom weight and multiplying the result by 100. Dry tissue was ground in a food processor and then sieved through a mesh screen (size 16; 1.18 mm, Fisher Scientific
Co.). Mushroom powders (~20 g) were placed in sample bags and stored at room temperature in a glass desiccator until they were analyzed (Dubost et al. 2006). Substrate samples obtained for chemical analyses of minerals and Se were prepared in the same manner.
140 6.2.7 Selenium, nitrogen, mineral and ERGO analyses
Chemical analyses for Se, nitrogen and minerals [potassium (K), calcium (Ca), magnesium (Mg), manganese (Mn), iron (Fe), copper (Cu), boron (B), aluminum (Al), zinc (Zn) and sodium (Na)] were performed at the Pennsylvania State University
Agricultural Analytical Laboratory. For Se determination, mushroom and substrate powders were digested with nitric acid (HNO3), and then subject to inductively coupled
plasma-atomic emission spectrometry (ICP-MS) according to the Environmental
Protection Agency protocols 3051A and 6010 (USEPA 1986). Mineral determination was
performed following the dry ash method through atomic emission spectroscopy (Miller
1998). Nitrogen quantification was performed by the flash combustion procedure
(Horneck and Miller 1998). ERGO analyses were performed in the Department of Food
Science at PSU following Dubost et al. (2006) protocols. Bagged mushroom powders
were stored in a desiccator for a maximum of eight days before ERGO was quantified.
ERGO was extracted from 1 g of freeze-dried sample with an HPLC grade ethanol
solution (10 mM dithiotreitol, 100 μM betaine, 100 μM 2-mercapto-1-methyl-imidazole).
Quantifications were performed with an HPLC 600E system controller (Waters Corp.,
Milford, CT). Two Econosphere C18 columns (Alltech Associates, Deerfield, IL)
connected in tandem were used for sample separation and detection was performed
through a UV-VIS 490E detector at 254 nm wavelength. Protocols and methods were as
described by Dubost et al. (2006).
141 6.2.8 Estimation of solids, Se and ERGO
Estimates for total solids, Se and ERGO produced per bottle or bag (growing units) and ERGO per kg of dry substrate were calculated with formulas 1, 2 and 3.
(1) Solids per unit (g) = solids/basidioma (%) x mushroom fresh weight (g) 100
(2) Se (μg) or ERGO (mg) per unit = solids/unit (g) x Se (μg/g) or ERGO/mush (mg/g)
(3) ERGO (mg) per kg of dry substrate = ERGO/bag x 1 kg of dry substrate Dry substrate (kg)
Where:
Unit: Refers to bottles or bags
Fresh weight: Yield (g) per growing unit
Mush: Refers to the individual measurements obtained from a sample of two or
three mushrooms
Se or ERGO per unit: Quantities of Se or ERGO obtained from mushrooms
grown in ca. 500 g (bottles) or 2.5 kg (bags) substrate
ERGO/bag: Obtained from formula 2 (estimation of ERGO per growing unit)
Dry substrate: Oven dry weight
142 6.2.9 Production performance
Yield, biological efficiency (BE) and number of mushrooms were determined for
each crop. Yield is expressed as fresh mushroom weight (g) per bottle, bag or bin.
Biological efficiency is the ratio of fresh mushroom weight to substrate dry weight
expressed as a percentage.
Production length was determined in Crops 2, 3 and 4. Production length is the
number of days elapsed from inoculation to harvest. Mushrooms produced in bottles
(Crop 2) were harvested in one day. However, mushrooms grown in bags or bins were
typically harvested within 2 to 4 days (Crop 3 and 4). In the latter case, the mean point
between the first and last day of harvest was used to quantify production length.
6.2.10 Statistical analyses
Analyses of variance and mean separation were performed with the SAS
statistical software program JMP® (version 7, 2007). A one-way analysis of variance
(ANOVA) was used to examine yield, biological efficiency, number of mushrooms,
production length, Se, and ERGO concentration in the completely randomized
experiments where only one factor was evaluated at a time (Crops 1, 2 and 3). A two-way
analysis of variance for the two-level factorial experiment (Crop 4) was performed by the
standard least squares procedure. The individual sources of variation (casing, histidine
and substrate moisture) and their interactions where included in the model. Mean
separation was performed using the Tukey-Kramer Honestly Significant Difference
(HSD) test. The statistical software program Minitab (version 14, 2003) was used to
143 construct a correlation matrix based on Pearson coefficients among ERGO (basidioma
and bag), solids (basidioma and bags), substrate moisture and yield in Crop 4.
6.3 Results
6.3.1 Selenium concentration in basidiomata
Supplementation of substrate with sodium selenite significantly enhanced Se content in basidiomata. Selenium concentration in mushrooms harvested from non- supplemented substrates was below the detection level (<1.5 μg/g), while Se concentrations in mushrooms harvested from substrates containing 5 and 10 μg/g of Se addition were 4.6 and 9.3 μg/g, respectively (Table 6.3). Therefore, a serving size of raw mushrooms (85 g) produced from substrates enriched with Se at 5 ppm would provide
49.3 μg of a 60 μg RDA (Beelman and Royse 2006). Mushrooms grown on substrates supplemented at 10 ppm would provide 81.4 μg of Se, representing 135.7% of the RDA
(Table 6.3). A significant correlation (r=0.982) was observed between Se concentration in the substrate and Se content in the basidiomata (Fig. 6.3). Nitrogen and mineral contents in substrate and basidiomata are presented in Table 6.4 (see Appendix D for raw data).
Selenium supplementation affected yield, BE and solids (%). However, variations in these responses were not harmful when compared to the non-supplemented treatment
(Table 6.5). For example, yield and BE in treatment Se10ppm were comparable to the non-supplemented treatment. The percentage of solids in basidiomata was significantly lower in treatment Se10ppm (10.3%). Solids in Se0ppm and Se5ppm were 12.4 and
12.6%, respectively. The lower solids in basidiomata for treatment Se10ppm may be due to slightly lower moisture and substrate availability and by the influence of Se. Substrate
144 wet weights were highest for Se0ppm (526.8 g) and lowest for Se10ppm (487.1 g) (Table
6.6). However, estimated amounts of Se produced per bottle were still considerably higher for Se10ppm (134.2 μg) than for Se5ppm (74.4 μg) (Table 6.3).
Table 6.3. Selenium concentration in substrate, Pleurotus eryngii var. eryngii basidiomata, Se produced per bottle, per serving size of raw mushrooms (85 g) and percentage of the RDA (Recommended Dietary Allowances).
Se in Se in Se/bottleb Se in a RDAd Treatment substrate basidiomata servingc μg/g (d.w.)f μg/g (d.w.)f μg μg (%) Se0ppma < 1.5 c < 1.5 c 26.94 N/Ae N/Ae
Se5ppm 8.1 b 4.6 b 74.41 49.3 82.2 Se10ppm 14.4 a 9.3 a 134.20 81.4 135.7
a Control. b Estimated values. c Se in a serving (85 g) of fresh mushrooms. Amounts were calculated from solids content. d Recommended Dietary Allowance (RDA) of Se is 60 μg. e N/A: Not applicable. f Means followed by different letters indicates significant differences according to the Tukey- Kramer HSD test (P<0.05).
Scatterplot of Se/mushroom vs Se in substrate
10 Pearson correlation coefficient = 0.982 9
8
7
6
5
4 Se/mushroom (ppm) 3 Fig. 6.3. Scatter plot showing a 2 significant positive correlation 1 between Se concentration in the 0 42 6 8 10 12 14 16 Se in substrate (ppm) substrates and Se content in P. eryngii var. eryngii basidiomata.
145
Table 6.4. Mineral and nitrogen content in basal and supplemented substrate (sodium selenite) and Pleurotus eryngii var. eryngii basidiomata. Substrates were supplemented with Na2SeO3 to reach concentrations of 5 and 10 μg/g (ppm) Se.
Elementa,b N P K Ca Mg Mn Fe Cu B Al Zn Na
Substrate %c μg/g Se0ppmd 1.90 0.21 0.89 0.44 0.14 44 65.5 6.5 15.0 22.0 20.5 200.0 Se5ppm 2.11 0.22 0.91 0.46 0.14 43 68.5 8.0 16.0 25.5 19.0 239.5 Se10ppm 2.08 0.22 0.96 0.52 0.15 46 59.5 11.0 16.5 21.0 23.5 207.5
Basidiomata Se0ppm 3.36 0.70 1.91 0.0020 0.10 5.0 24.5 6.0 21.5 1.0 50.5 117.0 Se5ppm 3.51 0.68 1.84 0.0065 0.10 6.5 26.0 5.5 17.0 1.5 55.5 128.5 Se10ppm 4.14 0.76 2.06 0.0040 0.11 7.0 28.0 5.0 13.5 1.0 66.5 150.5 a Nitrogen (N), phosphorus (P), potassium (K), cailcium (Ca), magnesium (Mg), manganese (Mn), iron (Fe), copper (Cu), boron (B), aluminum (Al), zinc (Zn), sodium (Na) b Values are averages obtained from two replicates c Percentage dry weight d Non-supplemented substrate (control)
146 Table 6.5. Effects and mean comparisons (Tukey-Kramer HSD test) for yield, BE, number of mushrooms and solids of Pleurotus eryngii var. eryngii as affected by supplementation of substrate with sodium selenite.
Yielda,c BEa,c Numbera,c Solidsb,c Treatment (g/bottle) (%) Mushrooms (%) Se (0 ppm) 144.9 ± 9.1 a 68.7 ± 3.9 ab 4.3 ± 1.8 12.4 ± 0.1 a Se (5 ppm) 128.4 ± 10.5 b 65.1 ± 5.7 b 3.1 ± 2.2 12.6 ± 0.4 a Se (10 ppm) 140.1 ± 9.2 ab 71.9 ± 4.7 a 3.0 ± 0.9 10.3 ± 0.4 b
a Based on eight replicates per treatment b Based on two replicates per treatment c Means followed by different letters indicates significant differences according to the Tukey -Kramer HSD test (P<0.05).
Table 6.6. Weights of moist and dry substrates contained per polypropylene bottle (1050 ml) in Crop 1.
Substrate/unit Substrate/unit Treatment wet weightb,d dry weightc,d (g) (g) Se0ppma 526.8 ± 7.1 a 210.7 ± 2.8 a Se5ppm 493.3 ± 11.7 b 197.3 ± 4.7 b Se10ppm 487.1 ± 10.6 b 194.8 ± 4.1 b
a Control b Average wet substrate weights packed per bottle c Average calculated dry substrate weights packed per bottle d Means followed by different letters indicates significant dif- ferences according to the Tukey-Kramer HSD test (P<0.05).
6.3.2 ERGO and mushroom production as influenced by moisture content
(Crop 2) and fragmentation of substrate (Crop 3)
Moisture content of substrate - Crop 2: Moisture content of substrate was 56% for the low-moisture treatment and 60% for the high-moisture treatment. On average, one PP
147 bottle held 455 g of 56%-moisture substrate and 523 g of 60%-moisture substrate. ERGO concentration in mushrooms was significantly influenced by moisture content of the substrate. ERGO concentration in basidiomata produced on low-moisture substrate was significantly higher than mushrooms harvested from the high-moisture substrate, reaching concentrations of 2.57 and 2.21 mg/g, respectively (Table 6.7). Conversely, yield, BE, number of mushrooms and production cycle length were significantly higher for the 60%-moisture treatment (Table 6.8).
Fragmentation of substrate – Crop 3: Effects of fragmentation of substrate on
ERGO concentration in basidiomata are shown in Table 6.7. ERGO concentration in mushrooms grown in fragmented (bins and cased bins) and non-fragmented (bags) substrate was not statistically significant ranging from 2.04 to 2.20 mg/g of the dry weight.
Table 6.7. Effects of moisture content (Crop 2) and fragmentation of the substrate (Crop 3) on ERGO concentration in one commercial isolate of Pleurotus eryngii var. eryngii basidiomata.
ERGOa,b Treatment ERGOa Treatment mg/g d.w. mg/g d.w. Bags 2.20 ± 0.21 Bottle 55% 2.57 ± 0.22 a
Bins 2.18 ± 0.24
Bottle 60% 2.21 ± 0.10 b Cased Bins 2.04 ± 0.23
a Based on eight replicates per treatment. b Means followed by different letters indicates significant differences according to the Tukey-Kramer HSD test (P<0.05).
148 Table 6.8. Effects of substrate moisture content (Crop 2) on yield, BE, number of mushrooms, and production cycle length for one isolate of Pleurotus eryngii var. eryngii.
Yielda,c BEa,c Number Production Treatment (gr/bottle) (%) Mushroomsa,c cycle length a,b,c (days) Bottle 55% 102.8 ± 14.1 b 51.3 ± 6.5 b 2.3 ± 0.9 b 41.7 ± 0.8 b Bottle 60% 148.3 ± 11.4 a 70.9 ± 5.7 a 4.3 ± 1.5 a 43.1 ± 0.7 a
a Based on twelve replicates. b Number of days from inoculation to harvest. c Means followed by different letters indicates significant differences according to the Tukey- Kramer HSD test (P<0.05).
Yield and BE obtained from bags, bins and cased bins were not statistically
different (Table 6.9). However, number of mushrooms, solids and production cycle
length were significantly different among treatments. Number of mushrooms produced per bag averaged 24, the highest among the treatments. Cased bins produced 13 mushrooms/bag, the least among treatments. Non-cased bins produced an average of 15 mushrooms/bin. The lowest amounts of solids per basidiomata were found in mushrooms grown in substrate contained in cased bins (8.7%). In contrast, the non-cased treatments
(bags and bins) produced mushrooms with 12-13% solids. The shortest production cycle length was obtained for mushrooms produced from bags (37 days after spawning).
Harvest of mushrooms from cased substrate was significantly delayed by two days in comparison to the uncased substrate (Table 6.9).
149 Table 6.9. Effects of substrate fragmentation (Crop 3) on yield, BE, number of mushrooms, solids, and production cycle length for one isolate of Pleurotus eryngii var. eryngii.
Yielda BEa Number Solidsb,d Production Treatment (g/unit) (%) Mushroomsa,d (%) cycle a,c,d Length Bag 631.3 ± 37.1 63.1 ± 3.7 23.7 ± 1.2 a 12.3 ± 1.2 a 37.0 ± 0.0 c Bins 512.8 ± 96.3 51.3 ± 9.6 15.0 ± 5.9 ab 12.6 ± 1.2 a 40.5 ± 1.0 b Cased Bins 711.5 ± 172.8 71.2 ± 17.3 13.0 ± 3.5 b 8.7 ± 0.3 b 42.5 ± 0.6 a
a Based on four replicates per treatment. b Based on three replicates per treatment. Each replicate was composed of three mushrooms. c Number of days from inoculation until harvest. d Means followed by different letters indicates significant differences according to the Tukey- Kramer HSD test (P<0.05).
6.3.3 ERGO and mushroom yield as affected by substrate moisture content,
histidine supplementation of substrate, and casing layer application
(Crop 4)
Ergothioneine: Moisture content of the substrate and addition of a casing layer
significantly influenced ERGO concentration in mushrooms (Table 6.10). The highest
ERGO concentrations were observed in treatments NC55H10 and C55H10 (3.0 and 2.84
mg/g, respectively) while the lowest concentrations were found in treatments C60 and
C60H10 (1.78 and 1.72 mg/g, respectively) (See Table 6.2 for treatment description and
Table 6.11 for results). Histidine supplementation and factor interactions were not significant. However, slightly higher ERGO concentration was obtained for supplemented treatments. For instance, average ERGO concentration for histidine supplemented treatments 1-4 was 2.46 mg/g, while concentration for non-supplemented
150 treatments 5-8 was 2.29 mg/g (values obtained from Table 6.11). The average for low- moisture non-supplemented treatments (5 and 6) was 2.62 mg/g versus 2.92 mg/g for low-moisture histidine-supplemented treatments (1 and 2). The same trend was observed for high-moisture substrate treatments. Mushrooms from non-supplemented treatments (7 and 8) contained an average of 1.97 mg/g, while mushrooms from the supplemented treatments (3 and 4) contained an average of 2.01 mg/g. In both cases (low and high moisture content of the substrate), histidine supplementation slightly increased ERGO concentration in basidiomata. A significant source of variation was found for histidine x moisture interaction in the solids/bag and ERGO/bag estimated values. ERGO/bag and
ERGO/kg dry substrate were significantly affected by moisture content of the substrate and by casing x moisture interaction (Table 6.10). ERGO/bag and ERGO/kg dry substrate
Table 6.10. P-values obtained from analysis of variance for influence of three factors (casing, moisture content of substrate, and histidine supplementation of substrate) and their interactions on ERGO concentration, ERGO/bag and ERGO/kg of dry substrate with one commercial isolate of Pleurotus eryngii var. eryngii (Crop 4).
Source DF ERGO/Mush ERGO/bag ERGO/kg
Model 7 0.0033 * 0.0001 * 0.0017 * Effects tested Casing (C) 1 0.0278 * 0.1237 0.0749 Histidine (H) 1 0.2661 0.7989 0.1283 Moisture (M) 1 0.0002 * <.0001 * 0.0004 * C x H 1 0.9777 0.1742 0.1239 C x M 1 0.4579 0.0023 * 0.0034 * H x M 1 0.3739 0.0326 * 0.0598 H x C x M 1 0.5265 0.2404 0.2200
*P-values less than 0.05 were considered significant.
151
Table 6.11. ERGO concentration in Pleurotus eryngii var. eryngii basidiomata and estimated amount of ERGO produced per bag and ERGO per kg of dry substrate.
ERGOb,e ERGOc,e ERGOd,e Treatmenta (mg/g) (mg/bag) (mg/kg) 1. NC55H10 3.00 ± 0.31 a 179.67 ± 21.20 ab 159.71 ± 18.84 ab 2. C55H10 2.84 ± 0.57 a 175.81 ± 16.63 ab 156.28 ± 14.79 ab 3. NC60H10 2.29 ± 0.33 ab 157.98 ± 30.64 abc 157.97 ± 30.63 ab 4. C60H10 1.72 ± 0.18 b 111.45 ± 13.17 cd 111.44 ± 13.18 bc 5. NC55 2.79 ± 0.32 ab 175.41 ± 8.15 abc 159.46 ± 7.41 ab 6. C55 2.45 ± 0.24 ab 215.10 ± 6.76 a 195.54 ± 6.15 a 7. NC60 2.16 ± 0.12 ab 134.53 ± 10.18 bcd 144.47 ± 19.84 abc 8. C60 1.78 ± 0.13 b 91.40 ± 21.46 d 93.74 ± 22.01 c a NC55H10: non-cased, 55% moisture and 10 mM histidine supplementation; C55H10: cased, 55% mois- ture and 10 mM histidine supplementation; NC60H10: non-cased, 60% moisture and 10 mM histidine supplementation; C60H10: cased, 60% moisture and 10 mM histidine supplementation; NC55: non-cased and 55% moisture; C55: cased and 55% moisture; NC60: non-cased and 60% moisture; C60: cased and 60% moisture. b ERGO concentration: average of three replicates. Each replicate was composed of three whole basidio- mata harvested from one bag. c Estimated amount of ERGO (mg) produced per bag (substrate unit). d Estimated amount of ERGO (mg) produced per kg of dry substrate. e Means followed by different letters indicates significant differences according to the Tukey-Kramer HSD test (P<0.05).
was the highest in treatment C55 (215 mg/bag and 196 mg/kg, respectively) and the lowest for treatment C60 (91.40 mg and 93.74 mg/kg, respectively) (Table 6.11).
Yield, BE, solids, and production cycle length: Yield, BE, solids, and production cycle length were significantly affected by casing layer but not by histidine supplementation
(Table 6.12). Substrate moisture did not affect these responses with the exception of solids/mushrooms. Casing x substrate moisture interaction affected yield (Fig. 6.4a), BE,
152 solids/mushroom and solids/bag. Number of mushrooms was not affected by any factor
or their interactions. Presence of casing layer was the only factor that significantly
influenced production cycle length (Table 6.12). The three-way interaction (histidine x
casing x moisture) was significant for solids/mushroom and solids/bag. Effects of the
casing layer on yield, production cycle length and solids/mushrooms are shown in Fig.
6.4. Casing layer application dramatically increased yield when applied on low moisture
substrates but not on high moisture substrates (Figure 6.4a). Mushrooms from non-cased substrate contained higher solids contents than cased substrate (Fig. 6.4b and c).
Treatment C55 produced the highest yield, BE and solids/bag (807 g, 73% and 88 g) while treatment NC55H10 produced the lowest yield (499 g) and BE (44.3%) (Table
6.13). In general, highest yields, BE and lowest solids/mushroom were obtained from
cased treatments (2, 4, 6, and 8). While lowest yields, BE and highest solids/mushrooms
were found in non-cased treatments (1, 3, 5 and 7) (Fig. 6.4c). Production cycle length
from cased treatments was relatively shorter, ranging from 37 – 41 days between the first
and last day of harvest after spawning. However, mushrooms produced on non-cased
treatments were picked 40 – 45 days after spawning (Table 6.13, Fig. 6.4b).
153
Table 6.12. P-values from the analysis of variance for three factors (casing, moisture of substrate and histidine supplementation of substrate) and their interactions influencing yield, BE, number of mushrooms, solids, and production cycle length of Pleurotus eryngii var. eryngii (Crop 4).
Yield BE Number Solids/mush Solids/bag Production D room2 cycle length Source of Mushrooms F variation (days) (g/bag) (%) (%) Model 7 0.0080 * 0.0076 * 0.2272 <.0001 * 0.0115 * 0.0248 * Effects tested Casing (C) 1 0.0005 * 0.0009 * 0.0560 <.0001 * 0.3474 0.0008 * Histidine (H) 1 0.3912 0.2383 0.2003 0.1360 0.6087 0.6286 Moisture (M) 1 0.5845 0.1296 0.1682 <.0001 * 0.0808 0.2166 C x H 1 0.3893 0.3858 0.6196 0.6866 0.3422 0.1209 C x M 1 0.0072 * 0.0147 * 0.9316 0.0054 * 0.0093 * 0.5608 H x M 1 0.2579 0.3116 0.5272 0.1169 0.0038 * 0.6286 H x C x M 1 0.8132 0.8347 0.2501 0.0060 * 0.0485 * 0.7743
*P<0.05 were considered statistically significant.
154
Table 6.13. Effects of casing, substrate moisture content, and histidine supplementation of substrate on yield, BE, and number of mushrooms of Pleurotus eryngii var. eryngii.
Treatmenta Yieldb,d BEb,d Number Solidsd Solidsd Production b,d b,c (g/bag) (%) Mushrooms (%) (g/bag) cycle lengh first – last day 1. NC55H10 498.5 ± 36.67 b 44.3 ± 3.26 b 17.0 ± 7.4 12.23 ± 0.61 a 59.90 ± 4.75 b 43 – 44 2. C55H10 700.0 ± 45.17 ab 62.2 ± 4.02 ab 16.0 ± 2.9 8.97 ± 0.78 cd 62.95 ± 9.76 b 37 – 39 3. NC60H10 611.5 ± 88.18 ab 61.2 ± 8.82 ab 17.8 ± 4.9 10.23 ± 0.33 bc 68.76 ± 3.60 ab 44 – 45 4. C60H10 628.3 ± 165.18 ab 62.8 ± 16.52 ab 11.5 ± 4.2 9.13 ± 0.39 cd 65.63 ± 14.47 ab 38 – 39 5. NC55 529.8 ± 38.72 b 48.2 ± 3.52 b 25.8 ± 9.0 12.21 ± 0.67 a 63.07 ± 4.20 ab 40 – 41 6. C55 807.3 ± 140.27 a 73.4 ± 12.75 a 16.7 ± 6.4 9.98 ± 0.13 bcd 88.08 ± 5.93 a 38 – 39 7. NC60 580.0 ± 35.75 ab 59.5 ± 3.67 ab 17.8 ± 8.7 10.85 ± 0.38 ab 62.39 ± 2.43 b 42 – 44 8. C60 640.3 ± 118.33 ab 65.7 ± 12.14 ab 14.8 ± 8.8 8.51 ± 0.12 d 50.94 ± 8.99 b 39 – 41
a NC55H10: non-cased, 55% moisture and 10 mM histidine supplementation; C55H10: cased, 55% moisture and 10 mM histidine supplementation; NC60H10: non-cased, 60% moisture and 10 mM histidine supplementation; C60H10: cased, 60% moisture and 10 mM histidine supplementation; NC55: non-cased and 55% moisture; C55: cased and 55% moisture; NC60: non-cased and 60% moisture; C60: cased and 60% moisture. b Based on 4 replicates c Production length is expressed as a range between the first and last day of mushroom harvest. d Means followed by different letters indicates significant differences according to the Tukey-Kramer HSD test (P<0.05).
155 40 1000 Moisture 900 a 50 bb 55 800 9 Prod. Yield ld 700 45 (g/bottle) 60 Length Yie 600 (days)39.75 2 .98438 ± 9
500 Prod.Lenght 40 400 35 No Y es
No Yes Casing No YesYes Casing
14 Fig. 6.4. Influence of casing overlay on yield, c production cycle length and solid content of 13 Pleurotus eryngii var. eryngii. a. Significant 12 increases in yield were observed when the Solids casing layer was applied to low moisture- content(%) 11 (%).460952
content substrate. b. Main effect plot 12.34667 10 Solids (%) ±0 showing use of a casing layer decreased 9 production cycle. c. Main effect plot showing 8 decreased solids content in mushrooms harvested from cased substrate. No Yes No CasingCas ing
Correlation of ERGO, moisture content of substrate, yield and solids: A
significant negative correlation (-0.799) between substrate moisture content and
ERGO/mushroom was observed (Table 6.14). Higher ERGO concentrations were found in mushrooms produced on low-moisture substrates (55 – 56%). On the other hand, the lowest ERGO concentration was found in basidiomata grown on relatively high-moisture substrate (60 – 61%) (Fig. 6.5a). ERGO/mushroom - solids/mushroom and ERGO/bag - solids/bag were positive and significantly correlated (0.461 and 0.639, respectively).
Higher levels of ERGO/bag (mg) were obtained from treatments that produced more
156 mushroom solids/bag (Fig. 6.5b). ERGO concentration also was higher in mushrooms that had a high percentage of solids (Fig. 6.5c). A significant positive correlation (0.790) also was observed between yields - solids/bag. Increases in yields were accompanied by increases in solids/bag (Fig. 6.5d). In contrast, yield and solids/mushroom were
negatively correlated (-0.501).
Table 6.14. Pearson correlation coefficients among moisture, ERGO, ERGO/bag (substrate unit), yield, solids/mushroom and solids/bag (substrate unit).
Moisture ERGO ERGO/bag Yield Solids/Mush ERGOa -0.799*
ERGO/bagb -0.777* 0.776*
Yield -0.027 -0.243 0.298
Solids/mushroom -0.372 0.461* 0.436 -0.501*
Solids/bagb -0.260 0.025 0.639* 0.790* 0.129
a Concentration. b Estimated amounts/bag. * Statistically significant values (P<0.05).
157
Scatterplot of ERGO vs Substrate moisture Scatterplot of ERGO/bag vs Solids/bag 225 3.5 Correlation = -0.799 Correlation = 0.639 200
3.0 175
150 2.5 125 ERGO (mg/g) ERGO/bag (mg) 100 2.0 75 1.5 50 55 56 57 58 59 60 61 40 50 60 70 80 90 a Substrate moisture (%) b Solids/bag (g)
Scatterplot of ERGO vs Solids/mushroom Scatterplot of Solids/bag (g) vs Yield (g)
3.5 Correlation = 0.461 90 Correlation = 0.790
80 3.0 70 2.5 60 ERGO (mg/g) Solids/bag (g) 2.0 50
1.5 40 8 9 10 11 12 13 400 500 600 700 800 900 1000 c Solids/mushroom (%) d Yield (g)
Fig. 6.5. Scatter plots for significant correlations. a. Negative correlation between moisture
content of the substrate and ERGO concentration in basidiomata. b. Positive correlation between solids/bag and ERGO/bag. c. Positive correlation between ERGO/mushroom and solids/mushroom. d. Positive correlation between solids/bag and yield/bag.
6.4 Discussion
One of the objectives of this work was to evaluate the ability of P. eryngii var.
eryngii to accumulate Se in basidiomata when the fungus was produced on Na2SeO3- supplemented substrate. The author found that Se accumulation in basidiomata was approximately linear in relation to levels of Se added to the substrate. Addition of
Na2SeO3 at 5 and 10 μg/g in the substrate resulted in basidiomata with Se concentrations
158 of 4.6 and 9.3 μg/g (d. w.), respectively. Therefore, a serving size of 85 g of fresh P.
eryngii mushrooms produced from Na2SeO3-supplemented substrates may be considered a good source of Se because it provides more than 15% of the RDA. No significant variations in yield, BE and number of mushrooms were observed as a result of substrate supplementation with Na2SeO3. However, fewer solids (%) were produced in treatment
Se10ppm compared to the non-supplemented and Se5ppm treatment. Differences in
solids content of the mushrooms may be due, in part, to differences in dry substrate and
water availability. Bottles were individually filled with a bottle-filling machine that
stopped substrate flow when it generated pressure on the dispenser cone. Thus, the filling
process resulted in variation in substrate weight from bottle to bottle and batch to batch.
The first treatment prepared for the Se experiment was the non-supplemented substrate,
followed by the 5 ppm- and the 10 ppm-treatments. Bottles prepared for the latter
treatments contained slightly lower substrate matter than bottles prepared at the
beginning of the trial (Table 6.1). Yields and BEs from Se0ppm and Se10ppm treatments
were similar, confirming that less substrate in Se10ppm did not affect performance of the
fungus. Since BE is defined as the ratio between mushroom yield and substrate dry
weight, a higher BE means that the fungus was able to use nutrients present in the
substrate more efficiently. In fact, BE (71.9%) was highest from substrate supplemented
with 10 ppm of Se. Although Se5ppm treatment also showed significant differences in
dry and wet weight substrate compared to the control (Se0ppm), mushroom solids were
not significantly different. Therefore, the author assumes that lower percentages of
mushroom solids in treatment Se10ppm might be also a result of a metabolic response of
the fungus to substrate supplementation. It is known that Se, in certain concentrations, is
159 toxic to fungi. Thuong et al. (1995) for example, observed that biomass in submerged
cultures of Saccharomyces cerevisiae decreased when Se was added to the growing
media at 30-100 μg/ml. Even though Se10ppm resulted in less solids/mushroom, the estimated overall amount of Se obtained in mushroom tissue per bottle was 134 μg, the
highest among the treatments (Table 6.3). Changes in basidiomata in the amounts of
other elements (N, P, K, Zn and Na) were observed as result of substrate supplementation
with Na2SeO3. Beelman and Royse (2006) also observed variations in certain elements
(e.g. sodium and potassium) in P. cornucopiae and G. frondosa mushrooms as result of
supplementation. However, differences in quantities were not as significant as the variations observed for Se.
Although information regarding Se absorption and accumulation is available for several species of mushrooms, studies on Se decreases or conversion during processing
and cooking, Se speciation and bioavalability in mushrooms are especially scarce
(Mutanen 1986, Van Elteren et al. 1998, Tham et al. 1999, Ogra et al. 2004). Such information is needed in order to thoroughly evaluate the benefits of Se-enriched mushrooms as an antioxidant sources for the humans diet.
Dubost et al. (2007a) examined ERGO concentration enhancement in A. bisporus
basidiomata as result of various factors such as moisture content, fragmentation and
histidine supplementation of the compost. Dubost observed that A. bisporus mushrooms
grown on low-moisture content compost (66%) yielded a higher concentration of ERGO
than mushrooms harvested from high-moisture compost (72%). Fragmentation of the
substrate also appeared to increase ERGO concentration in the mushrooms. Dubost and
colleagues suggested that ERGO might be a stress-induced metabolite that is enhanced
160 when the mushroom is exposed to low substrate moisture content and fragmentation of
the production media. The same author also found that histidine supplementation of the
compost resulted in an increase of ERGO in mushrooms harvested during the second and
third flushes. Based on that information, the author of this work sought to evaluate the
effects of moisture content, fragmentation of the substrate and histidine supplementation on ERGO concentration in P. eryngii basidiomata. Moisture content of the substrate significantly influenced ERGO concentration in basidiomata, with lower moisture contents producing higher ERGO concentrations. However, substrate fragmentation
(Crop 3) did not affect concentration of ERGO. The author hypothesized that high concentrations of ERGO in mushrooms produced on a low-moisture substrate could be the result of a concentration artifact. Since low yields were produced on low moisture substrate (56%), it seems likely that amount of ERGO is more concentrated in less fungal tissue. The use of a casing layer provided an additional water source (besides the substrate) for the developing mushrooms. Thus, water availability might not be a limiting factor for cased substrate. In fact, the highest yields and BEs were obtained from cased substrates. The author sought to determine if a casing layer increase yields in low- moisture substrates that presumably produce mushrooms with high ERGO concentration.
Thus, the author designed an experiment that would simultaneously evaluate how moisture content, histidine supplementation of the substrate and use of a casing layer affect yield and ERGO concentration in basidiomata (Crop 4). Indeed, low-moisture content substrate (55 – 56%) produced basidiomata with a higher ERGO concentration than substrates with higher moisture content (60 – 61%) regardless of the yields obtained.
High yields resulting from the use of a casing layer, did not result in low ERGO
161 concentrations. In fact, the lowest ERGO concentrations were found in treatments with
yields comparable to treatments with the highest concentrations of ERGO. Hence, high
concentrations of ERGO in mushrooms were a result of a relatively dry substrate used to
produce the basidiomata. Mushrooms with the highest ERGO concentration were
produced on low-moisture, histidine-supplemented substrates (NC55H10 and C55H10).
However, when ERGO/bag and ERGO/kg of dry substrate were calculated, histidine
effects were not significant. Quantities of ERGO/bag and ERGO/kg are estimated from
yields and mushroom solids, and histidine supplementation did not affect either response.
Supplementation of substrate with histidine significantly effected only solid/mushrooms
in a three way interaction (hisitidine x casing x substrate moisture content). Thus, the
influence of histidine on solids/mushroom might be dependent on moisture, either
supplied by the substrate or by the casing layer. Further experimentation would be necessary to confirm this hypothesis. Dubost et al. (2007a) demonstrated that histidine supplementation increased ERGO concentration in the 2nd and 3rd breaks of A. bisporus.
Because P. eryngii is usually harvested for only one break before the substrate is discarded, we restricted our analysis to a single flush. Use of a casing layer, as practiced
by Italian and Chinese growers, results in production of second and third flushes
(Rodriguez Estrada and Royse 2008). In future research, ERGO concentration in P.
eryngii basidiomata may be evaluated in multiple flushes. In contrast to findings of
Dubost et al. (2007a) for A. bisporus, fragmentation of the substrate did not have an
effect on ERGO concentration in P. eryngii basidiomata.
A casing layer dramatically affected yield, BE, solids/mushroom and production
length (Crop 4). Generally, the moisture content of the substrate plays an important role
162 in mushroom solids and yield. However, in this experiment, where a casing layer was
used, substrate moisture did not significantly influence yield and BE (Table 6.12). In fact,
yield and moisture content of the substrate were not correlated (Table 6.14). Highest
yields were obtained from cased treatments (C55, C55H10, C60, and C60H10) regardless
of the moisture content of the substrate. Increases in yields were not associated with the
number of mushrooms. In fact, number of mushrooms was not significantly influenced by
any of the factors evaluated. A significant correlation (0.790) was found between yield
and mushroom solids/bag. Also, individual mushrooms harvested from cased treatments
always produced the lowest percentage of solids (8.5 – <10%). Sine number of
mushrooms was not significantly different among treatments the author hypothesizes that
increments in yields might be due to formation of bigger and heavier mushrooms.
In conclusion, the presence of the antioxidants Se and ERGO in P. eryngii var.
eryngii may be enhanced through selected cultural practices. Supplementation of
substrate with sodium selenite and use of relatively low moisture content in the substrate
are cultural practices that would be relatively easy to implement on a commercial scale.
Potential yield reduction by lower moisture content in the substrate may be overcome by the use of a casing layer. This practice would also shorten the production cycle from 43 to 39 days when non-fragmented substrate is cased.
163 Chapter 7: Improvement of yield of Pleurotus eryngii var. eryngii using
a casing layer and substrate supplementation
7.1 Introduction
The crop cycle of many cultivated edible mushrooms consists of more than one
break or flush. However, Pleurotus eryngii var. eryngii, grown on substrate contained in
bags or bottles, produces only one flush before the substrate is discarded. A casing layer may be used with the bag system to allow the production of two or more flushes (Tan et al. 2005). Furthermore, where mushroom farms have limited control of environmental
conditions (due to rudimentary production rooms or in outdoor cultivation), the use of a
casing overlay minimizes the loss of substrate moisture content (Oei 2006, Rodriguez
Estrada and Royse 2008). In controlled environments, where the relative humidity is easily maintained around 85-90%, the use of a casing layer to grow P. eryngii is not necessary.
Biological efficiencies (BE) obtained from a single break by commercial isolates of P. eryngii grown on substrate in bottles or bags might average 50 to 80%. Although these values are relatively high, discarding substrate that generated only one break is inefficient relative to the potential productivity of the substrate. Improvements of BEs and yield of cultivated edible mushrooms may be obtained by various strategies. One of the most obvious is supplementation of substrate at either early or late stages of the production cycle (Sinden and Schisler 1962, Schisler and Sinden 1962, Curvetto et al.
2002, Royse et al. 2004, Rodriguez Estrada and Royse 2007). With each successive flush, yields decrease mainly as a consequence of nutrient depletion in the growing media
164 (Schisler 1964, Royse et al. 2008). Therefore, supplementation at casing or spawning
with delayed-release nutrients is a practice commonly used in the commercial cultivation
of Agaricus bisporus. Although available commercial supplements have been developed
specifically for use with this species, researchers have found that some supplements may
be effective in stimulating yields of some specialty mushrooms (Royse 1999). Other
factors such as accumulation of toxic metabolites in the substrate and a reduced
absorptive surface of the mycelium (stationary vegetative growing stage) might also be
responsible for yield declines as the crop cycle advances (Rasmussen 1959, Schisler
1990).
Cost-efficient production methods to improve yield and BE without sacrificing
the quality of the mushrooms is a subject of continuous research efforts for most
cultivated edible or medicinal species. In this work, the author sought to increase BE and
yield of P. eryngii var. eryngii by utilization of a casing layer and by the addition of a
delayed-release supplement. Characteristics such as number of mushrooms, pileus color,
and solids content also were evaluated. The data was arranged and analyzed in a way that
comparison of different production methods could be evaluated: 1) Non-casing (standard
method), 2) casing (from 1st flush), and 3) casing after 1st flush. Results indicated that
supplementation and casing at fragmentation produced the highest yields and BE. In
general, casing and supplementation increased yield by 176% over non-cased, non- supplemented substrates. Therefore, casing the substrate before first flush (“casing”
production method) might be the best cultural practice to increase yield and BE.
165 7.2 Materials and Methods
7.2.1 Experimental design
The experiment was designed as a 2 x 3 factorial design where the influence of a casing layer (cased vs. non-cased) and Remo’s supplement (non-supplemented and supplement added at spawning or casing) were evaluated for their effects on yield, BE and number of mushrooms. Each of the 6 treatments contained 6 replicates (Table 7.1).
Table 7.1. Design of factorial experiment used to evaluate influence of a casing layer and delayed-release nutrient supplement (Remo’s) on yield, BE and number of mushrooms produced by one isolate of Pleurotus eryngii var. eryngii.
Treatment Treatment Casing layer Supplement number designationa 1 NC No No 2 NC/Sb/AS No Spawning 3 NC/S/AF No Fragmentation 4 C Yes No 5 C/S/AS Yes Spawning 6 C/S/AF Yes Fragmentation
a NC: Non-cased; NC/S/AS: non-cased, supplemented at spawning; NC/S/AF: non- cased, supplemented at fragmentation; C: cased; C/S/AS: cased and supplemented at spawning; C/S/AF: cased and supplemented at fragmentation. b Remo’s supplement added at 4% of dry substrate weight.
166 7.2.2 Spawn
Spawn of P. eryngii var. eryngii (WC-888) was prepared in 500 ml flasks by autoclaving a mixture of Hesco mushroom rye grain (91 g), hardwood sawdust (13 g) ,
CaSO4 (3 g) and 120 ml of warm tap water. After the ingredients were cooled, five
mycelial-agar plugs (5 mm diameter) were placed into the grain mixture and then
incubated for 1 week at room temperature. The spawn then was shaken in order to evenly
distribute the mycelia on the grain. The spawn was incubated for an additional week,
shaken again and then stored at 4°C until it was used.
7.2.3 Substrate preparation, inoculation and incubation
Mushrooms were produced on a substrate as follows: cottonseed hulls (56%),
corn distiller’s waste (4%), calcium sulfate (1%), ground soybean (12%) and hardwood
sawdust (27%). Dry ingredients were mixed for 2 minutes in a paddle mixer at the
Mushroom Research Center (MRC). Warm tap water was then added to reach 60%
moisture content. Final moisture content of the substrate for each treatment was
determined in triplicates with an Ohaus moisture analyzer (model MB35). Moistened
substrate was packed into polypropylene (PP) bags (2.5 kg) with medium porosity
patches (Unicorn Import and Manufacturing, Commerce, TX) and then autoclaved at
121ºC for 90 min. Cooled substrate was inoculated with 30 g of grain spawn. Bags were
heat-sealed and then vigorously shaken to uniformly distribute the spawn. The substrate
was incubated for 25 days in a 9 m2 room at the MRC. Room temperature was
maintained at 21ºC with a light cycle of 8 h light/16 h darkness using cool-white
fluorescent bulbs.
167 7.2.4 Supplementation at spawning
Treatments 2 and 5 (NC/S/AS and C/S/AS, respectively) were supplemented at
substrate preparation. Since supplementation at this time is equivalent to supplementation
at inoculation in A. bisporus, the author will refer to this as “supplementation at spawning” (AS). A commercial delayed-release nutrient supplement (Remo’s, corn and soy bean base) was added to the substrate (4% d. w.) and mixed prior to water addition.
The substrate was packed, sterilized, spawned and incubated as outlined above.
7.2.5 Substrate fragmentation, supplementation at fragmentation and
casing
After incubation, colonized substrate (all treatments) was removed from the bags and manually fragmented. Treatments 3 and 6 (NC/S/AF and C/S/AF, respectively) were supplemented at fragmentation by adding 4% of d. w. delayed-release nutrient (Remo’s) and uniformly mixed by hand. Non-supplemented and supplemented substrates were compacted into 6.1 L plastic bins (33 cm long x 18.5 cm wide x 12 cm deep,
Rubbermaid®) and then either non-cased (NC) or cased (C). Non-cased bins (Treatments
1, 2, and 3) were covered with a perforated plastic sheet (holes 7 mm in diameter, separated by 44 mm x 94 mm spaces, Fig. 7.1a). Bins for treatments 4, 5 and 6 were cased by placing 1 kg of 2:1 d. w. peat moss and calcium carbonate (78.7% moisture) on the surface of the exposed substrate (Fig. 7.1d). The bins were transferred to a production room set at 90% relative humidity (RH), 16ºC and 8 h light/16 h dark light cycle. The plastic sheet was removed once the primordia made contact with the film (Fig. 7.1b).
168 Cased bins were watered at intervals of three to four days. Primordia formed underneath
the casing layer and developed through it as shown in Fig. 7.1e. Mushrooms were
manually harvested when mature (Fig. 7.1c and 7.1f). Second and third flushes were
obtained from the cased treatments (4, 5 and 6) without further treatment. However,
additional flushes for the non-cased treatments (1, 2 and 3) were induced by placing a
casing layer after first flush was harvested (Fig. 7.2).
7.2.6 Induction of subsequent flushes in non-cased treatments
In order to increase the productivity of non-cased substrates that otherwise would be
discarded; subsequent flushes were induced by placing a casing overlay. The new set of treatments applied to the “spent” non-cased substrates remaining after first flush is shown in Table 7.2 (the author will refer to them as “later-cased or second treatments”). A second practice of substrate fragmentation and supplementation was performed for half of the replicates. Therefore, for each original non-cased treatment (NC, NC/S/AS and
NC/S/AF) three replicates arbitrarily selected were directly cased and three replicates where fragmented, supplemented and cased (Table 7.2). Non-fragmented (NF) substrate
(Fig. 7.2a) was cased with a mixture of 1 kg of casing soil and 1.4% of casing inoculum
(spent colonized substrate) per bin. The fragmented/supplemented treatment (F) consisted of removal of the substrate from bins, manually fragmenting the substrate and subsequent
Remo’s supplementation at 4% d. w. of the initial substrate weight (Fig. 7.2b). Substrate was thoroughly mixed by hand and placed into the original bins from where it was removed. These treatments were cased as explained above (Fig. 7.2c).
169 Table 7.2. Second set of treatments applied to spent non-cased substrates in order to induce subsequent breaks.
First treatments1 Second treatments2 Treatment Name3
1. NC a. Casing (3) NC-NF
b. Fragmentation, supplementation and casing (3) NC-F
2. NC/S/AS a. Casing (3) NC/S/AS-NF
b. Fragmentation, supplementation and casing (3) NC/S/AS-F
3. NC/S/AF a. Casing (3) NC/S/AF-NF
b. Fragmentation, supplementation and casing (3) NC/S/AF-F
1 NC: Non-cased; NC/S/AS: non-cased, supplemented at spawning; NC/S/AF: non-cased, supplemen- ted at time of fragmentation. Six replicates were available per each treatment. 2 a. Spent substrate in bins was cased without fragmentation/supplementation; b. spent substrate was subtracted from the bins, manually fragmented, supplemented with Remo’s (4% d. w.), placed back into the bin and cased; (3) three replicates per treatment. 3 NF: non-fragmented substrate; F: fragmented substrate.
7.2.7 Solids
Two mushrooms from three bins per treatment were evaluated (6 replicates per treatment). Whole mushrooms where chopped (10 - 15 mm3), placed in polystyrene weight boats (14 x 14 x 2.5 cm, VWR*) and weighed. Mushroom cubes were dried in an
oven (Shel Lab, model 1330GM) at 65ºC for 36 hr, and then transferred to a new dish
(8.9 x 8.9 x 2.5 cm) and weighed again. Percentage solids were calculated by dividing the
dry weight of the cubes by their fresh weight and multiplying the result by 100.
170
a d
b e
c f
Fig. 7.1. Pleurotus eryngii var. eryngii primordia and basidiomata development in cased and non-cased substrates (“casing” and “non-casing” production methods). a. The bin was covered with a plastic sheet in order to induce primordia formation. b. The plastic was removed from the bin when the primordia reached the plastic sheet. c. Mature basidiomata growing from non- cased substrate contained in bins. d. Fragmented substrate covered with a casing layer (3 cm in depth). e. Primordia emerging from the casing layer. f. Mature basidiomata growing from cased substrate contained in bins.
171
a b
Fig. 7.2. Second treatment. a. Substrate as it remained after first flush. b. Fragmented, supplemented (Remo’s 4% d. w.) substrate. c. Substrate re-packed c into the bin (right) and cased (left).
7.2.8 Pileus Color
Color of the pileus was evaluated for the mushrooms harvested during first flush.
Three mushrooms per bin were arbitrarily selected and three replicates were evaluated per treatment. For each mushroom, three measurements were taken at approximately equal distances around the circumference of the pileus and at a middle distance from the center to the margin. Hence, a total of 27 measurements were made per treatment.
Brightness of the color (L-values) was measured using a Chroma-meter Minolta (model
CR-200).
172 7.2.9 Yield, biological efficiency and number of mushrooms
Yield, biological efficiency (BE) and number of mushrooms were determined for
all treatments and flushes. Yield is expressed as fresh mushroom weight (g) produced per
bin; BE is the ratio of basidiomata fresh weight to dry substrate weight expressed as a percentage. Number of mushrooms obtained per bin was also recorded.
7.2.10 Statistical analyses
Analyses of variance (ANOVA) and mean separation were performed with SAS statistical software package JMP® (version 7, 2007). Data for first break (yield, BE, number of mushrooms, solids, and color) was analyzed through the standard least square procedure in a two-way ANOVA. The model included the factors casing layer, delayed release nutrient, and their interactions. The Tukey-Kramer Honestly Significant
Difference (HSD) test was used to separate treatment means. In order to compare different production methods, the data for yield, BE and number of mushrooms was analyzed through a one-way ANOVA. A standard production method (non-casing) only produces one flush and a casing method produces up to 3 flushes. Therefore, data from a single flush obtained from non-cased substrates (treatment 1, 2, and 3) and data from all flushes obtained in cased substrates (treatment 4, 5, and 6) were included in the ANOVA analysis named “non-casing versus casing” (Table 7.6). To compare a production method where substrates are cased after first flush and the casing method, data from all flushes were combined and analyzed in the ANOVA analysis named “casing after first flush versus casing” (Table 7.6).
173 7.3 Results
7.3.1 First Break
First mushroom harvest started 38 days after spawning and lasted for 7 days.
Yield and BE were significantly affected by casing layer and supplementation (Table
7.3). Highest yield (678.2 g) and BE (67%) were observed for treatment C/S/AF (cased
substrate supplemented at fragmentation), while the lowest yield (367.6 g) and BE
(35.9%) were observed for NC/S/AS (non-cased substrate supplemented at spawning)
(Table 7.4). Number of mushrooms and solids content were affected only by use of a
casing layer. Number of mushrooms for cased treatments ranged from 11 to 12, considerably lower than the non-cased treatments NC and NC/S/AF (16 and 21
respectively). Number of mushrooms in treatment NC/S/AS (12) was comparable to the
cased treatments. Solids content were higher in the non-cased treatments (10.6 – 11.9%)
compared to the cased treatments (7.3 to 9.1%). On average, L-values (brightness of the
pileus) were significantly higher (lighter) for the non-cased treatments (68.4 - 74.1) than
for the cased treatments (55.3 - 57.3) (Fig. 7.3).
174 Table 7.3. P-values obtained from the analysis of variance for casing layer, supplementation and their interactions influencing yield, BE, number of mushrooms, solids, and pileus color during first flush of Pleurotus eryngii var. eryngii.
Source D Yield BE No. mush- Solids Color F rooms (g) (%) (%) (L-value)
Model 5 0.0004* 0.0003* 0.0133* <.0001* <.0001* Effects tested Casing (C) 1 0.0002* 0.0002* 0.0081* <.0001* <.0001* Supplement (S) 1 0.0029* 0.0020* 0.1117 0.0119* 0.0015* C x S 1 0.8828 0.8782 0.1415 0.6340 <.0001*
*P-values less than 0.05 were considered significant
Fig. 7.3. Mature basidiomata harvested from non-cased and cased substrate (first flush). Color measurements (L- values, brightness) of the pileus ranged Non-cased Cased from 80 to 62 for non-cased substrate and from 61 to 44 for cased substrate (raw data).
175
Table 7.4. Mean separation (Tukey-Kramer HSD test) for yield, BE, number of mushrooms, solids and color measured in the first break of Pleurotus eryngii var. eryngii. Standard deviation (estimation of variance) is indicated after ±.
Treatmenta Yieldb BEb No. Solidsb Colorb b g % mushrooms % L-value 1. NC 481.5 ± 34.2 bc 47.6 ± 3.4 bc 16.3 ± 4.0 ab 10.6 ± 1.2 ab 68.4 ± 2.9 b 2. NC/S/AS 367.6 ± 167.3 c 35.9 ± 16.3 c 11.6 ± 9.6 ab 11.8 ± 0.7 a 74.1 ± 3.8 a 3. NC/S/AF 537.5 ± 45.36 abc 53.1 ± 4.5 abc 21.0 ± 6.6 a 11.6 ± 1.1 a 71.1 ± 4.5 ab 4. C 664.7 ± 114.6 ab 65.7 ± 11.3 ab 12.0 ± 3.1 ab 7.3 ± 1.0 c 55.3 ± 3.6 c 5. C/S/AS 517.5 ± 139.6 abc 50.5 ± 13.6 abc 10.5 ± 4.1 b 9.1 ± 0.2 bc 54.7 ± 4.2 c 6. C/S/AF 678.2 ± 104.1 a 67.0 ± 10.3 a 10.8 ± 3.1 b 8.1 ± 1.3 c 57.3 ± 4.1 c a NC: Non-cased; NC/S/AS: non-cased, supplemented at spawning; NC/S/AF: non-cased, supplemented at time of fragmentation; C: cased; C/S/AS: cased and supplemented at spawning; C/S/AF: cased and supplemented at time of fragmentation. b Means followed by different letters indicates significant differences according to the Tukey-Kramer HSD test (P< 0.05).
176 7.3.2 Induced second and third breaks
The beginning and end of second and third breaks were difficult to determine due
to unequal primordia formation and development of basidiomata after first break.
Therefore, in order to delimit breaks, yield distribution obtained for the treatments was
pooled into a histogram (data not shown). Harvest peaks were considered middle of each
break. Second and third flushes started at day 45 and 53 after spawning, respectively.
Both breaks lasted for 8 days. In order to facilitate the analysis of the data, the second and
third breaks per each treatment were analyzed in combination. Hence, from this point on
the author will refer to break 2 and 3 as “subsequent flushes”. Yield, BE and number of
mushrooms for the subsequent flushes obtained in the later-cased treatments (induced by
casing and/or fragmenting spent substrate) are presented in Table 7.5. These results
indicate that in general, the highest values for yield and BE were obtained from the fragmented/supplemented treatments (F). Yield ranged from 492 to 687 g/bin while BE
ranged from 48.6 to 67.1%. On the other hand, yields from non-fragmented treatments
(NF) ranged from 471.0 to 332.0 g/bin and from 46.5 to 32.4% BE per bin. When data for
fragmented and non-fragmented treatments were combined, significant differences were
found for yield and BE (Table 7.5). The yield average per bin attained from fragmented
substrate was 607 g, while mushroom yield for the non-fragmented treatment was 396 g.
BE varied accordingly from 60% to 39% for the fragmented and non-fragmented treatments, respectively. Number of mushrooms in fragmented treatments was 14.1 versus 9.8 for the non-fragmented treatments; however, this difference was not statistically significant.
177
Table 7.5. Yield (g/bin), BE and number of mushrooms produced per bin during the second and third flushes (subsequent flushes) for the later-cased treatments for Pleurotus eryngii var. eryngii.
Treatmenta Yieldd,f BEd,f No. mush.d,f Total Total Total g % Yielde BEe Number of e g % mushrooms 1. NC-Fb 642.0 ± 143.4 a 63.4 ± 14.2 a 14.3 ± 0.6 ab 607.0 a 59.7 a 14.1 2. NC/S/AS-Fb 687.0 ± 113.4 a 67.1 ± 11.1 a 18.3 ± 1.5 a ± 131.1 ± 12.8 ± 4.5 3. NC/S/AF-Fb 492.0 ± 63.7 ab 48.6 ± 6.3 ab 9.7 ± 4.7 ab 4. NC-NFc 386.3 ± 63.5 b 38.2 ± 6.3 b 14.7 ± 9.6 ab 396.4 b 39.0 b 9.8 5. NC/S/AS-NFc 332.0 ± 47.3 b 32.4 ± 4.6 b 5.3 ± 1.2 b ± 83.0 ± 8.3 ± 6.4 6. NC/S/AF-NFc 471.0 ± 81.2 ab 46.5 ± 8.0 ab 9.3 ± 1.5 ab
a NC: Non-cased; NC/S/AS: non-cased, supplemented at spawning; NC/S/AF: non-cased, supplemented at time of fragmentation. b Fragmentation (F): after first flush substrate was subtracted from the bins, manually fragmented, supplemented with 4% Remo’s (d. w. of the original substrate weight), placed in bins and cased. c Non-fragmented (NF): substrate was cased after first flush. d Based on three replicates per treatment. e Mean for fragmented and non-fragmented treatments. f Means followed by different letters indicates significant differences according to the Tukey-Kramer HSD test (P<0.05).
178 7.3.3 Comparison of production methods
Yield for a single flush (standard “non-casing” method) in the non-cased
treatments (1, 2, and 3) ranged from 367.6 to 537.5 g. However, yield for 3 flushes
obtained through the “casing” production method (treatments 4, 5, and 6), was
significantly higher, reaching 1.3 kg. Consequently, differences in BE were also
significant. BEs ranged from 35.9 - 53.1% in non-cased treatments while in cased
treatments BE ranged from 114.8 to 132.8% (Table 7.6, “non-casing” versus “casing”
method). Data comparing “casing” and “casing after first flush” method is presented in
Table 7.6. “Casing” includes yield, BE, and number of mushrooms obtained from all
flushes, same as the previous analysis. “Casing after first flush” includes first flush
obtained without casing and subsequent flushes (induced). Highest yield, BE and number
of mushrooms were from cased treatments compared to the “casing after first flush”
method although some values where similar. For example, yield in treatment NC/S/AF (1
kg) was not significantly different than yield from C/S/AF (1.3 kg). BEs were higher than
100% for most treatments, except for NC and NC/S/AS (98.4 and 88.1%, respectively).
Total number of mushrooms ranged from 25 to 40, where the highest number of
mushrooms was observed for treatments representing the “casing” production method
(Table 7.6).
179
Table 7.6. Yield, BE and number of mushrooms for three production methods: “casing”, “non-casing”, and “casing after first flush” Non-casing vs casing includes data for all flushes in the cased substrates and the single flush obtained in the non-cased substrates. Casing after first flush vs casing includes data obtained in the subsequent flushes induced in non-cased substrates and all flushes for the cased substrates.
Method of Non-casing vs casingb Casing after first flush vs casingc cultivation
d d d d Yield BE No. Yield BE No. d d Treatmenta g % mushrooms g % mushrooms 1. NC 481.5 ± 34.2 b 47.6 ± 3.4 b 16.3 ± 4.0 b 995.7 ± 188.5 bc 98.4 ± 18.6 bc 30.8 ± 7.5 ab 2. NC/R/AS 367.6 ± 167.3 b 35.9 ± 16.3 b 11.6 ± 9.6 b 902.0 ± 371.1 c 88.1 ± 36.2 c 24.6 ± 15.0 b 3. NC/R/AF 537.5 ± 45.4 b 53.1 ± 4.5 b 21.0 ± 6.3 b 1019.0 ± 89.5 abc 100.7 ± 8.8 bc 30.5 ± 8.9 ab 4. C 1162.0 ± 105.9 a 114.8 ± 10.5 a 36.0 ± 6.6 a 1162.0 ± 105.9 abc 114.8 ± 10.5 abc 36.0 ± 6.6 ab 5. C/R/AS 1248.2 ± 74.0 a 121.9 ± 7.2 a 39.8 ± 5.2 a 1248.2 ± 74.0 ab 121.9 ± 7.2 ab 39.8 ± 5.2 ab 6. C/R/AF 1344.7 ± 169.1 a 132.8 ± 16.7 a 40.2 ± 4.2 a 1344,7 ± 169.1 a 132.8 ± 16.7 a 40.2 ± 4.2 a a NC: Non-cased; NC/S/AS: non-cased, supplemented at spawning; NC/S/AF: non-cased, supplemented at time of fragmentation; C: cased; C/S/AS: cased and supplemented at spawning; C/S/AF: cased and supplemented at time of fragmentation. b Non-casing: Since only one flush is obtained in this production method, data from first flush in non-cased treatments was included. Casing: Since several flushes are obtained in this method, data from all flushes in the cased treatments was included. c Casing after first flush: Includes data from firs flush obtained from in non-cased treatments, plus flushes induced by the second set of treatments (casing and/or supplementation). d Means followed by different letters indicates significant differences according to the Tukey-Kramer HSD test (P<0.05).
180 7.4 Discussion
During the first flush, differences in yield and BE were significant. A preliminary
experiment (data not shown) demonstrated that cased treatments were likely to result in
higher yields than non-cased treatments. In those preliminary experiments,
supplementation (Remo’s 4%) was added only at time of casing. However, in the present
experiment the author observed that the two treatments involving supplementation at
spawning performed poorly during first break. Yields, BEs and number of mushrooms
were the lowest on NC/S/AS. Remo’s added at spawning (cased and non-cased
treatments) produced lower yields (442.6 g) and BE (43.2%) when compared to the
treatments supplemented at time of fragmentation of the substrate (607.8 g and 60.0%)
(data calculated from Table 7.4). The non-supplemented treatments produced
intermediate values (573.1 g and 56.6%). Therefore, the influence of Remo’s supplement
on yield and BE appears dependent upon the time of supplementation (as indicated also
from the ANOVA analysis, Table 7.3). It can be concluded that in P. eryngii,
supplementation of substrate at spawning might negatively affect productivity. However,
when Remo’s was added later in the crop cycle (substrate fragmentation and casing),
yield and BE increased.
Supplementation of “spent” (after first break) substrate and casing (later-cased treatments) resulted in higher yields, BE and number of mushrooms compared to non- fragmented/non-supplemented treatments. Yield and BE for the fragmented/ supplemented substrates (F) increased by 53% over the non-fragmented/non-supple-
mented substrates (NF). Number of mushrooms also increased 44% over the same
treatments. Since substrate fragmentation and supplementation were always applied
181 together in this experiment, it is not possible to elucidate the influence of one factor over the other. However, Rasmussen (1959) showed the stimulatory effect of substrate fragmentation during the production cycle of A. bisporus. He demonstrated that yields increased when the colonized compost was fragmented 7 to 14 days after spawning.
Schisler (1964) demonstrated that fragmentation of compost after 2nd break increased yield substantially over non-fragmented 2nd break compost. Therefore fragmentation of the substrate is important in order to promote vigorous re-growth of the mycelium and probably primordia formation. Observations by the author indicate that in general, after first break, P. eryngii mycelium rarely forms additional pins if the substrate remains unaltered. Still, pinning can be induced by placing a casing layer over an undisturbed colonized substrate.
The use of a casing layer in A. bisporus production is essential. Factors such as casing layer depth, chemical and microbial composition, physical properties and moisture content of the casing layer play important roles in yield and quality of mushrooms (Hayes
1981, Schroeder and Schisler 1981, Kalberer 1985, Cochet et al. 1992, Pardo et al. 2002,
Gulser and Peksen 2003). However, limited information is available regarding casing soils in P. eryngii. Rana et al. (2000) reported that certain isolates of P. eryngii cased with different materials may be prone to develop warts and yellowing and be more susceptible to Trichoderma viridae, Cladobotryum dendroides and bacterial infections. In these experiments, green molds or pathogens that negatively affect yield or quality of the mushrooms were not observed. Although pilei brightness significantly dropped, changes may be imperceptible to the naked eye. On the other hand, lower solids content of basidiomata obtained as result of the casing overlay should be further evaluated to
182 determine changes in shelf life. Other studies regarding nutritional qualities and texture of the basidiomata should be undertaken in order to obtain a more comprehensive evaluation of the influences of the casing overlay in quality of basidiomata. Casing layer residues on mushrooms may not represent a major problem since manual or mechanical cleaning or washing is often performed for other edible species (Kopytowski et al. 2006).
Availability of the peat (casing material) is a concern in some regions around the world where button mushrooms are produced. Therefore, some research efforts have been devoted to a search for alternative materials that may be used as a substitute or in combination with the peat (Gulser and Peksen 2003, Noble and Dobrovin-Pennington
2004). This task has not been easy to accomplish, since microbial populations in the casing material are important to promote fructification in A. bisporus. Microorganisms do not play a role in promoting pinning of P. eryngii and different soils may be used as casing materials in this specialty mushroom (Rana et al. 2000, Zervakis and Venturella
2002).
The use of a casing overlay itself proved to be an effective way to increase yields and BEs by 141% when yield from a one-break-crop (standard “non-casing” method) was compared with a cased-substrate (“casing” method). A non-cased substrate would produce 106% higher yield if cased after a first harvest. Therefore, casing before first flush produced better yield and BE avoiding the additional step of “spent” substrate fragmentation. On the other hand, supplementation itself with Remo’s at substrate fragmentation resulted in yield increases of 14% compared to the non-supplemented treatments. When a casing overlay and nutrient supplement were used together, yields increased by 176% over non-cased, non-supplemented substrates. Casing and
183 supplementation of the substrate used to produce P. eryngii are relatively easy and low cost cultural practices that may be successfully used to enhance yields and BE in this species.
184 Chapter 8: General Conclusions
Phylogenetic studies were performed for four varieties of the P. eryngii species
complex (eryngii, ferulae, nebrodensis and elaeoselini) and allied taxa. Four genomic
regions were evaluated for their usefulness to elucidate evolutionary pathways among the taxa. The ITS region of rDNA showed minor sequence differences among three varieties
(elaeoselini, ferulae and eryngii). This region also had some degree of intra-isolate polymorphism in some isolates. The partial β-tubulin gene examined in this study was highly polymorphic within a single isolate, especially in the var. eryngii but was essentially non-variable in var. nebrodensis. These intra-isolate polymorphisms complicated the phylogenetic reconstruction in var. eryngii, elaeoselini and ferulae. Still, the var. nebrodensis was well separated in both ITS and β-tubulin gene genealogies. In order to define gene pools among the isolates, a non-phylogenetic approach was undertaken. It appears that β-tubulin alleles from different varieties are not shared between them and, therefore, these varieties might be reproductively isolated in nature.
Populations of var. ferulae might also be isolated since only one allele was shared by three isolates. Partial tef1 and RPB2 genes, used in combination, provided the best phylogenetic resolution showing that three varieties (eryngii, elaeoselini and ferulae) are closely related and share a common ancestor. Pleurotus eryngii var. nebrodensis was clearly distinguished from the other three varieties in all of the phylogenies constructed here. Therefore, the author concludes that the variety nebrodensis should be considered a different species. However, ferula, eryngii and elaeoselini taxa should still be considered varieties of the P. eryngii species complex.
185 Isolates of the var. eryngii, ferulae, elaeoselini, and P. nebrodensis were cultivated under conditions optimized for var. eryngii, the most widely cultivated variety.
Therefore, most isolates of var. eryngii evaluated in this study produced mushrooms while the majority of the P. nebrodensis isolates did not fructify. Important information regarding productivity and morphological features for isolates of P. eryngii var. eryngii
are given in this work. The author expects that the information provided here might be of
utility to growers and breeders interested in commercially producing and improving
cultivars of this species.
At the beginning of this work, The Pennsylvania State University Mushroom
Culture Collection (PSUMCC) had only seven isolates of P. eryngii var. eryngii and only
two isolates of P. nebrodensis. The author sought to acquire a broad representation of the
genetic diversity in P. eryngii. For about a year, isolates were received from several parts
of the world. Most of the isolates were cultured, characterized, stored in liquid nitrogen
and included in this study. Now, the culture collection holds isolates of two more
varieties: ferulae and elaeoselini. In total, the PSUMCC holds approximately 70 isolates
what have been accurately identified based on molecular information.
Cultural practices that might be easily adapted to commercial production
conditions were useful to enhance concentration of the antioxidants selenium (Se) and
ergothioneine (ERGO) in P. eryngii var. eryngii basidiomata. Se supplementation of the
substrate with sodium selenite (Na2SeO3) proved to be a convenient way to increase the
concentration of this element in basidiomata. Mushrooms were found to efficiently
uptake and accumulate Se from the substrate. No negative yield effects were observed as
result of supplementation at 5 and 10 μg/g. ERGO concentration was enhanced by low-
186 moisture content substrates (55%). The negative effect (low yields) resulting from the use of a low-moisture substrate in mushroom cultivation was overcome by using a casing overlay. In fact, casing also allowed the production of two additional flushes. The use of a casing layer itself increased yield up to 141% in P. eryngii var. eryngii.
Supplementation of the substrate with delayed-release nutrient (Remo’s) after colonization of the substrate also proved to be effective in increasing yields by up to
14%. Supplementation and casing of the substrate at fragmentation together increased yield by 176% over a non-cased, non-supplemented substrate. Therefore this practice might be highly recommended for commercial production of P. eryngii var. eryngii.
187 Appendix A: Sequence alignment of partial tef1 and RPB2 genes from the
Pleurotus eryngii species complex
a) tef1 gene
Ery (Pe-AL1) GCGCTATCCT CATCATTGCC GCCGGTACTG GTGAATTCGA AGCTGGTATC [ 50] Fer (WC982) ...... [ 50] Ela (WC999) ...... [ 50] WC958 ...... [ 50] Neb (WC980) ...... [ 50]
Ery (Pe-AL1) TCCAAGGATG GCCAGACTCG TGAACACGCT CTCCTTGCCT TCACTCTCGG [100] Fer (WC982) ...... [100] Ela (WC999) ...... [100] WC958 ...... [100] Neb (WC980) ...... C..... [100] & 95 Ery (Pe-AL1) TGTCCGTCAA CTCATCGTTG CCATCAACAA GATGGACACA ACCAAGGTTT [150] Fer (WC982) ...... [150] Ela (WC999) ...... [150] WC958 ...... [150] Neb (WC980) ...... T...... [150] & 116 Ery (Pe-AL1) GTGACTCGCA TTTATTAGTT GTGACTAATT TTCCTGAGAA TTTTCGCAGT [200] Fer (WC982) ...... [200] Ela (WC999) ...... T...... [200] WC958 ...... Y...... [200] Neb (WC980) ...... A...... [200] & 188 Ery (Pe-AL1) GGAGCGAGGA CCGATTCAAC GAAATCATCA AGGAAACCTC TAACTTCATC [250] Fer (WC982) ...... C...... [250] Ela (WC999) ...... C...... [250] WC958 ...... C...... [250] Neb (WC980) ...... C...... [250] * 241 Ery (Pe-AL1) AAGAAGGTCG GCTACAACCC GAAGGCCGTT GCCTTCGTCC CCATCTCAGG [300] Fer (WC982) ...... T...... [300] Ela (WC999) ...... T...... [300] WC958 ...... T...... [300] Neb (WC980) ...... C...... [300] * & 271
188 Ery (Pe-AL1) ATGGCACGGT GACAACATGT TGGAGGAGTC CGTCAAGTAA GTACCCATAT [350] Fer (WC982) ...... [350] Ela (WC999) ...... [350] WC958 ...... [350] Neb (WC980) ...... [350]
Ery (Pe-AL1) GATTGATCTA AAGAGGCAAT GATCTTACCA TTTTCCAGCA TGACATGGTA [400] Fer (WC982) ...... C...... [400] Ela (WC999) ...... C...... [400] WC958 ...... Y...... C...... [400] Neb (WC980) ...... C...... [400] * 393
Ery (Pe-AL1) CAAGGGCTGG ACCAAGGAGA CCAAGGCCGG TGTCGTCAAG GGCAAGACCC [450] Fer (WC982) ...... [450] Ela (WC999) ...... [450] WC958 ...... [450] Neb (WC980) ...... [450]
Ery (Pe-AL1) TCCTCGATGC CATCGATGCC ATCGAACCCC CCGTCCGCCC CTCCGACAAG [500] Fer (WC982) ...... [500] Ela (WC999) ...... [500] WC958 ...... [500] Neb (WC980) ...... [500]
Ery (Pe-AL1) CCTCTCCGTC TTCCTCTCCA GGACGTCTAC AAGATC [536] Fer (WC982) ...... [536] Ela (WC999) ...... [536] WC958 ...... [536] Neb (WC980) ...... [536]
Note: Position numbers are given according to the sequence of Pe-AL1 (GenBank accession number in progress). * Positions reported by Marongiu et al. (2005) able to distinguish variety eryngii and ferulae. & Positions that unequivocally distinguish P. eryngii var. nebrodensis from the closest related P. eryngii complex.
b) RPB2-1 (f5F / b7.1R)
Ery (Pe-AL1) AATTCCTGGA GGAGTGGGGC TTGGAGTCCC TCGAAGAGAA CGCGCATTCA [ 50] Fer (WC982) ...... [ 50] Ela (WC999) ...... A...... [ 50] WC958 ...... A...... [ 50] Neb (WC980) .....T...... [ 50] & # 6 11
189 Ery (Pe-AL1) TCTATACCGT GTACGAAGGT CTTCGTCAAT GGTGTTTGGA TGGGTGTACA [100] Fer (WC982) ...... [100] Ela (WC999) ...... [100] WC958 ...... [100] Neb (WC980) ...... [100] Ery (Pe-AL1) TAGGGACCCG GCTAATCTCG TCAAAACGCT GAAGAAGCTT CGCAGGAAAG [150] Fer (WC982) ...... [150] Ela (WC999) ...... [150] WC958 ...... [150] Neb (WC980) ...... ?...... [150]
Ery (Pe-AL1) ATGACATCAG TCCCGAAGTC TCTGTCGTGC GAGACATCCG TGAAAAGGAG [200] Fer (WC982) ...... [200] Ela (WC999) ...... [200] WC958 ...... [200] Neb (WC980) .C...... [200] & 152 Ery (Pe-AL1) CTTAGGGTGT ACACCGACGC CGGGCGTGTT TGCAGGCCGC TGTTCATCGT [250] Fer (WC982) ...... [250] Ela (WC999) ...... [250] WC958 ...... [250] Neb (WC980) ...... Y...... [250]
Ery (Pe-AL1) CGAGAACCAT CAATTGCTCC TGCAGAAGAA GCATATCCGC TGGCTAAACC [300] Fer (WC982) ...... [300] Ela (WC999) ...... [300] WC958 ...... [300] Neb (WC980) ...... T...... C.... [300] & & 269 296 Ery (Pe-AL1) AAACCGTTGA TGATGCGGGC GAGCCATTCA AGTGGGACGG ACTCATCAGG [350] Fer (WC982) ...... [350] Ela (WC999) ...... [350] WC958 ...... [350] Neb (WC980) ...... Y...... [350]
Ery (Pe-AL1) AGTGGTGTTA TAGAGATGTT AGATGCCGAA GAGGAGGAGA CGGTTATGAT [400] Fer (WC982) ...... [400] Ela (WC999) ...... [400] WC958 ...... [400] Neb (WC980) ...... [400]
Ery (Pe-AL1) TTCCATGACC CCGGAGGATC TAGAGAACTC CCGATTGCAG CACGCTGGTG [450] Fer (WC982) ...... T ...... [450] Ela (WC999) ...... [450] WC958 ...... [450] Neb (WC980) ...... [450] * 410
190 Ery (Pe-AL1) TTGATACGAG GGTGAACGAT GGAGAGTTTG ACCCCGCCGC TCGTTTGAAG [500] Fer (WC982) ...... T...... T...... [500] Ela (WC999) ...... [500] WC958 ...... [500] Neb (WC980) ...... A...... G.. ...C...... [500] & & & 478 488 494
Ery (Pe-AL1) GCGAGCACCC ACGCGCACAC A [521] Fer (WC982) ...... [521] Ela (WC999) ...... [521] WC958 ...... [521] Neb (WC980) ...... [521]
c) RPB2-2 (b6.9F/b11R1)
Ery (Pe-AL1) AAAGCTCGGT CGATCGTGGT CTATTCCGGA GTATGTATTA CCGCAGTTAC [ 50] Fer (WC982) ...... [ 50] Ela (WC999) ...... T...... [ 50] WC958 ...... T...... [ 50] Neb (WC980) ...... [ 50] # 11 Ery (Pe-AL1) ATGGATCTCG AAAAGAAATC TGGAATCCAG CAGTTGGAAG AATTCGAGAA [100] Fer (WC982) ...... G...... C...... [100] Ela (WC999) ...... G...... [100] WC958 ...... G.. ...R...... [100] Neb (WC980) ...... G...... C...... [100] * * 75 84 Ery (Pe-AL1) GCCTTCTCGT GACAACACAC TTCGCATGAA ACATGGCACG TATGACAAAC [150] Fer (WC982) ...... [150] Ela (WC999) ...... [150] WC958 ...... [150] Neb (WC980) ...... [150]
Ery (Pe-AL1) TCGAGAATGA CGGCCTCATC GCTCCTGGAA CTGGTGTCGT TGGTGAAGAC [200] Fer (WC982) ...... C...... [200] Ela (WC999) ...... [200] WC958 ...... [200] Neb (WC980) ...... [200]
Ery (Pe-AL1) ATTATTATCG GCAAAACGGC GCCTATCCCT CCGGACAGTG AAGAACTTGG [250] Fer (WC982) ...... A...... [250] Ela (WC999) ...... [250] WC958 ...... [250] Neb (WC980) ...... T...... A...... [250] & & * 209 218 221
191 Ery (Pe-AL1) TCAGAGAACT CGCACTCATA CACGAAGAGA CGTGTCGACT CCGTTGAAGA [300] Fer (WC982) ...... [300] Ela (WC999) ...... [300] WC958 ...... [300] Neb (WC980) ...A...... [300] & 254 Ery (Pe-AL1) GTACGGAGAA TGGTATTGTG GATCAAGTCC TTATCACCAC CAACCACGAG [350] Fer (WC982) ...... [350] Ela (WC999) ...... T...... [350] WC958 ...... T...... [350] Neb (WC980) ...... [350] # 344 Ery (Pe-AL1) GGTCAGAAGT TCGTCAAAAT CAGAGTTCGT TCTACACGTA TCCCCCAGAT [400] Fer (WC982) ...... [400] Ela (WC999) ...... [400] WC958 ...... [400] Neb (WC980) ...... [400]
Ery (Pe-AL1) TGGCGATAAG TTTGCCTCGC GTCACGGGCA GAAGGGTACC ATTGGCATAA [450] Fer (WC982) ...... [450] Ela (WC999) ...... [450] WC958 ...... [450] Neb (WC980) ...... C...... [450] & 407 Ery (Pe-AL1) CATACAGACA AGAGGACATG CCCTTCACAT GCGAAGGAAT TGTTCCAGAT [500] Fer (WC982) ...... [500] Ela (WC999) ...... [500] WC958 ...... [500] Neb (WC980) ...... [500]
Ery (Pe-AL1) ATCATCATTA ACCCCCACGC CATTCCCTCA CGTATGACAA TCGGCCATCT [550] Fer (WC982) ...... [550] Ela (WC999) ...... [550] WC958 ...... [550] Neb (WC980) ...... G...... [550] & 527 Ery (Pe-AL1) TGTCGAATGT CTTCTTTCCA AGGTGGCCAC TCTTATCGGG AACGAAGGTG [600] Fer (WC982) ...... [600] Ela (WC999) ...... [600] WC958 ...... [600] Neb (WC980) ...... [600]
Ery (Pe-AL1) ACGCTACTCC ATTCACCGAT CTTACGGTCG AGTCCGTTTC CGCCTTCTTG [650] Fer (WC982) ...... G...... [650] Ela (WC999) ...... [650] WC958 ...... [650] Neb (WC980) ...... G..T..G...... [650] * & & 611 604 607
192 Ery (Pe-AL1) AGACAGAAAG GCTATCAGTC CCGTGGTCTG GAAGTGATGT ACCATGGTCA [700] Fer (WC982) ..G...... [700] Ela (WC999) ..G...... [700] WC958 ..G...... ?...... [700] Neb (WC980) ..G...... ?...... [700]
Ery (Pe-AL1) CACTGGCAGG AAGCTCCAAG CGCAGGTATA T [731] Fer (WC982) ...... [731] Ela (WC999) ...... [731] WC958 ...... [731] Neb (WC980) ...... [731]
* Varieties eryngii and ferulae distinguished by marked positions. & Positions that unequivocally distinguish P. eryngii var. nebrodensis from other groups within the P. eryngii complex. # Positions that distinguish P. eryngii var. elaeoselini from var. ferulae, eryngii and nebrodensis.
193 Appendix B: Phylogenetic tree for the Pleurotus eryngii species complex
based on combined sequences of the ITS regions and partial β-tubulin,
tef-1 and RPB2 genes
Phylogenetic consensus tree constructed for four varieties of P. eryngii (eryngii, ferulae,
elaeoselini, and nebrodensis) based on combined sequences of the ITS region and partial β- tubulin, tef1 and RPB2 genes. The Neighbor-Joining method and the p-nucleotide model were used to construct the tree. Bootstrap values were based on 1,000 replications. Pleurotus ostreatus was used as outgroup.
53 var. eryngii (WC888) var. eryngii (Pe-Al32) 89 var. eryngii (Pe-Al1) 76 var. eryngii (Pe-AL11) var. elaeoselini (WC999)
100 85 WC958
82 var. ferulae (WC927) var. ferulae (WC933)
92 var. ferulae (WC956) P. fuscus var. ferulae (WC994) 77 var. ferulae (WC966) 60 var. ferulae (WC969) var. nebrodensis (WC980) var. nebrodensis (WC979) 100 var. nebrodensis (WC977) P. ostreatus (WC971)
194 Appendix C: Substrate supplementation with selenium and histidine
a) Supplementation with selenium
Selenium was added as sodium selenite (Na2SeO3) to substrates to obtain concentrations of 5 and 10 μg/g (ppm) of the dry weight. The calculations were as follows:
4,000 g substrate (d.w.) x 5 μg/g = 0.02 g of Se4+ 1,000,000
4,000 g substrate (d.w.) x 10 μg/g = 0.04 g of Se4+ 1,000,000
Molecular weights (MW):
Na2SeO3 = 172.9 g/mol Se4+ = 78.96 g/mol
172.9 / 78.96 = 2.2
Therefore:
4+ (0.02 g of Se ) (2.2) = 0.044 g of Na2SeO3 to reach 5 μg/g in the substrate
4+ (0.04 g of Se ) (2.2) = 0.088 g of Na2SeO3 to reach 10 μg/g in the substrate
195 b) Supplementation with histidine
The amino acid histidine (C6H9N3O2) was added to substrate to obtain a concentration of 10 mM of the wet substrate (46 kg). The calculations are as follows:
Histidine MW = 155.16 g/mol
10 mM = 0.01 M
M = moles liters
Therefore:
Moles = M x L
(46 kg) (0.01 M) = 0.46 moles
(0.46 moles) (155.16 g/mol) = 71.37 g
Add 71.37 g of histidine to 46 kg of wet substrate in order to reach a concentration of 10 Mm.
196
Appendix D: Chemical analyses of substrate and basidiomata
a) Substrate
Elements1 N P K Ca Mg Mn Fe Cu B Al Zn Na Se
T4 %2 μg/g3 Se0ppm5 1.95 0.21 0.90 0.43 0.14 43 65 6 15 20 20 210 < 1.50 Se0ppm5 1.86 0.20 0.87 0.45 0.14 45 66 7 15 24 21 190 < 1.50 Se5ppm 2.16 0.19 0.83 0.46 0.13 41 70 5 16 25 16 214 8.21 Se5ppm 2.05 0.24 0.98 0.45 0.15 45 67 11 16 26 22 265 8.00 Se10ppm 2.23 0.22 0.98 0.49 0.15 44 57 9 17 18 21 218 15.22 Se10ppm 1.92 0.22 0.93 0.55 0.14 48 62 13 16 24 26 197 13.62
1 Nitrogen (N), Phosphorus (P), Potassium (K), Calcium (Ca), Magnesium (Mg), Manganese (Mn), Iron (Fe), Copper (Cu), Boron (B), Aluminum (Al), Zinc (Zn), Sodium (Na). 2 Percentage of the dry weight 3 Concentration, same as parts per million (ppm) 4 Each treatment has two replicates 5 Non-supplemented substrate (control)
197
b) Basidiomata
Elements1 N P K Ca Mg Mn Fe Cu B Al Zn Na Se
T4 %2 μg/g3 Se0ppm5 3.40 0.70 1.92 0.002 0.10 5 24 6 22 1 50 117 < 1.50 Se0ppm5 3.31 0.70 1.90 0.002 0.10 5 25 6 21 1 51 117 < 1.50 Se5ppm 3.53 0.68 1.86 0.011 0.10 7 27 6 16 2 56 130 4.55 Se5ppm 3.49 0.67 1.81 0.002 0.10 6 25 5 18 1 55 127 4.74 Se10ppm 4.15 0.76 2.06 0.004 0.11 7 28 5 14 1 67 149 9.00 Se10ppm 4.12 0.76 2.06 0.004 0.11 7 28 5 13 < 1 66 152 9.60
1 Nitrogen (N), Phosphorus (P), Potassium (K), Calcium (Ca), Magnesium (Mg), Manganese (Mn), Iron (Fe), Copper (Cu), Boron (B), Aluminum (Al), Zinc (Zn), Sodium (Na). 2 Percentage of the dry weight 3 Concentration, same as parts per million (ppm) 4 Each treatment has two replicates 5 Non-supplemented substrate (control)
198 Literature Cited
Akanmu, D., Cecchini, R., Aruoma, O. I., and Halliwell, B. 1991. The antioxidant action
of ergothioneine. Arch. Biochem. Biophys. 288:10-16.
Alexopoulos, C. J., Mims, C. W., and Blackwell, M. 1996. Introductory Mycology. 4th
ed. John Wiley & Sons, Inc., NY, USA.
Bae, S. C., Seong, K. Y, Lee, S. W., Go, S. J., Eun, M. Y., and Rhee, I. K. 1996.
Phylogenetic relationships among Pleurotus species inferred from sequence data
of PCR amplified ITS II region in ribosomal DNA. Korean J. Mycol. 24:155-165.
Bakkeren, G., Kronstad, J. W., and Levesque, C. A. 2000. Comparison of AFLP
fingerprints and ITS sequences as phylogenetic markers in Ustilaginomycetes.
Mycologia 92:510-521.
Bao, D., Aimi, T., and Kitamoto, Y. 2005. Cladistic relationships among the Pleurotus
ostreatus complex, the Pleurotus pulmonarius complex, and Pleurotus eryngii
based on the mitochondrial small subunit ribosomal DNA sequence analysis. J.
Wood Sci. 51:77-82.
Bao, D., Ishihara, H., Mori, N., and Kitamoto, Y. 2004a. Phylogenetic analysis of oyster
mushrooms (Pleurotus spp.) based on restriction fragment length polymorphism
of the 5' portion of 26S rDNA. J. Wood Sci. 50:169-176.
Bao, D., Kinugasa, S., and Kitamoto, Y. 2004b. The biological species of oyster
mushrooms (Pleurotus spp.) from Asia based on mating compatibility test. J.
Wood Sci. 50:162-168.
199 Beech, R., Prichard, R. K., and Scott, M. E. 1994. Genetic variability of the β-tubulin
genes in benzimidazole-susceptible and -resistant strains of Haemonchus
contortus. Genetics 138:103-110.
Beelman, R. B., and Royse, D. J. 2006. Selenium enrichment of Pleurotus cornucopiae
(Paulet) Rollant and Grifola frondosa (Dicks.:Fr.) S.F. gray mushrooms. Int. J.
Med. Mush. 8:1-8.
Begerow, D., John, B., and Oberwinkler, F. 2004. Evolutionary relationships among β-
tubulin gene sequences of basidiomycetous fungi. Mycol. Res. 108:1257-1263.
Blondel, J., and Aronson, J. 1999. Biology and wildlife of the Mediterranean region.
Oxford University Press., New York.
Boisselier-Dubayle, M. C. 1983. Taxonomic significance of enzyme polymorphism
among isolates of Pleurotus (Basidiomycetes) from Umbellifers. Trans. Br.
Mycol. Soc. 81:121-128.
Boisselier-Dubayle, M. C, and Baudoin, R. 1986. Contribution de l'etude du
polymorphisme enzymatique a la systematique des Pleurotes des Ombelliferes.
Can. J. Bot. 64:1467-1473.
Bresinsky, A., Fischer, M., Meixner, B., and Paulus, W. 1987. Speciation in Pleurotus.
Mycologia 79:234-245.
Bridge, P. D., Roberts, P. J., Spooner, B. M., and Panchal, G. 2003. On the unreliability
of published DNA sequences. New Phytol. 160:43-48.
Buchanan, P. K. 1993. Identification, names and nomenclature of common edible
mushrooms. In: Mushroom Biology and Mushroom Products. Chang, S. T.,
Buswell, J. A., and Chiu, S. W. eds. The Chinese University Press, Hong Kong.
200 Cailleux, R., and Diop, A. 1976. Recherches preliminaires sur la fructification en culture
du Pleurotus eryngii (Fr. ex D.C.) Quelet. Rev. Mycol. 40:365-388.
Cailleux, R., Diop, A., and Joly, P. 1981. Relations d'interfertilite entre quelques
representants des pleurotes des ombelliferes. Bull. Soc. Mycol. Fr. 97:99-124.
Cailleux, R., and Joly, P. 1987. Etude de quelques stations italiennes du Pleurote de la
ferule. Bull. Soc. Myc. Fr. 103:315-346.
Campbell, C. S., Wojciechowski, M. F., Baldwin, B. G., Alice, L. A., Donoghue, M. J.
1997. Persistent nuclear ribosomal DNA sequence polymorphism in the
amelanchier agamic complex (Rosaceae). Mol Biol Evol 14:81-90.
Candusso, M., and Basso, M. T. 1995. Analisi comparativa di Pleurotus eryngii e P.
nebrodensis. Docum. Mycol. 25:119-128.
Chang, S. T. 1999. World production of cultivated edible and medicinal mushrooms in
1997 with emphazis on Lentinula edodes (Berk.) Sing. in China. Int. J. Med.
Mush. 1:291-300.
Chang, S. T. 2005. Witnessing the development of the mushroom industry in China. In:
Mushroom Biology and Mushroom Products. Tan, Q., Zhang, J., Chen, M., Cao,
H., Buswell, J. A. eds. Shanghai Xinhua Printing Co., Ltd. Shanghai, China. Acta
Edulis Fungi 12:3-19.
Chang, S. T. 2006. The world mushroom industry: trends and technological development.
Int. J. Med. Mush. 8:297-314.
Choi, S. W., and Sappers, M. 1994. Effects of washing on polyphenols and polyphenol
oxidase in commercial mushrooms (Agaricus bisporus). J. Agric. Food Chem.
42:2286-2290.
201 Cochet, N., Gillman, A., and Lebeault, J. M. 1992. Some biological characteristics of the
casing soil and their effect during Agaricus bisporus fructification. Acta
Biotechnol. 12:411-419.
Coli, R., Granetti, B., Damiani, P., and Fidanza, F. 1988. Composizione chemica e valore
nutritivo di alcuni ceppi di Pleurotus eryngii, P. nebrodensis e P. ostreatus
coltivati in serra. Annali. Fac. Agr. Univ. Perugi 152:847-859.
Combs, G. F., Clark, L. C., and Turnbull, B. W. 1997. Reduction of cancer risk with an
oral supplement of selenium. Biomed. Environ. Sci. 10:227-234.
Corner, E.J.H. 1981. The Agaric genera Lentinus, Panus, and Pleurotus with particular reference
to Malaysian species. Beihefte zur Nova Hedwigia 69:1-169.
Curvetto, N. R., Figlas, D., Devalis, R., and Delmastro, S. 2002. Growth and productivity
of different Pleurotus ostreatus strains on sunflower seed hulls supplemented with
+ N-NH4 and/or Mn(II). Bioresource Technol. 84:171-176.
Deacon, J. 2006. Fungal Biology. 4th ed. Blackwell publisher. Malden, MA.
De Gioia, T., Sisto, D., Rana, G. L., and Figliuolo, G. 2005. Genetic structure of the
Pleurotus eryngii species-complex. Mycol. Res. 109:71-80.
Doyle J. J. 1995. The irrelevance of allele tree topologies for species delimitation, and a
non-topological alternative. Syst. Bot. 20:574-588.
Dubost, N. J., Beelman, R. B., Peterson, D., and Royse, D. J. 2006. Identification and
quantification of ergothioneine in cultivated mushrooms by liquid
chromatography-mass spectroscopy. Int. J. Med. Mush. 8:215-222.
Dubost, N. J., Beelman, R. B., and Royse, D. J. 2007a. Influence of selected cultural
factors and postharvest storage on ergothioneine content of common button
202 mushroom Agaricus bisporus (J. Lge) Imbach (Agaricomycetideae). Int. J. Med.
Mush. 9:163-176.
Dubost, N. J., Ou, B., Beelman, R. B. 2007b. Quantification of polyphenols and
ergothioneine in cultivated mushrooms and correlation to total antioxidant
capacity. Food Chem. 105:727-735.
Elhuyar Fundazioa 2006. Sequencing of the oyster mushroom genome. In: Science Daily.
http://www.sciencedaily.com/releases/2006/10/061004/80016.htm. Accessed
April 2008.
Ey, J., Schomig, E., and Taubert, D. 2007. Dietary sources and antioxidant effects of
ergothioneine. J. Agric. Food Chem. 55:6466-6474.
Franzke, A., and Mummenhoff, K. 1999. Recent hybrid speciation in Cardamine
(Brassicaceae) - conversion of nuclear ribosomal ITS sequences in statu nascendi.
Theor. Appl. Genet. 98:831-834.
Froslev, T. G., Matheny, P. B., and Hibbett, D. S. 2005. Lower level relationships in the
mushroom genus Cortinarius (Basidiomycota, Agaricales): A comparison of
RPB1, RPB2, and ITS phylogenies. Mol. Phylogenet. Evol. 37:602-618.
Genghof, D. S. and Van Damme. 1964. Biosynthesis of ergothioneine and hercynine by
mycobacteria. J. Bacteriol. 87:852-862.
Gonzalez, P., and Labarere, J. 2000. Phylogenetic relationships of Pleurotus species
according to the sequence and secondary structure of the mitochondrial small-
subunit rRNA V4, V6 and V9 domains. Microbiology 146:209-221.
203 Grenetti, B. 1987. Stimulating effect of ferulic acid on mycelium growth in vitro of some
strains of Pleurotus eryngii and Pleurotus nebrodensis. Annali Fac. Agr. Univ.
Perugia. 151:889-907.
Grove, A. T., and Rackham, O. 2001. The nature of Mediterranean Europe. An ecological
history. Yale University Press. New Haven and London.
Gulser, C., and Peksen, A., 2003. Using tea waste as a new casing material in mushroom
(Agaricus bisporus (L.) Sing.) cultivation. Bioresource Technol. 88:153-156.
Harrison, C. J., and Langdale, J. 2006. A step by step guide to phylogeny reconstruction.
Plant J. 45:561-572.
Hartman, P. E. 1990. Ergothioneine as antioxidant. Meth. Enzy. 186:310-318.
Hayes, W. A. 1981. Interrelated studies of physical, chemical and biological factors in
casing soils and relationships with productivity in commercial culture of Agaricus
bisporus. Mush. Sci. 11:103-129.
Hilber, O. 1977. Zur systematik der section Pleurotus. Acta. Sci. Nat. Mus. Bohem.
Merid. Ceske Budejovice 17:128-133.
Hilber, O. 1989. Valid, invalid and confusing taxa of the genus Pleurotus. Mush. Sci. 12:
241-248.
Horneck, D. A., and Miller, R. O. 1998. Determination of total nitrogen in plant tissue.
In: Handbook and Reference Methods for Plant Analysis. Kalra, Y. P. ed. CRC
Press, New York, USA.
Hu, D. 2003. Mushroom industry in China "small mushrooms and big bussiness". In: LEI
Projects in China. http://www.lei.dlo.nl/leichina/project.php3?id=11. Accessed
May 2007.
204 Institute of Medicine, Food and Nutrition Board. 2000. Dietary reference intakes: vitamin
C, vitamin E, Selenium, and Carotenoids. National Academy Press, Washington,
D.C.
Isikhuemhen, O., Moncalvo, J. M., Nerud, F., and Vilgalys, R. 2000. Mating
compatibility and phylogeography in Pleurotus tuberregium. Mycol. Res.
104:732-737.
James, T. Y., Moncalvo, J. M., Li, S., and Vilgalys, R. 2001. Polymorphism at the
ribosomal DNA spacers and its relation to breeding structure of the widespread
mushroom Schizopgyllum commune. Genetics 157:149-161.
Jiménez-Gasco, M. M., Navas-Cortes, J. A., and Jimenez-Diaz, R. M. 2004. The
Fusarium oxysporum f. sp. ciceris/Cicer arietinum pathosystem: a case study f the
evolution of plant pathogenic fungi into races and pathotypes. Int. Microbiol.
7:95-104.
Jung, M. K. and Oakley, B. R. 1990. Identification of an amino acid substitution in the
benA, β-tubulin gene of Aspergillus nidulans that confers thiabendazole resistance
and benomyl supersensitivity. Cell Motil. Cytoskel. 17:87-94.
Kalberer, P. P. 1985. Influence of the depth of the casing layer on the water extraction
from casing soil and substrate by the sporophores, on the yield and on the dry
matter content of the fruit bodies of the first three flushes of the cultivated
mushroom, Agaricus bisporus. Scientia Hortic. 27:33-43.
Kang, R. 2004. Report on Awei mushroom (Pleurotus nebrodensis) farms in Kunming
and Beijing. In: MushWorld. http://www.mushworld.com/oversea/view.asp?cata_
id=5120&vid=6621. Accessed March, 2007.
205 Kauserud, H., and Schumacher, T. 2003. Ribosomal DNA variation, recombination and
inheritance in the basidiomycete Trichaptum abietinum: implications for reticulate
evolution. Heredity 91:163-172.
Kauserud, H., Svegarden, I. B., Decock, C., and Hallenberg, N. 2007. Hybridization
among cryptic species of the cellar fungus Conidiophora puteana
(Basidiomycota). Mol. Ecol. 16:389-399.
Kawano, H., Higuichi, F., Mayumi, T., Hama, T. 1982. Studies on ergothioneine. VII.
Some effects of ergotioneine on glycolytic metabolism in red blood cells from
rats. Chem. Pharm. Bull. 30:2611-2613.
Kim, B. G., Shin, P. G., Jeon, M. J., Park, S. C., Yoo, Y. B., Ryu, J. C. and Kwon, S. T.
1997. Isolation and sequencing of the cDNA encoding β-tubulin from Pleurotus
sajor-caju. Korean J. Mycol. 25:1-5.
Kim, B. G., Yoo, Y. B., Kwon, S. T., and Magae, Y. 2001. Molecular Characterization of
β-tubulin gene from Pleurotus sajor-caju. Biosci. Biotechnol. Biochem. 65:2280-
2283.
Koenraadt, H., Somerville, S. C. and Jones, A. L. 1992. Characterization of mutations in
the beta-tubulin gene of benomyl resistant field strains of Venturia inaequalis and
other plant pathogenic fungi. Phytopathology 82:1348-1354.
Kopytowski Filho, J., Minhoni M. T. A., and Rodriguez Estrada., A. E. 2006. Agaricus
blazei: "The Almond Portabello", Cultivation and commercialization. Mushroom
News 54:22-28.
206 Kumar, S., Tamura, K., and Nei, M. 2004. MEGA3: Integrated software for molecular
evolutionary genetics analysis and sequence alignment. Brief. Bioinform. 5:150-
163.
La Guardia, M., Venturella, G., Venturella, F. 2005. On the chemical composition and
nutritional value of Pleurotus taxa growing on Umbelliferous plants (Apiaceae). J.
Agric. Food Chem. 53:5997-6002.
Lamoure, D. 1981. Pleurotus eryngii et ses formes voisines. Bull. Soc. Mycol. Fr. 97:87-
93.
Landvik, S., Eriksson, O. E., and Berbee, M. L. 2001. Neolecta - a fungal dinosaur?
Evidence from β-tubulin amino acid sequences. Mycologia 93:1151-1163.
Lewinsohn, D., Nevo, E., Hadar, Y., Wasser, S. P., and Beharav, A. 2000.
Ecogeographical variation in the Pleurotus eryngii complex in Israel. Mycol. Res.
104:1184-1190.
Lewinsohn, D., Nevo, E., Wasser, S. P., Hadar, Y., Beharav, A. 2001. Genetic diversity
in populations of Pleurotus eryngii complex in Israel. Mycol. Res. 8:941-951.
Lewinsohn, D., Wasser, S. P., Reshetnikov, S. V., Hadar, Y., Nevo, E. 2002. The
Pleurotus eryngii species-complex in Israel: distribution and morphological
description of a new taxon. Mycotaxon 81:51-67.
Li, W. H. 1997. Molecular Evolution. Sinauer Associates Inc. ed. Massachusetts, USA.
Liu, Y. J., Whelen, S., and Hall, D. 1999. Phylogenetic relationships among
Ascomycetes: evidence from an RNA polymerase II subunit. Mol. Biol. Evol.
16:1799-1808.
207 Lutzoni, F., Kauff, F., Cox, C., McLaughlin, D., Celio, G., Dentinger, B., Padamsee, M.,
Hibbett, D., James, T., Baloch, E., Grube, M., Reeb, V., Hofstetter, V., Schoch,
C., Arnold, E., Miadlikowska, J., Spatafora, J., Johnson, D., Hambleton. S.,
Crockett, M., Shoemaker, R., Sung, G. H., Lucking, R., Lumbsch, T., O'Donnell,
K., Binder, M., Diederich, P., Ertz, D., Gueidan, C., Hansen, K., Harris, R.,
Hosaka, K., Lim, Y. W., Matheny, B., Nishida, H., Pfister, D., Rogers, J.,
Rossman, A., Schmitt, I., Sipman, H., Stone, J., Sugiyama, J., Yahr, R., and
Vilgalys, R. 2004. Assembling the fungal tree of life: Progress, classifications,
and evolution of subcellular traits. Am. J. Bot. 91:1446-1480.
Marongiu, P., Maddau, L., Frisullo, S., and Marras., F. 2005. A multigene approach for
the taxonomic determination of Pleurotus eryngii isolates. In: Mushroom Biology
and Mushroom Products. Tan, Q., Zhang, J., Chen, M., Cao, H., Buswell, J. A.
eds. Shanghai Xinhua Printing Co., Ltd. Shanghai, China. Acta Edulis Fungi
12:89-91.
Marongiu, P., Maddau, L., Marras, F. 2004. Identificazione rapida di isolati di Pleurotus
eryngii mediante analisi PCR-RFLP. Micol. Ital. 33:23-27.
Matheny, P. B. 2005. Improving phylogenetic inference of mushrooms with RPB1 and
RPB2 nucleotide sequences (Inocybe; Agaricales). Mol. Phylogenet. Evol. 35:1-
20.
Matheny, P. B. 2006. PCR primers to amplify and sequence rpb2 (RNA polymerase II
second largest subunit) in the Basidiomycota (Fungi).
http://www.clarku.edu/faculty/dhibbett. Accessed March 28, 2007.
208 Matheny, P. B., Curtis, J. M., Hofstetter, V., Aime, M. C., Moncalvo, J. M., Ge, Z. W.,
Yang, Z. L., Slot, J. C., Ammirati, J. F., Baroni, T. J., Bougher, N. L., Hughes, K.
W., Lodge, D. J., Kerrigan, R. W., Seidl, M. T., Aanen, D. K., Matthew, D.,
Daniele, G. M., Desjardin, D. E., Kropp, B. R., Norvell, L. L., Parker, A.,
Vellinga, E. C., Vilgalys, R., and Hibbett, D. S. 2006. Major clades of Agaricales:
a multilocus phylogenetic overview. Mycologia 98:982-995.
Matheny, P. B., Liu, Y. J., Ammirati, J. F., and Hall, B. 2002. Using RPB1 sequences to
improve phylogenetic inference among mushrooms (Inocybe, Agaricales). Am. J.
Bot. 89:688-698.
Matheny, P. B., Wang, Z., Binder, M., Curtis, J. M., Lim, Y. W., Nilsson, H., Hughes, K.
W., Hofstetter, V., Ammirati, J. F., Schoch, C. L., Langer, E., Langer, G.,
McLaughlin, D. J., Wilson, A. W., Froslev, T., Ge, Z. W., Kerrigan, R. W., Slot,
J. C., Yang, Z. L., Baroni, T. J., Fischer, M., Hosaka, K., Matsuura, K., Seidl, M.
T., Vauras, J., and Hibbett, D. S. 2007. Contributions of rpb2 and tef1 to the
phylogeny of mushrooms and allies (Basidiomycota, Fungi). Mol. Phylogenet.
Evol. 43:430-451.
Mattila, P., Konko, K., Eurola, M., Pihlava, J. M., Astola, J., Vahteristo, L., Hietaniemi,
V., Kumpulainen, Valtonenm M., and Piironen, V. 2001. Vitamins, mineral
elements and some phenolics compounds in cultivated mushrooms. J. Agric. Food
Chem. 49:2343-2348.
Matsuo, T., Yamamoto, Y., Muraguchi, H., and Kamada, T. 1999. Effects of amino-acid
substitutions in β-tubulin on benomyl sensitivity and microtubule functions in
Coprinus cinereus. Mycoscience 40:241-249.
209 Mau, J. L., Lin, Y. P., Chen, P.T., Wu, Y. H., Peng, J. T. 1998. Flavor compounds in king
oyster mushrooms Pleurotus eryngii. J. Agric. Food Chem. 46:4587-4581.
Mau, J. L., Lin, H. C., and Song, S. F. 2002. Antioxidant properties of several specialty
mushrooms. Food Res. Int. 35:519-526.
Melville, D. B. 1958. Ergothioneine. Vitam. and Horm. 17:155-204.
Melville, D. B., Genghof, D. S., Inamine, E., and Kovalenko. 1956. Ergothioneine in
microorganisms. J. Biol. Chem. 223:9-17.
Miller, R. O. 1998. High-Temperature Oxidation: Dry Ashing. In: Handbook and
Reference Methods for Plant Analysis. Kalra, Y. P. ed. CRC Press, New York.
Mutanen, M. 1986. Bioavailability of selenium in mushrooms, Boletus edulis, to young
women. Int. J. Vitam. Nutr. Res. 56:297-301
Myllys, L., Stenroos, S. and Thell, A. 2002. New genes for phylogenetic studies of
lichenized fungi: glyceraldehyde-3-phosphate dehydrogenase and beta-tubulin
genes. Lichenologist 34: 237-246.
Nei, M., and Kumar, S. 2000. Molecular evolution and phylogenetics. Oxford University
Press. New York.
Nelson, D. L., and Cox, M. M. 2001. Lehninger principles of biochemistry. Worth
Publishers. New York.
Noble, R., and Dobrovin-Pennington, A. 2004. Use of fine particle tailings in mushroom
casing. Mush. Sci. 16:335–341.
O'Donnell, K., and Cigelnik, E. 1997. Two divergent intragenomic rDNA ITS 2 types
within a monophyletic lineage of the fungus Fusarium are nonorthologous. Mol.
Phylogenet. Evol. 7:103-116.
210 O'Donnell, K. C., Cigelnik, E., and Nirenberg, H. I. 1998. Molecular systematics and
phylogeography of the Giberella fujikuroi species complex. Mycologia 90:465-
493.
Office of Dietary Supplements (ODS). 2004. Dietary Supplement Fact Sheet: Selenium,
National Institute of Health. http://dietary-supplements.info.nih.gov/factsheets/
selenium.asp. Accessed February 28, 2008.
Oei, P. 2006. Italy: halfway Holland and China. Mushroom Business. 16:10-11.
Ogra, Y., Ishiwata, K., Encinar, J. R., Lobinski, R., and Suzuki, K. T. 2004. Speciation of
selenium in selenium-enriched shiitake mushroom, Lentinula edodes. Anal.
Bioanal. Chem. 379:861-866.
Okabe, I., Arakawa, M., and Matsumoto, N. 2001. ITS polymorphism within a single
strain of Sclerotium rolfsii. Mycoscience 42:107-113.
Okabe, I., and Matsumoto, N. 2003. Phylogenetic relationship of Sclerotium rolfsii
(teleomorph Athelia rolfsii) and S. delphinii based on ITS sequences. Mycol. Res.
107:164-168.
Orbach, M. J., Porro, E. B. and Yanofsky, C. 1986. Cloning and characterization of the
gene for β-tubulin from a benomyl-resistant mutant of Neurospora crassa and its
uses as a dominant marker. Mol. Cell. Biol. 6:2452-2461.
Pardo, A., DeJuan, J. A., and Pardo, J. E. 2002. Bacterial activity in different types of
casing during mushroom cultivation (Agaricus bisporus (Lange) Imbach). Acta
Aliment 31:327-342.
Pegler, D. 1983. The Genus Lentinus. A world monograph. Kew. Bull. Additional Series
No. 10. HMSO, London.
211 Peng, J. T., Dai, M. C., Tsai, Y. F., Chen, M. H., and Chen, J. T. 2001. Selection and
breeding of king oyster mushroom. Jour. Agric. Res. China 50:43-58.
Pennington, J. A, and Young, B. E. 1991. Total diet study nutritional elements, 1982-
1989. J. Am. Diet. Assoc. 91:179-183.
Pennington, J. A., Schoen, S. A. 1996. Contributions of food groups to estimated intakes
of nutritional elements: Results from the FDA total diet studies, 1982-91. Int. J.
Vitam. Nutr. Res. 66:342-349.
Piepponen, S., Liukkonen-Lilja, H., and Kuusi, T. 1983. The selenium content of edible
mushrooms in Finland. Z. Lebensm. Unters. Forsch. 177:257-260.
Rana, G. L., Marino, R., Sisto, D., and Candido, V., 2000. Effetti di tre tipi di terreno di
copertura sulla comparsa delle verruche sul fungo cardoncello. Agricoltura
Ricerca 188:113-121.
Rasmussen, C. R., 1959. “Shake-up-spawning". Mush. Sci. 4:21–29.
Rauscher, J. T., Doyle, J. J., and Brown, H. D. 2002. Internal transcribed spacer repeat-
specific primers and the analysis of hybridization in the Glycine tomentella
(Leguminosae) polyploid complex. Mol. Ecol. 11:2691-2702.
Ro, H. S, Kim, S. S., Ryu, J. S., Jeon, C. O., Lee, T. S., Lee, H. S. 2007. Comparative
studies on the diversity of the edible mushroom Pleurotus eryngii: ITS sequence
analysis, RAPD fingerprinting, and physiological characteristics. Mycol. Res.
111:710-715.
Rodriguez Estrada, A. E. 2005. Influence of substrate composition and mushroom strains
on productivity and susceptibility of Pleurotus eryngii to bacterial blotch disease.
M.S. Thesis. The Pennsylvania State University.
212 Rodriguez Estrada, A. E, and Royse, D. J. 2005. Cultivation of Pleurotus eryngii in
bottles. Mush. News 53:10–19.
Rodriguez Estrada, A. E. and Royse, D. J. 2006. Bacterial blotch of the king oyster
mushroom: effects of strain and substrate supplementation on disease severity. Mush.
News. 54:14-21.
Rodriguez Estrada, A. E., Royse, D. J. 2007. Yield, size and bacterial blotch resistance of
Pleurotus eryngii grown on cottonseed hulls/oak sawdust supplemented with
manganese, copper and whole ground soybean. Bioresource Technol. 98:1898-
1906.
Rodriguez Estrada, A. E., and Royse, D. J. 2008. Pleurotus eryngii and Pleurotus
nebrodensis: from the wild to the commercial production. Mush. News. 56:4-11.
Rodriguez Estrada, A. E, and Royse, D. J. Pleurotus eryngii (DC.Fr.) QUEL. In:
Mushroom treasures. Earth EcoSciences Publishing Company, Sacramento,
California, U.S.A (In press).
Rodriguez Estrada, A. E., Royse, D. J., and Jimenez-Gasco, M. M. 2008. Nucleotide
sequence polymorphisms of the partial β-tubulin gene in two varieties of Pleurotus
eryngii. Mush. Sci. 17:83-96 (CD-ROM).
Roger, A. J., Sandblom, O., Doolittle, W. F., Philippe, H. 1999. An evaluation of
elongation factor 1α as a phylogenetic marker for eukaryotes. Mol. Biol. Evol.
16:218-233.
Royse, D. J. 1999. Yield stimulation of king oyster mushroom, Pleurotus eryngii, by
brewer's grain and SpawnMate IISE supplementation of cottonseed hull and wood
chip substrates. Mush. News 47:4-8.
213 Royse, D. J., Rhodes, T. W., Ohga, S., and Sanchez, J. E. 2004. Yield, mushroom size
and time to production of Pleurotus cornucopiae (oyster mushroom) grown on
switch grass substrate spawned and supplemented at various rates. Bioresource
Technol. 91:85-91.
Royse, D. J., Sanchez, J. E., Beelman, R. B., and Davidson, J., 2008. Re-supplementing
and re-casing mushroom (Agaricus bisporus) compost for a second crop. World J.
Microbiol. Biotechnol. 24:319-325.
Royse, D. J., Shen, Q., and McGarvey, C. 2005. Consumption and production of recently
domesticated edible fungi in the United States with a projection of their potential.
In: Mushroom Biology and Mushroom Products. Tan, Q., Zhang, J., Chen, M.,
Cao, H., Buswell, J. A. eds. Shanghai Xinhua Printing Co., Ltd. Shanghai, China.
Acta Edulis Fungi 12:331-337.
Russo, P., Juuti, J. T., and Raudaskoski M. 1992. Cloning, sequence and expression of a
β-tubulin-encoding gene in the homobasidiomycete Schizophyllum commune.
Gene 119:175-182.
Sanders, I. R., Alt, M., Groppe, K., Boller, T., and Wiemken, A. 1995. Identification of
ribosomal DNA polymorphisms among and within spores of the Glomales:
application to studies on the genetic diversity of arbuscular mycorrhizal fungal
communities. New Phytol. 130:419-427.
Schisler, L. C. 1964. Nutrient supplementation of mushroom compost during the
mushroom growth cycle. Mushroom Growers Assoc. Bull. 179:503–541.
Schisler, L. C., and Sinden, J. W. 1962. Nutrient supplementation of mushroom compost
at spawning. Mush. Sci. 5:150–164.
214 Schisler, L. C. 1990. Why mushroom production declines with each successive break,
and, the production of a second crop of Agaricus mushrooms on "spent" compost.
Appl. Agr. Res. 5:44-47.
Schroeder, G. M., and Schisler, L. C. 1981. Influence of compost and casing moisture on
size, yield and dry weight of mushrooms. Mush. Sci. 11:495-509.
Shen, Q., Geiser, D. M., and Royse, D. J. 2002. Molecular phylogenetic analysis of
Grifola frondosa (maitake) reveals a species partition separating eastern North
American and Asian isolates. Mycologia 94:472-482.
Shen, J., Guo, H., Cheng, Y., Wei, X., Guo, G., Liu G. and Jia, S. 2005. The exploitation
and cultivation of Pleurotus nebrodensis in China. In: Mushroom Biology and
Mushroom Products. Tan, Q., Zhang, J., Chen, M., Cao, H., Buswell, J. A. eds.
Shanghai Xinhua Printing Co., Ltd. Shanghai, China. Acta Edulis Fungi 12:354-
359.
Shukla, Y., Kulshrestha, O. P., Khuteta, K. P. 1981. Ergothioneine content in normal and
senile human cataractous lenses. Indian J. Med. Res. 73:472-473.
Sinden, J. W., and Schisler, L. C. 1962. Nutrient supplementation of mushroom compost
at casing. Mush. Sci 5:267-280.
Singer, R. 1986. The agaricales in modern taxonomy. Germany, Koeltz Scientific Books.
Stajic, M., Brceski, I., Wasser, S. P., Nevo, E., Vukojevic, J., and Duletic-Lausevic, S.
2005. Ability of selenium absorption by mycelia of Pleurotus eryngii (DC.:Fr.)
Quel., depending on selenium source in medium. Int. J. Med. Mush. 7:469.
215 Stajic, M., Sikorski, J., Wasser, S. P., and Nevo, E. 2005. Genetic similarity and
taxonomic relationships within the genus Pleurotus (higher Basidiomycetes)
determined by RAPD analysis. Mycotaxon 93:247-255.
Stenroos, S., Hyvonen, J., Myllys, L., Thell, A., and Ahti, T. 2002. Phylogeny of the
genus Cladonia s.lat. (Clasoniaceae, Ascomycetes) inferred from molecular,
morphological, and chemical data. Cladistics 18:237-278.
Stijve, T. 1977. Selenium content of mushrooms. Z. Lebensm. Unters. Forsch. 164:201-
203.
Tan, Q., Romaine, C., Schlagnhaufer, C., Cheng, M. J., Guo, Q., Geml, J., and Garzon, C.
2006. DNA fingerprinting of six Pleurotus nebrodensis strains cultivated
commercially in China. Acta Edulis Fungi 13:20-23.
Tan, Q., Wang, Z., Cheng, J., Guo, Q., and Guo, L., 2005. Cultivation of Pleurotus spp.
in China. In: Mushroom Biology and Mushroom Products. Tan, Q., Zhang, J.,
Chen, M., Cao, H., Buswell, J. A. eds. Shanghai Xinhua Printing Co., Ltd.
Shanghai, China. Acta Edulis Fungi 12:338-342.
Tanabe, Y., Saikawa, M., Watanabe, M. M., and Sugiyama, J. 2004. Molecular
phylogeny of Zygomycota based on EF-1α and RPB1 sequences: limitations and
utility of alternative markers to rDNA. Mol. Phylogenet. Evol. 30:438-449.
Tham, L. X., Matsuhhashi, S., Kume, T. 1999. Growth and fruitbody formation of
Ganoderma lucidum on media supplemented with vanadium, selenium and
germanium. Mycoscience 40:87-92.
Thell, A., Stenroos, S., Feuerer, T., Karnefelt, I., Myllys, L., and Hyvonen, J. 2002.
Phylogeny of cetrarioid lichens (Parmeliaceae) inferred from ITS and b-tubulin
216 sequences, morphology, anatomy and secondary chemistry. Mycological Progress
1:335-354.
Thon, M. R., and Royse, D. J. 1999a. Partial β-tubulin gene sequences for evolutionary
studies in the Basidiomycotina. Mycologia 91:468-474.
Thon, M. R., and Royse, D. J. 1999b. Evidence for two independent lineages of shiitake
of the Americas Lentinula boryana based on rDNA and β-tubulin gene sequences.
Mol. Phylogenet. Evol. 13:520-524.
Thuong, N. Q., Bao, D. T., Muravieva, D. A., Ogursob, I. U., and Strapuchuko, P. A.
1995. Etude d'une levure rich en selenium. Rev. Pharmaceut 1:21-26.
Twyman, R. M. 1998. Advanced molecular biology: a concise reference. BIOS Scientific
Publisher, Oxford, USA.
Urbanelli, S., Della Rosa, V., Fanelli, C., Fabbri, A. A., Reverberi, M. 2003. Genetic
diversity and population structure of the Italian fungi belonging to the taxa
Pleurotus eryngii (D.C.:Fr.) Quel and P. ferulae (D.C.:Fr) Quel. Heredity 90:
253-259.
Urbanelli, S., Della Rosa, V., Punelli, F., Porreta, D., Reverberi, M., Fabbri, A. A.,
Fanelli, C. 2007. DNA-fingerprinting (AFLP and RFLP) for genotypic
identification in species of the Pleurotus eryngii complex. Appl. Microbiol.
Biotechnol. 74:592-600.
Urbanelli, S., Fanelli, C., Fabbri, A. A., Della Rosa, V., Maddau, L., Marras, F.,
Reverberi, M. 2002. Molecular genetic analysis of two taxa of the Pleurotus
eryngii complex: P. eryngii (DC.Fr.) Quel. var. eryngii and P. eryngii (DC.Fr.)
Quel. var. ferulae. Biol. J. Linn. Soc. 75:125-136.
217 USEPA. 1986. Test Methods for Evaluating Solid Waste. Volume IA: 3rd ed. EPA/SW-
846. National Technical Information Service. Springfield, VA.
Van Elteren, J. T., Woroniecka, U. D., and Kroon, K. J. 1998. Accumulation and
distribution of selenium and cesium in the cultivated mushroom Agaricus
bisporus - a radiotracer-aided study. Chemosphere 36:1787-1798.
Venturella, G. 2000. Typification of Pleurotus nebrodensis. Mycotaxon 75:229-231.
Venturella, G. 2002. On the real identity of Pleurotus nebrodensis in spain. Mycotaxon
84:445-446.
Venturella, G. 2006. Pleurotus nebrodensis. In: IUCN 2006. IUCN Red List of
Threatened Species. www.iucnredlist.org. Accessed June, 2008.
Venturella, G., Zervakis, G., and La Rocca, S. 2000. Pleurotus eryngii var. elaeoselini
var. nov. from Sicily. Mycotaxon 76:419-427.
Vilgalys, R. 1991. Speciation and species concepts in the Collybia dryophila complex.
Mycologia 83:758-773.
Vilgalys, R., and Sun, B. L. 1994. Ancient and recent patterns of geographic speciation in
the oyster mushroom Pleurotus revealed by phylogenetic analysis of ribosomal
DNA sequences. Proc. Natl. Acad. Sci. Evolution 91:4599-4603.
Weatherbee, J. A., and Morris, N. R. 1984. Aspergillus contains multiple tubulin genes. J.
Biol. Chem. 259:15452-15459.
Wendland, J., and Kothe, E. 1997. Isolation of tef1 encoding translation elongation factor
EF-1α from the homobasidiomycete Schizophyllum commune. Mycol. Res.
101:798-802.
218 Werner, A. R., and Beelman, R. B. 2002. Growing high-selenium edible and medicinal
button mushrooms (Agaricus bisporus (J. Lge) Imbach) as ingredients for
functional foods or dietary supplements. Int. J. Med. Mush. 4:167-171.
White, T. J., Bruns, T., Lee, S., and Taylor, J. 1990. Amplification and direct sequencing
of fungal ribosomal RNA genes for phylogenetics. Pages 315-322. In: PCR
Protocols: A Guide to Methods and Applications. Innis, M. A., Gelfand, D. H.,
Sninsky, J. J., and White, T. J. eds. Academic Press, New York. USA.
Widmer, G. T. L., Chappell, C. L., and Tzipori, S. 1998. Sequence polymorphism in the
β-tubulin gene reveals heterogeneous and variable population structures in
Cryptosporidium parvum. Appl. Environ. Microbiol. 64:4477-4481.
Zadrazil, F. 1974. The ecology and industrial production of Pleurotus ostreatus,
Pleurotus florida, Pleurotus cornucopiae, and Pleurotus eryngii. Mush. Sci.
9:621-652.
Zervakis, G., Katsaris, P., Ioannidou, E., Lahouvaris, E., and Philippoussis. 2001a.
Facultative biotrophic basidiomycetes produce high quality edible mushrooms.
Phytopathol Mediterr 40:190.
Zervakis, G., and Balis, C. 1996. A pluralistic approach in the study of Pleurotus species
with emphasis on compatibility and physiology of the European morphotaxa.
Mycol. Res. 100:717-731.
Zervakis, G., Moncalvo, J. M, and Vilgalys, R. 2004. Molecular phylogeny,
biogeography and speciation of the mushroom species Pleurotus cystidiosus and
allied taxa. Microbiology 150:715-726.
219 Zervakis, G., and Venturella, G., 2002. Mushroom breeding and cultivation enhances ex
situ conservation of Mediterranean Pleurotus taxa. Pages 351–358. In: Managing
Plant Genetic Diversity. Engels, J. M. M., Rao, V. R., Brown, A. H. D., and
Jackson, M. T. eds. CABI Publishing, Wallingford, UK.
Zervakis, G., Venturella, G., and Papadopoulou, K. 2001b. Genetic polymorphism and
taxonomic infrastructure of the Pleurotus eryngii species-complex as determined
by RAPD analysis, isozyme profiles and ecomorphological characters.
Microbiology 147:3183-3194.
Zervakis, G., Sourdis, J., and Balis, C. 1994. Genetic variability and systematics of
eleven Pleurotus species based on isozyme analysis. Mycol. Res. 98:329-341.
Zhang, J., Huang, C. and Li, C. 2005. The cultivars of P. nebrodensis in China In:
Mushroom Biology and Mushroom Products. Tan, Q., Zhang, J., Chen, M., Cao,
H., Buswell, J. A. eds. Shanghai Xinhua Printing Co., Ltd. Shanghai, China. Acta
Edulis Fungi 12:350-353.
Zhang, J. X., Huang, C. Y., Ng, T. B, and Wang, H. X. 2006. Genetic polymorphims of
ferula mushroom growing on Ferula sinkiangensis. Appl. Microbiol. Biotechnol.
71:304-309.
220 Vita
Alma Edith Rodriguez Estrada
Education:
2008: Ph.D. Plant Pathology. The Pennsylvania State University – University Park, PA 2005: M.S. Plant Pathology. The Pennsylvania State University – University Park, PA 2002: B.S. Biology. Universidad Veracruzana – Cordoba-Orizaba, Mexico
Honors, awards and scholarships:
• International Society for Mushroom Science Scholarship to attend the 17th International Society of Mushroom Science (ISMS) Congress. Cape Town, South Africa (2008) • Dr. James W. Sinden Scholarship. American Mushroom Institute, Avondale, PA (2007) • The Arthur Gaspari Memorial Scholarship. College of Agricultural Sciences. The Pennsylvania State University (2004-2005 and 2006-2007) • The L. F. Lambert Spawn Company Endowed Scholarship. College of Agricultural Sciences. The Pennsylvania State University (2005-2006 and 2007-2008) • Graduate Student Travel Award. The Pennsylvania State University. College of Agricultural Science. University Park, PA (2005, 2007, and 2008) • Graduate Studies Scholarship. Secretaria de Educacion Publica (Public Education Boreu) Mexico, D. F. (2003 – 2005) • XII Scientific Research Summer Scholarship. Academia Mexicana de Ciencias (Mexican Academy of Science). Irapuato, Mexico (2002) • Honor Roll Recognition. McPherson College. McPherson, KS (2001)
Selected publications:
Rodriguez Estrada, A. E., Royse, D. J. and Jimenez-Gasco, M. M. 2008 Nucleotide sequence polymorphisms of the partial β-tubulin gene in two varieties of Pleurotus eryngii. Mushroom Science 17:83-96 (CD-ROM). Rodriguez Estrada, A. E. and Royse, D. J. 2007. Yield, size and bacterial blotch resistance of Pleurotus eryngii grown on cottonseed hulls/oak sawdust supplemented with manganese, copper and whole ground soybean. Bioresource Technology 98:1898-1906. Mata, G. and Rodriguez Estrada, A. E. 2005. Studies on laccase and biomass production in vitro and culture by a Mexican wild strain of Agaricus bisporus (J.Lge) Imbach: a comparison with commercial strains. International Journal Medicinal Mushrooms 7:431-432. Rodriguez Estrada, A. E. and Royse, D. J. 2005. Determination of Pseudomonas tolaasii threshold concentrations required to produce symptoms of bacteria blotch disease in Pleurotus eryngii. Proceedings of the 5TH International Conference on Mushroom Biology and Mushroom Products [Acta Edulis Supplement] 12:379- 382.