Toll-Like Receptor 4–Induced IL-22 Accelerates Kidney Regeneration

BASIC RESEARCH www.jasn.org

Onkar P. Kulkarni,* Ingo Hartter,* Shrikant R. Mulay,* Jan Hagemann,* Murthy N. Darisipudi,* † Santhosh Kumar VR,* Simone Romoli,* Dana Thomasova,* Mi Ryu,* Sebastian Kobold, and Hans-Joachim Anders*

*Nephrologisches Zentrum, Medizinische Klinik und Poliklinik IV, Klinikum der Universität, Munich, Germany; and †Center of Integrated Protein Science Munich and Division of Clinical Pharmacology, Department of Internal Medicine IV, Ludwig-Maximilians-Universität München, Munich, Germany

ABSTRACT AKI involves early Toll-like receptor (TLR)–driven immunopathology, and resolution of inflammation is needed for rapid regeneration of injured tubule cells. Notably, activation of TLRs also has been implicated in epithelial repair. We hypothesized that TLR signaling drives tubule regeneration after acute injury through the induction of certain ILs. Systematic screening in vitro identified IL-22 as a candidate proregeneratory factor in primary tubular cell recovery, and IL-22 deficiency or IL-22 blockade impaired post- ischemic tubular recovery after AKI in mice. Interstitial mononuclear cells, such as dendritic cells and macrophages, were the predominant source of IL-22 secretion, whereas IL-22 receptor was expressed by tubular epithelial cells exclusively. Depleting IL-22–producing cells during the healing phase impaired epithelial recovery, which could be rescued entirely by reconstituting mice with IL-22. In vitro, necrotic tubular cells and oxidative stress induced IL-22 secretion selectively through TLR4. Although TLR4 blockade during the early injury phase prevented tubular necrosis and AKI, TLR4 blockade during the healing phase suppressed IL-22 production and impaired kidney regeneration. Taken together, these results suggest that necrotic cell–derived TLR4 agonists activate intrarenal mononuclear cells to secrete IL-22, which accelerates tubular regeneration and recovery in AKI.

J Am Soc Nephrol 25: ccc–ccc, 2014. doi: 10.1681/ASN.2013050528

AKI involves a sterile inflammatory response that initiate the influx of various immune cell subsets contributes to the extent of tubular cell damage.1 In into the kidney, that contribute to the early ampli- turn, tubular cell necrosis is the predominant trigger fication of the inflammatory response and AKI by for this associated inflammatory response, because enhancing immune-mediated tubular cell death.10,11 dying cells release intracellular molecules, such as To limit overshooting immunopathology in sterile HMGB1, histones, uric acid, or ATP, that elicit im- tissue injuries and allow tissue recovery,12 anumber munostimulatory effects in the extracellular space, of counterregulatory mechanisms exists that mostly which are referred to as damage-associated molecular patterns (DAMPs).2–5 Tubular damage also induces Tamm–Horsfall protein (THP)/uromodulin leakage Received May 24, 2013. Accepted December 11, 2013. from the tubular lumen into the interstitium, where O.P.K., I.H., and S.R.M. contributed equally to this work. it turns into an immunostimulatory danger signal.6,7 Published online ahead of print. Publication date available at DAMPs activate a set of pattern recognition receptors, www.jasn.org. such as Toll-like receptors (TLRs) or inflammasomes, Correspondence: Dr. Hans-Joachim Anders, Medizinische Klinik on renal parenchymal cells as well as in interstitial und Poliklinik IV, Klinikum der Universität München, Ziemssen- – dendritic cells.2 9 The subsequent innate immune strasse 1, 80336 München, Germany. Email: [email protected] response involves the transcription of numerous muenchen.de proinflammatory cytokines and chemokines, which Copyright © 2014 by the American Society of Nephrology

J Am Soc Nephrol 25: ccc–ccc, 2014 ISSN : 1046-6673/2505-ccc 1 BASIC RESEARCH www.jasn.org limits immune activation of intrarenal dendritic cells.13,14 For ischemia-reperfusion injury, in which, similar to severe AKI, example, pentraxin-3 release from the microvasculature and less than 10% of the TECs survived.19,28 We considered the dendritic cells limits leukocyte recruitment.15,16 Most impor- regenerative outgrowth from the surviving TECs reforming a tantly, switching the phenotype of intrarenal mononuclear monolayer as a valuable in vitro system to screen for the impact phagocytes away from classically activated (proinflammatory) of ILs on post-ischemic epithelial healing. Among all ILs tested, to alternatively activated (anti-inflammatory/proregeneratory) recombinant IL-22 had the strongest proregeneratory effect cells is necessary for recovery on AKI.17–19 (Figure 1A). To better mimic epithelial monolayer injury and Although surviving tubular epithelial cells (TECs) enter the validate this candidate, we also tested IL-22 on mechanical cell cycle within few hours on injury,1 a functional tubular re- scratching of primary TEC monolayers. Recombinant IL-22 covery does not occur before the resolution of sterile inflamma- dose dependently enhanced wound closure (Figure 1B), con- tion has occurred and the tubulointerstitial microenvironments firming that IL-22 enhances re-epithelialization on TEC injury. become dominated by proregeneratory factors.18,19 They are Which signaling pathways contribute to this process? Recombi- provided in a paracrine manner by other surviving TECs, intra- nant IL-22 induced phosphorylation of signal transducer and tubular tubular progenitor cells, or bone marrow-derived stem activator of transcription 3 (STAT3) and extracellular signal- cells.1,20–23 Although dendritic cells and other immune cells regulated kinases 1/2 (ERK1/2) in primary TECs, a process play a dominant role in orchestrating the early injury phase of that was blocked by an mitogen-activated protein kinase AKI, little is known about the contribution of intrarenal im- (MEK1/2) inhibitor (Figure 1C). Furthermore, Jak1 and mune cells to the subsequent phase of kidney regeneration.24 MEK1/2 inhibition partially abrogated the proregeneratory ef- Three reports recently consistently showed that mono- fect of recombinant IL-22 on mechanical scratch–induced ep- nuclear phagocyte depletion in the healing phase of post- ithelial injury of primary TEC monolayers (Figure 1D). The ischemic AKI impairs tubular regeneration,18,19,25 but the inhibitors did not affect the wound healing process on their phagocyte-derived mediators that drive tubular healing re- own. Thus, IL-22 enhances re-epithelialization on TEC injury main unknown. Zhang et al.19 showed that colony-stimulating through activation of the Jak/STAT3P and ERK1/2 pathways. factor (CSF)-1 activates M2 macrophage–dependent tubular repair, but CSF-1 is predominately produced by activated tu- Neutralizing Endogenous IL-22 Impairs Epithelial bular cells.26 M2 macrophages produce IL-10 and growth fac- Recovery on AKI tors like TGF-b that have anti-inflammatory and profibrotic To confirm the role of IL-22 on epithelial repair in vivo,wefirst effects, but more specific myeloid cell-derived mediators that characterized the expression of IL-22 in plasma (ELISA) and enhance epithelial healing should exist. kidney (RT-PCR) 1, 5, and 10 days after unilateral renal ped- Generally, we follow the concept that renal mononuclear icle clamping. Plasma IL-22 protein levels were significantly phagocytes orchestrate all phases of AKI—the onset and the elevated at days 5 and 10 (Supplemental Figure 1A), whereas resolution of inflammation as well as subsequent tissue regen- intrarenal IL-22 mRNA levels increased as early as day 1 (Fig- eration or repair.27 Here, we focused on the ILs, a paradig- ure 2A). IL-22 immunostaining revealed positivity exclusively matic family of leukocyte-derived mediators that regulates in the interstitial compartment on day 1 as well as day 5 in homeostasis and immunity in a paracrine manner. We hoped post-ischemic but not contralateral control kidneys after uni- to identify yet unknown proregeneratory properties of ILs on lateral renal pedicle clamping (Figure 2B). By contrast, IL-22R TECregenerationinAKI.Ourunbiasedin vitro screening immunostaining displayed positivity exclusively in TECs (Fig- approach revealed IL-22 as a candidate, which we subse- ure 2C). We also found extrarenal expression of IL-22 in post- quently validated as a renal dendritic cell–derived stimulator ischemic injury (e.g., in splenic dendritic cells) (Figure 2D). of tubular regeneration. To our surprise, we found IL-22 se- Toinvestigatethe functional significance of endogenous IL-22 cretion to be selectively induced by TLR4 agonists released forAKIrecovery,weneutralizedIL-22inthehealing phaseofAKI from necrotic tubular cells, which first documents a role of by injecting anti–IL-22 antibody only from day 2 after renal TLR signaling for not only renal immunopathology but also, pedicle clamping and euthanized the mice on day 5. This time kidney regeneration in vivo. Furthermore, our data imply that point was selected, because in our model, the injury phase lasts dying TECs involve interstitial dendritic cells to support their for 48 hours; the recovery phase covers days 2–5 at the given regeneration through a specificTLR4–IL-22 pathway. ischemia time.29 IL-22 blockade significantly impaired tubular recovery as defined by the index of injured tubules assessed on RESULTS periodic acid–Schiff sections, the numbers of Lotus tetragonolobus lectin+ proximal tubules and THP+ distal tubules, and the IL-22 Enhances Tubular Cell Re-Epithelialization by number of proliferating THP+ proliferating cell nuclear antigen+ Jak-Stat3 and Erk1/2 In Vitro cells (Figure 3). IL-22 neutralization did not affect IL-22 expres- First, we set up an experimental system that mimics primary sion as assessed by IL-22 staining (Figure 3A). This result was tubular cell recovery on ischemia-reperfusion injury. We used consistent with the profound increase in the renal mRNA ex- kidney explanation from adult mice and the preparation pression levels of the tubular injury markers kidney injury mol- of renal tubular cell suspensions for culture as a model of ecule (Kim)-1, p2glutathione S-transferase (GST), a-GST, and

2 Journal of the American Society of Nephrology J Am Soc Nephrol 25: ccc–ccc,2014 www.jasn.org BASIC RESEARCH

function after ischemic tubular injury, we carried out bilateral ischemic injury in Il- 22–deﬁcient mice. These mice displayed impaired tubular regeneration accompanied by higher plasma BUN levels on day 5 (Figure 3C). Of note, plasma BUN levels were iden- tical at day 1, implying that IL-22 does not contribute to the injury phase of AKI. To- gether, the post-ischemic kidney induces IL-22 expression, which supports tubular recovery during the healing phase of AKI.

Interstitial Mononuclear Phagocytes Are the Major Source of Renal IL-22 Expression We used flow cytometry of renal cell suspen- sionsprepared5daysafterkidneyischemiato better define the IL-22–producing cells. IL- 22 was selectively produced by CD45+ leu- 2 kocytes and not at all produced by CD45 renal nonimmune cells (data not shown). Additional surface markers specified the IL- 22–producing renal leukocyte subsets (Table 1). We characterized CD45+IL-22+ cells in various subsets of mononuclear phagocytes based on the surface expression of CD11b, CD11c, F4/80, and CD103. All CD11b+, CD11b+CD103+, CD103+, CD11c+,and F4/80+ mononuclear phagocytes expressed IL-22 in the post-ischemic kidney (Figure 4A, Supplemental Figure 3). Clodronate liposome did not reduce a minor population of natural killer (NK+) and CD3 T cells producing IL-22 (Supplemental Figure 2). In- travenous clodronate liposome injection on days 2 and 4 after renal pedicle clamping significantly depleted these IL-22–producing cells inside the post-ischemic kidney, except for CD11c+F4/80+ cells, but only during the recovery phase of AKI (Table 1) In contrast, clodronate injection did not affect the num- + + Figure 1. IL-22 promotes epithelial healing in vitro. (A) Primary isolated tubular epithelial bers of neutrophils, CD3 Tcells,andNK1.1 cells were studied for regeneration in the presence of various ILs. IL-22 significantly cells inside the post-ischemic kidney (Sup- induced the regenerative outgrowth of isolated primary TECs. (B) Proregenerative plemental Figure 2). Immunostaining con- activity of IL-22 was further confirmed using in vitro scratch assays on monolayers of firmed the depletion of IL-22–producing primary TECs with and without recombinant IL-22. IL-22 (0.1, 1, and 10 ng/ml) sig- leukocytes in the post-ischemic kidney at nificantly enhanced wound closure in a dose-dependent manner. (C) IL-22 (10 ng/ml) day 5 (Figure 4B). Clodronate-induced de- activates phosphorylation of STAT3 and ERK1/2 on primary TECs. (D) Pharma- pletion of mononuclear phagocytes was re- cological inhibition of STAT3 phosphorylation using Jak inhibitor I (10 nM) and ERK1/ cently reported to impair tubular repair in m 2 phosphorylation using PD98059 (10 M) abolished the wound re-epithelialization this model.18,19,25 Our own experiments re- 6 capacity of IL-22 (1 ng/ml). Data are means SEMs from three separate experiments. produced the phenotype of impaired AKI *P,0.05 versus control; **P,0.01 versus control. recovery reported by these studies, because clodronate depletion of renal mononuclear fatty acid–binding protein (FABP) versus isotype controls (Fig- phagocytes reduced the proliferating cell nuclear antigen+ ure 3B). To understand the role of IL-22 in regaining renal THP-1+ proliferating distal TECs and the amount of THP+

J Am Soc Nephrol 25: ccc–ccc, 2014 IL-22 in AKI Recovery 3 BASIC RESEARCH www.jasn.org

on renal function in post-ischemic injury. Renal phagocyte depletion impaired tubular recovery, which was indicated by elevated plasma BUN on day 5. Reconstitution of IL-22 normalized plasma BUN (Figure 5C). These ﬁndings show that renal mononuclear phagocytes contribute to AKI recovery during the healing phase by secreting IL-22.

Necrotic Tubular Cells Trigger IL-22 Release by Releasing Agonists for TLR4 What are the triggers for intrarenal mononuclear phagocytes to secrete IL-22 during AKI? AKI involves tubular necrosis that activates pattern recognition receptors on immune cells by releasing endogenous danger signals, which are referred to as DAMPs.9 Therefore, we first used supernatants of necrotic TECs to stimulate bone marrow–derived dendritic cells (BMDCs) and found them to induce IL-22 secretion even stronger than the known IL-22 induc- ers aryl hydrocarbon receptor agonist 6-formylindolo[3,2-b]carbazole (FICZ) and hydroxyl peroxide (Figure 6A). To study the involved pattern recognition receptors, we used synthetic receptor agonists (e.g., Pam3Cys [TLR2], LPS [TLR4], poly-IC RNA [TLR3], imiquimod [TLR7], and CpG-DNA [TLR9]). All of these TLR agonists induced IL-6 release from BMDCs, whereas only TLR4 activation induced IL- Figure 2. Renal ischemia clamping induces intrarenal IL-22 expression. (A) IL-22 ex- 22 release (Figure 6B). To further confirm pression was analyzed by RT-PCR. IL-22 is expressed significantly in ischemic kidney on the role of TLR4, we blocked the necrotic all the observed time points on days 1, 5, and 10. (B) Interstitial expression of IL-22 was supernatant stimulation with a neutraliz- observed in ischemic kidneys on days 1 and 5, whereas contralateral kidney sections do ing TLR4 antibody, which entirely sup- not show IL-22 expression on these time points. (C) IL-22R expression was observed in pressed IL-22 release in a dose-dependent immunohistochemical analysis on tubular epithelial cells, and (D) IL-22 was expressed manner (Figure 6C). Necrotic supernatant + fi fl at day 5 in spleen cells, which were expressed by CD11c cells identi ed by ow and TLR4 stimulation of primary renal cytometry. Data are means6SEMs from three separate experiments. *P,0.05 versus dendritic cells also induced IL-22 expres- control; **P,0.01 versus ischemic control (IR). sion (Figure 6D). In contrast, direct TLR4 stimulation of TEC monocultures did not affect their viability or growth (Supple- tubules (Figure 5A), showing insufficient tubular cell prolifera- mental Figure 4, B and C). These data document that necrotic tion as a cause for poor AKI recovery, which was evidenced by a TECs trigger IL-22 release in dendritic cells by TLR4 activa- higher tubular necrosis index and elevated tubule injury marker tion. (Kim-1, p‐GST, a‐GST, and FABP) mRNA expression at day 5 (Figure 5B). However, does this effect specifically relate to a TLR4 Activation–Mediated IL-22 Release Drives lack of IL-22 release by the depleted mononuclear phagocytes? Tubular Repair on Post-ischemic AKI To address this question, we injected recombinant IL-22 from TLR4 activation triggers innate immunity, immunopathology, day 3 into clodronate liposome-treated mice. IL-22 reconstitu- and the extent of AKI during the early injury phase of AKI.30 To tion recovered tubular cell repair, which was indicated by nor- test a putative role of TLR4 in AKI recovery experimentally malization of all the aforementioned AKI parameters (Figure 5, requires either a conditional knockout approach or a specific 2 2 A and B). We examined the effect of renal phagocytes depletion TLR4 antagonist. Because conditional TLR4 / mice are not

4 Journal of the American Society of Nephrology J Am Soc Nephrol 25: ccc–ccc,2014 www.jasn.org BASIC RESEARCH

available, we used a TLR4 blocking antibody. However, when we injected anti- TLR4 IgG only from 48 hours after renal pedicle clamping, it partially reduced intrarenal expression of IL-22, which was evidenced by decreased expression of IL-22 in the injured kidney (Figure 7A). In this way, TLR4 inhibition impaired tubular recovery on post-ischemic AKI, which was illus- trated by an increased index of tubular necrosis, lower numbers of lectin+ or THP+ tubules, and the tubular injury marker p‐GST (Figure 7B). TLR4 blockade with CLI-095 initiated in the recovery phase was also associated with higher BUN levels on bilateral ischemic injury (P=0.06), which indicates that TLR4 blockade during recovery phase slows down the process of the tubular repair, whereas TLR4 blockade during the injury phase prevented AKI (Figure 7C). Together, releases from necrotic TECs activate TLR4 on intrarenal mononuclear phagocytes to induce IL- 22, a mechanism that enhances tubular recovery during the healing phase of AKI.

DISCUSSION

We had hypothesized that some ILs may hold the potential to drive tubular regeneration during the recovery phase of AKI. Our unbiased in vitro screening approach revealed IL-22 as a candidate. IL-22 not only fostered the regenerative outgrowth from those few TECs that had survived the ischemia-reperfusion injury of primary TEC isolation but also, accelerated wound closure on scratching TEC monolayers in culture. We used post-ischemic AKI in mice to validate these findings and found Figure 3. IL-22 blockade attenuates tubular repair on post-ischemic kidney injury. (A) Tubular injury was quantified on a periodic acid–Schiff (PAS)-stained renal section at that IL-22 accelerates tubular injury. We fi day 5 after unilateral renal artery clamping as described in Concise Methods. Isotype identi ed intrarenal mononuclear phago- represents isotype IgG, and aIL-22 represents IL-22 IgG. L. tetragonolobus lectin cytes (i.e., the various subsets of renal dendritic staining identified proximal tubuli, and THP staining identified distal tubuli in post- cells and macrophages) as the predomi- ischemic kidneys. IL-22 expression was analyzed using staining of IL-22. Renal injury nant source of IL-22 expression. Further- was quantified by analyzing PAS stain, and the quantitative assessment of tubuli with more, we found TLR4 signaling as a specific intact staining patterns is shown for each staining. Data are means6SEMs from six stimulus for IL-22 induction. These data mice in each group. Original magnification, 3100. (B) Effect of IL-22 inhibition on renal further specify how renal mononuclear injury and tubular repair was further determined by expression of various tubular injury phagocytes also orchestrate kidney regener- a p – fi markers (Kim-1, -GST, -GST, and L-FABP). (C) Il-22 de cient mice impaired tubular ation beyond their well known function in regeneration in bilateral ischemic injury, which was evident by elevated plasma BUN renal immunopathology. These data sur- on day 5, but IL-22 does not contribute to the injury phase; plasma BUN levels were comparable on day 1. (D) Pharmacological inhibition of IL-22 reduced proliferating prisingly imply that TLR4 signaling in my- THP+ proliferating cell nuclear antigen+ (PCNA+) tubular cells. Data are means6SEMs eloid cells drives danger response programs from six mice in each group. *P,0.05 versus isotype IgG-treated mice. and tissue inflammation as well as tissue regeneration.31,32

J Am Soc Nephrol 25: ccc–ccc, 2014 IL-22 in AKI Recovery 5 BASIC RESEARCH www.jasn.org

proliferation of keratinocytes in psoria- sis,34,35 lung epithelial cells in lung injury,36 enterocytes on toxic mucosal injury,37,38 hepatocytes in liver injury,39,40 and thymic epithelial cells on total body irradiation.41 The data from epithelial or- gans, like the gut and the skin, are consistent with our findings, documenting the concep- tual similarities between re-epithelialization of TEC monolayer injury inside renal tubules and re-epithelialization of epithelial surfaces in other body compartments. IL- 22–mediated re-epithelialization involves binding to its receptor IL-22R on TECs followed by activation of STAT3 and ERK1/2 phosphorylation.42 Although T and NKT cells were first thought to rep- resent the predominant IL-22–producing cells,43,44 IL-22 secretion by dendritic cells has previously been recognized.38,45 The dense network of interstitial dendritic cells in the healthy kidney seems to be the first source of intrarenal IL-22 secretion.46 Three studies as well as our own results showed an unexpected contribution of renal mononuclear phagocytes to AKI recovery by depleting them with clodronate selectively during the recovery phase. This process depleted the IL-22–producing cells, although it is theoretically possible that clodronate indirectly reduced IL-22 pro- Figure 4. Clodronate liposomes deplete IL-22–producing myeloid cells from the post- duction.18,19,25 IL-22 reconstitution recov- ischemic kidney. (A) Ischemic renal injury induced intrarenal expression of IL-22, and ered this phenotype, which identifies IL-22 renal mononuclear phagocytes (CD11b+,CD103+,CD11c+, and F4/80+) are the major as a paracrine mediator of this effect. It re- source of IL-22 in ischemic renal injury. (B) Effect of clodronate-liposome depletion on mains unclear if IL-22 reconstitution also IL-22 expression in ischemic kidney was analyzed using immunohistochemistry. had a supraphysiological therapeutic effect. Clodronate-liposome significantly reduced intrarenal expression of IL-22. Data are It is likely that IL-22 is just one of several 6 , means SEMs from six mice in each group. *P 0.05 versus PBS-liposome (Lipo- phagocyte-derived factors that regulate the – Control) treated mice. healing process. However, these data add on to the existing evidence that the various Table 1. Clodronate induced depletion of IL-22–producing phenotypes of intrarenal dendritic cells and macrophages or- cells in the post-ischemic kidney chestrate all phases of tissue injury and recovery to allow tis- Renal Mononuclear Phagocytes Control Clodronate sues to regain and maintain homeostasis.24 CD11b+IL-22+ 0.1360.06 0.0360.01a We also identified TLR4 signaling as a stimulus for IL-22 CD11b+CD103+IL-22+ 0.0860.04 0.0260.01a secretion in dendritic cells, similar to the endogenous DAMP 2 CD11b CD103+IL-22+ 0.0360.02 0.0160.004a concept of cell necrosis-induced activation of sterile inflam- CD11c+IL-22+ 0.1060.04 0.0160.01a mation.47 This finding does not contradict the proinflamma- + + + CD11c F4/80 IL-22 0.0360.01 0.0360.01 tory role of TLR4 in the injury phase of AKI. In fact, rapid 2 + + 6 6 a CD11c F4/80 IL-22 0.09 0.04 0.01 0.01 repair of epithelial barriers is another important innate re- 3 6 6 fi Cell number is in cells per kidney ( 10 ). Data are means SEMs from ve sponse mechanism of pathogen control and host defense mice in each group. aP,0.05 versus Lipo-Control. (e.g., inside the intestinal epithelium or the skin), which implies that inflammation and rapid re-epithelialization are both IL-22 is a member of the IL-10 family of cytokines with needed and potentially triggered by the same signaling cas- regulatory roles in tissue repair.33 IL-22 regulates the cades during host defense. The potential of the TLR/MyD88

6 Journal of the American Society of Nephrology J Am Soc Nephrol 25: ccc–ccc,2014 www.jasn.org BASIC RESEARCH

intestinal epithelial injury causes sepsis and death. Also, signals from the intestinal micro- biota activate TLRs to drive rapid intestinal epithelial repair. In addition, activation of keratinocyte TLR2 by macrophage-activating lipopeptide-2 or topical application of the TLR3 agonist poly-I:C RNA accelerates dermal wound healing.49,50 Similar mechanisms seem to apply to tubular recovery during AKI, where necrotic TECs release DAMPs with TLR4 agonistic activity that induce IL- 22 secretion by renal dendritic cells. This mechanism would add on to the potential of endogenous TLR2 agonists to activate tubular progenitor cells to release microvesicles with proregeneratory proteins and micro- RNAs and drive their differentiation into TECs.51,52 Finally, IL-22 increases the survival of such epithelial progenitor cells during injury.53 Altogether, IL-22 is a previously unknown mediator of TEC regeneration during the AKI recovery phase. TEC necrosis provides a stimulus to TLR4-mediated induction of IL-22 secretion by intrarenal dendritic cells and other mononuclear phagocytes. The mitogenic effects of IL- 22 on the surviving TECs are mediated by IL-22R and subsequent STAT3 and ERK1/2 phosphorylation. We conclude that TLR4 signaling drives epithelial regeneration on post-ischemic AKI through secretion of IL- 22 from mononuclear phagocytes, which links the two danger response programs of renal inﬂammation and regeneration at the level of TLR4.

Figure 5. Depletion of IL-22–producing cells attenuates tubular recovery. (A) De- pletion of IL-22–producing phagocytes significantly increased renal injury, reduced CONCISE METHODS THP+ and Lectin+ tubules, and reduced proliferating renal tubular cells identified as proliferating cell nuclear antigen+ (PCNA+)THP+ cells (green, PCNA+ cells; red, THP+ cells). Renal injury was quantified by analyzing PAS stain, and the quantitative as- Isolation of Tubular Epithelial Cells sessment of tubuli with intact staining patterns is shown for each staining. Control We performed complete perfusion with sterile represents IR control, Clodronate represents Clodronate-liposome, and Clodronate+IL- Dulbecco’s phosphate-buffered saline (DPBS) 22 represents Clodronate-liposome+recombinant IL-22 on day 3. Original magnifica- on 6- to 7-week-old wild-type C57BL6 mice tion, 3100. (B) Effect depletion of IL-22–producing cells on renal injury and tubular by puncture of the left ventricle. Subsequently, repair was further determined by mRNA expression of various tubular injury markers both kidneys were weighed, mashed, digested in (Kim-1, a-GST, p-GST, and L-FABP). (C) Depletion of renal phagocytes using clodronate collagenase (Collagenase A; Roche Diagnostics) fi signi cantly impaired recovery of renal function in bilateral ischemic injury (25 minutes). for 30 minutes, and then sieved through a 6 Reconstitution of IL-22 on day 3 normalized plasma BUN levels. Data are means SEMs 70-mm sieve. After one step of centrifugation fromsixmiceineachgroup.+P,0.05 versus control; *P,0.05 versus clodronate- (1500 rpm for 5 minutes), the tubular fragments treated mice. were resuspended in 2 ml DPBS, carefully lay- ered on a 31% Percoll column, and centrifuged (3000 rpm for 10 minutes). The pellet (tubular signaling pathway to accelerate epithelial healing was first discov- fragments) was washed two times in DPBS and then cultured in 48 28 ered by Rakoff-Nahoum et al., who found that dextran-induced hormone-conditioned media at 37°C and 5% CO2 as described.

J Am Soc Nephrol 25: ccc–ccc, 2014 IL-22 in AKI Recovery 7 BASIC RESEARCH www.jasn.org

was added to the cells at different concentrations (0.1, 1, and 10 ng/ml). Two pictures per wound were taken on a phase contrast microscope at different time points (0, 16, 20, and 24 hours). Changes in wound size were analyzed digitally (Photoshop) and then translated into wound closure. To understand the functional role of various pathways, scratch assay was performed in the presence of JAK-STAT inhibitor (10 nM Jak inhibitor I; Santa Cruz Biotechnology) and MEK1/2 inhibitor (10 mM PD98059; Cell Sig- naling Technology), and cells were stimulated with 1 ng/ml IL-22.

Protein Isolation and Western Blotting We extracted protein from cell lysate using RIPA buffer (Sigma-Aldrich) containing protease inhibitors (Roche Diagnostics) and phosphatase inhibitor (Sigma-Aldrich) and processed it for Western blotting as described.29,54 Briefly, proteins were separated by SDS-PAGE and then transferred to a polyvinylidene difluoride membrane. Nonspecific binding to the membrane was blocked for 2 hours at room temperature with 5% BSA in Tris-buffered saline buffer. The membranes were incubated overnight at 4°C with primary rabbit antibodies against mouse p-stat3, p-ERK 42/44, and b-actin (Cell Signaling Technology). Figure 6. Necrotic cell supernatant, oxidative stress, and AhR regulate IL-22 secretion. After washing, the membranes were incubated (A) Stimulation of BMDCs with necrotic supernatant in different concentrations induced with peroxidase-conjugated secondary antibodies IL-22 production. AhR agonist (FICZ) and H O also produced IL-22 secretion by 2 2 in Tris-buffered saline buffer. Secondary antibodies BMDCs. (B) BMDCs were stimulated for 16 hours with LPS (1 mg/ml), pI:C RNA (5 mg/ ml), Pam3Cys (1 mg/ml), Imiquimod (1 mg/ml), and CpG (3 mg/ml). Cell culture su- were peroxidase-conjugated anti-rabbit IgG pernatants were analyzed for IL-6 and IL-22. (C) Primary BMDCs cultured necrotic (Cell Signaling Technology). The signals were supernatant from TECs. IL-22 release was quantified in cell culture supernatant on 18 visualized by an enhanced chemiluminescence hours of stimulation in the presence of TLR4 blocking antibody at different concen- system (Amersham). trations. (D) Necrotic cell supernatant and TLR4 stimulation induced IL-22 expression in primary renal dendritic cells. Data are means6SEMs from three independent ex- BMDC Stimulation Experiments periments. *P,0.05 versus NS control; *P,0.01 versus NS control. Med, medium; ND, BMDCs were generated by established protocols. fl not detected. Brie y, bone marrow cells were harvested from mouse femor and cultured with granulocyte macrophage CSF (2 ng/ml) for 8 days. Cell media Assessment of Regeneration were replaced on day 8, and adherent dendritic cells were stimulated. We performed a large-scale screening experiment with over 20 Renal dendritic cells were isolated fromwhole kidneys by magnetic bead cytokines (Immunotools). Right after isolation, an equal amount separation (MACS) using CD11c MicroBeads (Miltenyi Biotech). The (according to the kidney weight) of tubular fragments was plated into purity of CD11c+ renal cells was confirmed by FACS analysis using anti- 24-well plates. On the same 24-well plates, four squares (434mm) CD11c antibody (BD Biosciences–Pharmingen). Necrotic cell superna- with a gap between them were marked on the bottom of the plate tants were prepared from mouse tubular cells by repeated freezing and before the cell culture. Photos of these squares were taken with a thawing. BMDCs were stimulated with necrotic supernatant with dif- phase contrast microscope (ProgRes software; Leica) on day 5 after ferent concentration (50, 150, and 250 ml) as well as AhR agonist (FICZ; ischemia. By digital analysis (Photoshop; Adobe), the area surface Enzo Life Sciences) and H O (Merck). We purchased ultrapure LPS covered by tubular cells was measured in percent to the total image 2 2 (from Escherichia coli strain K12), pI:C RNA, Pam3Cys, imiquimod, size. and CpG (InvivoGen). All cells were stimulated in serum-free RPMI 6 Scratch Assay 1640 medium (Invitrogen) at a density of 1310 cells/ml. Cells were For scratch assays, artificial wounds were created through standard- stimulated for 16 hours with LPS (1 mg/ml), pI:C RNA (5 mg/ml), ized scratching of the tubular cell monolayer with a pipette tip. IL-22 Pam3Cys (1 mg/ml), imiquimod (1 mg/ml), and CpG (3 mg/ml). Cell

8 Journal of the American Society of Nephrology J Am Soc Nephrol 25: ccc–ccc,2014 www.jasn.org BASIC RESEARCH

culture supernatants were analyzed for IL-6 (BD Biosciences–Pharmingen) and IL-22 (eBioscien- ces) cytokine secretion by ELISA according to the manufacturer’s instructions. In some experiments, BMDCs were preincubated with TLR4 antibody (MTS510; BioLegend) at different concentration 30 minutes before necrotic supernatant stimulation.

Animal Experiments C57BL/6 wild-type mice were obtained from Charles River (Sulzfeld, Germany). Il-22–deficient mice were provided by S. Kobold. Mice were housed in groups of five in filter-top cages with unlimited access to food and water. Cages, food, and water were sterilized by autoclaving before use. Unilateral (45 minutes) and bilateral (25 minutes) renal ischemia-reperfusion injuries were induced under general anesthesia as previously described.29 Mice were euthanized 1 and 5 days later, and pieces from ischemic and contralateral (sham) kidneys were snap- frozen in liquid nitrogen and fixed in 10% buffered formalin. In some experiments, mice received intraperitoneal injections with either 20 mg/ injection of the anti–IL-22 antibody or isotype control (eBiosciences) on days 2, 3, and 4 post- injury. Clodronate-liposome and PBS-liposome (200 ml per mouse per injection), both of which were procured from Haarlem (The Netherlands), were injected on days 1, 2, and 4 postinduc- tion of injury. Recombinant IL-22 (20 mg/ mouse; Biolegend) was injected in clodronate- liposome–injected mice on day 3 post-ischemic injury. Anti-TLR4 antibody (15 mg per mouse per injection; Biolegend) and isotype control Figure 7. TLR4-mediated release of IL-22 contributes to tubular repair. TLR4 blocking were injected as specified. TLR4 inhibitor antibody was injected on days 2, 3, and 4 after induction of ischemic and renal injuries, (CLI-095; Invivogen) was injected at the dose and tubular injury was analyzed by immunohistochemistry and RT-PCR. (A) Tubular of 1 mg/kg on day 0 (pre) as well as days 2, 3, injury was quantified on PAS-stained renal sections at day 5 after unilateral renal artery and 4 post-ischemic injury. Plasma BUN was clamping as described in Concise Methods. Isotype represents isotype IgG, and determined by taking blood samples on days a fi TLR4Ab represents TLR4 blocking IgG. L. tetragonolobus lectin staining identi ed 0, 1, and 5. IL-22 knockout mice were also ex- fi proximal tubuli, and THP staining identi ed distal tubuli in post-ischemic kidneys. amined to understand the role of IL-22 on renal IL-22 expression was analyzed using staining of IL-22. Renal injury was quantified by function. All experiments were conducted ac- analyzing PAS stain, and the quantitative assessment of tubuli with intact staining cordingtoGermananimalprotectionlaws patterns is shown for each staining. Original magnification, 3100. (B) Effect of TLR4 blockade on renal injury and tubular repair was further determined by expression of (equivalent to the National Institutes of Health various markers of tubular injury (Kim-1, a-GST, p-GST, and L-FABP). (C) We analyzed GuidefortheCareandUseofLaboratoryAni- the effects of TLR4 inhibitor (CLI-095; 1 mg/kg) treatment on renal function in bilateral mals) and had been approved by the local gov- ischemic injury. Early blockade (pre) of TLR4 protected from renal damage, which was ernment authorities. evident by plasma BUN on day 1, whereas late blockade (post) of TLR4 impaired 6 recovery of renal function. Data are means SEMs from six mice in each group. Assessment of Kidney Inflammation , *P 0.05 versus isotype IgG-treated mice. and Injury Kidneys were embedded in paraffin, and 2-mm sections were used for periodic acid–Schiff stains and immunostaining as described.55

J Am Soc Nephrol 25: ccc–ccc, 2014 IL-22 in AKI Recovery 9 BASIC RESEARCH www.jasn.org

Post-ischemic tubular injury was scored Table 2. List of primers used for RT-PCR by assessing the percentage of tubules in Right Primer (59 → 39) Left Primer (59 → 39) the corticomedullary junction that dis- 18S AGGGCCTCACTAAACCATCC GCAATTATTCCCCATGAACG fl played tubular cell attening, cell necrosis, p-GST ACACCGCCCTCGAACTGGGAA CGCAGCACTGAATCCGCACC loss of brush border, and luminal cast for- a-GST CTTCAAACTCCACCCCTGCTGC CAATGGCCGGGAAGCCCGTG mation as 0, none; 1, #10%; 2, 11%–25%; IL-22 GCTCAGCTCCTGTCACATCA TCGCCTTGATCTCTCCACTC 3, 26%–45%; 4, 46%–75%; 5, .76%. L-FABP AGGCAATAGGTCTGCCCGAGGAC CCAGTTCGCACTCCTCCCCCA For histochemistry, we used biotinylated AhR CTCCTTCTTGCAAATCCTGC GGCCAAGAGCTTCTTTGATG L. tetragonolobus lectin stain (Vector Labs), KIM-1 TGGTTGCCTTCCGTGTCTCT TCAGCTCGGGAATGCACAA THP stain (Santa Cruz Biotechnology), proliferating cell nuclear antigen (Cell Signaling Technology), IL-22R (BIOSS), and IL-22 antibody (Santa Cruz Biotechnology). To quantify the IL-22 REFERENCES staining, the slides were scanned using an Olympus BX 61 microscope and recorded with CellP software. The scans underwent digital stain 1. Bonventre JV, Yang L: Cellular pathophysiology of ischemic acute counting using Adobe Photoshop. kidney injury. JClinInvest121: 4210–4221, 2011 2. Wu H, Ma J, Wang P, Corpuz TM, Panchapakesan U, Wyburn KR, Chadban SJ: HMGB1 contributes to kidney ischemia reperfusion injury. Real-Time Quantitative RT-PCR – Total RNA was isolated from kidneys using a Qiagen RNA extraction J Am Soc Nephrol 21: 1878 1890, 2010 ’ fi 3. Allam R, Scherbaum CR, Darisipudi MN, Mulay SR, Hägele H, kit following the manufacturer s instructions. After quanti cation, Lichtnekert J, Hagemann JH, Rupanagudi KV, Ryu M, Schwarzenberger RNA quality was assessed using agarose gels. From isolated RNA, C, Hohenstein B, Hugo C, Uhl B, Reichel CA, Krombach F, Monestier M, cDNA was prepared using reverse transcription (Superscript II; In- Liapis H, Moreth K, Schaefer L, Anders HJ: Histones from dying renal vitrogen). Real-time quantitative RT-PCR was performed using cells aggravate kidney injury via TLR2 and TLR4. JAmSocNephrol23: – SYBRGreen PCR master mix and analyzed with a Light Cycler 480 1375 1388, 2012 4. Rabadi MM, Ghaly T, Goligorksy MS, Ratliff BB: HMGB1 in renal (Roche Diagnostics). All gene expression values were normalized us- ischemic injury. Am J Physiol Renal Physiol 303: F873–F885, 2012 ing 18s RNA as a housekeeping gene, and negative controls were used 5. Rabadi MM, Kuo MC, Ghaly T, Rabadi SM, Weber M, Goligorsky MS, for quality control as described.56 All primers used for amplification Ratliff BB: Interaction between uric acid and HMGB1 translocation and were from Metabion and are listed in Table 2. release from endothelial cells. Am J Physiol Renal Physiol 302: F730– F741, 2012 Flow Cytometry 6. Darisipudi MN, Thomasova D, Mulay SR, Brech D, Noessner E, Liapis H, Anti-mouse CD11c, CD11b, CD103, F4/80, and CD45 antibodies (BD Anders HJ: Uromodulin triggers IL-1b-dependent innate immunity via fl – Biosciences–Pharmingen) were used to detect renal mononuclear the NLRP3 in ammasome. JAmSocNephrol23: 1783 1789, 2012 7. Säemann MD, Weichhart T, Zeyda M, Staffler G, Schunn M, Stuhlmeier 57 phagocyte populations in the ischemic kidneys as described ;7/4 KM, Sobanov Y, Stulnig TM, Akira S, von Gabain A, von Ahsen U, Hörl (Abd Serotec), Ly6G (BD), CD3 (BD), and NK1.1 (BD) antibodies WH, Zlabinger GJ: Tamm-Horsfall glycoprotein links innate immune were used to detect neutrophil, T cell, and NK cell in the ischemic cell activation with adaptive immunity via a Toll-like receptor-4- kidneys. IL-22 expression was determined using intracellular staining dependent mechanism. J Clin Invest 115: 468–475, 2005 8. Anders HJ, Muruve DA: The inflammasomes in kidney disease. JAm with IL-22 antibodies (R&D Systems). Respective isotype antibodies – fi fi Soc Nephrol 22: 1007 1018, 2011 were used to show speci c staining of cell populations. Quanti cation 9. Anders HJ: Toll-like receptors and danger signaling in kidney injury. J of cell number was achieved using counting beads (Invitrogen). Am Soc Nephrol 21: 1270–1274, 2010 10. Anders HJ, Vielhauer V, Schlöndorff D: Chemokines and chemokine Statistical Analyses receptors are involved in the resolution or progression of renal disease. 6 Data are presented as mean SEM. Comparison of groups was performed Kidney Int 63: 401–415, 2003 using ANOVA or t test; post hoc Bonferroni correction was used for 11. Bonventre JV, Zuk A: Ischemic acute renal failure: An inflammatory multiple comparisons. A P value ,0.05 were considered significant. disease? Kidney Int 66: 480–485, 2004 12. Bonventre JV: Pathophysiology of acute kidney injury: Roles of potential inhibitors of inflammation. Contrib Nephrol 156: 39–46, 2007 13. Lech M, Avila-Ferrufino A, Allam R, Segerer S, Khandoga A, Krombach ACKNOWLEDGMENTS F, Garlanda C, Mantovani A, Anders HJ: Resident dendritic cells pre- vent postischemic acute renal failure by help of single Ig IL-1 receptor- related protein. JImmunol183: 4109–4118, 2009 Wethank HeniEkaSusanti,DanDraganovic,andJaninaMandelbaum 14. Lassen S, Lech M, Römmele C, Mittruecker HW, Mak TW, Anders HJ: for their expert technical assistance. Ischemia reperfusion induces IFN regulatory factor 4 in renal dendritic I.H., J.H., and H.-J.A. were supported by Deutsche For- cells, which suppresses postischemic inflammation and prevents acute schungsgemeinschaft Grant GRK1202, and D.T. by TH1836/1-2. renal failure. JImmunol185: 1976–1983, 2010 15. Lech M, Römmele C, Gröbmayr R, Eka Susanti H, Kulkarni OP, Wang S, Gröne HJ, Uhl B, Reichel C, Krombach F, Garlanda C, Mantovani A, Anders HJ: Endogenous and exogenous pentraxin-3 limits post- DISCLOSURES ischemic acute and chronic kidney injury. Kidney Int 83: 647–661, None. 2013

10 Journal of the American Society of Nephrology J Am Soc Nephrol 25: ccc–ccc,2014 www.jasn.org BASIC RESEARCH

16. Chen J, Matzuk MM, Zhou XJ, Lu CY: Endothelial pentraxin 3 contrib- cytokines on reconstituted human epidermis suggest potential roles in utes to murine ischemic acute kidney injury. Kidney Int 82: 1195–1207, cutaneous innate defense and pathogenic adaptive immunity in pso- 2012 riasis. JImmunol178: 2229–2240, 2007 17. Anders HJ, Ryu M: Renal microenvironments and macrophage phe- 36. Aujla SJ, Chan YR, Zheng M, Fei M, Askew DJ, Pociask DA, Reinhart TA, notypes determine progression or resolution of renal inflammation and McAllister F, Edeal J, Gaus K, Husain S, Kreindler JL, Dubin PJ, Pilewski fibrosis. Kidney Int 80: 915–925, 2011 JM, Myerburg MM, Mason CA, Iwakura Y, Kolls JK: IL-22 mediates 18. Lee S, Huen S, Nishio H, Nishio S, Lee HK, Choi BS, Ruhrberg C, Cantley mucosal host defense against Gram-negative bacterial pneumonia. LG: Distinct macrophage phenotypes contribute to kidney injury and Nat Med 14: 275–281, 2008 repair. J Am Soc Nephrol 22: 317–326, 2011 37. Sugimoto K, Ogawa A, Mizoguchi E, Shimomura Y, Andoh A, Bhan AK, 19. Zhang MZ, Yao B, Yang S, Jiang L, Wang S, Fan X, Yin H, Wong K, Blumberg RS, Xavier RJ, Mizoguchi A: IL-22 ameliorates intestinal in- Miyazawa T, Chen J, Chang I, Singh A, Harris RC: CSF-1 signaling flammation in a mouse model of ulcerative colitis. JClinInvest118: mediates recovery from acute kidney injury. J Clin Invest 122: 4519– 534–544, 2008 4532, 2012 38. Pickert G, Neufert C, Leppkes M, Zheng Y, Wittkopf N, Warntjen M, 20. Humphreys BD, Bonventre JV: Mesenchymal stem cells in acute kidney Lehr HA, Hirth S, Weigmann B, Wirtz S, Ouyang W, Neurath MF, Becker injury. Annu Rev Med 59: 311–325, 2008 C: STAT3 links IL-22 signaling in intestinal epithelial cells to mucosal 21. Humphreys BD, Czerniak S, DiRocco DP, Hasnain W, Cheema R, wound healing. JExpMed206: 1465–1472, 2009 Bonventre JV: Repair of injured proximal tubule does not involve 39. Radaeva S, Sun R, Pan HN, Hong F, Gao B: Interleukin 22 (IL-22) plays a specialized progenitors. Proc Natl Acad Sci U S A 108: 9226–9231, protective role in T cell-mediated murine hepatitis: IL-22 is a survival 2011 factor for hepatocytes via STAT3 activation. Hepatology 39: 1332– 22. Angelotti ML, Ronconi E, Ballerini L, Peired A, Mazzinghi B, Sagrinati C, 1342, 2004 Parente E, Gacci M, Carini M, Rotondi M, Fogo AB, Lazzeri E, Lasagni L, 40. Zenewicz LA, Yancopoulos GD, Valenzuela DM, Murphy AJ, Karow M, Romagnani P: Characterization of renal progenitors committed toward Flavell RA: Interleukin-22 but not interleukin-17 provides protection to tubular lineage and their regenerative potential in renal tubular injury. hepatocytes during acute liver inflammation. Immunity 27: 647–659, Stem Cells 30: 1714–1725, 2012 2007 23. Romagnani P: Family portrait: Renal progenitor of Bowman’scapsule 41. Dudakov JA, Hanash AM, Jenq RR, Young LF, Ghosh A, Singer NV, and its tubular brothers. Am J Pathol 178: 490–493, 2011 West ML, Smith OM, Holland AM, Tsai JJ, Boyd RL, van den Brink MR: 24. Lech M, Gröbmayr R, Weidenbusch M, Anders HJ: Tissues use resident Interleukin-22 drives endogenous thymic regeneration in mice. Science dendritic cells and macrophages to maintain homeostasis and to regain 336: 91–95, 2012 homeostasis upon tissue injury: The immunoregulatory role of chang- 42. Lejeune D, Dumoutier L, Constantinescu S, Kruijer W, Schuringa JJ, ing tissue environments. Mediators Inflamm 2012: 951390, 2012 Renauld JC: Interleukin-22 (IL-22) activates the JAK/STAT, ERK, JNK, 25. Kim MG, Boo CS, Ko YS, Lee HY, Cho WY, Kim HK, Jo SK: Depletion of and p38 MAP kinase pathways in a rat hepatoma cell line. Pathways that kidney CD11c+ F4/80+ cells impairs the recovery process in ischaemia/ are shared with and distinct from IL-10. J Biol Chem 277: 33676–33682, reperfusion-induced acute kidney injury. Nephrol Dial Transplant 25: 2002 2908–2921, 2010 43. Cella M, Fuchs A, Vermi W, Facchetti F, Otero K, Lennerz JK, Doherty 26. Isbel NM, Hill PA, Foti R, Mu W, Hurst LA, Stambe C, Lan HY, Atkins RC, JM, Mills JC, Colonna M: A human natural killer cell subset provides an Nikolic-Paterson DJ: Tubules are the major site of M-CSF production in innate source of IL-22 for mucosal immunity. Nature 457: 722–725, experimental kidney disease: Correlation with local macrophage pro- 2009 liferation. Kidney Int 60: 614–625, 2001 44. Duhen T, Geiger R, Jarrossay D, Lanzavecchia A, Sallusto F: Production 27. Lech M, Anders HJ: Macrophages and fibrosis: How resident and in- of interleukin 22 but not interleukin 17 by a subset of human skin- filtrating mononuclear phagocytes orchestrate all phases of tissue in- homing memory T cells. Nat Immunol 10: 857–863, 2009 jury and repair. Biochim Biophys Acta 1832: 989–997, 2013 45. Zheng Y, Valdez PA, Danilenko DM, Hu Y, Sa SM, Gong Q, Abbas AR, 28. Hagemann JH, Thomasova D, Mulay SR, Anders HJ: Nrf2 signalling Modrusan Z, Ghilardi N, de Sauvage FJ, Ouyang W: Interleukin-22 promotes ex vivo tubular epithelial cell survival and regeneration via mediates early host defense against attaching and effacing bacterial murine double minute (MDM)-2. Nephrol Dial Transplant 28: 2028– pathogens. Nat Med 14: 282–289, 2008 2037, 2013 46. Nelson PJ, Rees AJ, Griffin MD, Hughes J, Kurts C, Duffield J: The renal 29. Mulay SR, Thomasova D, Ryu M, Anders HJ: MDM2 (murine double mononuclear phagocytic system. JAmSocNephrol23: 194–203, 2012 minute-2) links inflammation and tubular cell healing during acute 47. Rock KL, Latz E, Ontiveros F, Kono H: The sterile inflammatory re- kidney injury in mice. Kidney Int 81: 1199–1211, 2012 sponse. Annu Rev Immunol 28: 321–342, 2010 30. Wu H, Chen G, Wyburn KR, Yin J, Bertolino P, Eris JM, Alexander SI, 48. Rakoff-Nahoum S, Paglino J, Eslami-Varzaneh F, Edberg S, Medzhitov Sharland AF, Chadban SJ: TLR4 activation mediates kidney ischemia/ R: Recognition of commensal microflora by toll-like receptors is re- reperfusion injury. JClinInvest117: 2847–2859, 2007 quired for intestinal homeostasis. Cell 118: 229–241, 2004 31. Gurtner GC, Werner S, Barrandon Y, Longaker MT: Wound repair and 49. Dasu MR, Isseroff RR: Toll-like receptors in wound healing: Location, regeneration. Nature 453: 314–321, 2008 accessibility, and timing. J Invest Dermatol 132: 1955–1958, 2012 32. Anders HJ: Four danger response programs determine glomerular and 50. Huebener P, Schwabe RF: Regulation of wound healing and organ fi- tubulointerstitial kidney pathology: Clotting, inflammation, epithelial brosis by toll-like receptors. Biochim Biophys Acta 1832: 1005–1017, and mesenchymal healing. Organogenesis 8: 29–40, 2012 2013 33. Sonnenberg GF, Fouser LA, Artis D: Border patrol: Regulation of im- 51. Sallustio F, Costantino V, Cox SN, Loverre A, Divella C, Rizzi M, Schena munity, inflammation and tissue homeostasis at barrier surfaces by IL- FP: Human renal stem/progenitor cells repair tubular epithelial cell 22. Nat Immunol 12: 383–390, 2011 injury through TLR2-driven inhibin-A and microvesicle-shuttled de- 34. Zheng Y, Danilenko DM, Valdez P, Kasman I, Eastham-Anderson J, corin. Kidney Int 83: 392–403, 2013 Wu J, Ouyang W: Interleukin-22, a T(H)17 cytokine, mediates IL-23- 52. Sallustio F, De Benedictis L, Castellano G, Zaza G, Loverre A, Costantino induced dermal inflammation and acanthosis. Nature 445: 648–651, V, Grandaliano G, Schena FP: TLR2 plays a role in the activation of human 2007 resident renal stem/progenitor cells. FASEB J 24: 514–525, 2010 35. Sa SM, Valdez PA, Wu J, Jung K, Zhong F, Hall L, Kasman I, Winer J, 53. Hanash AM, Dudakov JA, Hua G, O’Connor MH, Young LF, Singer NV, Modrusan Z, Danilenko DM, Ouyang W: The effects of IL-20 subfamily West ML, Jenq RR, Holland AM, Kappel LW, Ghosh A, Tsai JJ, Rao UK,

J Am Soc Nephrol 25: ccc–ccc, 2014 IL-22 in AKI Recovery 11 BASIC RESEARCH www.jasn.org

Yim NL, Smith OM, Velardi E, Hawryluk EB, Murphy GF, Liu C, Fouser 56. Lech M, Avila-Ferrufino A, Skuginna V, Susanti HE, Anders HJ: Quan- LA, Kolesnick R, Blazar BR, van den Brink MR: Interleukin-22 protects titative expression of RIG-like helicase, NOD-like receptor and in- intestinal stem cells from immune-mediated tissue damage and regu- flammasome-related mRNAs in humans and mice. Int Immunol 22: lates sensitivity to graft versus host disease. Immunity 37: 339–350, 717–728, 2010 2012 57. Mulay SR, Kulkarni OP, Rupanagudi KV, Migliorini A, Darisipudi MN, 54. Teixeira VP, Blattner SM, Li M, Anders HJ, Cohen CD, Edenhofer I, Vilaysane A, Muruve D, Shi Y, Munro F, Liapis H, Anders HJ: Calcium Calvaresi N, Merkle M, Rastaldi MP, Kretzler M: Functional con- oxalate crystals induce renal inflammation by NLRP3-mediated IL-1b sequences of integrin-linked kinase activation in podocyte damage. secretion. J Clin Invest 123: 236–246, 2013 Kidney Int 67: 514–523, 2005 55. Patole PS, Pawar RD, Lichtnekert J, Lech M, Kulkarni OP, Ramanjaneyulu A, Segerer S, Anders HJ: Coactivation of Toll-like receptor-3 and -7 in immune complex glomerulonephritis. JAutoimmun This article contains supplemental material online at http://jasn.asnjournals. 29: 52–59, 2007 org/lookup/suppl/doi:10.1681/ASN.2013050528/-/DCSupplemental.

12 Journal of the American Society of Nephrology J Am Soc Nephrol 25: ccc–ccc,2014