US 201700 16035A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2017/0016035 A1 Ramseier et al. (43) Pub. Date: Jan. 19, 2017

(54) GENETICALLY ENGINEERED (86) PCT No.: PCT/US2O14/0447O6 METHYLOTROPHS FOR THE S 371 (c)(1), PRODUCTION OF PHABOPOLYMERS AND (2) Date: Dec. 28, 2015 C3, C4, AND C5 BIOCHEMICALS FROM METHANOL OR METHANE AS SOLE Related U.S. Application Data CARBON FEEDSTOCK (60) Provisional application No. 61/841,275, filed on Jun. 28, 2013, provisional application No. 61/893.311, (71) Applicant: METABOLIX, INC., Cambridge, MA filed on Oct. 21, 2013. (US) Publication Classification (72) Inventors: Thomas M. Ramseier, Newton, MA (51) Int. C. (US); Dong-eun Chang, Cambridge, CI2P 7/62 (2006.01) MA (US); Jian-rong Gao, Cambridge, CI2P 7/18 (2006.01) MA (US); William R. Farmer, (52) U.S. C. Concord, MA (US); Oliver P. Peoples, CPC. CI2P 7/625 (2013.01): CI2P 7/18 (2013.01) Arlington, MA (US) (57) ABSTRACT (21) Appl. No.: 14/901,540 Methods and genetically engineered hosts for the production of 3-carbon, 4-carbon and 5-carbon products, polymers and (22) PCT Filed: Jun. 27, 2014 copolymers in methylotrophic bacteria are described herein. Patent Application Publication Jan. 19, 2017. Sheet 1 of 6 US 2017/OO16035 A1

Methane Or Methanol OUTSIDE

WSOE 1." a 1 2 DHA AC-COA->3. ACAC-COA-> 3HB-COAN 13 P(3HB-CO-3HP) 4. 7 13 8 Mal-CoA --> 3HP--> 3HP-CoA i? > P3HP N Y5 MSA 6s/ 9/ O 11 14 GO-3P->9 GO -->1 34 PDO

FIG. 1 Patent Application Publication Jan. 19, 2017. Sheet 2 of 6 US 2017/OO16035 A1

Methane O Methanol

OLSOE

ASIO 4 a 2 SuC-COA OK AC-COA-" - Y ACAC-COA-> 3HB-COA 3Y, /4 9 11 SSA Crot-COA P(3HB-CO-4HB) 5 ! 6 10 11 ins u 4HB-CoA -> P4HB 7 N- - 8 12 13 4HB-P 4HBA --> BEDO

FIG 2 Patent Application Publication Jan. 19, 2017. Sheet 3 of 6 US 2017/OO16035 A1

Methane Or Methanol OLTSOE

WSOE

A: w A 1 2 Lys AC-COA-> ACAC-COA > 3HB-COAN 10 3 - > P(3HB-CO-5HV) 4. 5 6 7 10 5APA - 5APO - GSA--> 5HV- > 5HV-CoA 1--> P5HV 8 9 5HVA - > 1,5PD

FIG. 3 Patent Application Publication Jan. 19, 2017. Sheet 4 of 6 US 2017/0016035 A1

Patent Application Publication Jan. 19, 2017. Sheet 5 of 6 US 2017/0016035 A1

||||||||| Patent Application Publication Jan. 19, 2017. Sheet 6 of 6 US 2017/0016035 A1

s US 2017/00 16035 A1 Jan. 19, 2017

GENETICALLY ENGINEERED on C1-compounds (single carbon-containing compounds) as METHYLOTROPHS FOR THE their sole source of carbon and energy and thus are able to PRODUCTION OF PHABOPOLYMERS AND make every carbon-carbon bond de novo. C1 substrates that C3, C4, AND C5 BIOCHEMICALS FROM are used for methylotrophic growth include not only meth METHANOL OR METHANE AS SOLE ane and methanol, but also methylamine (CH-NH), form CARBON FEEDSTOCK aldehyde (HCHO), formate (HCOOH), formamide (HCONH), and carbon monoxide (CO). Examples for use RELATED APPLICATIONS of methane as sole carbon feedstock include the wild-type methanotrophic bacterium Methylococcus capsulatus (Bath) 0001. This application claims the benefit of U.S. Provi that was used by Norferm Danmark A/S to produce Bio sional Application No. 61/811.275, filed on Jun. 28, 2013 Protein, a bacterial single cell protein (SCP) product serving and claims the benefit of U.S. Provisional Application No. as a protein source in feedstuff (Bothe et al., Appl. Micro 61/893.311, filed on Oct. 21, 2013. The entire teachings of biol. Biotechnol. 59:33-39 (2002)), and production of poly the above application(s) are incorporated herein by refer 3-hydroxybutyrate (PHB) using Methylocystis hirsute (Rah CCC. nama et al., Biochem. Engineer. J. 65:51-56 (2012)) or Methylocystis sp. GB 25 wild-type strains (Wendlandt et al., INCORPORATION BY REFERENCE OF J. Biotech. 86:127-133 (2001)). The obligate methano MATERIAL IN ASCII TEXT FILE trophic Methylomonas sp. strain 16a was genetically engi 0002 This application incorporates by reference the neered to produce astaxanthin from methane (Ye et al., J. Sequence Listing contained in the following ASCII text file Ind. Microbiol. Biotechnol. 34:289-299 (2007)). Industrial being submitted concurrently herewith: scale processes using methanol as sole carbon feedstock 0003 a) File name: 46141 014002SEQUENCELIST were established by Imperial Chemical Industries (ICI) in ING..txt; created May 8, 2014, 18 KB in size. the 1970s and 80s with the aim of providing large amounts of SCP (soluble carbohydrate polymer) for human and BACKGROUND animal feed. 0004. With the recent ability to access the vast amount of 0006 Production of poly-3-hydroxybutyrate (PHB) has natural gas trapped in shale rock formations using technolo also been accomplished using methanol as the sole carbon gies such as hydraulic fracturing and horizontal drilling, the source in wild-type methylotrophs, where PHB concentra price for American natural gas has decreased to a fraction of tions of up to 130 g/L were obtained and PHB accumulated that in earlier years. Biobased, “green natural gas is pro up to 60% of the total biomass (Kim et al., Biotechnol. Lett. duced from renewable resources that are formed by the 18:25-30 (1996); Zhao et al., Appl. Biochem. Biotechnol. breakdown of organic matter Such as manure, sewage, 39-40:191-199 (1993)). Production of the copolymer poly municipal waste, green waste, plant material, and crops in (3-hydroxybutyrate-co-3-hydroxyvalerate) in wild-type the absence of oxygen. Natural gas consists primarily of methylotrophs was accomplished when a mixture of metha methane (CH4). Methane is used as an energy source for nol and n-amyl-alcohol, Valeric acid, or propionic acid was heating, cooking, and electricity generation. It is also the C1 fed to the fermentation medium (Haywood et al., Biotech carbon Source for the commercial production of methanol nol. Lett. 11(7):471-476 (1989); Bourque et al., Appl. (CHOH, often abbreviated MeOH). Methanol is an impor Microbiol. Biotechnol. 37(1): 7-12 (1992): Ueda et al., Appl. tant chemical building block used for many organic inter Environ. Microbiol. 58(11):3574-3579 (1992)). Genetic mediates and downstream processes including esterification, engineering of Methylobacterium extorquens to express the ammoniation, methylation, and polymerization. The primary phaC1 or phaC2 genes encoding the PHA synthase 1 or 2, chemical intermediates produced from methanol include respectively, from Pseudomonas fluorescens enabled pro formaldehyde, acetic acid, methylamines, methyl methacry duction of functionalized PHA copolymer when n-alkenoic late (MMA), dimethyl terephthalate (DMT) and methyl acids were co-fed with methanol (Höfer et al., Microb. Cell tertiary butyl ether (MTBE). It is also used as antifreeze, Fact. 9:70 (2010), PMID: 20846434, DOI: 10.1186/1475 Solvent, fuel, a denaturant for ethanol, and to produce 2859-9-70; Höfer et al., Biochem. Eng. J. 54:26-33 (2011), biodiesel via transesterification reaction. Methanol is pro Höfer et al., Bioengineered Bugs 2(2):71-79 (2011)). duced in a three stage process that includes (1) reforming 0007 Previous work has shown that it is possible to where methane is combined with steam under heat to produce a very limited range of PHA materials in microor produce synthesis gas, a mixture of hydrogen (H2), carbon ganisms using C1 compounds as the sole carbon feedstock. monoxide (CO) and carbon dioxide (CO), (2) compression There is a need therefore to engineer methylotrophic micro conversion where the synthesis gas is pressurized and con organisms to enable the production of a wider variety of verted to methanol, and (3) distillation where the liquid PHA biopolymers as well as C3, C4, and C5 biochemicals mixture is heated to separate the components and the result from methanol or methane as the sole carbon feedstock. ing vapor is cooled and condensed to produce pure metha nol. Methanol can consequently be produced very cost SUMMARY OF THE INVENTION effectively from methane. Biobased, “green' methanol (bio 0008. The invention generally relates to methods of methanol) can also be produced from renewable raw increasing the production of a 3-carbon (C3) product or materials such as glycerol on a large industrial scale as polymer of 3-carbon monomers, 4-carbon (C4) product or a shown by BioMCN at the world wide web at biomcn.eu. polymer of 4-carbon monomers, or 5-carbon (C5) productor 0005. Both methane and methanol can also be an inex polymer of 5-carbon monomers or copolymers thereof from pensive alternative carbon feedstock utilized by methylo methanol or methane in methylotrophic bacteria. Metabolic trophic microorganisms for the production of valuable pathways in bacteria are genetically engineered by providing industrial chemicals. Methylotrophs are capable of growth one or more genes that are stably expressed that encodes an US 2017/00 16035 A1 Jan. 19, 2017 enzyme with an activity catalyzing the methanol or methane E. coli or mutants and homologues thereof a malonyl-CoA to produce the carbon products, polymer or copolymers, reductase (3-hydroxypropionate-forming) from Chloro wherein microorganism growth is improved and the carbon flexus aurantiacus or mutants and homologues thereof; flux from the renewable feedstock is increased. malonyl-CoA reductase (malonate semialdehyde-forming) 0009. In certain embodiments of any of the aspects of the from Sulfolobus tokodaii Str. 7 or mutants and homologues invention, the pathway is a malonyl CoA metabolic pathway, thereof; malonic semialdehyde reductase from Sulfolobus an acetyl-CoA pathway, a 3-hydroxypropioate CoA path tokodai Str. 7 or mutants and homologues thereof; CoA way, a 4-hydroxybutyrate-CoA pathway, a 5-hydroxyvaler transferase from Clostridium kluyveri DSM 555, or mutants ate-pathway, a Succinate semialdehyde dehydrogenase path and homologues thereof. CoA ligase from Pseudomonas way optionally including an alpha-ketoglutarate putida or mutants and homologues thereof, and polyhy decarboxylase pathway, an alpha-ketoglutarate pathway, a droxyalkanoate synthase from a fusion protein of lysine pathway, Pseudomonas putida and Ralstonia eutropha JMP134 or 0010. The invention also pertains to increasing the mutants and homologues thereof wherein the expression amount of poly 3 hydroxypropionate (P3HP) homopolymer, increases the production of poly-3-hydroxypropionate. In a P(3HB-co-3HP) copolymer, and 1,3-propanediol (PDO) in certain aspect of the fifth embodiment, the modified organ methylotrophic bacteria. In other aspects, the invention ism is Methylophilus methylotrophus. pertains to increasing the amount of poly-4-hydroxybutyrate 0014. In a sixth embodiment of the first aspect, the (P4HB) homopolymer, P(3HB-co-4HB) copolymer, and product is poly-3-hydroxypropionate, the feedstock is 1,4-butanediol (BDO) in methylotrophic bacteria. Exem methanol and the modified genetic pathway is a dihydroxy plary pathways for production of these products are pro acetone-phosphate metabolic pathway. The one or more vided in FIGS. 1-3. It is understood that additional enzy genes that are stably expressed encode one or more enzymes matic changes that contribute to this pathway can also be or mutants and homologues thereof are selected from: introduced or Suppressed for a desired production of carbon glycerol-3-phosphate dehydrogenase (NAD+); glycerol-3- product, polymer or co-polymers. phosphate dehydrogenase (NADP+); glycerol-3-phos 0011. In a first aspect, the invention pertains to a method phatase, glycerol dehydratase; glycerol dehydratase reacti of increasing the production of a 3-carbon (C3) product, a Vating enzyme; CoA transferase, CoA ligase, aldehyde 4-carbon (C4) product or a 5-carbon (C5) product, a polymer dehydrogenase; alcohol dehydrogenase; CoA-acylating of 3-carbon monomers, a polymer of 4-carbon monomers or 3-hydroxypropionaldehyde dehydrogenase; and polyhy a polymer of 5-carbon monomers or copolymer combina droxyalkanoate synthase, wherein the expression increases tions thereof from a renewable feedstock of methane or the production of poly-3-hydroxypropionate. For example, methanol, by providing a genetically modified methylotroph the one or more genes that are stably expressed encode one organism having a modified or metabolic C3, C4 or C5 or more enzyme are selected from glycerol-3-phosphate pathway or incorporating a modified metabolic C3, C4 or C5 dehydrogenase (NAD+) from Saccharomyces cerevisiae pathway, and providing one or more genes that are stably S288c or mutants and homologues thereof glycerol-3-phos expressed that encodes one or more enzymes of the carbon pathway, wherein the production of the carbon product, phate dehydrogenase (NADP+) from Rickettsia prowazeki polymer or copolymer is improved compared to a wild type (strain Madrid E) or mutants and homologues thereof; organism. In a first embodiment of the first aspect, the wild glycerol-3-phosphatase from Saccharomyces cerevisiae type methylotroph naturally produces polyhydroxybutyrate. S288c or mutants and homologues thereof glycerol dehy In a second embodiment of the first aspect, the wild type dratase Small, medium and large Subunits from Klebsiella methylotroph is genetically modified to produce polyhy pneumonia or mutants and homologues thereof glycerol droxybutyrate. In a third embodiment of the first aspect or dehydratase reactivating enzyme (Chain A and Chain B) any of the other embodiments, the product, polymer or from Klebsiella pneumonia or mutants and homologues copolymer is a 3-carbon product, polymer or copolymer and thereof, aldehyde dehydrogenase/alcohol dehydrogenase the methylotroph has a modified metabolic C3 pathway; the from E. coli str. K-12 substr. MG 1655; or mutants and product, polymer or copolymer is a 4-carbon product, poly homologues thereof; CoA transferase from Clostridium mer or copolymer and the methylotroph has a modified Kluyveri DSM 555, or mutants and homologues thereof; metabolic C4 pathway; or the product, polymer or copoly CoA ligase from Pseudomonas putida or mutants and homo mer is a 5-carbon product, polymer or copolymer and the logues thereof, 3-hydroxy-propionaldehyde dehydrogenase methylotroph has a modified metabolic C5 pathway. (gamma-Glu-gamma-aminobutyraldehyde dehydrogenase, 0012. In a fourth embodiment, of the first aspect or any NAD(P)H-dependent) from E. coli str. K-12 substr. other embodiment, the feedstock is methanol or methane. MG 1655 or mutants and homologues thereof; CoA-acylat 0013. In a fifth embodiment of the first aspect, the prod ing 3-hydroxypropionaldehyde dehydrogenase from Salmo uct is poly-3-hydroxypropionate, the feedstock is methanol nella enterica Subsp. enterica serovar Tiphimurium str. LT2 and the modified genetic pathway is a malonyl-CoA reduc or mutants and homologues thereof, and polyhydroxyal tase metabolic pathway and the one or more genes that are kanoate synthase from a fusion protein of Pseudomonas stably expressed encode one or more enzymes or mutants putida and Ralstonia eutropha JMP134 or mutants and and homologues thereof are selected from: acetyl-CoA homologues thereof, wherein the expression increases the carboxylase, malonyl-CoA reductase (3-hydroxypropionate production of poly-3-hydroxypropionate. forming), malonyl-CoA reductase (malonate semialdehyde forming), malonic semialdehyde reductase, CoA transferase, 0015. In a certain aspect of the sixth embodiment, the CoA ligase, and polyhydroxyalkanoate synthase, wherein organism is Methylophilus methylotrophus. the expression increases the production of poly-3-hydroxy 0016. In the seventh embodiment of first aspect, the propionate, wherein the expression increases the production product is poly-3-hydroxybutyrate-co-3-hydroxyproprion of poly-3-hydroxypropionate. For example, the one or more ate copolymer and the feedstock is methanol and the modi genes that are stably expressed encode one or more enzyme fied genetic pathway is a malonyl-CoA reductase metabolic are selected from: an acetyl-CoA carboxylase subunits from pathway. The one or more genes that are stably expressed US 2017/00 16035 A1 Jan. 19, 2017 encode one or more enzyme are selected from acetyl-CoA thereof; wherein the expression increases the production of acetyltransferase; acetoacetyl-CoA reductase; acetyl-CoA poly-3-hydroxybutyrate-co-3-hydroxyproprionate copoly carboxylase, malonyl-CoA reductase (3-hydroxypropionate C. forming), malonyl-CoA reductase (malonate semialdehyde 0019. In a certain embodiment of the eighth embodiment forming), malonic semialdehyde reductase, CoA transferase, the organism is Methylophilus methylotrophus or Methyl CoA ligase, and polyhydroxyalkanoate synthase, wherein obacterium extorquens with one or more of the following the expression increases the production of poly-3-hydroxy genes deleted: phaA, phaB, phaCl, phaC2, depA and depB. butyrate-co-3-hydroxyproprionate copolymer. 0020. In a ninth embodiment of the first aspect, the 0017 For example, the one or more genes that are stably product is 1,3-propanediol, the feedstock is methanol and expressed encode one or more enzyme are selected from the modified genetic pathway is a malonyl-CoA reductase acetyl-CoA acetyltransferase from Zoogloca rumigera or metabolic pathway. mutants and homologues thereof acetoacetyl-CoA reduc 0021. The one or more genes that are stably expressed tase from Zoogloea ramigera or mutants and homologues encode one or more enzymes are selected from: acetyl-CoA thereof; an acetyl-CoA carboxylase subunits from E. coli or carboxylase, malonyl-CoA reductase (3-hydroxypropionate mutants and homologues thereof; a malonyl-CoA reductase forming), malonyl-CoA reductase (malonate semialdehyde (3-hydroxypropionate-forming) from Chloroflexus auran forming), malonic semialdehyde reductase, aldehyde dehy tiacus or mutants and homologues thereof malonyl-CoA drogenase/alcohol dehydrogenase; and aldehyde reductase reductase (malonate semialdehyde-forming) from Sulfolo wherein the expression increases the production of 1,3- bus tokodai Str. 7 or mutants and homologues thereof. propanediol. For example, the one or more genes that are malonic semialdehyde reductase from Sulfolobus tokodai stably expressed encode one or more enzymes are selected Str. 7 or mutants and homologues thereof; CoA transferase from: acetyl-CoA carboxylase subunits from E. coli or mutants and homologues thereof malonyl-CoA reductase from Clostridium kluyveri DSM 555, or mutants and homo 3-hydroxypropionate-forming from Chloroflexus aurantia logues thereof. CoA ligase from Pseudomonas putida or cus or mutants and homologues thereof: malonyl-CoA mutants and homologues thereof, and polyhydroxyalkanoate reductase (malonate semialdehyde forming from Sulfolobus synthase from a fusion protein of Pseudomonas putida and tokodai Str. 7 or mutants and homologues thereof malonic Ralstonia eutropha JMP134 or mutants and homologues semialdehyde reductase from Sulfolobus tokodaii str. 7 or thereof; wherein the expression increases the production of mutants and homologues thereof, aldehyde dehydrogenase/ poly-3-hydroxybutyrate-co-3-hydroxyproprionate copoly alcohol dehydrogenase 3-hydroxy-propionaldehyde dehy mer. In a certain embodiment of the seventh embodiment, drogenase (gamma-Glu-gamma-aminobutyraldehyde dehy the organism is methylophilus methylotrophus or the organ drogenase, NAD(P)H-dependent) from E. coli str. K-12 ism is Methylobacterium extorquens with one or more of the substr. MG 1655 or mutants and homologues thereof; and following genes deleted: phaC1, phaC2, depA and depB. succinic aldehyde reductase from E. coli K-12 or mutants 0018. In the eighth embodiment of the first aspect, the and homologues thereof, wherein the expression increases product is poly-3-hydroxybutyrate-co-3-hydroxyproprion the production of 1,3-propanediol. In a certain embodiment ate copolymer, the feedstock is methanol and the modified of the ninth embodiment, organism is Methylophilus meth genetic pathway is a dihydroxyacetone-phosphate metabolic ylotrophus. pathway. The one or more genes that are stably expressed 0022. In the tenth embodiment of the first aspect, the encode one or more enzymes are are selected from: glycerol product is 1,3-propanediol, the feedstock is methanol and 3-phosphate dehydrogenase (NAD+); glycerol-3-phosphate the modified genetic pathway is a dihydroxyacetone-phos dehydrogenase (NADP+); glycerol-3-phosphatase; glycerol phate metabolic pathway. The one or more genes that are dehydratase; glycerol dehydratase reactivating enzyme; stably expressed encode one or more enzymes are selected aldehyde dehydrogenase; alcohol dehydrogenase; and alde from: acetyl-CoA carboxylase, malonyl-CoA reductase hyde reductase, wherein the expression increases the pro (3-hydroxypropionate-forming), malonyl-CoA reductase duction of poly-3-hydroxybutyrate-co-3-hydroxyproprion (malonate semialdehyde-forming), malonic semialdehyde ate copolymer. For example the one or more genes that are reductase, aldehyde dehydrogenase/alcohol dehydrogenase; stably expressed encode one or more enzyme are selected and aldehyde reductase wherein the expression increases the from glycerol-3-phosphate dehydrogenase (NAD+) from production of 1,3-propanediol. Fore example, the one or Saccharomyces cerevisiae S288c or mutants and homo more genes that are stably expressed encode one or more logues thereof glycerol-3-phosphate dehydrogenase enzymes are selected from: acetyl-CoA carboxylase Sub (NADP+) from Rickettsia prowazekii (strain Madrid E) or units from E. coli or mutants and homologues thereof. mutants and homologues thereof glycerol-3-phosphatase malonyl-CoA reductase 3-hydroxypropionate-forming from from Saccharomyces cerevisiae S288c or mutants and Chloroflexus aurantiacus or mutants and homologues homologues thereof glycerol dehydratase Small, medium thereof: malonyl-CoA reductase (malonate semialdehyde and large subunits from Klebsiella pneumonia or mutants forming from Sulfolobus tokodai Str. 7 or mutants and and homologues thereof glycerol dehydratase reactivating homologues thereof, malonic semialdehyde reductase from enzyme (Chain A and Chain B) from Klebsiella pneumonia Sulfolobus tokodai Str. 7 or mutants and homologues or mutants and homologues thereof, 3-hydroxy-propional thereof, aldehyde dehydrogenase/alcohol dehydrogenase dehyde dehydrogenase (gamma-Glu-gamma-aminobutyral 3-hydroxy-propionaldehyde dehydrogenase (gamma-Glu dehyde dehydrogenase, NAD(P)H-dependent) from E. coli gamma-aminobutyraldehyde dehydrogenase, NAD(P)H-de str. K-12 substr. MG 1655 or mutants and homologues pendent) from E. coli str. K-12 substr. MG 1655 or mutants thereof, and aldehyde reductase (Succinic semialdehyde and homologues thereof, and Succinic aldehyde reductase reductase) from E. coli K-12 or mutants and homologues from E. coli K-12 wherein the expression increases the US 2017/00 16035 A1 Jan. 19, 2017

production of 1,3-propanediol. In a certain embodiment of thereof. Succinate semi aldehyde reductase or mutants and the tenth embodiment, the organism is Methylophilus meth homologues thereof; CoA-transferase or mutants and homo ylotrophus. logues thereof; Co-A ligase or mutants and homologues 0023. In the eleventh embodiment of the first aspect, the thereof, and polyhydroxyalkanoate synthase or mutants and product is poly-4-hydroxybutyrate and the feedstock is homologues thereof, wherein the expression increases the methanol and the modified genetic pathway is a Succinate production of poly-5-hydroxyvalerate. In a certain embodi semialdehyde dehydrogenase pathway optionally including ment of the fourteenth embodiment, the organism is Meth an alpha-ketoglutarate decarboxylase pathway. ylophilus methylotrophus. 0024. The one or more genes that are stably expressed 0029. In the fifteenth embodiment of the first aspect, the encode one or more enzymes are selected from: Succinate product is poly-3-hydroxybutyrate-co-5-hydroxyvalerate semialdehyde dehydrogenase, alpha-ketoglutarate decar and the feedstock is methanol and the pathway is a lysine boxylase, Succinic semialdehyde reductase, CoA trans pathway. The one or more genes that are stably expressed ferase, CoA ligase, butyrate kinase, phosphotransbutyrylase, encode one or more enzymes are selected from acetyl-CoA 4-hydroxybutyryl-CoA reductase and 4-hydroxybutyrylal acetyltransferase or mutants and homologues thereof. dehyde reductase; wherein the expression increases the acetoacetyl-CoA reductase or mutants and homologues production of poly-4-hydroxybutyrate. In a certain embodi thereof; polydroxyalkanoate synthase or mutants and homo ment of the eleventh embodiment, the organism is Methylo logues thereof lysine 2-monooxygenase, 5-aminopentana philus methylotrophus. midase or mutants and homologues thereof, aminopentano 0025. In the twelfth embodiment of the first aspect, the ate transaminase or mutants and homologues thereof. product is poly-3-hydroxybutyrate-co 4-hydroxybutyrate Succinate semialdehyde reductase or mutants and homo and the feedstock is methanol and the modified genetic logues thereof; CoA-transferase or mutants and homologues pathway is a Succinate semialdehyde dehydrogenase path thereof; Co-Aligase or mutants and homologues thereof. way optionally including an alpha-ketoglutarate decarboxy and polyhroxyalkanoate synthase or mutants and homo lase pathway or a crotonase pathway. The one or more genes logues thereof, wherein the expression increases the pro that are stably expressed encode one or more enzymes are duction of poly-3-hydroxybutyrate-co-5-hydroxyvalerate selected from: acetyl-CoA acetyltransferase; acetoacetyl copolymer. In a certain embodiment of the fifteenth embodi CoA reductase; succinate semialdehyde dehydrogenase, ment, the organism is Methylophilus methylotrophus or alpha-ketoglutarate decarboxylase, Succinic semialdehyde Methylobacterium extorquens. reductase, CoA transferase, CoA ligase, butyrate kinase, 0030. In the sixteenth embodiment of the first aspect, the phosphotransbutyrylase, 4-hydroxybutyryl-CoA reductase; product is 1.5-pentanediol and the feedstock is methanol and 4-hydroxybutyrylaldehyde reductase; acetyl-CoA trans the pathway is a lysine pathway. The one or more genes that ferase and acetoacetyl-CoA reductase; crotonase; and poly are stably expressed encode one or more enzymes are hydroxyalkanoate synthase, wherein the expression selected from lysine 2-monooxygenase or mutants and increases the production of poly-3-hydroxybutyrate-co-4- homologues thereof. 5-aminopentanamidase or mutants and hydroxybutyrate. homologues thereof. 5-aminopentanoate transaminase or 0026. In a certain embodiment of the twelfth embodi mutants and homologues thereof. Succinate semialdehyde ment, the organism is Methylophilus methylotrophus or reductase or mutants and homologues thereof; CoA-trans Methylobacterium extorquens having one or more of the ferase or mutants and homologues thereof; CoA ligase or following genes deleted: phaC1, phaC2, depA and depB. mutants and homologues thereof; CoA-dependent propi 0027. In the thirteenth embodiment of the first aspect, onaldehyde dehydrogenase or mutants and homologues wherein the product is 1,4-butanediol, and the feedstock is thereof, and 1,3-propanediol dehydrogenase or mutants and methanol and the modified genetic pathway is a Succinate homologues thereof, wherein the expression increases the semialdehyde dehydrogenase pathway optionally including production of 1,5-pentanediol. In a certain embodiment of an alpha-ketoglutarate decarboxylase pathway or a croto the sixteenth embodiment, the organism is Methylophilus nase pathway. The one or more genes that are stably methylotrophus. expressed encode one or more enzymes are selected from: 0031. In the seventeenth embodiment of the first aspect, Succinate semialdehyde dehydrogenase, alpha-ketoglutarate the product is poly-3-hydroxypropionate, the feedstock is decarboxylase, Succinic semialdehyde reductase, CoA trans methane and the modified genetic pathway is a malonyl ferase, CoA ligase, butyrate kinase, phosphotransbutyrylase, CoA reductase metabolic pathway. The one or more genes 4-hydroxybutyryl-CoA reductase: 4-hydroxybutyrylalde that are stably expressed encode one or more enzymes are hyde reductase; acetyl-CoA transferase, acetoacetyl-CoA selected from: acetyl-CoA:acetyltransferase, acetyl-CoA car reductase, crotonase, 4-hydroxybutyryl-CoA dehydratase, boxylase, malonyl-CoA reductase (3-hydroxypropionate 4-hydroxybutyryl-CoA reductase and 4-hydroxybutyrylal forming), malonyl-CoA reductase (malonate semialdehyde dehyde reductase, wherein the expression increases the forming), malonic semialdehyde reductase, CoA transferase, production of 1,4-butanediol. In a certain embodiment of the CoA ligase, aldehyde dehydrogenase/alcohol dehydroge thirteenth embodiment, the organism is Methylophilus meth nase, coA-acylating 3-hydroxypropionaldehyde dehydroge ylotrophus. nase, and polyhydroxyalkanoate synthase, wherein the 0028. In the fourteenth embodiment of the first aspect, expression increases the production of poly-3-hydroxypro wherein the product is poly-5-hydroxyvalerate and the feed pionate. For example, one or more genes that are stably stock is methanol and the pathway is a lysine pathway. The expressed encode one or more enzyme are selected from: an one or more genes that are stably expressed encode one or acetyl-CoA carboxylase Subunits from E. coli or mutants more enzymes are selected from lysine 2-monooxygenase, and homologues thereof; a malonyl-CoA reductase (3-hy 5-aminopentanamidase or mutants and homologues thereof. droxypropionate-forming) from Chloroflexus aurantiacus or aminopentanoate transaminase or mutants and homologues mutants and homologues thereof malonyl-CoA reductase US 2017/00 16035 A1 Jan. 19, 2017

(malonate semialdehyde-forming) from Sulfolobu tokodali pionate copolymer. For example, the one or more genes that Str. 7 or mutants and homologues thereof: malonic semial are stably expressed encode one or more enzyme are dehyde reductase from Sulfolobu tokodaii str. 7 or mutants selected from acetyl-CoA acetyltransferase from Zoogloea and homologues thereof; CoA transferase from Clostridium ramigera or mutants and homologues thereof acetoacetyl Kluyversi DSM 555, or mutants and homologues thereof; CoA reductase from Zoogloea ramigera or mutants and CoA ligase from Pseudomonas putida or mutants and homo homologues thereof, an acetyl-CoA carboxylase subunits logues thereof, and polyhydroxyalkanoate synthase from a from E. coli or mutants and homologues thereof; a malonyl fusion protein of Pseudomonas putida and Ralstonia eutro CoA reductase (3-hydroxypropionate-forming) from Chlo pha JMP134 or mutants and homologues thereof, wherein roflexus aurantiacus or mutants and homologues thereof. the expression increases the production of poly-3-hydroxy malonyl-CoA reductase (malonate semialdehyde-forming) propionate. In a certain embodiment of the seventeenth from Sulfolobus tokodaii Str. 7 or mutants and homologues embodiment, the organism is methylocystis hirsute having thereof; malonic semialdehyde reductase from Sulfolobus one or more of the following genes deleted: pha A, phaB, tokodai Str. 7 or mutants and homologues thereof; CoA phaC1, phaC2, depA and depB. transferase from Clostridium kluyveri DSM 555, or mutants 0032. In the eighteenth embodiment of the first aspect, and homologues thereof. CoA ligase from Pseudomonas the product is poly-3-hydroxypropionate, the feedstock is putida or mutants and homologues thereof, and polyhy methane and the modified genetic pathway is a dihydroxy droxyalkanoate synthase from a fusion protein of acetone-phosphate metabolic pathway. The one or more Pseudomonas putida and Ralstonia eutropha JMP134 or genes that are stably expressed encode one or more enzymes mutants and homologues thereof, wherein the expression are selected from: glycerol-3-phosphate dehydrogenase increases the production of poly-3-hydroxybutyrate-co-3- (NAD+); glycerol-3-phosphate dehydrogenase (NADP+); hydroxyproprionate copolymer. In a certain embodiment of glycerol-3-phosphatase; glycerol dehydratase; glycerol the nineteenth embodiment, the organism is methylocystis dehydratase reactivating enzyme; aldehyde dehydrogenase; hirsute having one or more of the following genes deleted: alcohol dehydrogenase; CoA-acylating 3-hydroxypropi phaC1, phaC2, depA and depB. onaldehyde dehydrogenase; and polyhydroxyalkanoate Syn 0034. In the twentieth embodiment of the first aspect, thase, wherein the expression increases the production of wherein the product is poly-3-hydroxybutyrate-co-3-hy poly-3-hydroxypropionate. For example, the one or more droxypropionate copolymer, the feedstock is methane and genes that are stably expressed encode one or more enzyme the modified genetic pathway is a dihydroxyacetone-phos are selected from glycerol-3-phosphate dehydrogenase phate metabolic pathway. The one or more genes that are (NAD+) from Saccharomyces cerevisiae S288c or mutants stably expressed encode one or more enzymes are selected and homologues thereof glycerol-3-phosphate dehydroge from: from acetyl-CoA acetyltransferase; acetoacetyl-CoA nase (NADP+) from Rickettsia prowazekii (strain Madrid E) reductase; glycerol-3-phosphate dehydrogenase (NAD+); or mutants and homologues thereof glycerol-3-phosphatase glycerol-3-phosphate dehydrogenase (NADP+); glycerol-3- from Saccharomyces cerevisiae S288c or mutants and phosphatase; glycerol dehydratase; glycerol dehydratase homologues thereof glycerol dehydratase Small, medium reactivating enzyme; aldehyde dehydrogenase; alcohol and large subunits from Klebsiella pneumonia or mutants dehydrogenase; CoA-acylating 3-hydroxypropionaldehyde and homologues thereof glycerol dehydratase reactivating dehydrogenase; and polyhydroxyalkanoate synthase, enzyme (Chain A and Chain B) from Klebsiella pneumonia wherein the expression increases the production of poly-3- or mutants and homologues thereof aldehyde dehydroge hydroxybutyrate-co-3-hydroxy-propionate copolymer. For nase/alcohol dehydrogenase from E. coli str. K-12 substr. example, the one or more genes that are stably expressed MG 1655; or mutants and homologues thereof; CoA-acylat encode one or more enzyme are selected from: acetyl-CoA ing 3-hydroxypropionaldehyde dehydrogenase from Salmo acetyltransferase from Zoogloea ramigera or mutants and nella enterica Subsp. enterica serovar Tiphimurium str. LT2 homologues thereof; acetoacetyl-CoA reductase from Zoo or mutants and homologues thereof, and polyhydroxyal gloea ramigera or mutants and homologues thereof glyc kanoate synthase from a fusion protein of Pseudomonas erol-3-phosphate dehydrogenase (NAD+) from Saccharo putida and Ralstonia eutropha JMP134 or mutants and myces cerevisiae S288c or mutants and homologues thereof. homologues thereof, wherein the expression increases the glycerol-3-phosphate dehydrogenase (NADP+) from Rick production of poly-3-hydroxypropionate. In a certain ettsia prowaZeki (strain Madrid E) or mutants and homo embodiment of the eighteenth embodiment, the organism is logues thereof glycerol-3-phosphatase from Saccharomyces methylocystis hirsute having one or more of the following cerevisiae S288c or mutants and homologues thereof glyc genes deleted: pha A, phaB, phaCl, phaC2, depA and depB. erol dehydratase Small, medium and large subunits from 0033. In the nineteenth embodiment of the first aspect, Klebsiella pneumonia or mutants and homologues thereof. wherein the product is poly-3-hydroxybutyrate-co-3-hy glycerol dehydratase reactivating enzyme (Chain A and droxy propionate copolymer, the feedstock is methane and Chain B) from Klebsiella pneumonia or mutants and homo the modified genetic pathway is a malonyl-CoA reductase logues thereof aldehyde dehydrogenase/alcohol dehydroge metabolic pathway. The one or more genes that are stably nase from E. coli str. K-12 substr. MG 1655; or mutants and expressed encode one or more enzymes are selected from: homologues thereof; CoA-acylating 3-hydroxypropionalde from acetyl-CoA acetyltransferase; acetoacetyl-CoA reduc hyde dehydrogenase from Salmonella enterica Subsp. tase; acetyl-CoA carboxylase, malonyl-CoA reductase enterica serovar Tiphimurium str. LT2 or mutants and (3-hydroxypropionate-forming), malonyl-CoA reductase homologues thereof, and polyhydroxyalkanoate synthase (malonate semialdehyde-forming), malonic semialdehyde from a fusion protein of Pseudomonas putida and Ralstonia reductase, CoA transferase, CoA ligase, and polyhydroxy eutropha JMP134 or mutants and homologues thereof; alkanoate synthase, wherein the expression increases the wherein the expression increases the production poly-3- production of is poly-3-hydroxybutyrate-co-3-hydroxy pro hydroxybutyrate-co-3-hydroxy propionate copolymer. In a US 2017/00 16035 A1 Jan. 19, 2017

certain embodiment of the twentieth embodiment, the organ putida and Ralstonia eutropha JMP134 or mutants and ism is methylocystis hirsute having one or more of the homologues thereof, wherein the expression increases the following genes deleted: phaC1, phaC2, depA and depB. production of poly-3-hydroxypropionate. In a certain 0035. In the twenty-first embodiment of the first aspect, embodiment of the twenty-second embodiment, the organ wherein the product is 1,3-propanediol, the feedstock is ism is methylocystis hirsute having one or more of the methane and the modified genetic pathway is a malonyl following genes deleted: pha A, phaB, phaCl, phaC2, depA CoA reductase metabolic pathway. The one or more genes and depB. that are stably expressed encode one or more enzymes are 0037. In the twenty-third embodiment of the first aspect, selected from: -CoA carboxylase, malonyl-CoA reductase wherein the product is poly-4-hydroxybutyrate and the feed (3-hydroxypropionate-forming), malonyl-CoA reductase stock is methane and the modified genetic pathway is a (malonate semialdehyde-forming), malonic semialdehyde Succinate semialdehyde dehydrogenase pathway optionally reductase, CoA transferase, CoA ligase, and polyhydroxy including an alpha-ketoglutarate decarboxylase pathway. alkanoate synthase, wherein the expression increases the The one or more genes that are stably expressed encode one production of is 1,3-propanediol. For example, the one or or more enzymes are selected from: Succinate semialdehyde more genes that are stably expressed encode one or more dehydrogenase, alpha-ketoglutarate decarboxylase. Succinic enzyme are selected an acetyl-CoA carboxylase Subunits semialdehyde reductase, CoA transferase, CoA ligase, from E. coli or mutants and homologues thereof; a malonyl butyrate kinase, phosphotransbutyrylase, 4-hydroxybutyryl CoA reductase (3-hydroxypropionate-forming) from Chlo CoA reductase and 4-hydroxybutyrylaldehyde reductase. In roflexus aurantiacus or mutants and homologues thereof. a certain embodiment of the twenty-third embodiment, the malonyl-CoA reductase (malonate semialdehyde-forming) organism is Methylocystis hirsute having one or more of the from Sulfolobus tokodaii Str. 7 or mutants and homologues following genes deleted: pha A, phaB, phaCl, phaC2, depA thereof; malonic semialdehyde reductase from Sulfolobus and depB. tokodai Str. 7 or mutants and homologues thereof; CoA 0038. In the twenty-fourth embodiment of the first aspect, transferase from Clostridium kluyveri DSM 555, or mutants wherein the product is poly-3-hydroxybutyrate-co-4-hy and homologues thereof. CoA ligase from Pseudomonas droxybutyrate and the feedstock is methane and the modified putida or mutants and homologues thereof, and polyhy genetic pathway is a Succinate semialdehyde dehydrogenase droxyalkanoate synthase from a fusion protein of pathway optionally including an alpha-ketoglutarate decar Pseudomonas putida and Ralstonia eutropha JMP134 or boxylase pathway. The one or more genes that are stably mutants and homologues thereof; wherein the expression expressed encode one or more enzymes are selected from: increases the production of 1,3-propanediol. In a certain acetyl-CoA acetyltransferase; acetoacetyl-CoA reductase; embodiment of the twenty-first embodiment, the organism is Succinate semialdehyde dehydrogenase, alpha-ketoglutarate methylocystis hirsute having one or more of the following decarboxylase, Succinic semialdehyde reductase, CoA trans genes deleted: pha A, phaB, phaCl, phaC2, depA and depB. ferase, CoA ligase, butyrate kinase, phosphotransbutyrylase, 0036. In the twenty-second embodiment of the first 4-hydroxybutyryl-CoA reductase: 4-hydroxybutyrylalde aspect, wherein the product is 1,3-propanediol, the feedstock hyde reductase; acetyl-CoA transferase and acetoacetyl is methane and the modified genetic pathway is a dihydroxy CoA reductase. In a certain embodiment of the twenty acetone-phosphate metabolic pathway. The one or more fourth embodiment, the organism Methylocystis hirsute genes that are stably expressed encode one or more enzymes having one or more of the following genes deleted: phaC1, are selected from glycerol-3-phosphate dehydrogenase phaC2, depA and depB. (NAD+); glycerol-3-phosphate dehydrogenase (NADP+); 0039. In the twenty-fifth embodiment of the first aspect, glycerol-3-phosphatase; glycerol dehydratase; glycerol the product is poly-3-hydroxybutyrate-co-4-hydroxybu dehydratase reactivating enzyme; aldehyde dehydrogenase; tyrate and the feedstock is methane and the modified genetic alcohol dehydrogenase; CoA-acylating 3-hydroxypropi pathway is a crotonase pathway. The one or more genes that onaldehyde dehydrogenase; and polyhydroxyalkanoate Syn are stably expressed encode one or more enzymes are thase, wherein the expression increases the production of selected from: acetyl-CoA transferase, acetoacetyl-CoA poly-3-hydroxypropionate. For example, the one or more reductase, crotonase, and polylhydroxyalkanoate synthase. genes that are stably expressed encode one or more enzyme For example, the one or more genes that are stably expressed are selected from: glycerol-3-phosphate dehydrogenase encode one or more enzymes are selected from: acetyl-CoA (NAD+) from Saccharomyces cerevisiae S288c or mutants transferase, acetoacetyl-CoA reductase, crotonase, and poly and homologues thereof glycerol-3-phosphate dehydroge hydroxyalkanoate synthase from a fusion protein of nase (NADP+) from Rickettsia prowazekii (strain Madrid E) Pseudomonas putida and Ralstonia eutropha JMP134 or or mutants and homologues thereof glycerol-3-phosphatase mutants and homologues thereof, wherein the expression from Saccharomyces cerevisiae S288c or mutants and increases the production of poly-3-hydroxybutyrate-co-4- homologues thereof glycerol dehydratase Small, medium hydroxybutyrate. and large subunits from Klebsiella pneumonia or mutants 0040. In a certain embodiment of the twenty-fifth and homologues thereof glycerol dehydratase reactivating embodiment, the organism Methylocystis hirsute having one enzyme (Chain A and Chain B) from Klebsiella pneumonia or more of the following genes deleted: phaC1, phaC2, depA or mutants and homologues thereof aldehyde dehydroge and depB. nase/alcohol dehydrogenase from E. coli str. K-12 substr. 0041. In the twenty-sixth embodiment of the first aspect, MG 1655; or mutants and homologues thereof; CoA-acylat the product is 1,4-butanediol, and the feedstock is methanol ing 3-hydroxypropionaldehyde dehydrogenase from Salmo and the modified genetic pathway is a Succinate semialde nella enterica Subsp. enterica serovar Tiphimurium str. LT2 hyde dehydrogenase pathway optionally including an alpha or mutants and homologues thereof, and polyhydroxyal ketoglutarate decarboxylase pathway or a acetyl-CoA kanoate synthase from a fusion protein of Pseudomonas acetyltransferase pathway. The one or more genes that are US 2017/00 16035 A1 Jan. 19, 2017 stably expressed encode one or more enzymes are selected mutants and homologues thereof, and polyhydroxyalkanoate from: Succinate semialdehyde dehydrogenase, alpha-keto synthase or mutants and homologues thereof, wherein the glutarate decarboxylase, Succinic semialdehyde reductase, expression increases the production of poly-3-hydroxy CoA transferase, CoA ligase, butyrate kinase, phosphotrans butyrate-co-5-hydroxyvalerate. For example, the one or butyrylase, 4-hydroxybutyryl-CoA reductase: 4-hydroxybu more genes that are stably expressed encode one or more tyrylaldehyde reductase; acetyl-CoA transferase, enzymes are selected from acetyl-CoA acetyltransferase acetoacetyl-CoA reductase, crotonase, 4-hydroxybutyryl from Zoogloea ramigera or mutants and homologues CoA dehydratase, 4-hydroxybutyryl-CoA reductase and thereof, acetoacetyl-CoA reductase from Zoogloea ramigera 4-hydroxybutyrylaldehyde reductase. For example, the one or mutants and homologues thereof and polyhydroxyalkano or more genes that are stably expressed encode one or more ate synthase from a fusion protein of Pseudomonas putida enzymes are selected from: acetyl-CoA transferase from and Ralstonia eutropha JMP134 or mutants and homologues Zoogloea ramigera or mutants and homologues thereof, thereof, wherein the expression increases production of acetoacetyl-CoA reductase from Zoogloea ramigera or poly-3-hydroxybutyrate-co-5-hydroxyvalerate copolymer In mutants and homologues thereof, 3-hydroxybutyryl-CoA a certain embodiment of the twenty-ninth embodiment, the dehydratase from Clostridium acetobutyllicum ATCC 824 or organism is methylocystis hirsute having one or more of the mutants and homologues thereof 4-hydroxybutyryl-CoA following genes deleted: phaCl, phaC2, depA and depB. dehydratase from Clostridium aminobutyricum or mutants 0046. In the thirtieth embodiment of the first aspect, and homologues thereof coenzyme A aceylating aldehyde wherein the product is 1.5-pentanediol and the feedstock is dehydrogenase from Clostridium beijerinckii NCIMB 8052 methane, the modified genetic pathway is a lysine pathway. 4-hydroxybutyrylaldehyde and acetaldehyde dehydrogenase The one or more genes that are stably expressed encoding (aceylating) from Geobacillus thermosglucosidasium strain one or more enzymes are selected from lysine 2-monooxy M1OESG or mutants and homologues thereof, wherein the genase or mutants and homologues thereof. 5-aminopen expression increases the production of 1,4-butanediol. In a tanamidase or mutants and homologues thereof. 5-amino certain embodiment of the twenty-sixth embodiment, the pentanoate transaminase or mutants and homologues organism is methylocystis hirsute having one or more of the thereof. Succinate semialdehyde reductase or mutants and following genes is deleted: pha A, phaB, phaCl, phaC2, homologues thereof; CoA-transferase or mutants and homo depA and depB. logues thereof; CoA ligase or mutants and homologues 0042. In the twenty-seventh embodiment of the first thereof. CoA-dependent propionaldehyde dehydrogenase or aspect, wherein the product is 1,4-butanediol, the feedstock mutants and homologues thereof, and 1,3-propanediol dehy is methane and the modified genetic pathway is crotonase drogenase or mutants and homologues thereof, wherein the pathway. The one or more genes that are stably expressed expression increases the production of 1.5-pentanediol. In a encode one or more enzymes are selected from: acetyl-CoA certain embodiment of the thirtieth embodiment, the organ transferase, acetoacetyl-CoA reductase, crotonase, 4-hy ism is Methylocystis hirsute having one or more of the droxybutyryl-CoA dehydratase, 4-hydroxybutyryl-CoA following genes deleted: pha A, phaB, phaCl, phaC2, depA reductase and 4-hydroxybutyrylaldehyde reductase. In a and depB. certain embodiment of the twenty-seventh embodiment, the 0047. In any of the aspects or embodiments described organism is Methylocystis hirsute having one or more of the above, the method further includes culturing a genetically following genes is deleted: pha A, phaB, phaCl, phaC2, engineered organism with a renewable feedstock to produce depA and depB. a biomass. 0043. In the twenty-eighth embodiment of the first 0048. A second aspect of the invention is the biomass aspect, the product is poly-5-hydroxyvalerate and the feed produced by any of the aspects or embodiments described stock is methane and the modified genetic pathway is a above. In a certain embodiment of the second aspect, the lysine pathway. The one or more genes that are stably genetically engineered organism produces a biomass and the expressed encode one or more enzymes are selected from biomass is converted to a 3-carbon product, a 4-carbon lysine 2-monooxygenase, 5-aminopentanamidase or product or a 5-carbon product. In another embodiment of the mutants and homologues thereof, aminopentanoate second aspect included any embodiment described, the transaminase or mutants and homologues thereof. Succinate biomass is pyrolyzed. In a particular aspect, the biomass is semialdehyde reductase or mutants and homologues thereof. P3HP and the product is acrylic acid; or biomass is P4HB CoA-transferase or mutants and homologues thereof; Co-A and the product is gamma-butyrolactone or the biomass is ligase or mutants and homologues thereof, and polyhroxy P5HV and the product is delta-Valerolactone. alkanoate synthase or mutants and homologues thereof. 0049. In particular embodiments of any of the aspects or wherein the expression increases the production of poly-5- embodiments described above, the methylotroph organism hydroxyvalerate. is selected from: Methylophilus methylotrophus AS-1; Meth 0044. In a certain embodiment of the twenty-eighth vlocystis hirsute, Methylophilus methylotrophus M12-4, embodiment, the organism is Methylocystis hirsute having Methylophilus methylotrophus M1, Methylophilus methylo one or more of the following genes deleted: pha A, phaB, trophus sp. (deposited at NCIMB as Acc. No. 11809), phaC1, phaC2, depA and depB. Methylophilus leisingeri, Methylophilus flavus sp. nov., 0045. In the twenty-ninth embodiment of the first aspect, Methylophilus luteus sp. nov., Methylomonas sp. strain 16a, wherein the product is poly-3-hydroxybutyrate-co-5-hy Methylomonas methanica MCO9, Methylobacterium droxyvalerate copolymer and the feedstock is methane and extorquens AM1 (formerly known as Pseudomonas AM1). the pathway is an acetyl-CoA pathway. The one or more Methylococcus capsulatus Bath, Methylomonas sp. strain J. genes that are stably expressed encode one or more enzymes Methylomonas aurantiaca, Methylomonas fbdinarum, are selected from acetyl-CoA acetyltransferase or mutants Methylomonas scandinavica, Methylomonas rubra, Meth and homologues thereof acetoacetyl-CoA reductase or ylomonas streptobacterium, Methylomonas rubrum, Meth US 2017/00 16035 A1 Jan. 19, 2017 ylomonas rosaceous, Methylobacter chroococcum, Methyl acid can be produced from a C3 product, polymer or obacter bovis, Methylobacter capsulatus, Methylobacter copolymer, gamma-butyrolactone (GBL) can be produced vinelandii, Methylococcus minimus, Methylosinus sporium, from a C4 product, polymer or copolymer by heat and Methylocystis parvus, Methylocystis hirsute, Methylobacte enzymatic treatment that may further be processed for rium Organophilum, Methylobacterium rhodesianum, Meth production of other desired commodity and specialty prod vlobacterium R6, Methylobacterium aminovorans, Methyl ucts, for example 1,4-butanediol (BDO), tetrahydrofuran obacterium chloromethanicum, Methylobacterium (THF), N-methylpyrrolidone (NMP), N-ethylpyrrolidone dichloromethanicum, Methylobacterium filjisawaense, (NEP), 2-pyrrolidinone, N-vinylpyrrolidone (NVP), polyvi Methylobacterium mesophilicum, Methylobacterium radio nylpyrrolidone (PVP) and the like. Others include succinic tolerans, Methylobacterium rhodinum, Methylobacterium acid, 1,4-butanediamide, Succinonitrile, Succinamide, and thiocyanatum, Methylobacterium zatmanii, Methylomonas 2-pyrrolidone (2-Py); and C5 product, polymer or copoly methanica, Methylomonas albus, Methylomonas agile, mer can produce delta-Valerolactone and other C5 chemi Methylomonas P11, Methylobacillus glycogenes, Methylo cals. sinus trichosporium, Hyphomicrobium methylovorum, 0051. Additionally, the expended (residual) PHA reduced Hyphonicrobium zavarzini, Bacillus methanolicus, Bacil biomass can be further utilized for energy development, for lus cereus M-33-1, Streptomyces 239, Mycobacterium vac example as a fuel to generate process Steam and/or heat. cae, Diplococcus PAR, Prutaminobacter ruber, Rho dopseudomonas acidophila, Arthrobacter rufescens, BRIEF DESCRIPTION OF THE DRAWINGS Arthrobacter 1A1 and 1A2, Arthrobacter 2B2, Arthrobacter 0.052 FIG. 1 is a schematic diagram of exemplary path globiformis SK-200, Klebsiella 101, Pseudomonas 135, ways to P3HP homopolymer, P(3HB-co-3HP) copolymer, Pseudomonas Oleovorans, Pseudomonas rosea (NCIB and PDO showing reactions that were modified or intro 10597 to 10612), Pseudomonas extorquens (NCIB 9399), duced in the Examples or that could be modified in the future Pseudomonas PRL-W4, Pseudomonas AM1 (NCIB 9133), in methylotrophic bacteria. Both Ac-CoA and DHAP are Pseudomonas AM2, Pseudomonas M27, Pseudomonas PP, central metabolites produced from either methane or metha Pseudomonas 3A2, Pseudomonas RJ1, Pseudomonas TP1, nol as sole carbon source. Abbreviations: “Ac-CoA', acetyl Pseudomonas sp. 1 and 135, Pseudomonas sp. YR, JB1 and CoA: “AcAc-CoA, acetoacetyl-CoA: “3HB-CoA, 3-hy PCTN, Pseudomonas methylica sp. 2 and 15, Pseudomonas droxybutyryl-CoA: “Mal-CoA, malonyl-CoA: “MSA”, 2941, Pseudomonas AT2, Pseudomonas 80, Pseudomonas malonate semialdehyde: “3HP. 3-hydroxypropionate; aminovorans, Pseudomonas sp. 1A3, 1B1, 7B1 and 8B1, “3HP-CoA, 3-hydroxypropionyl-CoA: “DHAP, dihy Pseudomonas S25, Pseudomonas (methylica) 20, droxyacetone-phosphate: “Gol-3P, sn-glycerol-3-phos Pseudomonas W1, Pseudomonas W6 (MB53), Pseudomo phate: “Gol”, glycerol: “3HPA', 3-hydroxypropionalde nas C. Pseudomonas MA, Pseudomonas MS. Exemplary hyde: “P3HP', poly(3-hydroxypropionate): P(3HB-co-3HP) yeast strains include: Pichia pastoris, Gliocladium delique ". poly(3-hydroxybutyrate-co-3-hydroxypropionate); scens, Paecilomyces varioti, Trichoderma lignorum, Han “PDO, 1,3-propanediol. Numbered reactions: “1”, acetyl senula polymorpha DL-1 (ATCC 26012), Hansenula poly CoA acetyltransferase (a.k.a. beta-ketothiolase); “2. morpha (CBS 4732), Hansenula capsulata (CBS 1993), acetoacetyl-CoA reductase; “3, acetyl-CoA carboxylase; Hansenula lycozyma (CBS 5766), Hansenula henricii (CBS “4”, malonyl-CoA reductase (3-hydroxypropionate-form 5765), Hansenula minuta (CBS 1708), Hansenula nonfer ing); “5”, malonyl-CoA reductase (malonate semialdehyde mentans (CBS 5764), Hansenula philodenda (CBS), Han forming); “6”, malonic semialdehyde reductase; “7”, CoA senula wickerhamii (CBS 4307), Hansenula ofitaensis, Can transferase or CoA ligase; “8”, glycerol-3-phosphate dehy dida boidinii (ATCC 32195), Candida boidinii (CBS 2428, drogenase (NAD+) or glycerol-3-phosphate dehydrogenase 2429), Candida boidinii KM-2, Candida boidinil NRRL (NADP+): “9, glycerol-3-phosphatase: “10, glycerol Y-2332, Candida boidini S-1, Candida boidinii S-2, Can dehydratase and glycerol dehydratase reactivating enzymes; dida boidinii 25-A, Candida alcanigas, Candida methano “11”, aldehyde dehydrogenase/alcohol dehydrogenase; lica, Candida parapsilosis, Candida utilis (ATCC 26387), “12, CoA-acylating 3-hydroxypropionaldehyde dehydro Candida sp. N-16 and N-17, Kloeckera sp. 2201, Kloeckera genase; “13, polyhydroxyalkanoate synthase; “14, alde sp. A2, Pichia pinus (CBS 5098), Pichia pinus (CBS 744), hyde reductase. Pichia pinus NRRL YB-4025, Pichia haplophila (CBS 0053 FIG. 2 is a schematic diagram of exemplary path 2028), Pichia pastoris (CBS 704), Pichia pastoris (IFP206), ways to P4HB homopolymer, P(3HB-co-4HB) copolymer, Pichia trehalophila (CBS 5361), Pichia lidnerii, Pichia and BDO showing reactions that were modified or intro methanolica, Pichia methanothermo, Pichia sp. NRRL-Y- duced in the Examples or that could be modified in the future 11328, Saccharomyces H-1, Torulopsis pinus (CBS 970), in methylotrophic bacteria. Ac-CoA, C.KG, and Suc-CoA are Torulopsis initatophila (CBS 2027), Torulopsis nemodendra central metabolites produced from either methane or metha (CBS 6280), Torulopsis molishiana, Torulopsis metha nol as sole carbon source. Abbreviations: “Ac-CoA', acetyl no lovescens, Torulopsis glabrata, Torulopsis enoki, Toru CoA: “AcAc-CoA, acetoacetyl-CoA: “3HB-CoA, 3-hy lopsis methanophiles, Torulopsis methanosorbosa, Torulop droxybutyryl-CoA: “Suc-CoA', succinyl-CoA: “CKG”. sis methanodomercquil, Torulopsis nagoyaensis, Torulopsis alpha-ketoglutarate: “SSA’, succinic semialdehyde: “4HB', sp. A1, Rhodotorula sp., Rhodotorula glutinis (strain cy), 4-hydroxybutyrate: “4HB-CoA, 4-hydroxybutyryl-CoA: and Sporobolomyces roseus (strain y). “4HB-P'. 4-hydroxybutyryl-phosphate: “Crot-CoA, croto 0050. The biomass (C3 product, polymer or copolymer; nyl-CoA: “4HBA', 4-hydroxybutyrylaldehyde: “P4HB', C4 product, polymer or copolymer, C5 product, polymer or poly(4-hydroxybutyrate): P(3HB-co-4HB), poly(3-hy copolymer) can then be treated to produce versatile inter droxybutyrate-co-4-hydroxybutyrate); “BDO'', 1,4-butane mediates that can be further processed to yield desired diol. Numbered reactions: “1”, acetyl-CoA acetyltransferase commodity and specialty products. For example, acrylic (a.k.a. beta-ketothiolase); “2, acetoacetyl-CoA reductase: US 2017/00 16035 A1 Jan. 19, 2017

“3, succinate semialdehyde dehydrogenase; “4”, alpha Source. The enzymes in the 3-carbon pathways include ketoglutarate decarboxylase, also known as 2-oxoglutarate acetyl-CoA acetyltransferase (a.k.a. beta-ketothiolase); decarboxylase; “5”, succinic semialdehyde reductase; “6”. acetoacetyl-CoA reductase; acetyl-CoA carboxylase; malo CoA transferase or CoA ligase; “7”, butyrate kinase; “8”. nyl-CoA reductase (3-hydroxypropionate-forming); malo phosphotransbutyrylase; “9, crotonase; “10”, 4-hydroxy nyl-CoA reductase (malonate semialdehyde-forming); butyryl-CoA dehydratase; “1”, polyhydroxyalkanoate syn malonic semialdehyde reductase; CoA transferase or CoA thase: “12, 4-hydroxybutyryl-CoA reductase: “13. 4-hy ligase; glycerol-3-phosphate dehydrogenase (NAD+) or droxybutyrylaldehyde reductase. glycerol-3-phosphate dehydrogenase (NADP+); glycerol-3- 0054 FIG. 3 is a schematic diagram of exemplary path phosphatase; glycerol dehydratase and glycerol dehydratase ways to P5HV homopolymer, P(3HB-co-5HV) copolymer, reactivating enzymes; aldehyde dehydrogenase/alcohol and 1.5PD showing reactions that were modified or intro dehydrogenase; CoA-acylating 3-hydroxypropionaldehyde duced in the Examples or that could be modified in the future dehydrogenase; polyhydroxyalkanoate synthase and alde in methylotrophic bacteria. Both Ac-CoA and Lys are central hyde reductase. metabolites produced from either methane or methanol as 0059 For exemplary pathways for P4HB homopolymer, sole carbon source. Abbreviations: “Ac-CoA, acetyl-CoA: P(3HB-co-4HB) copolymer, and BDO, one or more “AcAc-CoA, acetoacetyl-CoA: “3HB-CoA, 3-hydroxy enzymes or mutants or homologues thereof may be intro butyryl-CoA: “Lys”. L-lysine: “5APA. 5-aminopentana duced including pathways for Ac-CoA, C.KG, and Suc-CoA mide: “5APO, 5-aminopentanoate: “GSA', glutarate semi produced from either methane or methanol as sole carbon aldehyde: “5HV, 5-hydroxyvalerate: “5HV-CoA, Source. The enzymes include acetyl-CoA acetyltransferase 5-hydroxyvaleryl-CoA: “5HVA', 5-hydroxyvalerylalde (a.k.a. beta-ketothiolase); acetoacetyl-CoA reductase, Succi hyde: “P5HV, poly(5-hydroxyvalerate): P(3HB-co-5HV)', nate semialdehyde dehydrogenase; alpha-ketoglutarate poly(3-hydroxybutyrate-co-5-hydroxyvalerate); “1.5PD', decarboxylase, also known as 2-oxoglutarate decarboxylase; 1,5-pentanediol. Numbered reactions: “1”, acetyl-CoA Succinic semialdehyde reductase; CoA transferase or CoA acetyltransferase (a.k.a. beta-ketothiolase); '2', acetoacetyl ligase; butyrate kinase; phosphotransbutyrylase; crotonase; CoA reductase; “3, lysine 2-monooxygenase; “4”. 4-hydroxybutyryl-CoA dehydratase; polyhydroxyalkanoate 5-aminopentanamidase; “5”. 5-aminopentanoate transami synthase: 4-hydroxybutyryl-CoA reductase: 4-hydroxybu nase; “6”, succinate semialdehyde reductase: “7”, CoA tyrylaldehyde reductase. transferase or CoA ligase; “8”. CoA-dependent propional 0060 Exemplary pathways to produce P5HV homopoly dehyde dehydrogenase; s'9", 1,3-propanediol mer, P(3HB-co-5HV) copolymer, and 1,5-pentanediol dehydrogenase; “10, polyhydroxyalkanoate synthase. (1.5PD) with reactions that can be modified or introduced 0055 FIG. 4 GC-MS chromatogram of compounds include Ac-CoA and Lysine pathways. The enzymes include obtained from pyrolysis ((a)25°C.) of Methylophilus meth acetyl-CoA acetyltransferase (a.k.a. beta-ketothiolase); ylotrophus AS-1 biomass--P3HP produced using methanol acetoacetyl-CoA reductase; lysine 2-monooxygenase; feedstock. Peak at 405-4.12 minutes is shown to be acrylic 5-aminopentanamidase; 5-aminopentanoate transaminase; acid or 2-propenoic acid as shown by the mass spectral Succinate semialdehyde reductase; CoA-transferase or CoA library match. ligase; CoA-dependent propionaldehyde dehydrogenase; 1,3-propanediol dehydrogenase; and polyhydroxyalkanoate DETAILED DESCRIPTION OF THE synthase. INVENTION 0061. The level of P3HB or P3HP. 3-carbon (C3) prod 0056 Methods of increasing the production of a 3-carbon uct, or polymer of 3-carbon monomers, P4HB, 4-carbon (C3) product or polymer of 3-carbon monomers, 4-carbon (C4) product or a polymer of 4-carbon monomers, or 5-car (C4) product or a polymer of 4-carbon monomers, or 5-car bon (C5) product, or polymer of 5-carbon monomers, or bon (C5) product or polymer of 5-carbon monomers or copolymers of these monomers produced in the biomass copolymers thereof from methanol or methane in methylo from the renewable substrate is greater than 5% (e.g., about trophic bacteria are described herein. Metabolic pathways 10%, about 20%, about 30%, about 40%, about 50%, about are genetically engineered in microorganisms by providing 60%, about 70%, about 80%) of the total dry weight of the one or more genes that are stably expressed that encodes an biomass. The biomass is then available for post purification enzyme with an activity catalyzing the methanol or methane and modification methodologies to produce other biobased to produce the carbon products, polymer or copolymers, chemicals and derivatives. wherein growth is improved and the carbon flux from the Producing C3, C4 and C5 Chemicals from the Biomass renewable feedstock is increased. 0062. In general, during or following production (e.g., 0057. In the 3-carbon, 4-carbon and 5-pathways culturing) of the PHA polymer or carbon chemical product described herein, one or more enzymes, mutants or homo biomass, the biomass is optionally combined with a catalyst logues thereof may be included or modified in the methylo under suitable conditions to help convert the PHA polymer trophic bacteria to produce a desired 3-carbon product, or chemical product to a C3, C4 or C5 product (e.g., acrylic 4-carbon product or 5-carbon product, or polymers or copo acid, gamma-butyrolactone, or delta-Valerolactone). The lymers thereof. These pathways provide increased yield of catalyst (in Solid or solution form) and biomass are com desired products that can be cultured using methanol or bined for example by mixing, flocculation, centrifuging or methane as a feedstock and produced in quantities that are spray drying, or other Suitable method known in the art for a viable, cost effective alternative to petroleum based prod promoting the interaction of the biomass and catalyst driving uctS. an efficient and specific conversion of polymer to product 0058. In the 3-carbon pathways, both acetyl CoA and (e.g., P4HB to gamma-butyrolactone). In some embodi dihydroxyacetone phosphate are central metabolites pro ments, the biomass is initially dried, for example at a duced from either methane or methanol as sole carbon temperature between about 100° C. and about 150° C. and US 2017/00 16035 A1 Jan. 19, 2017

for an amount of time to reduce the water content of the 0068 “Heating,” “pyrolysis”, “thermolysis” and “torre biomass. The dried biomass is then re-suspended in water fying as used herein refer to thermal degradation (e.g., prior to combining with the catalyst. Suitable temperatures decomposition) of the P4HB biomass for conversion to C4 and duration for drying are determined for product purity products. In general, the thermal degradation of the P4HB and yield and can in some embodiments include low tem biomass occurs at an elevated temperature in the presence of peratures for removing water (such as between 25° C. and a catalyst. For example, in certain embodiments, the heating 150° C.) for an extended period of time or in other embodi temperature for the processes described herein is between ments can include drying at a high temperature (e.g., above about 200° C. to about 400° C. In some embodiments, the 450° C.) for a short duration of time. Under “suitable heating temperature is about 200° C. to about 350° C. In conditions’ refers to conditions that promote the catalytic other embodiments, the heating temperature is about 300° C. reaction. For example, under conditions that maximize the “Pyrolysis’ typically refers to a thermochemical decompo generation of the product such as in the presence of co sition of the biomass at elevated temperatures over a period agents or other material that contributes to the reaction of time. The duration can range from a few seconds to hours. efficiency. Other suitable conditions include in the absence In certain conditions, pyrolysis occurs in the absence of of impurities, such as metals or other materials that would oxygen or in the presence of a limited amount of oxygen to hinder the reaction from progressing. avoid oxygenation. The processes for P4HB biomass 0063 As used herein, “catalyst” refers to a substance that pyrolysis can include direct heat transfer or indirect heat initiates or accelerates a chemical reaction without itself transfer. “Flash pyrolysis” refers to quickly heating the being affected or consumed in the reaction. Examples of biomass at a high temperature for fast decomposition of the useful catalysts include metal catalysts. In certain embodi P4HB biomass, for example, depolymerization of a P4HB in ments, the catalyst lowers the temperature for initiation of the biomass. Another example of flash pyrolysis is RTPTM thermal decomposition and increases the rate of thermal rapid thermal pyrolysis. RTPTM technology and equipment decomposition at certain pyrolysis temperatures (e.g., about from Envergent Technologies. Des Plaines, Ill. converts 200° C. to about 325° C.). feedstocks into bio-oil. “Torrefying refers to the process of 0064. In some embodiments, the catalyst is a chloride, torrefaction, which is an art-recognized term that refers to oxide, hydroxide, nitrate, phosphate, Sulphonate, carbonate the drying of biomass. The process typically involves heat or Stearate compound containing a metal ion. Examples of ing a biomass in a temperature range from 200-350° C., over Suitable metal ions include aluminum, antimony, barium, a relatively long duration (e.g., 10-30 minutes), typically in bismuth, cadmium, calcium, cerium, chromium, cobalt, cop the absence of oxygen. The process results for example, in per, gallium, iron, lanthanum, lead, lithium, magnesium, a torrefied biomass having a water content that is less than molybdenum, nickel, palladium, potassium, silver, Sodium, 7 wt % of the biomass. The torrefied biomass may then be strontium, tin, tungsten, Vanadium or Zinc and the like. In processed further. In some embodiments, the heating is done Some embodiments, the catalyst is an organic catalyst that is in a vacuum, at atmospheric pressure or under controlled an amine, azide, enol, glycol, quaternary ammonium salt, pressure. In certain embodiments, the heating is accom phenoxide, cyanate, thiocyanate, dialkyl amide and alkyl plished without the use or with a reduced use of petroleum thiolate. In some embodiments, the catalyst is calcium generated energy. hydroxide. In other embodiments, the catalyst is sodium 0069. In certain embodiments, the biomass is dried prior carbonate. Mixtures of two or more catalysts are also to heating. Alternatively, in other embodiments, drying is included. done during the thermal degradation (e.g., heating, pyrolysis 0065. In certain embodiments, the amount of metal cata or torrefaction) of the biomass. Drying reduces the water lyst is about 0.1% to about 15% or about 1% to about 25%, content of the biomass. In certain embodiments, the biomass or about 4% to about 50% based on the weight of metal ion is dried at a temperature of between about 100° C. to about relative to the dry solid weight of the biomass. In some 350° C., for example, between about 200° C. and about 275° embodiments, the amount of catalyst is between about 7.5% C. In some embodiments, the dried biomass has a water and about 12%. In other embodiments, the amount of content of 5 wt %, or less. catalyst is about 0.5% dry cell weight, about 1%, about 2%, 0070. In certain embodiments, the heating of the bio about 3%, about 4%, about 5, about 6%, about 7%, about mass/catalyst mixture is carried out for a Sufficient time to 8%, about 9%, or about 10%, or about 11%, or about 12%, efficiently and specifically convert the biomass to a carbon or about 13%, or about 14%, or about 15%, or about 20%, product. In certain embodiments, the time period for heating or about 30%, or about 40% or about 50% or amounts in is from about 30 seconds to about 1 minute, from about 30 between these. seconds to about 1.5 minutes, from about 1 minute to about 0.066. As used herein, the term “sufficient amount” when 10 minutes, from about 1 minute to about 5 minutes or a time used in reference to a chemical reagent in a reaction is between, for example, about 1 minute, about 2 minutes, intended to mean a quantity of the reference reagent that can about 1.5 minutes, about 2.5 minutes, about 3.5 minutes. meet the demands of the chemical reaction and the desired 0071. In other embodiments, the time period is from purity of the product. about 1 minute to about 2 minutes. In still other embodi ments, the heating time duration is for a time between about Thermal Degradation of the Biomass to Carbon Products 5 minutes and about 30 minutes, between about 30 minutes 0067. In certain embodiments, the biomass titer (g/L) of and about 2 hours, or between about 2 hours and about 10 carbon product has been increased when compared to the hours or for greater that 10 hours (e.g., 24 hours). host without the overexpression or inhibition of one or more 0072. In certain embodiments, the heating temperature is genes in the carbon pathway. In certain embodiments, the at a temperature of about 200° C. to about 350° C. including product titer is reported as a percent dry cell weight (% dcw) a temperature between, for example, about 205° C., about or as grams of product/Kg biomass. 210°C., about 215° C., about 220° C., about 225°C., about US 2017/00 16035 A1 Jan. 19, 2017

23.0°C., about 235°C., about 240° C., about 245° C., about to change the materials through decarboxylation, dehydra 250° C., about 255° C. about 260° C., about 270° C., about tion, devolatilization of organic matter, phase transformation 275° C., about 280° C., about 290° C., about 300° C., about or oxidation. The process is normally carried out in reactors 310° C., about 320° C., about 330° C., about 340° C., or Such as hearth furnaces, shaft furnaces, rotary kilns or more 345° C. In certain embodiments, the temperature is about recently fluidized beds reactors. The calcination temperature 250° C. In certain embodiments, the temperature is about is chosen to be below the melting point of the substrate but 275°C. In other embodiments, the temperature is about 300° above its decomposition or phase transition temperature. C Often this is taken as the temperature at which the Gibbs free 0073. In certain embodiments, the process also includes energy of reaction is equal to Zero. For the decomposition of flash pyrolyzing the residual biomass for example at a CaCO to CaO, the calcination temperature at AG=0 is temperature of 500° C. or greater for a time period sufficient calculated to be ~850° C. Typically for most minerals, the to decompose at least a portion of the residual biomass into calcination temperature is in the range of 800-1000° C. pyrolysis liquids. In certain embodiments, the flash pyro 0078. To recover the calcium catalyst from the biomass lyzing is conducted at a temperature of 500° C. to 750° C. after recovery of the C4 product, one would transfer the In some embodiments, a residence time of the residual spent biomass residue directly from pyrolysis or torrefaction biomass in the flash pyrolyzing is from 1 second to 15 into a calcining reactor and continue heating the biomass seconds, or from 1 second to 5 seconds or for a Sufficient residue in air to 825-850° C. for a period of time to remove time to pyrolyze the biomass to generate the desired pyroly all traces of the organic biomass. Once the organic biomass sis precuts, for example, pyrolysis liquids. In some embodi is removed, the catalyst could be used as is or purified ments, the flash pyrolysis can take place instead of torrefac further by separating the metal oxides present (from the tion. In other embodiments, the flash pyrolysis can take fermentation media and catalyst) based on density using place after the torrefication process is complete. equipment known to those in the art. 0074 As used herein, "pyrolysis liquids' are defined as a 0079. In other embodiments, the product can be further low viscosity fluid with up to 15-20% water, typically purified if needed by additional methods known in the art, containing Sugars, aldehydes, furans, ketones, alcohols, car for example, by distillation, by reactive distillation by treat boxylic acids and lignins. Also known as bio-oil, this ment with activated carbon for removal of color and/or odor material is produced by pyrolysis, typically fast pyrolysis of bodies, by ion exchange treatment, by liquid-liquid extrac biomass at a temperature that is sufficient to decompose at tion—with an immiscible solvent to remove fatty acids etc. least a portion of the biomass into recoverable gases and for purification after recovery, by vacuum distillation, by liquids that may solidify on standing. In some embodiments, extraction distillation or using similar methods that would the temperature that is Sufficient to decompose the biomass result in further purifying product to increase the yield of is a temperature between 400° C. to 800° C. product. Combinations of these treatments can also be 0075. In certain embodiments, “recovering the carbon utilized. product vapor includes condensing the vapor. As used 0080. As used herein, the term “residual biomass” refers herein, the term “recovering as it applies to the vapor to the biomass after PHA conversion to the small molecule means to isolate it from the P4HB biomass materials, for intermediates. The residual biomass may then be converted example including but not limited to: recovering by con via torrefaction to a useable, fuel, thereby reducing the waste densation, separation methodologies, such as the use of from PHA production and gaining additional valuable com membranes, gas (e.g., Vapor) phase separation, Such as modity chemicals from typical torrefaction processes. The distillation, and the like. Thus, the recovering may be torrefaction is conducted at a temperature that is sufficient to accomplished via a condensation mechanism that captures densify the residual biomass. In certain embodiments, pro the monomer component vapor, condenses the monomer cesses described herein are integrated with a torrefaction component vapor to a liquid form and transfers it away from process where the residual biomass continues to be ther the biomass materials. mally treated once the volatile chemical intermediates have 0076. As a non-limiting example, the condensing of the been released to provide a fuel material. Fuel materials vapor may be described as follows. The incoming gas/vapor produced by this process are used for direct combustion or stream from the pyrolysis/torrefaction chamber enters an further treated to produce pyrolysis liquids or syngas. Over interchanger, where the gas/vapor stream may be pre all, the process has the added advantage that the residual cooled. The gas/vapor stream then passes through a chiller biomass is converted to a higher value fuel which can then where the temperature of the gas/vapor stream is lowered to be used for the production of electricity and steam to provide that required to condense the designated vapors from the gas energy for the process thereby eliminating the need for waste by indirect contact with a refrigerant. The gas and condensed treatment. vapors flow from the chiller into a separator, where the I0081. A “carbon footprint’ is a measure of the impact the condensed vapors are collected in the bottom. The gas, free processes have on the environment, and in particular climate of the vapors, flows from the separator, passes through the change. It relates to the amount of greenhouse gases pro Interchanger and exits the unit. The recovered liquids flow, duced. or are pumped, from the bottom of the separator to storage. I0082 In certain embodiments, it may be desirable to For some of the products, the condensed vapors solidify and label the constituents of the biomass. For example, it may be the solid is collected. useful to deliberately label with an isotope of carbon (e.g., 0077. In certain embodiments, recovery of the catalyst is 'C) to facilitate structure determination or for other means. further included in the processes of the invention. For This is achieved by growing microorganisms genetically example, when a calcium catalyst is used calcination is a engineered to express the constituents, e.g., polymers, but useful recovery technique. Calcination is a thermal treat instead of the usual media, the bacteria are grown on a ment process that is carried out on minerals, metals or ores growth medium with 'C-containing carbon source, such as US 2017/00 16035 A1 Jan. 19, 2017 glucose, pyruvic acid, etc. In this way polymers can be sinus trichosporium, Hyphomicrobium methylovorum, produced that are labeled with 'Cuniformly, partially, or at Hyphonicrobium Zavarzini, Bacillus methanolicus, Bacil specific sites. Additionally, labeling allows the exact per lus cereus M-33-1, Streptomyces 239, 1Mycobacterium vac centage in bioplastics that came from renewable sources cae, Diplococcus PAR, Protaminobacter ruber, Rho (e.g., plant derivatives) can be known via ASTM D6866— dopseudomonas acidophila, Arthrobacter rufescens, an industrial application of radiocarbon dating. ASTM Arthrobacter 1A1 and 1A2, Arthrobacter 2B2, Arthrobacter D6866 measures the Carbon 14 content of biobased mate globiformis SK-200, Klebsiella 101, Pseudomonas 135, rials; and since fossil-based materials no longer have Carbon Pseudomonas Oleovorans, Pseudomonas rosea (NCIB 14, ASTM D6866 can effectively dispel inaccurate claims of 10597 to 10612), Pseudomonas extorquens (NCIB 9399), biobased content Pseudomonas PRL-W4, Pseudomonas AM1 (NCIB 9133), Pseudomonas AM2, Pseudomonas M27, Pseudomonas PP, EXAMPLES Pseudomonas 3A2, Pseudomonas RJ1, Pseudomonas TP1, Pseudomonas sp. 1 and 135, Pseudomonas sp. YR, JB1 and 0083. The present technology is further illustrated by the PCTN, Pseudomonas methylica sp. 2 and 15, Pseudomonas following examples, which should not be construed as 2941, Pseudomonas AT2, Pseudomonas 80, Pseudomonas limiting in any way. aminovorans, Pseudomonas sp. 1A3, 1B1, 7B1 and 8B1, 0084. These examples describe a number of biotechnol Pseudomonas S25, Pseudomonas (methylica) 20, ogy tools and methods for the construction of strains that Pseudomonas W1, Pseudomonas W6 (MB53), Pseudomo generate a product of interest. Suitable host strains, the nas C. Pseudomonas MA, Pseudomonas MS. Exemplary potential Source and a list of recombinant genes used in these yeast Strains include: Pichia pastoris, Gliocladium delique examples, suitable extrachromosomal vectors, Suitable strat scens, Paecilomyces varioli, Trichoderma lignorum, Han egies and regulatory elements to control recombinant gene senula polymorpha DL-1 (ATCC 26012), Hansenula poly expression, and a selection of construction techniques to morpha (CBS 4732), Hansenula capsulata (CBS 1993), overexpress genes in or inactivate genes from host organ Hansenula lycozyma (CBS 5766), Hansenula henricii (CBS isms are described. These biotechnology tools and methods 5765), Hansenula minuta (CBS 1708), Hansenula nonfer are well known to those skilled in the art. mentans (CBS 5764), Hansenula philodenda (CBS), Han senula wickerhamii (CBS 4307), Hansenula ofitaensis, Can Suitable Host Strains dida boidinii (ATCC 32195), Candida boidinii (CBS 2428, I0085. In certain embodiments, the host strain is Methylo 2429), Candida boidinii KM-2, Candida boidinii NRRL philus methylotrophus AS-1 (formerly known as Pseudomo Y-2332, Candida boidini S-1, Candida boidinii S-2, Can dida boidinii 25-A, Candida alcanigas, Candida methano nas methylotropha AS-1, deposited at the National Collec lica, Candida parapsilosis, Candida utilis (ATCC 26387), tions of Industrial, Marine and Food Bacteria (NCIMB) as Candida sp. N-16 and N-17, Kloeckera sp. 2201, Kloeckera Acc. No. 10515; MacLennan et al., UK Patent No. sp. A2, Pichia pinus (CBS 5098), Pichia pinus (CBS 744), 1370892), or Methylocystis hirsute (deposited at the Pichia pinus NRRL YB-4025, Pichia haplophila (CBS Deutsche Sammlung von Mikroorganismen und Zellkul 2028), Pichia pastoris (CBS 704), Pichia pastoris (IFP206), turen GmbH (DSMZ) as Acc. No. 18500; Linder et al., J. Pichia trehalophila (CBS 5361), Pichia lidnerii, Pichia Syst. Evol. Microbiol. 57:1891-1900 (2007); Rahnama et methanolica, Pichia methanothermo, Pichia sp. NRRL-Y- al., Biochem. Engineer. J. 65:51-56 (2012)). 11328, Saccharomyces H-1, Torulopsis pinus (CBS 970), I0086. Other exemplary microbial host strains that grow Torulopsis initatophila (CBS 2027), Torulopsis nemodendra on methane and/or methanol as sole carbon Source include (CBS 6280), Torulopsis molishiana, Torulopsis metha but are not limited to: Methylophilus methylotrophus M12-4, molovescens, Torulopsis glabrata, Torulopsis enoki, Toru Methylophilus methylotrophus M1, Methylophilus methylo lopsis methanophiles, Torulopsis methanosorbosa, Torulop trophus sp. (deposited at NCIMB as Ace. No. 11809), sis methanodomercquii, Torulopsis nagoyaensis, Torulopsis Methylophilus leisingeri, Methylophilus flavus sp. nov., Methylophilus luteus sp. nov., Methylomonas sp. strain 16a, sp. A1, Rhodotorula sp., Rhodotorula glutinis (strain cy), Methylomonas methanica MCO9, Methylobacterium and Sporobolomyces roseus (strain y). extorquens AM1 (formerly known as Pseudomonas AM1). Methylococcus capsulatus Bath, Methylomonas sp. strain J. Source of Recombinant Genes Methylomonas aurantiaca, Methylomonas fodinarum, I0087 Sources of encoding nucleic acids for PHA biopo Methylomonas scandinavica, Methylomonas rubra, Meth lymers or C3, C4, and C5 biochemicals pathway enzymes ylomonas streptobacterium, Methylomonas rubrum, Meth can include, for example, any species where the encoded ylomonas rosaceous, Methylobacter chroococcum, Methyl gene product is capable of catalyzing the referenced reac obacter bovis, Methylobacter capsulatus, Methylohacter tion. Such species include both prokaryotic and eukaryotic vinelandii, Methylococcus minimus, Methylosinus sporium, organisms including, but not limited to, bacteria, including Methylocystis parvus, Methylocystis hirsute, Methylobacte archaea and eubacteria, and eukaryotes, including yeast, rium Organophilum, Methylobacterium rhodesianum, Meth plant, insect, animal, and mammal, including human. Exem plary species for Such sources include, for example, Escheri vlobacterium R6, Methylobacterium aminovorans, Methyl chia coli, Saccharomyces cerevisiae, Saccharomyces obacterium chloromethanicum, Methylobacterium Kluyveri, Synechocystis sp. PCC 6803, Synechococcus elon dichloromethanicum, Methylobacterium filjisawaense, gatus PCC 7942, Synechococcus sp. PCC 7002, Chlorog Methylobacterium mesophilicum, Methylobacterium radio leopsis sp. PCC 6912, Chloroflexus aurantiacus, tolerans, Methylobacterium rhodinum, Methylobacterium Clostridium kluyveri, Clostridium acetobutylicum, thiocyanatum, Methylobacterium zatmanii, Methylomonas Clostridium beijerinckii, Clostridium saccharoperbutylac methanica, Methylomonas albus, Methylomonas agile, etonicum, Clostridium periringens, Clostridium difficile, Methylomonas P11, Methylobacillus glycogenes, Methylo Clostridium botulinum, Clostridium tyrobutyricum, US 2017/00 16035 A1 Jan. 19, 2017

Clostridium tetanomorphum, Clostridium tetani, ever, with the complete genome sequence available now for Clostridium propionicum, Clostridium aminobutyricum, more than 2500 species However, with the complete genome Clostridium subterminale, Clostridium Sticklandii, Ralsto sequence available now for more than 2,500 species (sec the nia eutropha, Mycobacterium bovis, Mycobacterium tuber world wide web at ncbi.nlm.nih.gov/genome/browse/), culosis, Porphyromonas gingivalis, Arabidopsis thaliana, including microorganism genomes and a variety of yeast, Thermus thermophilus, Pseudomonas species, including fungi, plant, and mammalian genomes, the identification of Pseudomonas aeruginosa, Pseudomonas putida, Pseudomo genes encoding the requisite PHA biopolymers or C3, C4. nas Stutzeri, Pseudomonas fluorescens, Chlorella minutis and C5 biochemicals biosynthetic activity for one or more sima, Chlorella emersonii, Chlorella Sorokiniana, Chlorella genes in related or distant species, including for example, ellipsoidea, Chlorella sp., Chlorella protothecoides, Homo homologues, orthologs, paralogs and nonorthologous gene sapiens, Oryctolagus cuniculus, Rhodobacter sphaeroides, displacements of known genes, and the interchange of Thermoanaerobacter brockii, Metallosphaera sedula, Leu genetic alterations between organisms is routine and well conostoc mesenteroides, Roseiflexus castenholzii, Erythro known in the art. Accordingly, the metabolic alterations bacter, Simmondsia chinensis, Acinetobacter species, enabling biosynthesis of PHA biopolymers or C3, C4, and including Acinetobacter calcoaceticus and Acinetobacter C5 biochemicals of the invention described herein with baylvi, Sulfolobus tokodai, Sulfolobus solfataricus, Sulfolo reference to particular organisms such as Methylophilus bus acidocaldarius, Bacillus subtilis, Bacillus cereus, Bacil methylotrophus and Methylocystis hirsute can be readily lus megaterium, Bacillus brevis, Bacillus pumilus, Rattus applied to other microorganisms, including prokaryotic and norvegicus, Klebsiella pneumonia, Klebsiella Oxytoca, eukaryotic organisms alike. Given the teachings and guid Euglena gracilis, Treponema denticola, Moorella thermo ance provided herein, those skilled in the art will know that acetica, Thermotoga maritima, Halobacterium salinarum, a metabolic alteration exemplified in one organism can be Geobacillus Stearothermophilus, Aeropyrum permix, Sus applied equally to other organisms. scrofa, Caenorhabditis elegans, Corynebacterium glutami cum, Acidaminococcus fermentans, Lactococcus lactis, Lac Production of Transgenic Host for Producing PHA tobacillus plantarum, Streptococcus thermophilus, Entero Biopolymers or C3, C4, and C5 Biochemicals bacter acrogenes, Candida, Aspergillus terreus, Pedicoccus I0088 Transgenic (recombinant) hosts for producing pentosaceus, Zymomonas mobilis, Acetobacter pasteurians, PHA biopolymers or C3, C4, and C5 biochemicals are Kluyveromyces lactis, Eubacterium barkeri, Bacteroides genetically engineered using conventional techniques capillosus, Anaerotruncus colihominis, Natranaerobius known in the art. The genes cloned and/or assessed for host thermophilus, Campylobacter jejuni, Haemophilus influen strains producing 3HP containing homo- and copolymers Zae, Serratia marcescens, Citrobacter amalonaticus, Myxo and 3-carbon biochemicals are presented below in Table 1A, coccus xanthus, Fusobacterium nuleatum, Penicillium chry along with the appropriate Enzyme Commission number sogenium, marine gamma proteobacterium, butyrate (EC number) and references. Some genes were synthesized producing bacterium, and Trypanosoma brucei. Other for codon optimization while others were cloned via PCR Suitable sources for recombinant genes constitute the meth from the genomic DNA of the native or wild-type host. As ylotrophic organisms listed above. For example, microbial used herein, "heterologous' means from another host. The hosts (e.g., organisms) having PHA biopolymers or C3, C4. host can be the same or different species. FIG. 1 shows and C5 biochemicals biosynthetic production are exempli exemplary pathways for producing P3HP, P(3HB-co-3HP), fied herein with reference to a methylotrophic host. How and PDO. TABLE 1A Genes overexpressed or deleted in microbial host strains producing 3HP containing PHA and 3-carbon chemicals. A star (*) after the gene name denotes that the nucleotide sequence was optimized for expression in E. coli. Reaction number EC (FIG. 1) Gene Name Enzyme Name Number Accession No. 1 phaA5 Acetyl-CoA 2.3.1.9 2VU2. A acetyltransferase (a.k.a. beta-ketothiolase) 2 phaB5 Acetoacetyl-CoA 1.1.1.36 P23238 reductase 3 accA Acetyl-CoA carboxylase, 6.4.1.2 AACA3296 alpha Subunit 3 accB Acetyl-CoA carboxylase, 6.4.1.2 AACT6287 BCCP (biotin carboxyl carrier protein) subunit 3 accC Acetyl-CoA carboxylase, 6.4.1.2 AAC76288 biotin carboxylase subunit 3 accD Acetyl-CoA carboxylase, 6.4.1.2 AACTS376 beta (carboxyltransferase) Subunit 4 Incirc Malonyl-CoA reductase Gene/Protein ID 1: (3-hydroxypropionate- AAS2O429 forming) 5 Incrs Malonyl-CoA reductase 1.2.1.75 BAB67276 (malonate semialdehyde forming) 6 msaR Malonic semialdehyde 1.1.1.298 BAKS4608 reductase US 2017/00 16035 A1 Jan. 19, 2017 14

TABLE 1A-continued Genes overexpressed or deleted in microbial host strains producing 3HP containing PHA and 3-carbon chemicals. A star (*) after the gene name denotes that the nucleotide sequence was optimized for expression in E. coli. Reaction number EC (FIG. 1) Gene Name Enzyme Name Number Accession No. 7 orf7 CoA transferase 2.8.3— AAA92344 7 alkK CoA ligase (a.k.a. acyl- 6.2.1. CABS4055 CoA synthetase) 8 DAR1 Glycerol-3-phosphate 1.1.1.8 NP 010262 (GPD1) dehydrogenase (NAD+) 8 gpSA Glycerol-3-phosphate 1.1.1.94 NP 220823 dehydrogenase (NADP+) 9 GPP2 glycerol-1-phosphatase 3.1.3.21 NP 010984 (HOR2) HOR2 10 dhaE1 Glycerol dehydratase 4.2.1.30 AAA74258 large subunit 10 dhaE2 Glycerol dehydratase 4.2.1.30 AAA74257 medium subunit 10 dhaE3 Glycerol dehydratase 4.2.1.30 AAA74256 Small subunit 10 gdra Chain A, Glycerol (1NBW A) AAA74255 Dehydratase Reactivase 10 gdrB Chain B, Glycerol 1NBW B Dehydratase Reactivase 11 puuC 3-Hydroxy- 1.2.1.3 NP 415816 propionaldehyde dehydrogenase (gamma-Glu-gamma aminobutyraldehyde dehydrogenase, NAD(P)H-dependent) 12 pduP CoA-acylating 3- 1.2.1. NP 460996 hydroxypropionaldehyde dehydrogenase 13 phaC3/C1* Polyhydroxyalkanoate 2.3.1.n U.S. Patent Appl. No. synthase fusion protein 2011024612 14 ych) Succinic semialdehyde 1.1.1.61 NP 417484 reductase

0089. Other proteins capable of catalyzing the reactions TABLE 1 B-continued listed in Table 1A can be discovered by consulting the scientific literature, patents, BRENDA searches (http:// Suitable homologues for the PhaA5 protein (beta-ketothiolase, www.brenda-enzymes.info/), and/or by BLAST searches from Zoogloea ramigera, EC No. 2.3.1.9, which acts on against e.g., nucleotide or protein databases at NCBI (www. acetyl-CoA + acetyl-CoA to produce acetoacetyl-CoA: incbi.nlm.nih.gov/). Synthetic genes can then be created to protein acc. no. 2VU2 A). provide an easy path from sequence databases to physical Protein DNA. Such synthetic genes are designed and fabricated Protein Name Accession No. from the ground up, using codons to enhance heterologous acetyl-CoA acetyltransferase YP 426557 protein expression, and optimizing characteristics needed acetyl-Coenzyme A acetyltransferase 3 NP 6947.91 for the expression system and host. Companies such as e.g., acetyl-CoA acetyltransferase YP 003153095 DNA 2.0 (Menlo Park, Calif. 94025, USA) will provide such Acetyl-CoA acetyltransferase CCF95917 routine service. Proteins that may catalyze some of the acetyl-CoA acetyltransferase ZP 07454.459 biochemical reactions listed in Table 1A are provided in Tables 1B to 1X.

TABLE 1B TABLE 1C Suitable homologues for the PhaA5 protein (beta-ketothiolase, Suitable homologues for the PhaB5 protein (acetoacetyl-CoA from Zoogloea ramigera, EC No. 2.3.1.9, which acts on reductase, from Zoogloea ramigera, EC No. 1.1.1.36, which acetyl-CoA + acetyl-CoA to produce acetoacetyl-CoA: acts on acetoacetyl-CoA to produce 3-hydroxybutyryl CoA: protein acc. no. 2VU2 A). protein acc. no. P23238). Protein Protein Accession Protein Name Accession No. Protein Name No. acetyl-CoA acetyltransferase YP 002827756 acetoacetyl-CoA reduetase YP 002827755 acetyl-CoA acetyltransferase YP 002283310 phaB gene product YP 770184 acetyl-CoA acetyltransferase YP OO2733453 acetoacetyl-CoA reductase ZP O8627619 acetyl-CoA acetyltransferase ZP 01 011874 molybdopterin-guanine dinucleotide ZP O1901796 acetyl-CoA acetyltransferase ZP 00961105 biosynthesis protein A US 2017/00 16035 A1 Jan. 19, 2017 15

TABLE 1 C-continued TABLE 1 F

Suitable homologues for the PhaB5 protein (acetoacetyl-CoA Suitable homologues for the AccC protein (biotin carboxylase reductase, from Zoogloea ramigera, EC No. 1.1.1.36, which subunit of Acetyl-CoA carboxylase from Escherichia coli, acts on acetoacetyl-CoA to produce 3-hydroxybutyryl CoA: EC No. 6.4.1.2, which acts on acetyl-CoA to produce protein acc. no. P23238). malonyl-CoA: protein acc. no. AAC76288). Protein Accession Protein Name Protein Accession No. Protein Name No. acetoacetyl-CoA reductase YP OO6369576 bio in carboxylasefacetyl-coenzyme A YP 544136 putative acetoacetyl-CoA reductase PhaB ZP 09394.630 carboxylase carboxyl transferase subunit acetoacetyl-CoA reductase YP 001352246 alpha acetoacetyl-CoA reductase ZP O2467262 acetyl-CoA carboxylase, biotin acetoacetyl-CoA reductase ZP 01985.557 carboxylase acetyl-CoA carboxylase, biotin YP 113521 carboxylase acetyl-CoA carboxylase, biotin WP OO5368464 TABLE 1D carboxylase subunit Suitable homologues for AccA protein (the alpha Subunit of acetyl-CoA carboxylase, biotin YP OO4512661 Acetyl-CoA carboxylase from Escherichia coli, EC No. carboxylase 6.4.1.2, which acts on acetyl-CoA to produce malonyl-CoA: bio in carboxylase WP 0071.43998 protein acc, no. AAC73296). bio in carboxylase WP O09725888 Protein Accession bio in carboxylase YP OO6293650 Protein Name No. bio in carboxylase YP OO6294632 Acetyl-coenzyme A carboxylase carboxyl WP OO6893763 transferase subunit alpha acetyl-CoA carboxylase, carboxyl YP 114242 transferase subunit alpha TABLE 1G acetyl-CoA carboxylase, carboxyl WP OO5370898 transferase, alpha Subunit Suitable homologues for the AccD protein (beta (carboxyltransferase) acetyl-CoA carboxylase alpha Subunit WP 007145523 subunit of Acetyl-CoA carboxylase from Escherichia coli, EC acetyl-coenzyine A carboxyl transferase WP OO9726998 No. 6.4.1.2, which acts on acetyl-CoA to produce malonyl-CoA: Subunit alpha protein acc. no. AAC75376). acetyl-coenzyme A carboxyl transferase YP OO6295989 Subunit alpha Protein Name Protein Accession No. acetyl-coenzyme A carboxyl transferase YP OO6292.159 Subunit alpha AccD protein AAU37781 acetyl-CoA carboxylase, carboxyl WP O0829.1216 acetyl-CoA carboxylase subunit beta YP 001347397 transferase, alpha Subunit acetyl-CoA carboxylase subunit beta YP OO582O031 acetyl-CoA carboxylase carboxyltransferase YP 275962 AccD ABD19972 Subunit alpha acetyl-CoA carboxylase, carboxyl YP 004116616 transferase subunit beta Acetyl-coenzyme A carboxylase carboxyl WP OO9112050 transferase subunit beta TABLE 1E acetyl-CoA carboxylase subunit beta WP OO8910693 acetyl-CoA carboxylase subunit beta WP OO6071327 Suitable homologues for AccB protein (the BCCP (biotin acetylcoA carboxylase, WP OO4586882 carboxyl carrier protein) subunit of Acetyl-CoA carboxylase carboxyltransferase subunit beta from Escherichia coi, EC No. 6.4.1.2, which acts on acetyl-CoA to produce malonyl-CoA: protein acc. no. AAC76287). TABLE 1H Protein Name Protein Accession No. Suitable homologues for the Mcre protein (malonyl CoA biotin carboxyl carrier protein YP 544137 reductase (3-hydroxypropionate-forming), from Chloroflexits acetyl-CoA carboxylase, biotin carboxyl WP OO6892078 attrantiacus, which acts on malonyl-CoA to produce carrier protein 3-hydroxypropionate: rotein acc. no. AAS20429). acetyl-CoA carboxylase, biotin carboxyl YP 113520 carrier protein Protein Accession acetyl-CoA carboxylase, biotin carboxyl WP OO5368465 Protein Name No. carrier protein biotin carboxyl carrier protein of acetyl YP 004917568 short-chain dehydrogenase/reductase YP OO1636209 CoA carboxylase short chain dehydrogenase/reductase YP OO2462600 acetyl-CoA carboxylase biotin carboxyl YP OO6293649 short-chain dehydrogenase/reductase ZP O7684596 carrier protein dehydrogenase of unknown specificity ZP O9692171.1| acetyl-CoA carboxylase, biotin carboxyl WP O08106026 NAD-dependent epimerase? dehydratase ZP 01039179 carrier protein short-chain alcohol dehydrogenase YP OO48.63680 Biotin carboxyl carrier protein of acetyl WP 008061392 oxidoreductase, short chain dehydrogenasef ZP O495.7196 CoA carboxylase reductase family acetyl-CoA carboxylase, biotin carboxyl short chain dehydrogenase ZP O16263.93 carrier protein short-chain dehydrogenase/reductase ZP 05125944 US 2017/00 16035 A1 Jan. 19, 2017 16

TABLE 1 I TABLE 1.L. Suitable homologues for the AlkK protein (CoA ligase, a.k.a. Suitable homologues for the Mcro protein (Malonyl-CoA acyl CoA synthetase, from Pseudomonas puttida, EC No. 6.2.1.—, which acts on 3-hydroxypropionate to produce reductase (malonate semialdehyde-forming), from Sulfolobits 3-hydroxypropionvil CoA: protein acc. no. CAB54055). tokodai str. 7, EC No. 1.2.1.75, which acts on malonyl-CoA Protein Accession to produce malonate semialdehyde; protein acc. no. BAB67276). Protein Name No AMP-dependent synthetase and ligase WP OO9506504 Protein Accession hypothetical protein WP 004696716 Protein Name No. acyl-coa synthetase protein YP OO6029621 medium-chain-fatty-acid-CoA ligase WP OO8641.287 acyl-CoA synthetase WP 007 607365 malonyl-succinyl-CoA reductase YP OO4410014 medium-chain-fatty-acid-CoA ligase YP OO4.981930 aspartate-semialdehyde dehydrogenase YP 004.459517 AMP-dependent synthetase and ligase WP O10683110 AMP-dependent synthetase and ligase YP OO2499566 aspartate-semialdehyde dehydrogenase ZP 09704495 AMP- ENdent Rthetase and E. YP OO1769606 aspartate-semialdehyde dehydrogenase YP 002844727 aspartate-semialdehyde dehydrogenase YP 0034.01535 aspartate-semialdehyde dehydrogenase YP 003435562 TABLE 1M aspartate semialdehyde dehydrogenase YP 004OO4235 aspartate-semialdehyde dehydrogenase YP 002461535 Suitable3-phosphate homologues E.drogenase for the DAR1 (NS. (GPD1) E. protein (Glycerol aspartate-semialdehyde dehydrogenase ZP 21643548 cerevisiae S288c, EC No. 1.1.1.8, which acts on dihydroxyacetone phosphate to produce Sn-glycerol-3-phosphate; protein acc. no. NP O10262).

Protein Accession TABLE 1 J Protein Name No. Suitable homologues for the MsaRs protein (Malonic hypothetical protein KAFR OF02240 XP 003957956 semialdehyde reductase, from Sulfolobus tokodai str. 7, K7 Gpd2p GAA26268 EC No. 1.1.1.298, which acts on malonate semialdehyde to Glycerol-3-phosphate dehydrogenase EFW94329 roduce 3-hydroxypropionate: protein acc. no. BAK54608). glycerol-3-phosphate dehydrogenase ABC17999 PREDICTED: glycerol-3-phosphate XP 004OO6414 Protein Accession dehydrogenase NAD(+), cytoplasmic Protein Name No. isoform 2 Glycerol-3-phosphate dehydrogenase ENEH63281 3-hydroxyacyl-CoA dehydrogenase NAD- YP 004.458285 NE Cp NP 984.407 binding protein hypothetical protein CLUG 03347 XP 002616106 malonate semialdehyde reductase YP OO4408885 hypothetical protein Kpol 1037.p2 XP OO1645264 3-hydroxyacyl-CoA dehydrogenase YP 007865821 3-hydroxybutyryl-CoA dehydrogenase YP 256228 3-hydroxyacyl-CoA dehydrogenas YP 002832248 3-hydroxyacyl-CoA dehydrogenase NP 070034 TABLE 1N 3-hydroxyacyl-CoA dehydrogenase NAD- ZP O3264549 binding Suitable homologues for the Gips.A protein (Glycerol-3- 3-hydroxyacyl-CoA dehydrogenase CCF365O1 phosphate dehydrogenase (NADP+), from Rickettsia 3-hydroxyacyl-CoA dehydrogenase NAD- YP 005646O18 prowazekii (strain Madrid E), EC No. 1.1.1.94, which acts on dihydroxyacetone-phosphate to produce Sn-glycerol binding protein 3-phosphate: protein acc. no. NP 220823). Protein Accession Protein Name No. TABLE 1 K NAD(P)H-dependent glycerol-3-phosphate YP 005391074 Suitable homologues for the OrfA protein (CoA transferase, from dehydrogenase Clostridium kluyveri DSM 555, EC No. 2.8.3.n, which acts on NAD(P)H-dependent glycerol-3-phosphate WP 010423122 3-hydroxypropionate to produce 3-hydroxypropionyl CoA; protein dehydrogenase acc. no. AAA92344) NAD(P)H-dependent glycerol-3-phosphate YP 538395 dehydrogenase Protein Accession NAD(P)H-dependent glycerol-3-phosphate YP 001937693 Protein Name No. dehydrogenase Probable glycerol-3-phosphate YP OO1704643 4-hydroxybutyrate coenzyme A transferase YP 001396397 dehydrogenase 2 acetyl-CoA hydrolase/transferase ZP 05395303 glycerol-3-phosphate dehydrogenase WP OO4982230 acetyl-CoA hydrolase/transferase YP OO1309226 NAD(P)+ 4-hydroxybutyrate coenzyme A transferase NP 781174 glycerol-3-phosphate dehydrogenase WP 004679245 4-hydroxybutyrate coenzyme A transferase ZP 05618453 (NAD(P)+) protein acetyl-CoA hydrolase/transferase ZP 05634318 Glycerol-3-phosphate dehydrogenase WP 012230519 4-hydroxybutyrate coenzyme A transferase ZP 0014.4049 (NAD(P)+) 2 hypothetical protein ANASTE 01215 ZP O2862002 Glycerol-3-phosphate dehydrogenase WP O06891779 4-hydroxybutyrate coenzyme A transferase ZP 07455129 (NAD(P)+) US 2017/00 16035 A1 Jan. 19, 2017

TABLE 1 O TABLE 1R

Suitable homologues for the GPP2 (HOR2) protein (Glycerol-3- Suitable homologues for the DhaB3 protein (Glycerol phosphatase, from Saccharomyces cerevisiae S288c, dehydratase Small subunit, from Klebsiella pneumoniae, EC No. 4.2.1.30, which acts on glycerol to produce EC No. 3.1.3.21, which acts on sn-glycerol-3-phosphate to 3-hydroxypropionaldehyde; protein acc. no. AAA74256). produce glycerol; protein acc. no. NP 010984). Protein Accession Protein Accession Protein Name No. Protein Name No. glycerol dehydratase Small subunit ABA39278 glycerol dehydratase Small subunit YP OO6320551 unnamed protein product CAA86169 glycerol dehydratase, Small subunit WP O08821391 hypothetical protein KNAG OLO1510 CCK72771 propanediol dehydratase Small subunit WP OO4105138 hypothetical protein TPHA OJOO860 XP OO3687343 propanediol utilization: dehydratase, Small WP O09201837 potential DL-glycerol-3-phosphatase XP 717809 Subunit hypothetical protein EME49670 dehydratase Small subunit YP 004471781 DOTSEDRAFT 164257 dehydratase Small subunit YP 004611538 hypothetical protein MYCTH 2296323 XP OO3659378 propanediol utilization: dehydratase, Small WP 003736322 Subunit 2-deoxyglucose-6-phosphate phosphatase, XP OO2420967 hypothetical protein WP 010739900 putative hor2p ES44022 ZYROOCO8184p XP OO24960O2 TABLE 1S Suitable homologues for the GdrA protein (Chain A, Glycerol Dehydratase Reactivase, from Klebsiella pneumoniae, TABLE 1P which acts on glycerol to produce 3-hydroxypropionaldehyde; protein acc, no AAA72S). Suitable homologues for the DhaB1 protein (Glycerol dehydratase large subunit, from Klebsiella pneumoniae, Protein Accession EC No. 4.2.1.30, which acts on glycerol to produce Protein Name No. 3-hydroxypropionaldehyde: protein acc. no. AAA74258). glycerol dehydratase large subunit WP 007372194 Protein Accession DhaF AAP48652 Protein Name No. hypothetical protein WP 004O98901 glycerol dehydratase reactivation factor, YP 695622 DhaE3 AAWSOO84 arge subunit propanediol dehydratase large subunit WP O03441619 diol glycerol dehydratase reactivating factor WP 008725497 glycerol dehydratase large subunit WP 0096,248O2 arge subunit propanediol dehydratase large subunit WP O0973O844 glycerol dehydratase reactivation factor, WP 003736323 propanediol dehydratase, large subunit YP 79.5723 arge subunit B12-dependent diol dehydratase large CAC82S41 diol glycerol dehydratase reactivating factor YP 002892885 Subunit arge subunit propanediol dehydratase large subunit WP OO3929110 Diolglycerol dehydratase reactivating WP 007062656 propanediol dehydratase, large subunit YP OO6455.258 actor large subunit glycerol dehydratase YP OO3.989236 hypothetical protein WP OO9267496

TABLE 1 O TABLE 1.T Suitable homologues for the DhaB2 protein (Glycerol Suitable homologues for the GdrB protein (Chain B, dehydratase medium Subunit, from Klebsiella pneumoniae, Glycerol Dehydratase Reactivase, from Klebsiella pneumoniae, EC No. 4.2.1.30, which acts on glycerol to produce which acts on glycerol to produce 3-hydroxypropionaldehyde; 3-hydroxypropionaldehyde: protein acc. no. AAA74257). protein acc. no. 1 NBW B). Protein Accession Protein Accession Protein Name No. Protein Name No. hypothetical protein WP OO4098897 hypothetical protein WP O05131414 coenzyme B12-dependent glycerol NP 561846 hypothetical protein WC1 03731 EOQ21483 dehydrogenase medium Subunit putative diol glycerol dehydratase YP OO632O602 propanediol dehydratase medium Subunit, WP 001701970 reactivating factor partial hypothetical protein WP O03441632 hypothetical protein YP 003961987 hypothetical protein GY4MC1 1865 YP OO3.989240 dehydratase medium Subunit YP 003994783 hypothetical protein TethS14 1949 YP OO1663563 dehydratase medium Subunit YP 003407459 propanediol utilization diol dehydratase WP OO8947524 propanediol dehydratase large subunit WP 003931871 reactivating factor Small chain glycerol dehydratase YP 004611539 propanediol utilization protein PduH WP O09201835 dehydratase medium Subunit WP OO6299594 hypothetical protein YP OO396.1984 US 2017/00 16035 A1 Jan. 19, 2017

TABLE 1U TABLE 1 W-continued Suitable homologues for the PuuC protein (3-Hydroxy Suitable homologues for the PhaC3/C1* protein (Polyhydroxyalkanoate propionaldehyde dehydrogenase (gamma-Glu-gamma synthase fusion protein from Pseudomonas puttida and Ralstonia eutropha aminobutyraldehyde dehydrogenase, NAD(P)H-dependent), JMP134, EC No. 2.3.1..n, which acts on (R)-3-hydroxybutyryl-CoA or from Escherichia coii str. K-12 substr. MG1655, EC 3-hydroxypropionyl-CoA + (R)-3-hydroxybutanoate-co-3- No. 1.2.1.3, which acts on 3-hydroxypropionaldehyde to produce hydroxypropionate to produce (R)-3-hydroxybutanoate-co-3- hydroxypropionately + CoA and also acts on 3 3-hydroxypropionate; protein acc. no. NP 415816). hydroxypropionyl-CoA + 3-hydroxypropionate, Protein Accession to produce 3-hydroxypropionatel, L + COA. Protein Name No. Protein Protein Name Accession No. gamma-glutamyl-gamma YP 003363997 aminobutyraldehyde dehydrogenase intracellular polyhydroxyalkanoate ADM24646 gamma-glutamyl-gamma WP OO4860378 synthase aminobutyraldehyde dehydrogenase Poly(3-hydroxyalkanoate) polymerase ZP O0942942 betaine aldehyde dehydrogenase WP 001009084 polyhydroxyalkanoic acid synthase YPOO3752369 gamma-Glu-gamma-aminobutyraldehyde YP 007405904 Pha AAF23364 dehydrogenase, NAD(P)H-dependent gamma-glutamyl-gamma YP 0050934.05 aminobutyraldehyde dehydrogenase aldehyde dehydrogenase YP OO4993326 TABLE 1X NAD-dependent aldehyde dehydrogenase WP 008086799 aldehyde dehydrogenase WP OO8891845 Suitable homologues for the YahD protein (succinic semialdehyde Gamma-glutamyl-gamma YP OO3622830 reductase, from Escherichia coi K-12, EC No. 1.1.1.61, aminobutyraldehyde dehydrogenase which acts on 3-hydroxypropionaldehyde to produce 1,3-propanediol; protein acc, no NP 47484). Protein TABLE 1 V Protein Name Accession No. Suitable homologues for the PduP protein (CoA-acylating alcohol dehydrogenase yohD ZP 02900879 3-hydroxypropionaldehyde dehydrogenase, from Salmonella alcohol dehydrogenase, NAD(P)-dependent YP 002384.050 enterica subsp. enterica serovar Typhimurium str. LT2, EC putative alcohol dehydrogenase YP 003367010 No. 1.2.1.—, which acts on 3-hydroxypropionaldehyde to produce alcohol dehydrogenase Yghl) ZP 026.67917 3-hydroxypropionyl CoA: protein acc. no. NP 460996). putative alcohol dehydrogenase YP 218095 hypothetical protein ESA 00271 YP OO1436408 Protein Accession iron-containing alcohol dehydrogenase YP OO3437606 Protein Name No. hypothetical protein CKO 04406 YP OO1455898 alcohol dehydrogenase ZP 03373496 hypothetical protein WP OO4105189 propanediol utilization: CoA-dependent YP 003365,687 propionaldehyde dehydrogenase CoA-dependent proprionaldehyde YP 002383144 0090 The genes cloned and/or assessed for host strains dehydrogenase pduP producing 4HB-containing PHA and 4-carbon chemicals CoA-dependent proprionaldehyde YP 002556907 dehydrogenase were disclosed previously (International Pub. WO 2011/ hypothetical protein WP OO8813236 100601). Additional genes are presented below in Table 2A, Aldehyde Dehydrogenase YP 002892893 along with the appropriate Enzyme Commission number aldehyde dehydrogenase family protein WP 007372115 (EC number) and references. As used herein, "heterologous' CoA-dependent propionaldehyde YP 84932O dehydrogenase means from another host. The host can be the same or hypothetical protein WP O10746532 different species. FIG. 2 shows exemplary pathways for producing P4HB, P(3HB-co-4HB), and BDO.

TABLE 2A TABLE 1 W. Genes overexpressed or deleted in microbial host strains Suitable homologues for the PhaC3/C1* protein (Polyhydroxyalkanoate producing 4HB-containing PHA and 4-carbon chemicals. synthase fusion protein from Pseudomonas puttida and Ralstonia eutropha JMP134, EC No. 2.3.1..n, which acts on (R)-3-hydroxybutyryl-CoA or Reaction 3-hydroxypropionyl-CoA + (R)-3-hydroxybutanoate-co-3- number Gene EC hydroxypropionate to produce (R)-3-hydroxybutanoate-co-3- (FIG. 2) Name Enzyme Name Number Accession No. hydroxypropionately + CoA and also acts on 3 hydroxypropionyl-CoA + 3-hydroxypropionate, 9 Crit 3-hydroxybutyryl- 4.2.1.– AAK80658 to produce 3-hydroxypropionatel, L, + COA. CoA dehydratase 10 abfL) 4-Hydroxybutyryl- 5.3.3.3 CAB60O3S Protein CoA dehydratase 4.2.1.120 Protein Name Accession No. 12 ald Coenzyme A acylating 1.2.1.10 AAQ12068 aldehyde dehydro Poly(R)-hydroxyalkanoic acid synthase, YP 295561 genase class I 13 adh1 Acetaldehyde dehydro- 1.2.1.— AY494991 Poly(3-hydroxybutyrate)polymerase YP 725940 genase (acetylating) polyhydroxyalkanoic acid synthase AAW.65074 polyhydroxyalkanoic acid synthase YP 002005374 Poly(R)-hydroxyalkanoic acid synthase, YP 58.3508 class I 0091 Proteins that may catalyze some of the biochemical reactions listed in Table 2A are provided in Tables 2B to 2E. US 2017/00 16035 A1 Jan. 19, 2017 19

TABLE 2B TABLE 2E Suitable homologues for the Adh1 protein (acetaldehyde Suitable homologues for the Crt protein (3-hydroxybutyryl dehydrogenase (acetylating), from Geobacilius thermoglucosidasius strain M10EXG, EC No. 1.2.1.—, which acts on 4-hydroxybutyraldehyde CoA dehydratase, from Clostridium acetobutyllicum ATCC to produce 1,4-butanediol: rotein acc. no. NP 149199). 824, EC No. 4.2.1.—, which acts on 3-hydroxybutyryl-CoA Protein to produce crotonyl-CoA: protein acc. no. AAK80658). Protein Name Accession No. aldehyde-alcohol dehydrogenase AdhE YP 007456732 Protein bifunctional acetaldehyde-CoA alcohol WP OO34471.64 Protein Name Accession No. dehydrogenase Aldehyde-alcohol dehydrogenase WP OO2780759 Aldehyde-alcohol dehydrogenase YP 005079865 Enoyl-CoA hydratasetisomerase YP OO3844.432 Aldehyde-alcohol dehydrogenase WP OO63O3608 aldehyde-alcohol dehydrogenase E, partial AAMS.1642 3-hydroxybutyryl-CoA dehydratase YP OO1884608 alcohol dehydrogenase, class IV YP OO72.99947 3-hydroxybutyryl-CoA dehydratase WP OO694O765 bifunctional acetaldehyde-CoA alcohol YP 002531871 Enoyl-CoA hydratasetisomerase WP 00706O131 dehydrogenase bifunctional protein: acetaldehyde-CoA WP OO3253794 Enoyl-CoA hydratasetisomerase YP OO3153097 dehydrogenasefalcohol dehydrogenase Enoyl-CoA hydratase YP 005847209 enoyl-CoA hydratase/carnithine racemase YP 007945423 enoyl-CoA hydratase WP OO7872887 TABLE 2F 3-hydroxybutyryl-CoA dehydratase YP OO4883776 Suitable homologues for the KgdM protein (alpha-ketoglutarate decarboxylase, from Mycobacterium tuberculosis, EC No. 4.1.1.71, which acts on alpha-ketoglutarate to produce Succinate semialdehyde and carbon dioxide: protein acc. no. NP 335730 TABLE 2C Protein Suitable homologues for the Abf) protein (4-Hydroxybutyryl Protein Name Accession No. CoA dehydratase, from Clostridium aminobutyricum, EC Nos. alpha-ketoglutarate decarboxylase YP 001282558 5.3.3.3 and 4.2.1.120, which acts on crotonyl-CoA to produce alpha-ketoglutarate decarboxylase NP 854934 4-hydroxybutyryl-CoA: rotein acc. no. CAB60035). 2-oxoglutarate dehydrogenase SucA ZP 06454.135 2-oxoglutarate dehydrogenase SucA ZP 0498O193 Protein alpha-ketoglutarate decarboxylase NP 961470 Protein Name Accession No. alpha-ketoglutarate decarboxylase Kgod YP OO1852457 alpha-ketoglutarate decarboxylase NP 301802 Vinylacetyl-CoA delta-isomerase WP OO3423094 alpha-ketoglutarate decarboxylase ZP 0521578O gamma-aminobutyrate metabolism WP OO9014.604 alpha-ketoglutarate decarboxylase YP OO1702133 dehydratase isomerase gamma-aminobutyrate metabolism YP 005O14369 dehydratase isomerase aromatic ring hydroxylase YP OO6466005 TABLE 2G vinylacetyl-CoA delta-isomerase YP 003702010 4-hydroxybutyryl-CoA dehydratase Suitable homologues for the SucD protein (Succinate semialdehyde YP OO6721174. dehydrogenase, from Clostridium kluyveri, EC No. 1.2.1.76, 4-hydroxybutyryl-CoA dehydratase YP 874977 which acts on Succinyl-CoA to produce Succinate semialdehyde; 4-hydroxyphenylacetate 3-monooxygenase WP OO7577713 rotein acc. no. YP 001396394 aromatic ring hydroxylase YP 460766 Protein Protein Name Accession No. CoA-dependent Succinate semialdehyde AAA92347 TABLE 2D dehydrogenase Succinate-semialdehyde dehydrogenase ZP O655998O Suitable homologues for the Ald protein (Coenzyme A acylating NAD(P)+ aldehyde dehydrogenase, from Clostridium beijerinckii NCIMB Succinate-semialdehyde dehydrogenase ZP 05401724 8052, EC No. 1.2.1.10, which acts on 4-hydroxybutyryl-CoA to NAD(P)+ produce 4-hydroxybutyraldehyde: protein acc. no. AY494991). aldehyde-alcohol dehydrogenase family ZP 07821123 protein Protein Succinate-semialdehyde dehydrogenase ZP 06983179 Protein Name Accession No. NAD(P)+ butyraldehyde dehydrogenase AAP42S63 Succinate-semialdehyde dehydrogenase YP OO1928839 coenzyme A acylating aldehyde CAQ57983 hypothetical protein CLOHYLEM 05349 ZP 03778292 dehydrogenase Succinate-semialdehyde dehydrogenase YP OO3994.018 ethanolamine utilization protein EutE YP OO1886,323 NAD(P)+ Aldehyde Dehydrogenase WP OO7505383 Succinate-semialdehyde dehydrogenase NP 904963 aldehyde dehydrogenase YP OO6390854 Aldehyde Dehydrogenase YP OO3822025 aldehyde dehydrogenase YP 003307836 0092 ethanolamine utilization protein EutE WP OO3736335 The genes cloned and/or assessed for host strains aldehyde dehydrogenase YP 958512 producing 5HV-containing PHA and 5-carbon chemicals, along with other proteins that may catalyze some of these biochemical reactions, were disclosed previously (US Patent US 2017/00 16035 A1 Jan. 19, 2017 20

Publication 2010/0168481). FIG. 3 shows exemplary path Raynolds, Nucl. Acids Res. 15:2343-2361 (1987); also at the ways for producing P5HV, P(3HB-co-5HV), and 1.5PD. world wide web at ecocyc.org and partsregistry.org). 0.098 Strategies for achieving expression of recombinant Suitable Extrachromosomal Vectors and Plasmids genes in methylotrophic bacteria have also been described in 0093. A “vector,” as used herein, is an extrachromosomal the literature. Heterologous promoters, such as the artificial replicon, such as a plasmid, phage, or cosmid, into which tac promoter described above and the E. coli trp promoter another DNA segment may be inserted so as to bring about have been Successfully used to express genes in M. meth the replication of the inserted segment. Vectors vary in copy ylotrophus (Byrom, In: Microbial Growth on C-1 Com number, depending on their origin of replication, and size. pounds (ed. Crawford and Hanson) pp. 221-223 (1984), Vectors with different origins of replication can be propa Washington, D.C.: Am, Soc. Microbiol. Press). Other pro gated in the same microbial cell unless they are closely moters such as the WP promoter and the promoter of the related such as e.g. pMB1 and ColE1. kanamycin resistance gene, P, were used to express the 0094 Suitable vectors to express recombinant proteins in FLP recombinase of S. cerevisiae and the xylE gene from E. coli can constitute puC vectors with a pMB1 origin of Pseudomonas putida, respectively (Abalakina et al., Appl. replication having 500-700 copies per cell, pFBluescript Microbiol. Biotechnol. 81:191-200 (2008)). The E. coli vectors with a Col. 1 origin of replication having 300-500 W3110 promoter of the Entner-Doudoroff pathway genes, copies per cell, pFBR322 and derivatives with a pMB1 origin P. was also shown to work in M. methylotrophus of replication having 15-20 copies per cell, p.ACYC and (Ishikawa et al., Biosci. Biotechnol. Biochem. 72(10):2535 derivatives with a p15A origin of replication having 10-12 2542 (2008)). As several heterologous antibiotic markers copies per cell, and pSC101 and derivatives with a pSC101 derived from broad host-range plasmids are functional in origin of replication having about 5 copies per cell as methylotrophic bacteria, the promoters of the genes encod described in the QIAGENR Plasmid Purification Handbook ing enzymes conferring resistance towards e.g. amplicillin, (found on the worldwide web at: kirshner.med.harvard.edu/ tetracycline, chloramphenicol, Streptomycin, or gentamycin files/protocols/QIAGEN QIAGENPlasmidPurification can be used. As partial or complete genomic sequences have EN.pdf). A widely used vector is pSE380 that allows recom been established for several of these methane- and metha binant gene expression from an IPTG-inducible trc promoter nol-utilizing microorganisms, the promoters of endogenous (Invitrogen, La Jolla, Calif.). genes can be used, e.g. the native promoter of the methanol 0095 Suitable vectors to express recombinant proteins in dehydrogenase P. (Fitzgerald and Lidstrom, Biotechnol. methylotrophic microorganisms include broad host-range Bioeng. 81 (3):263-268 (2003); Belanger et al., FEMS vectors such as the low-copy number IncP1-based vectors Microbiol. Letters 231: 197-204 (2004)) or the native pro pVK100 (Knauf and Nester, Plasmid 8:45-54 (1982)) and moter of the methane monooxygenase P. (Gilbert et al., pLA2917 (Allen and Hanson, J. Bacteriol. 161:955-962 Appl. Environ. Microbiol. 66(3):966-975 (2000)). (1985)) with copy numbers between 5 to 7 and the higher (0099 Exemplary promoters are: copy number IncQ-based vectors pGSS8 (Windass et al., Nature 287:396–401 (1980)) and p AYC30 (Chistoserdov and Tsygankov, Plasmid 16:161-167 (1986)) with copy dsyn. A (a.k.a. Psyn1) numbers between 10 to 12. Of particular practicality is the SEO ID NO: 1 very small, broad host-range vector pBBR1 isolated from (5'-TTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGC-3") , Bordetella bronchiseptica S87 (Antoine and Locht, Mol. dsyn C Microbiol. 6(13):1785-1799 (1992)) as it does not belong to SEO ID NO: 2 any of the broad host-range incompatibility groups IncP. (5'-TTGACAGCTAGCTCAGTCCTAGGTACTGTGCTAGC-3"), IncCR or IncW and thus can be propagated together with dsynE other broad host-range vectors. Suitable derivatives from SEO ID NO: 3 pBBR1 that contain antibiotic resistance markers include (5'-TTTACAGCTAGCTCAGTCCTAGGTATTATGCTAGC-3"), pBBR122 and pBHR1 that can be obtained from MoBiTec dsynh GmbH (Göttingen, Germany). Further derivatives of SEO ID NO: 4 pBBR122 and p3HR1 containing other antibiotic resistance (5' - CTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGC-3") , markers can be generated by genetic engineering by those skilled in the art. dsyn. K SEO ID NO : 5 0096 Suitable Strategies and Expression Control (5'-TTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGC-3"), Sequences for Recombinant Gene Expression 0097 Strategies for achieving expression of recombinant genes in E. coli have been extensively described in the SEO ID NO: 6 literature (Gross, Chimica Oggi 7(3):21-29 (1989); Olins (5'-TTGACAGCTAGCTCAGTCCTAGGGACTATGCTAGC-3") , and Lee, Cur. Op. Biotech. 4:520-525 (1993); Makrides, Microbiol. Rev. 60(3):512-538 (1996); Hannig and SEO ID NO : 7 Makrides, Trends in Biotech. 16:54-60 (1998)). Expression (5'-TCGCCAGTCTGGCCTGAACATGATATAAAAT-3"), control sequences can include constitutive and inducible d uspA promoters, transcription enhancers, transcription termina SEO ID NO: 8 tors, and the like which are well known in the art. Suitable (5'- promoters include, but are not limited to, P., P., P., P. AACCACTATCAATATATTCATGTCGAAAATTTGTTTATCTAACGAGTAAG P. P. P. P., Ps, and P., (Rosenberg and Court, CAAGGCGGATTGACGGATCATCCGGGTCGCTATAAGGTAAGGATGGTCT Ann. Rev. Genet. 13:319-353 (1979); Hawley and McClure, Nucl. Acids Res. 11 (8):2237-2255 (1983); Harley and US 2017/00 16035 A1 Jan. 19, 2017

- Continued where multiple pieces of DNA can be sequentially TAACACTGAATCCTTACGGCTGGGTTAGCCCCGCGCACGTAGTTCGCAG assembled together in a standardized way by using the same two restriction sites. GACGCGGGTGACGTAACGGCACAAGAAACG-3"), 0103) In addition to using vectors, genes that are neces sary for the enzymatic conversion of a carbon Substrate to SEO ID NO : 9 the desired products can be introduced into a host organism (5'- by integration into the chromosome using either a targeted ATGCGGGTTGATGTAAAACITTGTTCGCCCCTGGAGAAAGCCTCGTGTAT or random approach. For targeted integration into a specific site on the chromosome, the method generally known as ACTCCT CACCCTTATAAAAGTCCCTTTCAAAAAAGGCCGCGGTGCTTTAC Red/ET recombineering is used as originally described by AAAGCAGCAGCAATTGCAGTAAAATTCCGCACCATTTTGAAATAAGCTG Datsenko and Wanner (Proc. Natl. Acad. Sci. USA, 2000,97, 6640-6645). Another method for generating precise gene GCGTTGATGCCAGCGGCAAAC-3 '' ) . deletions and insertions in host strains involves the sacB gene that is used as a counterselectable marker for the Psyn AF7 positive selection of recombinant strains that have under SEO ID NO: 10 gone defined genetic alterations leading to the loss of the (5'-TTGACAGCTAGCTCAGTCCTAGGTACAGTGCTAGC-3') marker (Steinmetz et al., Mol. Gen. Genet. 191:138-144 Psyn AF3 (1983); Reyrat et al., Infect Immun. 66(9): 4011-4017 SEO ID NO: 11 (1998). Random integration into the chromosome involves (5'-TTGACAGCTAGCTCAGTCCTAGGTACAATGCTAGC-3') using a mini-Tn5 transposon-mediated approach as described by Huisman et al. (U.S. Pat. Nos. 6,316,262 and 0100 Exemplary terminators are: 6,593,116). The TargeTronTM Gene Knockout System from Sigma-Aldrich (Oakville, ON, Canada) is another method for the rapid and specific disruption of genes in prokaryotic TopL organisms. Introduction of recombinant DNA into the host SEO ID NO: 12 organisms is accomplished for example using electropora (5' - CTAATGAGCGGGCTTTTTTTTGAACAAAA-3"), tion or conjugation (a.k.a. matings). These methods are well known to the artisan. T1006 SEO ID NO: 13 (5'-AAAAAAAAAAAACCCCGCTTCGGCGGGGTTTTTTTTTT-3"), Example 1 Trn B1 SEO ID NO: 14 Production of P3HP in Methylophilus (5'-ATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTT methylotrophus from Methanol Using the AT-3") , Malonyl-CoA Reductase Metabolic Pathway Trn B2 SEO ID NO: 15 0104. This example shows P3HP production from metha (5'-AGAAGGCCATCCTGACGGATGGCCTTTT-3') nol as sole carbon Source using the malonyl-CoA reductase route in engineered M. methylotrophus host cells (FIG. 1). The strains used in this example are listed in Table 3. Both Construction of Recombinant Hosts strains were constructed using the well-known biotechnol ogy tools and methods described above. Strain 1 lacked any 0101 Recombinant hosts containing the necessary genes of the recombinant genes, whereas strain 2 contained the that will encode the enzymatic pathway for the conversion engineered P3HP pathway genes. of a carbon substrate to PHA biopolymers or C3, C4, and C5 biochemicals may be constructed using techniques well known in the art. TABLE 3 0102 Methods of obtaining desired genes from a source Strains used to produce P3HP from methanol carbon source. organism (host) are common and well known in the art of molecular biology. Such methods are described in, for Strains Genes Overexpressed example, Sambrook et al., Molecular Cloning. A Laboratory 1 None (control strain) Manual. Third Ed., Cold Spring Harbor Laboratory, New 2 Toog-P1-phaC3/C1*-T-P-mcro-orf7 York (2001); Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1999). For example, if the sequence of the gene is known, the DNA may 0105. The strains were evaluated in a shake flask assay. be amplified from genomic DNA using polymerase chain The production medium consisted of 5.0 g/L (NH)SO, reaction (Mullis, U.S. Pat. No. 4,683.202) with primers 0.097 g/L MgSO 1.9 g/L KHPO, 1.38 g/L NaH2PO. specific to the gene of interest to obtain amounts of DNA HO, 5.82 mg/L. FeCls, 15.99 ug/L ZnSO 17.53 ug/L Suitable for ligation into appropriate vectors. Alternatively, MnSOHO, 33.72 mg/L CaCl, 5 g/L CuSO4.5H2O, 200 the gene of interest may be chemically synthesized de novo uM KOH and 2% (v/v) methanol. To examine production of in order to take into consideration the codon bias of the host P3HP, the strains were cultured three days in sterile tubes organism to enhance heterologous protein expression. containing 3 mL, of production medium and appropriate Expression control sequences such as promoters and tran antibiotics. Thereafter, 500 uL was removed from each tube Scription terminators can be attached to a gene of interest via and added to a sterile tube containing 4 mL of fresh polymerase chain reaction using engineered primers con production medium. The resulting 4.5 mL broths were taining Such sequences. Another way is to introduce the cultured overnight. The next day, 1.3 mL was used to isolated gene into a vector already containing the necessary inoculate a sterile 250 mL flask containing 50 mL of control sequences in the proper order by restriction endo production medium with appropriate antibiotics. The flasks nuclcase digestion and ligation. One example of this latter were incubated at 37°C. with shaking for 5 hours and then approach is the BioBrickTM technology (www.biobricks.org) shifted to 28°C. for 48 hours with shaking. Methanol was US 2017/00 16035 A1 Jan. 19, 2017 22 added to a final concentration of 1% into each flask after 24 titers are performed as outlined in Example 1. Control strain hours of the 28°C. incubation period. 1 is expected to be unable to produce P3HP, whereas strain 0106 Thereafter, cultures from the flasks were analyzed 3 is anticipated to produce P3HP owing to the engineered for P3HP polymer content. At the end of the experiment, 1.5 pathway genes. mL of each culture broth was spun down at 12,000 rpm (13.523xg), washed twice with 0.2% NaCl solution, frozen Example 3 at -80° C. for 1 hour, and lyophilized overnight. The next day, a measured amount of lyophilized cell pellet was added to a glass tube, followed by 3 mL ofbutanolysis reagent that Production of P(3HB-Co-3HP) in Methylophilus consisted of a 1:3 volume mixture of 99.9% n-butanol and methylotrophus from Methanol 4.0 M HCl in dioxane with 2 mg/mL diphenylmethane as 0110. This example shows P(3HB-co-3HP) production internal standard. After capping the tubes, they were Vor texed briefly and placed on a heat block set to 93°C. for 24 from methanol as sole carbon Source using either the malo hours with periodic vortexing. Afterwards, the tubes were nyl-CoA reductase or the glycerol dehydratase metabolic cooled down to room temperature before adding 3 mL pathways in engineered M. methylotrophus host cells (FIG. deionized water. The tube was vortexed for approximately 1). The strains used in this example are listed in Table 6. 10s before spinning down at 600 rpm (Sorvall Legend RT Both strains were constructed using the well-known bio benchtop centrifuge) for 2 min. 1 mL of the organic phase technology tools and methods described above. Strain 1 was pipetted into a GC vial, which was then analyzed by gas lacked any of the recombinant genes, whereas strain 4 chromatography-flame ionization detection (GC-FID) (Agi contained different pathway genes enabling production of lent Technologies7890A). The quantity of PHA in the cell P(3HB-co-3HP) copolymer. pellet was determined by comparing against standard curves for 3HP. The 3HP standard curve was generated by adding different amounts of poly-3-hydroxypropionate to separate TABLE 6 butanolysis reactions. Strains used to produce P(3HB-co 0107 The results for the two strains are shown in Table 3HP) from methanol carbon source. 4 and demonstrate that P3HP was produced from methanol as the sole carbon Source. Strains Genes Overexpressed 1 None (control strain) TABLE 4 4 Toos-P1-PhaC3/C1*-T-Pa-mcro-orf7; Pa-pha A5 phaB5 P3HP polymer production from microbial strains. Biomass Titer P3HP Titer 0111. The strains were evaluated in a shake flask assay. Strains (gL) (gL) The production medium was the same as the one listed in 1 O.683 O.OOO Example 1 and culture was performed as outlined in 2 0.767 O.OO8 Example 1 except the flask culture started with 250 mL flask containing 30 mL of production medium and 300 uL of 100% methanol and 600 uL of 50xE0 buffer that consisted Example 2 of 375 g/L KHPO3HO, 185 g/L KHPO, and 181 g/L NaHPO were added into the culture after 24 hours incu Production of P3HP in Methylophilus bation at 28° C. methylotrophus from Methanol Using the Glycerol 0112 Determination of biomass and the contents of 3HB Dehydratase Metabolic Pathway and 3HP in the polymer were performed as outlined in Example 1. The quantity of PHA in the cell pellet was 0108. This example shows P3HP production from metha determined by comparing against Standard curves for 3HB nol as Sole carbon Source using the glycerol dehydratase and 3HP (for P(3HB-co-3HP) analysis). The 3HB standard route in engineered M. methylotrophus host cells (FIG. 1). curve was generated by adding different amounts of 99% The strains used in this example are listed in Table 5. Both ethyl 3-hydroxybutyrate to separate butanolysis reactions. strains are constructed using the well-known biotechnology tools and methods described above. Strain 1 lacks any of the The 3HP standard curve was generated by adding different recombinant genes, whereas strain 3 contains the engineered amounts of poly-3-hydroxybutyrate to separate butanolysis P3HP pathway genes. reactions. 0113. The results for the two strains are shown in Table TABLE 5 7 and demonstrated that P(3HB-co-3HP) copolymer was produced from methanol as the sole carbon Source. Strains used to produce P3HP from methanol carbon source. Strains Genes Overexpressed TABLE 7 1 None (control strain) P(3HB-CO-3HP) copolymer production from microbial Strains. 3 P-dhaE1-dhaE2-dhaE3-gdrA-gdrB-Tal; P PhaC3/C1*-Te; Pt?-orf7-puuC-T1: Pi-pduP Biomass Titer P(3HB-co-HP) Titer 3HB Titer 3HP Titer DAR1-GPP2 Strains (g/L) (gL) (gL) (g/L) 1 4.3O1 O.OOO O.OOO O.OOO 0109 The strains are evaluated in a shake flaskassay. The 2 S.118 O.O24 O.O14 O.O10 production medium is the same as the one listed in Example 1 with the exception that 1 uM vitamin B12 is added to the 0114. Using a methylotrophic microorganism such as e.g. medium. Growth and determination of biomass and P3HP Methylobacterium extorquens AM1, which is known to US 2017/00 16035 A1 Jan. 19, 2017

naturally produce P3HB homopolymer (Korotkova and Lid TABLE 9 strom, J. Bacteriol. 183(3):1038-1046 (2001)), the genetic engineering would not need to include the phaA and phaB Strains used to produce P4HB from methanol carbon source. genes encoding the enzymes that produce the 3HB-CoA precursor molecule for the production of the P(3HB-co Strains Genes Overexpressed 3HP) copolymer. However, unwanted endogenous PHA 1 None (control strain) biosynthesis and degradation genes such as PHA synthases 8 P-phaC3/C1*-SSaR*, P-Orfz, P-SucD* and depolymerases would need to be removed from the host organism. 0118. The strains are evaluated in a shake flaskassay. The production medium, cell growth, and determination of bio Example 4 mass are the same as described in Example 1. Determination of P4HB titers are performed as follows: a measured amount Production of PDO in Methylophilus of lyophilized cell pellet was added to a glass tube, followed methylotrophus from Methanol by 3 mL of butanolysis reagent that consists of an equal volume mixture of 99.9% n-butanol and 4.0 N HCl in 0115 This example shows PDO production from metha dioxane with 2 mg/mL diphenylmethane as internal stan nol as sole carbon Source using either the malonyl-CoA dard. After capping the tubes, they are vortexed briefly and reductase or the glycerol dehydratase metabolic pathways in placed on a heat block set to 93° C. for six hours with engineered M. methylotrophus host cells (FIG. 1). The periodic vortexing. Afterwards, the tube is cooled down to strains used in this example are listed in Table 8. All strains room temperature before adding 3 mL distilled water. The are constructed using the well-known biotechnology tools tube is vortexed for approximately 10 s before spinning and methods described above. Strain 1 lacks any of the down at 620 rpm (Sorvall Legend RT benchtop centrifuge) recombinant genes, whereas strains 6 and 7 contain the for 2 min. 1 mL of the organic phase is pipetted into a GC engineered pathway genes. vial, which is then analyzed by gas chromatography-flame ionization detection (GC-FID) (Hewlett-Packard 5890 TABLE 8 Series II). The quantity of PHA in the cell pellet is deter mined by comparing against a standard curve for 4HB (for Strains used to produce PDO from methanol carbon source. P4HB analysis). The 4HB standard curve is generated by Strains Genes Overexpressed adding different amounts of a 10% solution of Y-butyrolac tone (GBL) in butanol to separate butanolysis reactions. 1 None (control strain) 0119 Control strain 1 is expected to be unable to produce 7 P-dhaE1-dhaE2-dhaE3-gdrA-gdrB-Ta: PyghD P4HB, whereas strain 8 is anticipated to produce P4HB Tel: Pi-DAR1-GPP2 owing to the engineered pathway genes.

0116. The strains are evaluated in a shake flaskassay. The Example 6 production medium is the same as the one listed in Example 1 with the exception that 30 uMvitamin B12 is added to the Production of P(3HB-Co-4HB) in Methylophilus medium for strain 7. Growth is performed as outlined in methylotrophus from Methanol Example 1. The concentration of PDO is measured by GC/MS. Analyses are performed using standard techniques I0120) This example shows P(3HB-co-4HB) production and materials available to one of skill in the art of GC/MS. from methanol as sole carbon source in engineered M. One Suitable method utilized a Hewlett Packard 5890 Series methylotrophus host cells (FIG. 2). The strains used in this II gas chromatograph coupled to a Hewlett Packard 5971 example are listed in Table 10. All strains are constructed Series mass selective detector (EI) and a HP-INNOWax using the well-known biotechnology tools and methods column (30 m length, 0.25 mm i.d., 0.25 micron film described above. Strain 1 lacks any of the recombinant thickness). The retention time and mass spectrum of PDO genes, whereas strains 9 and 10 contain the engineered generated were compared to that of authentic PDO (m/e: 57. pathway genes. 58). Control strain 1 is expected to be unable to produce PDO, whereas strains 6 and 7 are anticipated to produce TABLE 10 PDO owing to the engineered pathway genes. Strains used to produce P(3HB-co 4HB) from methanol carbon source. Example 5 Strains Genes Overexpressed Production of P4HB in Methylophilus 1 None (control strain) P-phaC3/C1*-SSaR*: Pet-orf7, P-SucD*: P methylotrophus from Methanol phaA5-phaB5 10 P-phaC3/C1*; P-pha A5-phaB5: P-crt-abfD 0117 This example shows P4HB production from metha nol as Sole carbon source in engineered M. methylotrophus host cells (FIG. 2). The strains used in this example are listed I0121 The strains are evaluated in a shake flaskassay. The in Table 9. All strains are constructed using the well-known production medium, cell growth, and determination of bio biotechnology tools and methods described above. Strain 1 mass are the same as described in Example 1, whereas lacks any of the recombinant genes, whereas strain 8 con determination of 3HB and 4HB titers are performed as tains the engineered P4HB pathway genes. described in Examples 3 and 5. US 2017/00 16035 A1 Jan. 19, 2017 24

0122 Control strain 1 is expected to be unable to produce TABLE 12 P(3HB-co-4HB), whereas strains 9 and 10 are anticipated to produce P(3HB-co-4HB) owing to the engineered pathway Strains used to produce PSHV from methanol carbon source. genes. Strains Genes Overexpressed 0123. Using a methylotrophic microorganism such as e.g. 1 None (control strain) Methylobacterium extorquens AM1, which is known to 13 P-ssaR*: Pi-phaC3/C1*-orf7; P-davB-daVA-davT naturally produce P3HB homopolymer (Korotkova and Lid strom, J. Bacteriol. 183(3):1038-1046 (2001)), the genetic engineering would not need to include the phaA and phaB I0129. The strains are evaluated in a shake flaskassay. The genes encoding the enzymes that produce the 3HB-CoA production medium, cell growth, and determination of bio precursor molecule for the production of the P(3HB-co mass are as described in Example 1. Determination of P5HV 4HB) copolymer. titers are performed as follows: a measured amount of lyophilized cell pellet is added to a glass tube, followed by 0.124 However, unwanted endogenous PHA biosynthesis 3 mL ofbutanolysis reagent that consists of an equal volume and degradation genes Such as PHA synthases and depoly mixture of 99.9% n-butanol and 4.0 N HCl in dioxane with merases would need to be removed from the host organism. 2 mg/mL diphenylmethane as internal standard. After cap ping the tubes, they are vortexed briefly and placed on a heat Example 7 block set to 93° C. for 6 hours with periodic vortexing. Afterwards, the tubes are cooled down to room temperature before adding 3 mL distilled water. The tubes are vortexed Production of BDO in Methylophilus for approximately 10 s before spinning down at 620 rpm methylotrophus from Methanol (Prophetic (Sorvall Legend RT benchtop centrifuge) for 2 min. 1 mL of Example) the organic phase is pipetted into a GC vial, which is then 0.125. This example shows BDO production from metha analyzed by gas chromatography-flame ionization detection nol as Sole carbon source in engineered M. methylotrophus (GC-FID) (Hewlett-Packard 5890 Series II). The quantity of host cells (FIG. 2). The strains used in this example are listed P(5HV) homopolymer in the cell pellet is determined by in Table 11. All strains are constructed using the well-known comparing against standard curves that are made by adding biotechnology tools and methods described above. Strain 1 defined amounts of delta-Valerolactone (DVL) in separate lacks any of the recombinant genes, whereas strains 11 and butanolysis reactions. 12 contain the engineered pathway genes. 0.130 Control strain 1 is expected to be unable to produce P5HV, whereas strain 13 is anticipated to produce P5HV TABLE 11 owing to the engineered pathway genes. Strains used to produce BDO from methanol carbon Source. Example 9 Strains Genes Qverexpressed 1 None (control strain) Production of P(3HB-Co-5HV) in Methylophilus 11 Pa-SucD*-SSaR*; Pt?-orf7, P-adh-adhl methylotrophus from Methanol (Prophetic 12 P-phaA5-phaB5: P-crt-abfD: P-adh-adhl Example) I0131 This example shows P(3HB-co-5HV) production 0126 The strains are evaluated in a shake flaskassay. The from methanol as sole carbon source in engineered M. production medium and cell growth is the same as described methylotrophus host cells (FIG. 3). The strains used in this in Example 1. BDO in cell culture samples is derivatized by example are listed in Table 13. All strains are constructed silylation and quantitatively analyzed by GC/MS as using the well-known biotechnology tools and methods described by Simonov et al. (J. Anal. Chem. 59:965-971 described above. Strain 1 lacks any of the recombinant (2004)). genes, whereas strain 14 contains the engineered P(3HB 0127 Control strain 1 is expected to be unable to produce co-5HV) pathway genes. BDO, whereas strains 11 and 12 are anticipated to produce BDO Owing to the engineered pathway genes. TABLE 13 Strains used to produce P(3HB-co Example 8 5HV) from methanol carbon source. Strains Genes Overexpressed Production of P5HV in Methylophilus methylotrophus from Methanol 1 None (control strain) 14 P-SSaR*:rps P-phaC3/C1*-orf7;usp4 P -davB-dav A-davT: P-phaA5-phaB5 0128. This example shows P5HV production from methanol as sole carbon Source in engineered M. methyllo trophus host cells (FIG. 3). The strains used in this example 0.132. The strains are evaluated in a shake flaskassay. The are listed in Table 12. All strains are constructed using the production medium, cell growth, and determination of bio well-known biotechnology tools and methods described mass are the same as described in Example 1, whereas above. Strain 1 lacks any of the recombinant genes, whereas determination of 3HB and 5HV titers are performed as strain 13 contains the engineered P5HV pathway genes. described in Examples 3 and 8. US 2017/00 16035 A1 Jan. 19, 2017

0.133 Control strain 1 is expected to be unable to produce TABLE 1.5 P(3HB-co-5HV), whereas strain 14 is anticipated to produce P(3HB-co-5HV) owing to the engineered pathway genes. Strains used to produce P3HP from methanol carbon source. 0134. Using a methylotrophic microorganism such as e.g. Relevant Host Methylobacterium extorquens AM1, which is known to Strains Gene Inactivation Genes Overexpressed naturally produce P3HB homopolymer (Korotkova and Lid 16 phaA, phaB, phaC1, None (control strain) strom, J. Bacteriol. 183(3): 1038-1046 (2001)), the genetic phaC2, depA, depB engineering would not need to include the phaA and phaB 17 pha A. phaB, phaC1, Toog-P1-phaC3/C1*-T trip Pusp A phaC2, depA, depB micro-orf7. genes encoding the enzymes that produce the 3HB-CoA 18 pha A. phaB, phaC1, Pa-dhaE1-dhaE2-dhaE3-gdra-gdrB precursor molecule for the production of the P(3HB-co phaC2, depA, depB Tel: Pi-phaC3/C1*-Te; Ptr 5HV) copolymer. orf7-puuC-T1: Psynal pduP-DAR1 GPP2 0135 However, unwanted endogenous PHA biosynthesis and degradation genes Such as PHA synthases and depoly merases would need to be removed from the host organism. 0140 Methane is used as sole carbon source at pH 7 and 30° C. for cell growth and product accumulation. The composition of the culture medium is as follows (g/L): Example 10 (NH)SO (1.75); MgSO.7HO (0.1); CaCl2.H2O (0.02); KHPO (0.68); Na HPO.12H2O (6.14): FeSO.7H2O (4 Production of 1,5PD in Methylophilus g/50 cc) and trace elements (mg/L) made of MnSO'7HO methylotrophus from Methanol (5); ZnSO.7TO (1.5); Na MoO2Hf,O (0.04); CuSO. 5HO (0.04); CoC1.6HO (0.6) and HBO, (0.2). For strain 0136. This example shows 1.5PD production from 18, 30 uMvitamin B12 is added to the medium. Cell growth methanol as sole carbon Source in engineered M. methyllo and inoculum preparation for the bubble column reactor is as trophus host cells (FIG. 3). The strains used in this example described previously by Rahnama et al. (Biochem. Engin. J. are listed in Table 14. All strains are constructed using the 65; 51-56 (2012)). Briefly, plates are gassed with a natural well-known biotechnology tools and methods described gas/air mixture (1:1, V/v) in a sealed desiccator. The gas above. Strain 1 lacks any of the recombinant genes, whereas phase is refilled every 12 h with the same gas mixture. The strain 15 contains the engineered 1.5PD pathway genes. cultivation of cells is carried out at 30°C. for about 18 days. After this stage, one loop of the germinated colonies is TABLE 1.4 cultivated in the mineral medium containing 1% (v/v) methanol in a shake flask. The cultivation in shake flasks is Strains used to produce 1.5-PD from methanol carbon source. incubated at 30° C. and 200 rpm for 72 h to prepare the Strains Genes Overexpressed required inocula for a bubble bioreactor. P3HP production occurs in a 1 L bubble column bioreactor. 1 None (control strain) 0141 Natural gas and air streams are introduced through 15 P-ssaR*: P-pduP-dhaT-orf7; P-davB-daVA-davT separate lines, mixed at the bottom of the reactor, and fed into the column by a sparger. To prevent evaporation, a condenser is installed at the top of the column. For all 0.137 The strains are evaluated in a shake flaskassay. The experiments, reactor temperature and pH are adjusted at 30° production medium and cell growth is the same as described C. and 7.0, respectively, by a heat controllable water bath in Example 1.1.5PD in cell culture samples is quantitatively and 1.0 N HCl/NaOH solution. 20 mL of the Shake-flask analyzed by GC/MS as described by Farmer et al. (US culture is inoculated into 180 mL of the fresh medium and Patent Pub. 2010/01684.81). incubated at 30° C. under continuous aeration of a natural 0138 Control strain 1 is expected to be unable to produce gas/air mixture in a bubble-column bioreactor. All cultiva 1.5-PD, whereas strain 15 is anticipated to produce 1.5-PD tions are performed in two stages as follows. Cells are grown owing to the engineered pathway genes. in liquid medium under a natural gas/air mixture in the bubble column bioreactor at 30°C. In the second stage, cells Example 11 are harvested by centrifugation at 5000 rpm for 20 min and the pellets are resuspended in the medium with nitrogen deficiency. Production of P3HP in Methylocystis hirsuta from 0142. Determination of biomass and P3HP titers are Methane performed as outlined in Example 1. Control strain 16 is expected to be unable to produce P3HP, whereas strains 17 0.139. This example shows P3HP production from meth and 18 are anticipated to produce P3HP owing to the ane as sole carbon source using the malonyl-CoA reductase engineered pathway genes. or the glycerol dehydratase routes in engineered Methyllo cystis hirsuta host cells (FIG. 1). The strains used in this Example 12 example are listed in Table 15. All strains are constructed using the well-known biotechnology tools and methods described above. All strains have the endogenous PHB Production of P(3HB-Co-3HP) in Methylocystis biosynthesis (phaA, phaB, phaCl and phaC2) and depoly hirsuta from Methane merase genes (depA and depB) inactivated. Strain 16 lacks 0143. This example shows P(3HB-co-3HP) production any of the recombinant genes, whereas strains 17 and 18 from methane as Sole carbon Source using the malonyl-CoA contain the engineered pathway genes. reductase or the glycerol dehydratase routes in engineered US 2017/00 16035 A1 Jan. 19, 2017 26

Methylocystis hirsuta host cells (FIG. 1). The strains used in 30 uM vitamin B12. The concentration of PDO is measured this example are listed in Table 16. All strains are con by GC/MS as described in Example 4. Control strain 16 is structed using the well-known biotechnology tools and expected to be unable to produce PDO, whereas strains 22 methods described above. All strains have the endogenous and 23 are anticipated to produce PDO owing to the engi PHA synthase (phaC1 and phaC2) and depolymerase genes neered pathway genes. (depA and depB) inactivated, but retain the phaA and phaB genes for copolymer production. Strain 19 lacks all of the Example 14 recombinant genes, whereas strains 20 and 21 contain the engineered pathway genes. Production of P4HB in Methylocystis hirsuta from Methane TABLE 16 0147 This example shows P4HB production from meth Strains used to produce P(3HB-co ane as sole carbon Source in engineered Methylocystis 3HP) from methanol carbon source. hirsuta host cells (FIG. 2). The strains used in this example Relevant Host are listed in Table 18. All strains are constructed using the Strains Gene Inactivation Genes Overexpressed well-known biotechnology tools and methods described 19 phaC1, phaC2, None (control strain) above. All strains have the endogenous PHB biosynthesis depA, depB (phaA, phaB, phaCl and phaC2) and depolymerase genes 20 phaC1, phaC2, Toos-P1-phaG3/C1'-T-P,4-merc (depA and depB) inactivated. Strain 16 lacks all of the depA, depB orf7 recombinant genes, whereas strain 24 contains the engi neered pathway genes.

TABLE 1.8 0144. The strains are grown and evaluated as described in Strains used to produce P4HB from methanol carbon Source. Example 11. The growth medium of Strain 21 also contains Relevant Host 30 uM vitamin B12. The determination of 3HB and 3HP Strains Gene Inactivation Genes Overexpressed titers of the P(3HB-co-3HP) copolymer are performed as 16 phaA, phaB, phaC1, None (control strain) described in Examples 3 and 1. Control strain 19 is expected phaC2, depA, depB to be unable to produce P(3HB-co-3HP), whereas strains 20 24 phaA, phaB, phaC1, P-phaC3/C1*-ssaR*, P-Orfz. and 21 are anticipated to produce P(3HB-co-3HP) owing to phaC2, depA, depB P-SucD* the engineered pathway genes. Example 13 0.148. The strains are grown and evaluated as described in Example 11. Determination of P4HB titers are as described in Example 5. Control strain 16 is expected to be unable to Production of PDO in Methylocystis hirsuta from produce P4HB, whereas strain 24 is anticipated to produce Methane P4HB owing to the engineered pathway genes. 0145 This example shows PDO production from meth ane as sole carbon source using the malonyl-CoA reductase Example 15 or the glycerol dehydratase routes in engineered Methyllo cystis hirsuta host cells (FIG. 1). The strains used in this Production of P(3HB-Co-4HB) in Methylocystis example are listed in Table 17. All strains are constructed hirsuta from Methane using the well-known biotechnology tools and methods described above. All strains have the endogenous PHB 0149. This example shows P(3HB-co-4HB) production biosynthesis (phaA, phaB, phaCl and phaC2) and depoly from methane as sole carbon Source in engineered Methyllo merase genes (depA and depB) inactivated. Strain 16 lacks cystis hirsuta host cells (FIG. 2). The strains used in this all of the recombinant genes, whereas strains 22 and 23 example are listed in Table 19, All strains are constructed contain the engineered pathway genes. using the well-known biotechnology tools and methods described above. All strains have the endogenous PHA TABLE 17 synthase (phaCl and phaC2) and depolymerase genes (depA and depB) inactivated, but retain the phaA and phaB genes Strains used to produce PDO from methanol carbon source. for copolymer production. Strain 19 lacks all of the recom Relevant Host binant genes, whereas strains 25 and 26 contain the engi Strains Gene Inactivation Genes Overexpressed neered pathway genes. 16 phaA, phaB, phaC1, None (control strain) phaC2, depA, depB TABLE 19 22 phaA, phaB, phaC1, Toos-P1-yqhD-T-Pa-merc phaC2, depA, depB puuC Strains used to produce P(3HB-co 23 phaA, phaB, phaC1, P-dhaE1-dhaE2-dhaE3-gdrA-gdrB 4HB) from methanol carbon source. phaC2, depA, depB Tel: PlayghlD-Tel: Pi-DAR1 Relevant Host GPP2 Strains Gene Inactivation Genes Overexpressed 19 phaC1, phaC2, None (control strain) 0146 The strains are grown and evaluated as described in depA, depB Example 11. The growth medium of strain 23 also contains US 2017/00 16035 A1 Jan. 19, 2017 27

TABLE 19-continued (depA and depB) inactivated. Strain 16 lacks all of the recombinant genes, whereas strain 29 contains the engi Strains used to produce P(3HB-co neered P5HV pathway genes. 4HB) from methanol carbon source.

Relevant Host TABLE 21 Strains Gene Inactivation Genes Overexpressed Strains used to produce PSHV from methanol carbon Source. 25 phaC1, phaC2, P-phaC3/C1*-ssaR*, P-Orfz. depA, depB P-SucD Relevant Host 26 phaC1, phaC2, P-phaC3/C1*; Pt-crt-abfD Strains Gene Inactivation Genes Overexpressed depA, depB 16 phaA, phaB, phaC1, None (control strain) phaC2, depA, depB 0150. The strains are grown and evaluated as described in 29 pha A. phaB, phaC1, P-SSaR*: Pi-phaC3/C1*-orf7; phaC2, depA, depB P-davB-daVA-davT Example 11. The determination of 3HB and 4HB titers are oral performed as described in Examples 3 and 5. Control strain 19 is expected to be unable to produce P(3HB-co-4HB), 0154 The strains are grown and evaluated as described in whereas strains 25 and 26 are anticipated to produce P(3HB Example 11. The determination of P5HV titers are per co-4HB) owing to the engineered pathway genes. formed as described in Example 8. Control strain 16 is expected to be unable to produce P5HV, whereas strain 29 Example 16 is anticipated to produce P5HV owing to the engineered pathway genes. Production of BDO in Methylocystis hirsuta from Methane Example 18 0151. This example shows BDO production from meth Production of P(3HB-Co-5HV) in Methylocystis ane as sole carbon Source in engineered Methylocystis Hirsuta from Methane hirsuta host cells (FIG. 2). The strains used in this example are listed in Table 20, All strains are constructed using the (O155 This example shows P(3HB-co-5HV) production well-known biotechnology tools and methods described from methane as sole carbon Source in engineered Methyllo above. All strains have the endogenous PHB biosynthesis cystis hirsuta host cells (FIG. 3). The strains used in this (phaA, phaB, phaCl and phaC2) and depolymerase genes example are listed in Table 22. All strains are constructed (depA and depB) inactivated, Strain 16 lacks all of the using the well-known biotechnology tools and methods recombinant genes, whereas strains 27 and 28 contain the described above. All strains have the endogenous PHA engineered pathway genes. synthase (phaCl and phaC2) and depolymerase genes (depA and depB) inactivated, but retain the phaA and phaB genes TABLE 20 for copolymer production. Strain 19 lacks all of the recom binant genes, whereas strain 30 contains the engineered Strains used to produce BDO from methanol carbon Source. P(3HB-co-5HV) pathway genes. Relevant Host Strains Gene Inactivation Genes Overexpressed TABLE 22 16 phaA, phaB, phaC1, None (control strain) Strains used to produce P(3HB-co phaC2, depA, depB 5HV) from methanol carbon source. 27 pha A. phaB, phaC1, P-SucD*-ssaR*: P-Orfz. phaC2, depA, depB P-adh-adh1 Relevant Host 28 pha A. phaB, phaC1, P-pha A5-phaB5: P-crt-abfD; Strains Gene Inactivation Genes Overexpressed phaC2, depA, depB P-adh-adh1 19 phaC1, phaC2, None (control strain) depA, depB 0152 The strains are grown and evaluated as described in 30 phaC1, phaC2, P-ssaR*: Pi-phaC3/C1*-orf7; Example 11. BDO in cell culture samples is determined as depA, depB Pa-davB-daVA-davT described in Example 7. Control strain 16 is expected to be unable to produce BDO, whereas strains 27 and 28 are 0156 The strains are grown and evaluated as described in anticipated to produce BDO owing to the engineered path Example 11. The determination of 3HB and 5HV titers of the Way genes. P(3HB-co-5HV) copolymer are performed as described in Examples 3 and 8. Control strain 19 is expected to be unable Example 17 to produce P(3HB-co-5HV), whereas strain 30 is anticipated to produce P(3HB-co-5HV) owing to the engineered path Production of P5HV in Methylocystis hirsuta from Way genes. Methane 0153. This example shows P5HV production from meth Example 19 ane as sole carbon Source in engineered Methylocystis Production of 1.5PD in Methylocystis hirsuta from hirsuta host cells (FIG. 3). The strains used in this example Methane are listed in Table 21. All strains are constructed using the well-known biotechnology tools and methods described 0157. This example shows 1.5PD production from meth above. All strains have the endogenous PHB biosynthesis ane as sole carbon Source in engineered Methylocystis (phaA, phaB, phaCl and phaC2) and depolymerase genes hirsuta host cells (FIG. 3). The strains used in this example US 2017/00 16035 A1 Jan. 19, 2017 28 are listed in Table 23. All strains are constructed using the 5 minutes, heat from 120° C. to 240° C. at 10° C./min, then well-known biotechnology tools and methods described hold for 6 min. Total GC run time was 23 minutes. A split above. All strains have the endogenous PHB biosynthesis ratio of 50:1 was used during injection of the pyrolyzate (phaA, phaB, phaCl and phaC2) and depolymerase genes vapor onto the GC column. Peaks appearing in the chro matogram plot were identified by the best probability match (depA and depB) inactivated. Strain 16 lacks all of the to spectra from a NIST mass spectral library. The retention recombinant genes, whereas strain 31 contains the engi time for the acrylic acid (CASif79-10-7) produced from neered 1.5PD pathway genes. pyrolysis of P3HP was 4.10-4.12 minutes. FIG. 4 shows the UC-MS chromatogram of the pyrolyzate obtained from the TABLE 23 heating of the biomass--P3HP, the mass spectrum of the peak at 4.1-4.2 minutes as well as the spectral library match to this Strains used to produce 1.5-PD from methanol carbon source. unknown peak. The library match of the mass spectra of the Relevant Host unknown peak at 4.10 minutes showed that this was 2-pro Strains Gene Inactivation Genes Overexpressed penoic acid or acrylic acid with the mass fragments at 27, 45. 55 and 72 m/z. 16 phaA, phaB, phaC1, None (control strain) phaC2, depA, depB (0162 Gene ID 001 Nucleotide Sequence: Chloroflexus 31 pha A. phaB, phaC1, P-SsaR*: P-pduP-dhaT-orf7; aurantiacus malonyl-CoA reductase (3-hydroxypropionate phaC2, depA, depB P onpa -davB-dav A-davT forming) mcro.

0158. The strains are grown and evaluated as described in SEQ ID NO: 16 Example 11. 1.5PD in cell culture samples is quantitatively ATGTCTGGTACTGGTCGACTGGCAGGTAAAATTGCACTGAT analyzed by GC/MS as described in Example 10. Control strain 16 is expected to be unable to produce 1.5PD, whereas CACTGGCGGTGCTGGCAATATTGGTTCCGAGCTGACCCGCCGTTTCCTGG strain 31 is anticipated to produce 1.5PD owing to the engineered pathway genes. CCGAGGGCGCGACCGTCATCATCTCTGGTCGTAACCGCGCCAAACTGAC Example 20 CGCACTGGCAGAGCGTATGCAAGCAGAGGCTGGTGTGCCGGCTAAGCGT ATTGATCTGGAAGTCATGGACGGTAGCGATCCAGTCGCTGTGCGCGCTG Generation of Acrylic Acid from Pyrolysis of a Genetically Engineered Biomass Utilizing Methanol GTATTGAAGCGATTGTGGCTCGCCATGGTCAGATTGATATTCTGGTTAAC to Produce P3HP AATGCTGGTTCCGCGGGTGCACAGCGTCGCCTGGCCGAAATTCCGCTGA

0159. In this example, biomass containing P3HP gener CCGAGGCCGAACTGGGTCCGGGCGCTGAGGAAACTCTGCACGCGTCCAT ated as described in Example 1 from genetically engineered Methylophilus methylotrophus using methanol as a feed CGCAAATCTGCTGGGTATGGGCTGGCACCTGATGCGCATTGCGGCTCCA stock is pyrolyzed in a GC-MS to produce acrylic acid. 0160 To prepare a biomass--P3HP sample for pyrolysis CACATGCCGGTTGGTTCCGCAGTTATCAACGTTTCCACCATTTTCAGCCG GC-MS, approximately 20 mL of culture broth was spun down at 6000xg, the cell pellet produced was then washed CGCTGAATACTATGGTCGTATTCCGTACGTTACGCCGAAAGCCGCTCTGA twice with 0.2% NaCl solution (the solutions were decanted ACGCGCTGTCCCAGCTGGCGGCACGCGAGCTGGGCGCTCGTGGTATTCG and discarded). The remaining material was frozen at -80° C. for one hour and finally lyophilized over several days to TGTCAACACTATCTTCCCGGGTCCGATCGAGTCCGACCGTATCCGTACTG produce a dry biomass--P3HP powder. An Agilent 7890A/ 5975 GC-MS equipped with a Frontier Lab PY-2020iD TCTTTCAACGCATGGACCAGCTGAAAGGTCGCCCTGAGGGCGACACCGC pyrolyzer was used to analyze the dried biomass--P3HP (the P3HP was 0.6% by weight). For this technique, a sample is TCATCACTTCCTGAACACCATGCGTCTGTGCCGTGCGAACGATCAGGGCG weighed into a steel cup and loaded into a pyrolyzer CTCTGGAACGTCGCTTCCCGTCCGTGGGTGATGTGGCGGACGCGGCTGTG autosampler. When the pyrolyzer and GC-MS are started for a run, the steel cup is automatically dropped into the TTCCTGGCGTCTGCCGAATCTGCGGCACTGTCTGGTGAGACTATTGAAGT pyrolyzer which is set to a specific temperature. The sample is then held in the pyrolyzer for a short period of time while GACTCACGGCATGGAGCTGCCGGCGTGCTCTGAGACTAGCCTGCTGGCT volatiles are released by the sample. The volatiles are then CGTACGGATCTGCGCACCATCGACGCTAGCGGTCGCACCACCCTGATCT swept using helium gas into the GC column where they condensed onto the column maintained at a temperature of GTGCGGGCGACCAGATTGAAGAAGTGATGGCGCTGACCGGTATGCTGCG 120° C. Once the pyrolysis is complete, the GC column is heated at a certain rate in order to elute the volatiles released TACCTGCGGCTCTGAAGTTATTATCGGCTTCCGCTCCGCAGCAGCGCTGG from the sample. The volatile compounds are then swept using helium gas into an electro ionization/mass spectral CCCAGTTTGAACAGGCGGTCAACGAAAGCCGTCGTCTGGCAGGTGCTGA detector (mass range 10-700 daltons) for identification and TTTTACTCCACCAATCGCCCTGCCGCTGGACCCGCGTGATCCGGCAACTA quantitation. (0161 For GC-MS analysis of the dried biomass+P3HP. TCGATGCTGTGTTTGACTGGGGCGCAGGTGAAAACACCGGCGGCATCCA 1.76 mg of dry biomass was weighed into the steel pyrolyzer cup using a microbalance. The cup was then loaded into the CGCTGCTGTTATCCTGCCGGCAACCTCTCATGAGCCAGCCCCTTGTGTGA pyrolyzer autosampler and the pyrolyzer programmed to heat to a temperature of 225° C. for a duration of 0.2 TCGAGGTTGATGACGAGCGTGTTCTGAACTTCCTGGCTGACGAGATTACC minutes. The GC column utilized for separation of the GGCACGATCGTTATCGCGTCTCGTCTGGCTCGCTACTGGCAGTCTCAGCG pyrolyzate components was a Hewlett-Packard HP-INNO wax column (length 30 m, ID 0.251 m, film thickness 0.25 CCTGACCCCTGGTGCACGTGCCCGTGGCCCTCGTGTTATCTTTCTGTCCA um). The GC oven was programmed to hold at 120° C. for

US 2017/00 16035 A1 Jan. 19, 2017 30

SEQUENCE LISTING

<16O is NUMBER OF SEO ID NOS : 17

<210s, SEQ ID NO 1 &211s LENGTH: 35 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthesized <4 OOs, SEQUENCE: 1 ttgacagota gct cagtic ct aggtataatg ctago 35

<210s, SEQ ID NO 2 &211s LENGTH: 35 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthesized <4 OOs, SEQUENCE: 2 ttgacagcta gct cagtic ct agg tactgtg ctago 35

<210s, SEQ ID NO 3 &211s LENGTH: 35 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthesized <4 OOs, SEQUENCE: 3 tttacagota gct cagtic ct agg tattatgctago 35

<210s, SEQ ID NO 4 &211s LENGTH: 35 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthesized <4 OOs, SEQUENCE: 4

Ctgacagcta gct cagtic ct aggtataatg ctago 35

<210s, SEQ ID NO 5 &211s LENGTH: 35 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthesized

<4 OOs, SEQUENCE: 5 tttacggcta gct cagtic ct agg tacaatig citagc 35

<210s, SEQ ID NO 6 &211s LENGTH: 35 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthesized

<4 OOs, SEQUENCE: 6 ttgacagcta gct cagtic ct agggactatgctago 35

<210s, SEQ ID NO 7 US 2017/00 16035 A1 Jan. 19, 2017 31

- Continued

&211s LENGTH: 31 &212s. TYPE: DNA <213> ORGANISM: Escherichia coli 22 Os. FEATURE:

<4 OO > SEQUENCE: 7 tcqc cagt ct ggcctgaaca tdatataaaa 31

<210s, SEQ ID NO 8 &211s LENGTH: 178 &212s. TYPE: DNA <213> ORGANISM: Escherichia coli 22 Os. FEATURE:

<4 OOs, SEQUENCE: 8 aaccactato aatatatt ca tdtcgaaaat ttgtttatct aacgagtaag caaggcggat 6 O tgacggat.ca t c cqggtc.gc tataaggtaa ggatggit citt aac actgaat cottacggct 12 O gggittagc cc cc.gcacgta gttcgcagga cgcgggtgac gitalacggcac aagaaacg 178

<210s, SEQ ID NO 9 &211s LENGTH: 170 &212s. TYPE: DNA <213> ORGANISM: Escherichia coli 22 Os. FEATURE:

<4 OOs, SEQUENCE: 9 atgcgggttg atgtaaaact ttgttcgCCC Ctggagaaag CCtcgtgtat actCctic acc 60 cittataaaag tocctittcaa aaaaggcc.gc ggtgctttac aaa.gcagcag caattgcagt 12 O aaaatticcgc accattttga aataagctgg cgttgatgcc agcggcaaac 17 O

<210s, SEQ ID NO 10 &211s LENGTH: 35 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Synthesized

<4 OOs, SEQUENCE: 10 ttgacagcta gct cagtic ct agg tacagtg ctago 35

<210s, SEQ ID NO 11 &211s LENGTH: 35 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Synthesized

<4 OOs, SEQUENCE: 11 ttgacagcta gct cagtic ct agg tacaatg ctago 35

<210s, SEQ ID NO 12 &211s LENGTH: 29 &212s. TYPE: DNA <213> ORGANISM: Escherichia coli 22 Os. FEATURE:

<4 OOs, SEQUENCE: 12 ctaatgagcg ggcttitttitt togaacaaaa 29

<210s, SEQ ID NO 13

US 2017/00 16035 A1 Jan. 19, 2017 34

- Continued ccagagacta cc.gcaact to taccactgaa caatt cqctic toggcaaactt cattaaaact 342O acgctgcacg Ctttcaccgc gaccatcggc gttgagt ccg aacgtacggc gcagcgitatic 3480

Ctgat caatc aggtggat.ct gacticgt.cgt gcgc.gc.gc.cg aagaaccgcg cgatcc.gcac 354 O gaacgc.ca.gc aggaactgga gcgct tcatt galagcagtcc tectggt cac togcct Ctg 36OO ccaccggaag C9gacacgcg ctatgc.cggit cqcatcCatc gcggc.cgtgc cat cactgtc. 366 O tga 3 663

<210s, SEQ ID NO 17 &211s LENGTH: 12O2 212. TYPE: PRT <213> ORGANISM: Chloroflexus aurantiacus

<4 OOs, SEQUENCE: 17 Met Ser Gly Thr Gly Arg Lieu Ala Gly Lys Ile Ala Lieu. Ile Thr Gly 1. 5 1O 15 Gly Ala Gly Asn. Ile Gly Ser Glu Lieu. Thir Arg Arg Phe Lieu Ala Glu 2O 25 3O Gly Ala Thr Val Ile Ile Ser Gly Arg Asn Arg Ala Lys Lieu. Thir Ala 35 4 O 45 Glu Arg Met Glin Ala Glu Ala Gly Val Pro Ala Lys Arg Ile Asp Lieu. SO 55 6 O Glu Val Met Asp Gly Ser Asp Pro Val Ala Val Arg Ala Gly Ile Glu 65 70 75 8O Ala Ile Val Ala Arg His Gly Glin Ile Asp Ile Lieu Val Asn. Asn Ala 85 90 95 Gly Ser Ala Gly Ala Glin Arg Arg Lieu Ala Glu Ile Pro Lieu. Thr Glu 1OO 105 11 O Ala Glu Lieu. Gly Pro Gly Ala Glu Glu Thir Lieu. His Ala Ser Ile Ala 115 12 O 125 Asn Lieu. Lieu. Gly Met Gly Trp His Lieu Met Arg Ile Ala Ala Pro His 13 O 135 14 O Met Pro Val Gly Ser Ala Val Ile Asin Val Ser Thr Ile Phe Ser Arg 145 150 155 160 Ala Glu Tyr Tyr Gly Arg Ile Pro Tyr Val Thr Pro Lys Ala Ala Leu 1.65 17O 17s Asn Ala Lieu. Ser Glin Lieu Ala Ala Arg Glu Lieu. Gly Arg Ile Arg Val 18O 185 19 O Asn Thr Ile Phe Pro Gly Pro Ile Glu Ser Asp Arg Ile Arg Thr Val 195 2OO 2O5 Phe Glin Arg Met Asp Glin Lieu Lys Gly Arg Pro Glu Gly Asp Thir Ala 21 O 215 22O His His Phe Lieu. Asn. Thir Met Arg Lieu. Cys Arg Ala Asn Asp Glin Gly 225 23 O 235 24 O

Ala Lieu. Glu Arg Arg Phe Pro Ser Val Gly Asp Wall Ala Asp Ala Ala 245 250 255

Val Phe Lieu Ala Ser Ala Glu Ser Ala Ala Lieu. Ser Gly Glu Thir Ile 26 O 265 27 O

Glu Val Thr His Gly Met Glu Lieu Pro Ala Cys Ser Glu Thir Ser Lieu. 27s 28O 285

Lieu Ala Arg Thir Asp Lieu. Arg Thir Ile Asp Ala Ser Gly Arg Thir Thr 29 O 295 3 OO US 2017/00 16035 A1 Jan. 19, 2017 35

- Continued

Lieu. Ile Cys Ala Gly Asp Glin Ile Glu Glu Val Met Ala Lieu. Thr Gly 3. OS 310 315 32O Met Leu Arg Thr Cys Gly Ser Glu Val Ile Ile Gly Phe Arg Ser Ala 3.25 330 335 Ala Ala Glin Phe Glu Glin Ala Val Asn. Glu Ser Arg Arg Lieu Ala Gly 34 O 345 35. O Ala Asp Phe Thr Pro Pro Ile Ala Lieu Pro Lieu. Asp Pro Arg Asp Pro 355 360 365 Ala Thir Ile Asp Ala Val Phe Asp Trp Gly Ala Gly Glu Asn Thr Gly 37 O 375 38O Gly Ile His Ala Ala Val Ile Lieu Pro Ala Thir Ser His Glu Pro Ala 385 390 395 4 OO Pro Cys Val Ile Glu Val Asp Asp Glu Arg Val Lieu. Asn. Phe Lieu Ala 4 OS 41O 415 Asp Glu Ile Thr Gly. Thir Ile Val Ile Ala Ser Arg Lieu Ala Arg Tyr 42O 425 43 O Trp Glin Ser Glin Arg Lieu. Thr Pro Gly Ala Arg Arg Pro Arg Val Ile 435 44 O 445 Phe Lieu. Ser Asn Gly Ala Asp Glin Asn Gly Asn Val Tyr Gly Arg Ile 450 45.5 460 Glin Ser Ala Ala Ile Gly Glin Lieu. Ile Arg Val Trp Arg His Glu Ala 465 470 47s 48O Glu Lieu. Asp Tyr Glin Arg Ala Ser Ala Ala Gly Asp His Val Lieu Pro 485 490 495 Pro Val Trp Ala Asn Glin Ile Val Arg Phe Ala Asn Arg Ser Lieu. Glu SOO 505 51O Gly Lieu. Glu Phe Ala Cys Ala Trp Thir Ala Glin Lieu. Lieu. His Ser Glin 515 52O 525 Arg His Ile Asn. Glu Ile Thr Lieu. Asn. Ile Pro Ala Asn. Ile Ser Ala 53 O 535 54 O Thir Thr Gly Ala Arg Ser Ala Ser Val Gly Trp Ala Glu Ser Lieu. Ile 5.45 550 555 560 Gly Lieu. His Lieu. Gly Llys Val Ile Thr Gly Gly Ser Ala Gly Ile Gly 565 st O sts Gly Glin Ile Gly Arg Lieu. Lieu Ala Lieu. Ser Gly Ala Arg Val Met Lieu. 58O 585 59 O Ala Ala Arg Asp Arg His Llys Lieu. Glu Gln Met Glin Ala Met Ile Glin 595 6OO 605 Ser G Lieu Ala Glu Val Gly Tyr Thr Asp Val Glu Asp Arg Val His 615 62O Ile Ala Pro Gly Cys Asp Val Ser Ser Glu Ala Glin Lieu Ala Asp Lieu. 625 630 635 64 O

Val Glu Arg Thr Lieu. Ser Ala Phe Gly Thr Val Asp Tyr Lieu. Ile Asn 645 650 655

Asn Ala Gly Ile Ala Gly Val Glu Glu Met Val Ile Asp Met Pro Val 660 665 67 O Glu Gly Trp Arg His Thr Lieu. Phe Ala Asn Lieu. Ile Ser Asn Tyr Ser 675 68O 685

Lieu Met Arg Llys Lieu Ala Pro Lieu Met Lys Lys Glin Gly Ser Gly Tyr 69 O. 695 7 OO US 2017/00 16035 A1 Jan. 19, 2017 36

- Continued Ile Lieu. Asn Val Ser Ser Tyr Phe Gly Gly Glu Lys Asp Ala Ala Ile 7 Os 71O 71s 72O Pro Tyr Pro Asn Arg Ala Asp Tyr Ala Val Ser Lys Ala Gly Glin Arg 72 73 O 73 Ala Met Ala Glu Val Phe Ala Arg Phe Lieu. Gly Pro Glu Ile Glin Ile 740 74. 7 O Asn Ala Ile Ala Pro Gly Pro Val Glu Gly Asp Arg Lieu. Arg Gly Thr 7ss 760 765 Gly Glu Arg Pro Gly Lieu. Phe Ala Arg Arg Ala Arg Lieu. Ile Asn Lys 770 775 78O Arg Lieu. Asn. Glu Lieu. His Ala Ala Lieu. Ile Ala Ala Ala Arg Thr Asp 78s 79 O 79. 8OO Glu Arg Ser Met His Glu Lieu Val Glu Lieu. Lieu Lleu Pro Asn Asp Wall 805 810 815 Ala Ala Lieu. Glu Glin Asn Pro Ala Ala Pro Thr Ala Lieu. Arg Glu Lieu 82O 825 83 O Ala Arg Arg Phe Arg Ser Glu Gly Asp Pro Ala Ala Ser Ser Ser Ser 835 84 O 845 Ala Lieu. Lieu. Asn Arg Ser Ile Ala Ala Lys Lieu. Lieu Ala Arg Lieu. His 850 855 860 Asn Gly Gly Tyr Val Lieu Pro Ala Asp Ile Phe Ala Asn Lieu Pro Asn 865 87O 87s 88O Pro Pro Asp Pro Phe Phe Thr Arg Ala Glin Ile Asp Arg Glu Ala Arg 885 890 895 Llys Val Arg Asp Gly Ile Met Gly Met Lieu. Tyr Lieu. Glin Arg Met Pro 9 OO 905 91 O Thr Glu Phe Asp Wall Ala Met Ala Thr Val Tyr Tyr Lieu Ala Asp Arg 915 92 O 925 Asn Val Ser Gly Glu Thr Phe His Pro Ser Gly Gly Lieu. Arg Tyr Glu 93 O 935 94 O Arg Thr Pro Thr Gly Gly Glu Lieu Phe Gly Leu Pro Ser Pro Glu Arg 945 950 955 96.O Lieu Ala Glu Lieu Val Gly Ser Thr Val Tyr Lieu. Ile Gly Glu. His Lieu. 965 97O 97. Thr Glu. His Lieu. Asn Lieu. Lieu Ala Arg Ala Tyr Lieu. Glu Arg Tyr Gly 98O 985 99 O Ala Arg Glin Val Val Met Ile Val Glu Thr Glu Thr Gly Ala Glu Thr 995 1OOO 1 OOS Met Arg Arg Lieu. Lieu. His Asp His Val Glu Ala Gly Arg Lieu Met Thr 1010 1 O15 1 O2O Ile Val Ala Gly Asp Glin Ile Glu Ala Ala Ile Asp Glin Ala Ile Thr 1025 103 O 1035 104 O

Arg Tyr Gly Arg Pro Gly Pro Val Val Cys Thr Pro Phe Arg Pro Leu 1045 1OSO 105.5

Pro Thr Val Pro Leu Val Gly Arg Lys Asp Ser Asp Trp Ser Thr Val 106 O 1065 1OO

Lieu. Ser Glu Ala Glu Phe Ala Glu Lieu. Cys Glu. His Glin Lieu. Thir His 1075 108O 1085 His Phe Arg Val Ala Arg Lys Ile Ala Lieu. Ser Asp Gly Ala Ser Lieu. 1090 1095 11OO

Ala Lieu Val Thr Pro Glu. Thir Thir Ala Thir Ser Thir Thr Glu Glin Phe US 2017/00 16035 A1 Jan. 19, 2017 37

- Continued

1105 111 O 1115 112O Ala Asn Phe Ile Llys Thr Thr Lieu. His Ala Phe Thr Ala Thr Ile Gly 1125 113 O 1135 Val Glu Ser Thr Ala Glin Arg Ile Lieu. Ile Asn Glin Val Asp Lieu. Thr 114 O 1145 1150 Arg Arg Ala Arg Ala Glu Glu Pro Arg Asp Phe Arg Glin Glin Glu Lieu 1155 1160 1165 Glu Arg Phe Ile Glu Ala Val Lieu. Lieu Val Thr Ala Pro Lieu Pro Pro 1170 1175 118O Glu Ala Asp Thr Arg Tyr Ala Gly Arg Ile His Arg Gly Arg Ala Ile 1185 119 O 11.95 12 OO

Thir Wall

1-111. (canceled) an acetyl-CoA carboxylase subunits from E. coli: a 112. A method of producing a polymer product, the malonyl-CoA reductase (3-hydroxypropionate-form method comprising: ing) from Chloroflexus aurantiacus; malonyl-CoA feeding a genetically engineered methylotroph with a reductase (malonate semialdehyde-forming) from Sul renewable feedstock comprising methane or methanol folobus tokodai Str. 7: malonic semialdehyde reductase as the sole carbon source, the genetically engineered from Sulfolobus tokodai str. 7: CoA transferase from methylotroph producing the polymer product selected Clostridium kluyveri DSM 555, CoA ligase from from a homopolymer or a copolymer of a 4-carbon Pseudomonas putida; and polyhydroxyalkanoate Syn (C4) monomer or a homopolymer or a copolymer of a thase from a fusion protein of Pseudomonas putida and 5-carbon (C5) monomer, Ralstonia eutropha JMP134; wherein the expression wherein the genetically engineered methylotroph is increases the production of poly-3-hydroxybutyrate genetically modified to stably express one or more co-3-hydroxyproprionate copolymer. genes that encode one or more enzymes of the C4 or C5 129. The method of claim 126, wherein the genetically pathway. engineered methylotroph is Methylophilus methylotrophus, 113-115. (canceled) Methylobacterium extorquens with one or more of the 116. The method of claim 112, wherein the renewable following genes deleted: phaCl, phaC2, depA and depB, or feedstock is methanol. Methylocystis hirsute having one or more of the following 117. The method of claim 112, wherein the renewable genes deleted: phaCl, phaC2, depA and depB. feedstock is methane. 130-131. (canceled) 118-125. (canceled) 132. The method of claim 126, wherein the genetically 126. The method of claim 112, wherein the polymer engineered methylotroph is genetically engineered to product is poly-3-hydroxybutyrate-co-3-hydroxyproprion modify the dihydroxyacetone-phosphate metabolic pathway, ate copolymer and the genetically engineered methylotroph and wherein the one or more genes that are stably expressed is genetically engineered to modify a pathway selected from encode one or more enzymes selected from: glycerol-3- a malonyl-CoA reductase metabolic pathway, and a dihy phosphate dehydrogenase (NAD+); glycerol-3-phosphate droxyacetone-phosphate metabolic pathway. dehydrogenase (NADP+); glycerol-3-phosphatase; glycerol 127. The method of claim 126, wherein the genetically dehydratase; glycerol dehydratase reactivating enzyme; engineered methylotroph is genetically engineered to aldehyde dehydrogenase; alcohol dehydrogenase; aldehyde modify the malonyl-CoA reductase metabolic pathway, and reductase, acetyl-CoA acetyltransferase; acetoacetyl-CoA wherein the one or more genes that are stably expressed reductase; CoA-acylating 3-hydroxypropionaldehyde dehy encode one or more enzyme selected from acetyl-CoA drogenase; and polyhydroxyalkanoate synthase, acetyltransferase; acetoacetyl-CoA reductase; acetyl-CoA wherein the expression increases the production of poly carboxylase, malonyl-CoA reductase (3-hydroxypropionate 3-hydroxybutyrate-co-3-hydroxyproprionate copoly forming), malonyl-CoA reductase (malonate semialdehyde C. forming), malonic semialdehyde reductase, CoA transferase, 133. The method of claim 126, wherein the genetically CoA ligase, and polyhydroxyalkanoate synthase, wherein engineered methylotroph is genetically engineered to the expression increases the production of poly-3-hydroxy modify the dihydroxyacetone-phosphate metabolic pathway, butyrate-co-3-hydroxyproprionate copolymer. and wherein the one or more genes that are stably expressed 128. The method of claim 126, wherein the genetically encode one or more enzyme selected from glycerol-3- engineered methylotroph is genetically engineered to phosphate dehydrogenase (NAD+) from Saccharomyces modify the malonyl-CoA reductase metabolic pathway, and cerevisiae S288c.; glycerol-3-phosphate dehydrogenase wherein the one or more genes that are stably expressed (NADP+) from Rickettsia prowazekii (strain Madrid E): encode one or more enzyme selected from: glycerol-3-phosphatase from Saccharomyces cerevisiae acetyl-CoA acetyltransferase from Zoogloea ramigera: S288c: glycerol dehydratase Small, medium and large Sub acetoacetyl-CoA reductase from Zoogloea ramigera: units from Klebsiella pneumonia; glycerol dehydratase reac US 2017/00 16035 A1 Jan. 19, 2017 38 tivating enzyme (Chain A and Chain B) from Klebsiella 153. The method of claim 112, wherein the polymer pneumonia, 3-hydroxy-propionaldehyde dehydrogenase product is poly-5-hydroxyvalerate and the pathway is a (gamma-Glu-gamma-aminobutyraldehyde dehydrogenase, lysine pathway. NAD(P)H-dependent) from E. coli str. K-12 substr. 154. The method of claim 153, wherein the one or more MG 1655; and aldehyde reductase (succinic semialdehyde genes that are stably expressed encode one or more enzymes reductase) from E. coli K-12; acetyl-CoA acetyltransferase selected from lysine 2-monooxygenase, 5-aminopentanami from Zoogloea ramigera; acetoacetyl-CoA reductase from dase; aminopentanoate transaminase; Succinate semialde Zoogloea ramigera; aldehyde dehydrogenase/alcohol dehy hyde reductase; CoA-transferase; Co-A ligase; and drogenase from E. coli str. K-12 substr. MG 1655; CoA polyhroxyalkanoate synthase; wherein the expression acylating 3-hydroxypropionaldehyde dehydrogenase from increases the production of poly-5-hydroxyvalerate. Salmonella enterica Subsp. enterica serovar Tiphimurium 155. The method of claim 154, wherein the genetically Str. LT2; and polyhydroxyalkanoate synthase from a fusion modified methylotroph is Methylophilus methylotrophus, protein of Pseudomonas putida and Ralstonia eutropha Methylocystis hirsute having one or more of the following JMP134, genes deleted: pha A, phaB, phaCl, phaC2, depA and depB. wherein the expression increases the production of poly 156. The method of claim 112, wherein the polymer 3-hydroxybutyrate-co-3-hydroxyproprionate copoly product is poly-3-hydroxybutyrate-co-5-hydroxyvalerate C. and wherein the genetically engineered methylotroph is 134-143. (canceled) genetically engineered to modify a lysine pathway. 157. The method of claim 156, wherein the one or more 144. The method of claim 112, wherein the polymer genes that are stably expressed encode one or more enzymes product is poly-4-hydroxybutyrate and wherein the geneti selected from acetyl-CoA acetyltransferase; acetoacetyl cally engineered methylotroph is genetically engineered to CoA reductase; polyhydroxyalkanoate synthase; lysine modify a Succinate semialdehyde dehydrogenase pathway, 2-monooxygenase, 5-aminopentanamidase; aminopentano and, optionally, an alpha-ketoglutarate decarboxylase path ate transaminase; Succinate semialdehyde reductase; CoA way. transferase; Co-A; and polyhydroxyalkanoate synthase; 145. The method of claim 144, wherein the one or more wherein the expression increases the production of poly-3- genes that are stably expressed encode one or more enzymes hydroxybutyrate-co-5-hydroxyvalerate copolymer. selected from: Succinate semialdehyde dehydrogenase, 158. The method of claim 156, wherein the genetically alpha-ketoglutarate decarboxylase, succinic semialdehyde engineered methylotroph is Methylophilus methylotrophus, reductase, CoA transferase, CoA ligase, butyrate kinase, Methylobacterium extorquens, or Methylocystis hirsute hav phosphotransbutyrylase, 4-hydroxybutyryl-CoA reductase ing one or more of the following genes deleted: phaC1, and 4-hydroxybutyrylaldehyde reductase; wherein the phaC2, depA and depB. expression increases the production of poly-4-hydroxybu 159-193. (canceled) tyrate. 194. The method of claim 148, wherein the one or more 146. The method of claim 144, wherein the genetically genes that are stably expressed encode polyhydroxyalkano engineered methylotroph is Methylophilus methylotrophus ate synthase from a fusion protein of Pseudomonas putida or Methylocystis hirsute having one or more of the following and Ralstonia eutropha JMP134. genes deleted: pha A, phaB, phaCl, phaC2, depA and depB. 195-207. (canceled) 147. The method of claim 112, wherein the polymer 208. The method of claim 157, wherein the one or more product is poly-3-hydroxybutyrate-co-4-hydroxybutyrate genes that are stably expressed encode one or more enzymes and the genetically engineered methylotroph is genetically selected from acetyl-CoA acetyltransferase from Zoogloea engineered to modify a succinate semialdehyde dehydroge ramigera, acetoacetyl-CoA reductase from Zoogloea ramig nase pathway, and, optionally, an alpha-ketoglutarate decar era, and polyhydroxyalkanoate synthase from a fusion pro boxylase pathway or a crotonase pathway. tein of Pseudomonas putida and Ralstonia eutropha JMP134. 148. The method of claim 147, wherein the one or more genes that are stably expressed encode one or more enzymes 209-212. (canceled) selected from: acetyl-CoA acetyltransferase; acetoacetyl 213. The method of claim 112, wherein the method further CoA reductase; succinate semialdehyde dehydrogenase, includes culturing a genetically engineered organism with a alpha-ketoglutarate decarboxylase, Succinic semialdehyde renewable feedstock to produce a biomass. reductase, CoA transferase, CoA ligase, butyrate kinase, 214-219. (canceled) phosphotransbutyrylase, 4-hydroxybutyryl-CoA reductase; 220. The method of claim 112, wherein the genetically 4-hydroxybutyrylaldehyde reductase; acetyl-CoA trans engineered methylotroph is selected from: Methylophilus ferase and acetoacetyl-CoA reductase; crotonase; and poly methylotrophus AS-1; Methylocystis hirsute, Methylophilus hydroxyalkanoate synthase, wherein the expression methylotrophus M12-4, Methylophilus methylotrophus M1, increases the production of poly-3-hydroxybutyrate-co-4- Methylophilus methylotrophus sp. (deposited at NCIMB as hydroxybutyrate. Acc. No. 11809), Methylophilus leisingeri, Methylophilus flavus sp. nov. Methylophilus luteus sp. nov., Methylomonas 149. The method of claim 147, wherein the genetically sp. strain 16a, Methylomonas methanica MCO9, Methyl engineered methylotroph is Methylophilus methylotrophus obacterium extorquens AM1 (formerly known as or Methylobacterium extorquens having one or more of the Pseudomonas AM1), Methylococcus capsulatus Bath, following genes deleted: phaCl, phaC2, depA and depB, or Methylomonas sp. Strain J. Methylomonas aurantiaca, Meth Methylocystis hirsute having one or more of the following ylomonas fodinarum, Methylomonas Scandinavica, Meth genes deleted: phaCl, phaC2, depA and depB. ylomonas rubra, Methylomonas Streptobacterium, Methylo 150-152. (canceled) monas rubrum, Methylomonas rosaceous, Methylobacter US 2017/00 16035 A1 Jan. 19, 2017 39 chroococcum, Methylobacter bovis, Methylobacter capsu Pseudomonas C. Pseudomonas MA, Pseudomonas MS. latus, Methylobacter vinelandii, Methylococcus minimus, Exemplary yeast strains include: Pichia pastoris, Gliocla Methylosinus sporium, Methylocystis parvus, Methylocystis dium deliquescens, Paecilomyces varioti, Trichoderma hirsute, Methylobacterium organophilum, Methylobacte lignorum, Hansenula polymorpha DL-1 (ATCC 26012). rium rhodesianum, Methylobacterium R6, Methylobacte Hansenula polymorpha (CBS 4732), Hansenula capsulata rium aminovorans, Methylobacterium chloromethanicum, Methylobacterium dichloromethanicum, Methylobacterium (CBS 1993), Hansenula lycozyma (CBS 5766), Hansenula fiujisawaense, Methylobacterium mesophilicum, Methyl henricii (CBS 5765), Hansenula minuta (CBS 1708), Han obacterium radiotolerans, Methylobacterium rhodinum, senula nonfermentans (CBS 5764), Hansenula philodenda Methylobacterium thiocyanatum, Methylobacterium zat (CBS), Hansenula wickerhamii (CBS 4307), Hansenula manii, Methylomonas methanica, Methylomonas albus, ofuaensis, Candida boidinii (ATCC 32195), Candida boi Methylomonas agile, Methylomonas P11, Methylobacillus dinii (CBS 2428, 2429), Candida boidinii KM-2, Candida glycogenes, Methylosinus trichosporium, Hyphomicrobium boidinii NRRL Y-2332, Candida boidinii S-1, Candida methylovorum, Hyphomicrobium zavarzini, Bacillus metha boidinii S-2, Candida boidinii 25-A, Candida alcamigas, nolicus, Bacillus cereus M-33-1, Streptomyces 239, Myco Candida methanolica, Candida parapsilosis, Candida utilis bacterium vaccae, Diplococcus PAR, Protaminobacter (ATCC 26387), Candida sp. N-16 and N-17, Kloeckera sp. ruber, Rhodopseudomonas acidophila, Arthrobacter rufe 2201, Kloeckera sp. A2, Pichia pinus (CBS 5098), Pichia scens, Arthrobacter 1A1 and 1A2, Arthrobacter 2B2. pinus (CBS 744), Pichia pinus NRRL YB-4025, Pichia Arthrobacter globiformis SK-200, Klebsiella 101, haplophila (CBS 2028), Pichia pastoris (CBS 704), Pichia Pseudomonas 135, Pseudomonas oleovorans, Pseudomonas pastoris (IFP206), Pichia trehalophila (CBS 5361), Pichia rosea (NCIB 10597 to 10612), Pseudomonas extorquens lidnerii, Pichia methanolica, Pichia methanothermo, Pichia (NCIB 9399), Pseudomonas PRL-W4, Pseudomonas AM1 sp. NRRL-Y-11328, Saccharomyces H-1, Torulopsis pinus (NCIB 9133), Pseudomonas AM2, Pseudomonas M27. (CBS 970), Torulopsis initatophila (CBS 2027), Torulopsis Pseudomonas PP, Pseudomonas 3A2, Pseudomonas RJ1. nemodendra (CBS 6280), Torulopsis molishiana, Torulopsis Pseudomonas TP1, Pseudomonas sp. 1 and 135, Pseudomo methanolovescens, Torulopsis glabrata, Torulopsis enoki, nas sp. YR, JB1 and PCTN, Pseudomonas methylica sp. 2 Torulopsis methanophiles, Torulopsis methanos Orbosa, and 15. Pseudomonas 2941, Pseudomonas AT2, Pseudomo Torulopsis methanodomercquii, Torulopsis nagovaensis, nas 80, Pseudomonas aminovorans, Pseudomonas sp. 1A3, Torulopsis sp. A1, Rhodotorula sp., Rhodotorula glutinis 1B1, 7B1 and 8B1, Pseudomonas S25, Pseudomonas (meth (strain cy), and Sporobolomyces roseus (strain y). vlica) 20, Pseudomonas W1, Pseudomonas W6 (MB53),