13: 17-26, 2004 Pleurotus Eryngii (Dc. : Fr.) Quel. (Pleurotaceae

13: 17-26, 2004

1 2,3

1 2 3 [email protected] +886-4-22851676 93 1 3

. 2004. . 13: 17-26.

10 3-4 GR-12 GR-28

20 GR-12 GR-28 10 Verticillium Penicillium 4.0-6.8 3.0-4.5 m 20-32 (Internal transcribed spacer, ITS) 28S rDNA Gliocladium roseum Bainier

Gliocladium roseum 28S DNA

Pleurotus eryngii (Dc. : Fr.) Que l. (Pleurotaceae) (Pleurotus) (21)

1993 (3)

(1) (5)

Cladobotryum varium Nees: Fr. Pseudomonas tolassii Paine (10) (0.5 0.5 cm) 1% (v/v) P. tolassii Vertcillium fungicola var. fungicola Ware 20 (9) 2% (w/v) (water agar, WA) 24 Gliocladium GR-06 GR- Gliocladium virens Miller (7) 07 GR-12 GR-13 GR-16 GR-18 GR-23 GR-28 G. deliquescens Sopp (18) GR-31 GR-37 10 28 (potato dextrose agar, PDA Difco) 18 13 1 2004

14 10 ( 0.5 ) (1.3 106 (JSM-6330F, Field Emission Scanning spores/ml) Electron Microscope) GR-12 GR-28

PDA 14 PE-B011 GR-12 GR-28 (13) PDA 24 (104 spores/ml) 50 l 4 PDA 12 16 20 24 (2,4) 40 28 32 36 24 %(v/v) 65 % pH 6.5 900 ml 100 700 (121 15 1b/cm2) 4 PDA 24 35 GR-12 GR-28 PE-B011 ( 2% WA 14 0.7 PDA 8 12 16 20 24 28 32 36 ) 7 15.5 - 17.5 85 - 95% 1000 ppm 8-11 250 300 lux 8 10 12 (DNA) 10 PDA 28 14 250 28 PDA 14 GR-12 (potato dextrose broth, PDB, Difico) 500 GR-28 10 28 125 rpm 10

6 10 DNA DNeasy spores/ml (Taiwan SC-202 Plant mini kit (QIAGEN, Hilden, Germary) ) 13 ( 3-5 cm) 100 mg 2 ml 16 400 l AP1 4 l 100 mg/ml RNase A 65 10 130 l AP2 5 GR-12 GR-28 15 k rpm 5 DNA (malt extract peptone agar, MEA) (8) QIAshredder spin column 20 10 675 l AP3/E PDA 650 l DNeasy mini spin column 10 k rpm 1 28 8 14 DNA column 500 l AW column 100 l 65 50 AE 5 10 k rpm DNA WA 28 8 -20 10 ( 0.7 cm) WA 19

10 ITS 28S rDNA PCR 100 ng/ l 10 ng 1 l 1 l (ligase) pCRII- DNA PCR (template) PCR TOPO TA (Invitrogen, Co., Carlsbad, CA) 5 Collopy (6) 2001 l 5 (ligation) (internal transcribed spacer, ITS) (competent cell) ITS1 (5'- TCCGTAGGTGAACCTGCGG -3') 20 42 1 ALRO (5'- CATATGCTTAAGTTCAGCGGG -3') PCR 37 1 10 ng DNA 5 l 10x PCR buffer 4 100 l 50 l 100 mM IPTG 50 l 2% X-gal l 2.5 mM dNTP 25 pmol 0.5U ExTaq (50 ppm kanamycin) 37 polymerase (Takara Shuzo Co., Shiga, Japan) 16 50 l (GeneAmp PCR System 50 ppm kanamycin (LB) 2400, Perkin-Elmer, Co., Norwalk, CT) 35 PCR (GeneMark, Technology Co., Ltd., Taiwan) ITS 94 (denature) 1 ml 13 k rpm 1 2 94 15 57 (annealing) 30 200 l Solution I 72 (extension) 45 35 72 200 l Solution II 200 l Solution III 4 28S rDNA PCR DNA (15 k rpm) 5 (20) Vilgalys Hester 1990 miniprep spin column Gliocladium spp. 28S rDNA 13 k rpm 1 700 l washing solution LROR (5'- GTACCCGCTGAACTTAAGC-3') column 3 LR7 (5'- TACTACCACCAAGAT CT-3') 28S rDNA 60 5 50 l 94 2 94 1 1 13 k rpm DNA 3 l 50 1 72 2 35 DNA 2 l 10x buffer 1 U EcoRI 37 72 4 2 PCR

ITS 28S rDNA DNA DNA PCR PCR 10 l 2 l (Mission-Biotech Co., Ltd., Taiwan) ABI PRISM 377-96 blue dye (0.01% xylene cyanol, 0.01% bromophenol blue, DNA (Perkin-Elmer, CA, USA) 50% glycerol) 1.2% (Seakem LE DNAstar (DNASTAR, USA) agarose, FMC) 0.5x TAE [20 mM Tris-acetate, 0.5 mM (NCBI) (GenBank) EDTA(pH8.0)] 100V blue dye 3/4 (ethidium bromide, EtBr, 0.5 g/ml) 10 UV (IS-2000, Alpha Innotech Co.) PCR PCR (QIAGEN, Hilden, Germary) 200 l PCR [Agaricus bisporus (Lange) Imbach] 1000 l PB buffer [Lentinus edodes (Berk.) Sing.] [Flammulina QIAquick spin column 13 k rpm (HITACHI, himac velutipes (Curt.: Fr.) Sing.] [Pleurotus sajor (Fr.) CF15DZ RT15A3) 1 2 ml Sing.] [Pleurotus cystidosus Miller] 750 l PE buffer QIAquick [Auricularia mesenterica (Dick. : Fr.) Pers.] spin column 13 k rpm 1 column [Hypsizigus marmoreus Bunashimeji] [Coprinus column 30 l 1 1 comatus (Mull.: Fr. ) Pers.] [Lepista nuda DNA -20 (transformation) (Bull. :Fr.) Cooke] [Griffola frondosa (Dicks. Fr.) S.F. Gray.] 2 ml GR-12 GR-28 (1.3 106 spores/ml) ITS 28S rDNA 16 20 13 1 2004

3 ( ) 2-3 ( )

4.0-6.8 x 3.0-4.5 m (Verticillium- like) 110-170 m 2-6 12-20 m Penicillium 40-70 m 5-8 12-16 m 2.0-3.5 m Domsch (7) (16) (17) ( ) 10 Schroers Smalley Hansen 3-4 Gliocladium roseum Bainier.

GR- GR-12 GR-28 MEA 12 GR-28 12 20 10 3.5-4.2 24 16

(1) (2) (3) (4) H D

Fig. 1. Brown spot disease of king oyster mushroom Pleurotus eryngii, caused by Gliocladium roseum. Symptoms consisted of brown spots, curling of the tissues, and shrinking and cracking of fruit bodies. (1) healthy mushrooms, (2 3) diseased mushrooms, and (4) diseased mushrooms (D) with brownish discoloration. 21

GR-12 GR-28 (24 ) GR-12 GR-28 Fig. 3. Effect of temperature on conidial germination of (1) 10 (2) Gliocladium roseum isolates GR-12 and GR-28 on potato Gliocladium roseum Verticillium (Cp) ( dextrose agar plates for 24 hrs. ) (P) (3) G. roseum Bar = Standard error. (Cp) ( ) (4) G. roseum (Ca) 10 m Fig. 2. Morphologies of Gliocladium roseum including (1) colonies of G. roseum isolates GR-12 and GR28 grown on malt extract peptone agar for 10 days at 20 , (2) Verticillium-like conidiophores (Cp) (arrowhead), phiales (P) (arrowhead) and conidia (Ca) (arrowhead) under light microscope; (3) Penicillium-like conidiophores (Cp) (arrowhead) and (4) conidia (Ca) (arrowhead) under scanning electron microscope. Bar 10 m

20% 28 80% 36 20% 28 ( ) GR-12 GR-28 PE-B011 ( ) Fig. 4. Effect of temperature on mycelial growth of Gliocladium roseum isolates GR-12 GR-28 and Pleurotus GR-12 GR-28 PE- eryngii PE-B011 on potato dextrose agar plates for 7 days. B011 8-36 7 Bar = Standard error. 8 12 28 GR-12 GR-28 32 8 36 ( ) 16 ITS1 ALRO ( ) DNA 20 32 10 24-28 556 bp ( ) 10 PCR 22 13 1 2004

10 ITS1 ITS2 5.8S rDNA Fig. 5. Agarose gel electrophoresis showing amplification product of PCR in the ITS1 ITS2 regions and 5.8S rDNA of ten isolates of Gliocladium roseum, the causal agent of brown spot disease of king oyster mushroom Pleurotus eryngii. Lane M: 100 bp marker (GeneMark).

PCR DNA pCRII-TOPO TA ( DNA ) 10 ITS ITS DNA 556 bp ( ) ITS DNAstar (NCBI) ITS 13 Gliocladium sp.(Acc. No. AF139858 AF048733 ) 98.2-99.6% Verticillium 50.6 - 55.10% (Acc. No. AF048740 AF048741 AF048742) Gliocladium LROR LR7 28S rDNA

10 DNA LROR LR7 PCR 10 1355 bp ( ) PCR ITS (internal transcribed spacer, ITS) NCBI GenBank Fig. 6. Nucleotide sequence of internal transcribed spacer regions (ITS1 ITS2 regions and 5.8S rDNA) of Gliocladium 28S rDNA G. roseum (Acc. No. U00736) roseum, the causal agent of brown spot of king oyster Nectria ochroleuca (Acc. No. U00746 U00751 U00752 mushroom Pleurotus eryngii. U00750) 97.3-98.6% ( ) G. roseum Bainer 23

10 28S rDNA Fig. 7. Agarose gel electrophoresis showing amplification product of PCR in the 28S rDNA of ten isolates of Gliocladium roseum, the causal agent of brown spot of king oyster mushroom Pleurotus eryngii. Lane M: 100 bp marker (GeneMark).

GR-12 GR-28 12 16

( )

Gliocladium Corda Hyphomyces Domsch (7) G. roseum Verticillium Penicillium Verticillium G. roseum Sphaerostilbella lutea (15) Verticillium G. roseum

G. roseum GR-12 28S rDNA (Internal transcribed spacer, ITS) (NCBI) (GenBank)

Fig. 8. Phylogenetic tree illustrating the pairwise genetic distance of the sequence of 28S rDNA of Gliocladium roseum isolate GR-12 compared with sequences deposited in the (16) (11) Mckay ITS GenBank database of National Center for Biotechnology Cladobotryum dendroides Rehner Information (NCBI). 24 13 1 2004

Gliocladium roseum Table 1. Pathogenicity tests of Gliocladium roseum obtained from diseased king oyster mushroom Pleurotus eryngii on fruiting bodies of various mushroom-producing fungi Symptom appearance Mushroom-producing Pathogenicity test2 (days after inoculation) fungus1 GR-12 GR-28 GR-12 GR-28 Agaricus bisporus 22 Auricularia polytrica -- Coprinus comatus 33 Flammulina velutipes 22 Grifola frondosa -- Hypsizigus marmoreus 22 Lentinus edodes 22 Lepista nuda -- Pleurotus cystidosus 22 Pleurotus eryngii 33 Pleurotus sajor 22 1. Each fungus was inoculated with 2 ml spore suspension (1.5 106 spores/ml) of Gliocladium roseum isolates GR-12 and GR-28 on its sporophores cultivated at 16 . 2. , with symptoms; , without symptom.

Samuels (15) 1994 28S r DNA . 46: 51-59 Gliocladium spp. PCR 3. . 1998. . ITS 28S rDNA . p.44-46. . . NCBI GenBank ITS 4. . 2000. NCBI GenBank 13 Gliocladium sp. (Acc. . 49: No.AF139858 AF048733 AF358244 AF358243 56-64

AF358241 AF358234 AF358233 AF358231 5. . 2000 Cladobotryium varium.

c c c c

c c c c

c c c c

c c c c

c c c c

c c c c

c c c c

c c c c

cyAˆhc c cGˆc c dc c

cyPdgyPdddAhc cyPdcGuyFceyAˆchc cxIc c ctdv c

yPd@wccdddddHwhfc cddHwccxd@‰cddddAchc cducfdcfcyAˆhc ‡F‚Guchgc

ddH‰drfcs9ˆec‡8chc cdgdcfcdrchc cddddddddddddddddAhc c‡F‰c†RTuchfc

dcecGˆcxIecUSchc cdgddfcdhec cdecde‡@c9ˆchfc y8 cecƒdTuchec

dcyAˆxIccdet@‰chc cdddddgddddhec cdetSeU‰c†AuyAˆchc yPH‚RddddHwsRTuchc

ddddddddAcdcfF‰hec cdgddfcdhec cdeUreddddddddAchc yPd‰hecsRddcgc

dcgcddchfc cdddddedceddddhec cdctdcctdccdhgc cdH‰dddddddddddddchec

ctdcecduccd‰ccyAˆhc cdˆdgdAucecdhec cd‡8dc‡8dccdeyAˆchc dcfdcfdchec

cUddTˆcddddddddddAhc tddddddddddddddddddd@cgc cd@‰dcF‰ddddddddIchc dcdTˆcdc‡Pdcdchec

tddcsGcdecdfdrhc U` ‡@‰cgc cdrcdcedddddddddchc dcc†Aˆd‡8‰edchec

U‰dcecddddddddddchc dceddddddddddddeF‰hc cdedcedccdhgc dddddddddddddchec

ctScdcecdecdfdchc c‡ddhfc cdedcedccdecyAˆhc c

‡F‰cdcecdecdfdchc dddHwchfc tSedcedddddddddAhc cdddddddddddhfc

F‰edccddddddddddddddcgc dcfcyAˆhc Uredcedc c cdhcdhfc

dcecdhdchc cddddddddddddddddddAhc dcfA„da c cdhcdhfc

dcecdhdchc dc c ctSccded@‚RdccdcGuchc cdddddddddddhfc

dc c dcecdhdchc cUrctdedrfcdv†9Tˆcgc cdhcdhfc

dcecdhdchc dc c tSc‡8SeQafcdDc†RAcgc cdhcdhfc

dcecdfddddSchc cddddc c F‰c8H‰e†RdddddH‰chec cdddddddddddhfc

dcecdgs@‰chc csdc c c cdwcgsdhfc

c c c c

c c c

( ) c 8:

c c c c

c c c

AF132803 AF358228 AF358225 AJ309346 c c c c c

c c c c

c c c c

c c c c

c c c c AJ309334) 98.2-99.6% 28S rDNA 1-20. GenBank Gliocladium roseum (Acc. No. 6. Collopy, P. D., Largeteau-Mamoun, M. L., Romaine, C. U00736) Nectria ochroleuca (Acc. No. U00746 P., and Royse, D, J. 2001. Molecular phylogenetic U00751 U00752 U00750) 97.3-98.6% analysis of Verticillium fungicola and related species ITS 28S rDNA causing dry bubble disease of the cultivated button G. roseum mushroom, Agaricus bisporus. Phytopathology 91: 905- Gliocladium G. roseum G. virens 912. 7. Dadwal, V. S., and Jamaluddin. 1984. A new disease of Fusarium spp.(19) Verticillium spp.(11) white button mushroom (Agaricus bisporus). Current Rhizoctonia solani (14) G. roseum Science 53: 532-533. 8. Domsch, K. H., Gams, W., and Anderson, T. H. 1980. (7,18) Gliocladium Gliocladium Corda 1840. Pages 368-377 in:Compendium of Soil Fungi. K. H. Domsch, and W. Gams, eds. Academic Press. London. 9. Dragt, J. W., Geels, F. P., De Bruijn, W. C., and Van Griensven, L. J. L. D. 1996. Intracellular infection of the cultivated mushroom Agaricus bisporus by the mycoparasite Verticillium fungicola var. fungicola. 1. . 1996. . Mycol. Res. 100: 1082-1086. . p.135-137. . . 10. Ferri, D. F. 1985. Batteriosi in funghi del gen. Pleurotus. 2. . 1997. Mushroom Information. pp. 47-54. 25

11. Gourley, C. O., and Macnab, A. A. 1964. Verticillium roseum in Clonostachys as C. rosea, its relationship to dahliae and Gliocladium roseum isolation from Bionectria ochroleuca, and notes on other Gliocladium- strawberries in nova scotia. Can. J. Pl. Sci. 44:544-549. like fungi. Mycologia 91: 365-385. 12. Mckay, G. J., Egan, D., Morris, E., Scott, C., and Brown, 17. Smalley, E. B., and Hansen, H. N. 1957. The perfect stage A. E. 1999. Genetic and morphological characterization of Gliocladium roseum. Mycologia 49: 529-533. of Cladobotryum species causing cobweb disease of 18. Thapa, C. D., and Seth, P. K. 1989. Brown spot disease of mushrooms. Appl. Environ. Microbiol. 65: 606-610. white button mushroom [Agaricus bisporus (Lange) 13. Peng, J. T., Dai, M. C., Tsai, Y. F., Chen, M. H., and Imbach] due to Gliocladium deliquescens Sopp. Chen, J. T. 2001. Selection and breeding of king oyster Mushroom Science XII: 781-787. mushroom. J. Agric. China. 50: 43-58. 19. Vaartaja, O., and Salisbury, P. J. 1965. Mutual effects in 14. Pugh, G. J. F., and Emden, J. H. V. 1969. Cellulose vitro of microorganisms isolated from tree seedlings, decomposing fungi in polder soils and their possible nursery soil, and forests. Est Sci. 11: 160-168. influence on pathogenic fungi. Neth. J. Pl. Pathol. 75: 20. Vilgalys, R., and Hester, M. 1990. Rapid genetic 287-295. identification and mapping of enzymatically amplified 15. Rehner, S. A., and Samuels, G. J. 1994. Taxonomy and DNA from several Cryptococcus species. Bacteriol. 172: phylogeny of Gliocladium analysed from nuclear large 4238-4246. subunit ribosomal DNA sequences. Mycol. Res. 98: 625- 21. Zadraz il, F. 1978. Cultivation of Pleurotus. Pages 521- 634. 557 in: The Biology and Cultivation of Edible Mushroom. 16. Schroers, H. J., Samuels, G. J., Seifert, K. A., and Gams, S. T. Chang and W. A. Hayes, eds. Academic Press. New W. 1999. Classification of the mycoparasite Gliocladium York. 26 13 1 2004

ABSTRACT

Chen, J. T.1 and Huang, J. W.2,3 2004. Identification of Gliocladium roseum, the causal agent of brown spot of the king oyster mushroom Pleurotus eryngii. Plant Pathol. Bull. 13: 17-26. (1.Plant Pathology Division, Agricultural Research Institute, COA, Wufeng, Taichung, Taiwan; 2.Department of Plant Pathology, National Chung-Hsing University, Taichung, Taiwan; 3.Corresponding author, E-mail: [email protected], Fax: +886-4-22851676)

In 1998, commercial cultivation of Pleurotus eryngii (Dc. : Fr.) Que-l. in Wufeng area including the Agricultural Research Institute (ARI), COA, in central Taiwan was severely affected by an unknown disease. Symptoms consisted of brown spot, curling of the tissues, sometimes even shrinking and cracking of the infected fruit bodies. Ten isolates, GR-6 GR-7 GR-12 GR-13 GR-16 GR-18 GR-23 GR- 28 GR-31 and GR-37 were obtained from diseased fruiting bodies. Pathogenicity was confirmed by inoculating the fungus onto fruiting bodies of king oyster P. eryngii and incubating the inoculated fruiting bodies under high humidity (RH 93%) at 16 . Discoloration of brown spot similar to the original symptoms developed only on inoculated king oyster mushrooms. The same fungus was reisolated from the artificially infected king oyster mushrooms. Noninoculated king oyster mushrooms remained symptomless. On malt extract peptone agar, the colony diameter reached 32.5-35.0 mm 10 days after inoculation at 20 , the colony appeared orange to salmon red. Mycelium with septa produced verticillate conidiophores 110- 170 m, bearing 2-6 whorls of phialides 13-28 m and conidiophores bearing the "densely penicillate" phialides 10-16 m . Conidia were hyaline, one-celled, ovoid , accumulating in a single, slimy and protruding base, smooth-walled, 4.0-6.8 x 3.0-4.5 m. The fungus was identified as Gliocladium roseum Bainier according to the descriptions of Domsch, et al (1980) Schroer, et al (1999) and Smalley Hansen (1957). The causal agent was further confirmed by comparing the ITS and 28S rDNA sequences of ten isolates of the pathogen with NCBI database. The optimum temperature for conidial germination and mycelial growth of G. roseum isolates GR-12 and GR-28 was 20-32 . G. roseum isolates GR-12 and GR- 28 was also pathogenic to Agaricus bisporus (Lange) Imbach Lentinus edodes (Berk.) Sing. Flammulina velutipes (Curt.: Fr.) Sing. Pleurotus sajor (Fr.) Sing. Pleurotus cystidosus Miller Hypsizigus marmoreus Bunashimeji and Coprinus comatus (Mull.: Fr. ) Pers.

Key words : Pleurotus eryngii, Gliocladium roseum, ITS (internal transcribed spacer), 28S rDNA