A New Norwegian Lemming Subspecies from Novaya Zemlya, Arctic Russia

Home , Fennoscandia, Juliomys, Wrangel Island lemming, Yana (river)

Ecologica Montenegrina 40: 93-117 (2021) This journal is available online at: www.biotaxa.org/em http://dx.doi.org/10.37828/em.2021.40.8

https://zoobank.org/urn:lsid:zoobank.org:pub:102DFA47-5952-437B-A41E-F1D2D82A1B80

A new Norwegian Lemming subspecies from Novaya Zemlya, Arctic Russia

VITALY M. SPITSYN1,*, IVAN N. BOLOTOV1, ALEXANDER V. KONDAKOV1, ANNA L. KLASS1, IVAN A. MIZIN2, ALENA A. TOMILOVA1, NATALIA A. ZUBRII1 & MIKHAIL Y. GOFAROV1

1N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences, Northern Dvina Emb. 23, 163000 Arkhangelsk, Russia 2Russian Arctic National Park, Northern Dvina Emb. 36, 163051 Arkhangelsk, Russia *Corresponding author: [email protected]

Received 25 January 2021 │ Accepted by V. Pešić: 16 March 2021 │ Published online 17 March 2021.

Abstract Norwegian Lemming Lemmus lemmus is a remarkable population cycling species having a number of aposematic traits in coloration and behavior. This species was thought to be the only mammal endemic to Fennoscandia. Here, we report on the discovery of a distinct lineage of this species from Novaya Zemlya. This lineage is described here as the new subspecies Lemmus lemmus chernovi ssp. nov. that morphologically differs from the nominate subspecies by having a cryptic coloration. Our time-calibrated phylogeny revealed that this insular subspecies was isolated there since the Eemian interglacial (mean age 93 Ka). Hence, bright coloration and antipredator behavior of the nominate subspecies are novel aposematic traits that evolved since its isolation in a European refugium. This new discovery indicates that Novaya Zemlya supported a cryptic polar refugium for cold-adapted terrestrial fauna during the Pleistocene. Finally, our findings highlight that allopatric ranges of the true lemmings (Lemmus) reflect stepwise range expansions in cold climatic episodes with subsequent isolation in refugia during interglacial events.

Key words: Arctic Ocean islands, cryptic polar refugium, Eemian interglacial, integrative taxonomy, Lemmus lemmus, Lemmini, phylogeography, Pleistocene glaciations.

Introduction

Norwegian Lemming Lemmus lemmus (Linnaeus, 1758) is an iconic population cycling species, the density of which explosively increases every 3-5 years, with subsequent mass movements mystifying people at least since the Middle Ages (Kausrud et al. 2008; Lagerholm et al. 2017; Le Vaillant et al. 2018). The range of Norwegian Lemming covers Norway, eastern Sweden, northern Finland, and the Kola Peninsula in Russia (Abramson & Petrova 2018), and this species was thought to be one of a few animals endemic to Fennoscandia (Lagerholm et al. 2014, 2017). Norwegian Lemming shares a remarkable suit of aposematic

Ecologica Montenegrina, 40, 2021, 93-117

A NEW NORWEGIAN LEMMING SUBSPECIES FROM NOVAYA ZEMLYA traits that includes contrasting coloration with black, yellow and white colors, antipredator calls, and threat postures (Andersson 2015). It was thought that two lemming species occur on Novaya Zemlya: Siberian Lemming Lemmus sibiricus (Kerr, 1792) and Arctic Collared Lemming Dicrostonyx torquatus (Pallas, 1778) (Wilson et al. 2017; Wilson & Reeder 2005). Conversely, we found that the Lemmus population from Novaya Zemlya is phylogenetically distant from the Siberian Lemming, and is more closely related to the Norwegian Lemming. This remarkable population is isolated on the Southern Island of Novaya Zemlya, a large mountainous land with the maximum altitude of 1291 m. The Southern Island is separated from the Vaigach Island by the Kara Strait, a 56 km wide marine channel. Palynological data suggests that the Southern Island was free of large glacial shields during the entire Pleistocene epoch (Serebryanny & Malyasova 1998), and this hypothesis was supported by a growing body of phylogeographic research (Potapov et al. 2018). The archipelago was a closed nuclear test site for a half of century, and the current knowledge of its fauna is far from being complete (Coulson et al. 2014). This paper aims to (1) report on the first record of a Norwegian Lemming lineage outside Fennoscandia; (2) describe this lineage as a new insular subspecies; and (3) discuss the origin, and biogeographic patterns of the Norwegian Lemming subspecies in a broader taxonomic, phylogenetic and evolutionary context.

Materials and methods

Data sampling New samples of Lemmus specimens were obtained from the following areas: Southern Island, Novaya Zemlya (n = 23; type series of L. lemmus chernovi ssp. nov.), Kola Peninsula (n = 7 [RMBH Lem035 – Lem041]; L. lemmus lemmus), and Taymyr Peninsula (n = 1; L. sibiricus). The samples were collected using series of mouse traps that were checked daily. The coordinates of localities are presented in Table 1. All applicable international, national, and/or institutional guidelines for the care and use of animals were followed. The sampling procedures were approved by the Ethics Committee on Animal Research of the Institute of Ecological Problems of the North of Ural Branch of the Russian Academy of Sciences, Arkhangelsk, Russia (order no. 001-05/15 of May 10, 2015).

Specimen preparation and morphometric study The body length and weight of lemmings were measured using freshly dead specimens obtained from killing mouse traps. The body length was measured using a tapeline (±1 mm). A tissue snip was taken from each specimen and was preserved in 96% ethanol for subsequent molecular analyses. Skin samples were obtained from 9 specimens of Lemmus lemmus chernovi ssp. nov., 7 specimens of L. l. lemmus, and 1 specimen of L. sibiricus, while their heads and 14 whole specimens of L. lemmus chernovi ssp. nov. were fixed in 96% ethanol. Heads were processed in 8% potassium hydroxide (KOH) for 2 hours and skulls were bleached in 3% hydrogen peroxide solution. Craniodental measurements were taken to the nearest 0.01 mm using a digital caliper (Christoff et al. 2016).

Laboratory protocols and sequence alignment This study includes new molecular data for 12 specimens of Lemmus species (Table 1). Total DNA was extracted from ethanol-preserved soft tissue snips using the NucleoSpin® Tissue Kit (Macherey-Nagel GmbH & Co. KG, Germany). For molecular analyses we obtained partial sequences of two mtDNA markers as follows: the cytochrome c oxidase subunit I (COI) and the cytochrome b (cytb) gene fragments. Additionally, we sequenced two nuclear markers as follows: the growth hormone receptor (GHR) and the recombination activating protein 1 (RAG1) gene fragments. The PCR mix was as follows: total cell DNA (200 ng), each primer (10 pmol), each dNTP (200 μmol), PCR buffer with 20 mmol MgCl2 (2.5 μl), Taq DNA polymerase (SibEnzyme Ltd., Russia) (0.8 units), and H2O (up to 25 μl of the total volume). Primer sequences and thermocycling settings for PCR are shown in Table 2. Forward and reverse sequence reactions were generated on purified PCR products using ABI PRISM® BigDye™ Terminator v. 3.1 reagents kit and run on an ABI PRISM® 3730 DNA analyzer (Thermo Fisher Scientific Inc., Waltham, MA, USA). The sequences were checked with BioEdit v. 7.2.5 (Hall 1999). Altogether 69 additional cytb sequences were obtained from NCBI GenBank, and one sequence was digitized from a published paper (Lopatin et al. 2019)

SPITSYN ET AL.

(Table 3). The alignment of the cytb, COI, GHR and RAG1 sequence data sets was performed directly using the ClustalW algorithm of MEGA7 (Kumar et al. 2016).

Table 1. List of new molecular sequences of Lemmus taxa obtained in this study. Materials are deposited in the Russian Museum of Biodiversity Hotspots (RMBH), N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences (Arkhangelsk, Russia).

NCBI's GenBank acc. no. Specimen Taxon Locality Latitude Longitude Cytb COI GHR RAG1 Voucher L. lemmus MK895056 N/A N/A N/A Lem005 Russia: Novaya 72.3822 52.7506 chernovi ssp. Zemlya, Malye nov. Karmakuly L. lemmus MK895057 MK895068 MK895075 MK895082 Lem008 Russia: Novaya 72.3933 52.7567 chernovi ssp. Zemlya, Malye nov. Karmakuly L. lemmus MK895058 MK895069 MK895076 MK895083 Lem020 Russia: Novaya 72.4058 52.8286 chernovi ssp. Zemlya, Malye nov. Karmakuly L. lemmus MK895059 MK895070 MK895077 MK895084 Lem029 Russia: Novaya 72.8500 52.6500 chernovi ssp. Zemlya, nov. Bezymyannaya Bay L. lemmus MK895061 MK895072 MK895079 MK895086 Lem035 Russia: Kola 67.6633 33.7064 lemmus Peninsula, Khibiny Mts. L. lemmus MK895062 MK895073 MK895080 MK895087 Lem036 Russia: Kola 67.6633 33.7064 lemmus Peninsula, Khibiny Mts. L. lemmus MK895063 N/A N/A N/A Lem037 Russia: Kola 67.6633 33.7064 lemmus Peninsula, Khibiny Mts. L. lemmus MK895064 MK895074 MK895081 MK895088 Lem038 Russia: Kola 67.6633 33.7064 lemmus Peninsula, Khibiny Mts. L. lemmus MK895065 N/A N/A N/A Lem039 Russia: Kola 67.6633 33.7064 lemmus Peninsula, Khibiny Mts. L. lemmus MK895066 N/A N/A N/A Lem040 Russia: Kola 67.6633 33.7064 lemmus Peninsula, Khibiny Mts. L. lemmus MK895067 N/A N/A N/A Lem041 Russia: Kola 67.6633 33.7064 lemmus Peninsula, Khibiny Mts. L. sibiricus MK895060 MK895071 MK895078 MK895085 Lem034 Russia: Taymyr 69.4533 88.6697 Peninsula

Phylogenetic and phylogeographic analyses For phylogenetic calculations, we used the cytb data set with 67 unique haplotype sequences of 834 bp long, including four haplotypes of outgroup taxa, i.e. Dicrostonyx torquatus (Pallas, 1778), D. hudsonius (Pallas, 1778), Synaptomys cooperi (Baird, 1857), and Myopus schisticolor (Lilljeborg, 1844) (Tables 1 and 3). The GTR+G+I evolutionary model was applied based on the corrected Akaike Information Criterion (AICc) of MEGA7 (Kumar et al. 2016). The maximum likelihood phylogenetic analyses were computed with W-IQ- TREE (Nguyen et al. 2015) through an online web server (http://iqtree.cibiv.univie.ac.at) (Trifinopoulos et al. 2016). Node support values were calculated using an ultrafast bootstrapping algorithm implemented in the web server (Hoang et al. 2017). Bayesian inference analyses were performed in MrBayes v. 3.2.6 (Ronquist et al. 2012) at the San Diego Supercomputer Center through the CIPRES Science Gateway (Miller et al. 2010). Two runs, each with three heated (temperature = 0.1) and one cold Markov chain, were conducted for 30 million generations. Trees were sampled every 1000th generation. After completion of the MCMC analysis, the first 15% of trees were discarded as burn-in, and the majority rule consensus tree was calculated from the remaining trees. Convergence of the MCMC chains was checked visually based on the plotted posterior estimates using an MCMC trace analysis tool (Tracer v. 1.7) (Rambaut et al. 2018). For

Ecologica Montenegrina, 40, 2021, 93-117 95

A NEW NORWEGIAN LEMMING SUBSPECIES FROM NOVAYA ZEMLYA phylogeographic analyses, we used the cytb data set of Lemmus lemmus and L. sibiricus (length of sequences = 792 bp). A median joining network approach was applied using Network v. 5.0.0.1 software with default settings (Bandelt et al. 1999).

Table 2. Primer sequences for PCR amplification and sequencing.

Gene Primer’s name Thermocycling settings Direction Sequence (5ʹ-3ʹ) References fragment cytb LemF Forward gmtcccthctdggmcthtgcc 4 min at 95°C, 28 cycles (50 This study LemR Reverse gtwagbcctcgttgyttkgag seconds) at 94°C, 50 seconds at This study 60°C, 50 seconds at 72°C, and a 5 min final extension at 72°C COI LoboF1 Forward kbtchacaaaycayaargayathgg 4 min at 95°C, 24 cycles (50 Lobo et al. (2013) LoboR1 Reverse taaacytcwggrtgwccraaraayca seconds) at 94°C, 50 seconds at Lobo et al. (2013) 51°C, 50 seconds at 72°C, and a 5 min final extension at 72°C GHR GHREXON10 Forward ggraarttrgaggaggtgaacacmatctt 4 min at 95°C, 30 cycles (50 Adkins et al. (2001) GHREND Reverse ctactgcatgattttgttcagttggtctgtgctcac seconds) at 94°C, 50 seconds at Adkins et al. (2001) 67°C, 50 seconds at 72°C, and a 5 min final extension at 72°C RAG1 S278F Forward gagcagtctccagtagttccaga 4 min at 95°C, 29 cycles (50 Schenk et al. (2013) S281R Reverse ggtgcttacaactggtctcca seconds) at 94°C, 50 seconds at Justiniano et al. 58°C, 50 seconds at 72°C, and a (2015) 5 min final extension at 72°C

Divergence dating Divergence times were estimated in BEAST v. 1.10.4 using a random local clock algorithm with the Constant Coalescent model as the tree prior (Drummond & Rambaut 2007; Drummond et al. 2012). As an input data, we used the restricted sequence data set with up to five cytb haplotypes per every species-level taxon. We specified HKY+G+I substitution model to three partitions (3 codons of cytb) as suggested based on the AICc of MEGA7 (Kumar et al. 2016). To dating the phylogeny, one published fossil calibration (Abramson & Petrova 2018) was used with some modifications as follows: stem lineage of the Lemmus clade; absolute age estimate 2.6 Ma; 95% soft upper bound 5.2 Ma (twice the age of the fossil); BEAST’s prior settings: exponential distribution, mean (lambda) = 0.7, MRCA priors: Lemmus lemmus chernovi ssp. nov. and L. nigripes (True, 1894). Additionally, one tip date was assigned as follows: Lemmus sp. ‘Yakutia Mummy’; absolute age estimate 0.04 Ma (radiocarbon dating); Upper Pleistocene, Yana–Indigirka Lowland, Yakutia (Lopatin et al. 2019). Three replicate searches were computed, each with 50 million generations. The trees were sampled every 1,000th generation. Calculations were performed at the San Diego Supercomputer Center through the CIPRES Science Gateway (Miller et al. 2010). The log files were checked visually with Tracer v. 1.7 for an assessment of the convergence of the MCMC chains and the effective sample size (ESS) of parameters (Rambaut et al. 2018). All ESS values were recorded as >2,000; the posterior distributions were similar to the prior distributions. The resulting tree files from three independent analyses were compiled with LogCombiner v. 1.10.4 using an additional resampling at every 5,000th generation (Drummond et al. 2012). The first 10% of trees were discarded as an appropriate burn-in. The maximum clade credibility tree was obtained with TreeAnnotator v. 1.10.4 (Drummond et al. 2012).

Ancestral area and ancestral coloration reconstructions The ancestral area patterns were estimated using two different approaches, i.e., Statistical Dispersal- Vicariance Analysis (S-DIVA), Bayesian inference for discrete areas (BayArea) implemented in RASP v. 3.2 (Yu et al. 2015). For the ancestral area reconstruction, we used the set of 27,000 post-burn-in binary trees that were combined from three runs of BEAST v. 1.10.4 (see above). As a condensed tree, we used the user- specified consensus tree, which was calculated based on this set of trees with TreeAnnotator v. 1.10.4 (see above). Out-group sequences were removed using the appropriate option of RASP v. 3.2 (Yu et al. 2015). We coded four possible distribution areas of the Lemmus taxa as follows: (a) Europe, (b) North Asia (Siberia, Russian Far East, New Siberian Archipelago, and Wrangel Island), (c) North America (with the Pribilof and Aleutian Islands), and (d) Novaya Zemlya. The S-DIVA models were computed with the following priors: max areas = 3; allow reconstruction with max value = 100; max reconstructions for final tree = 1000; and

SPITSYN ET AL. allowing extinctions. The BayArea analyses were run with default settings. In addition to the evaluations obtained from each analysis separately, we used generalized results of the two modeling approaches, which were combined using an algorithm implemented in RASP v. 3.2 (Yu et al. 2015).

Table 3. Additional cytb sequences of lemmings and related taxa used in this study.

Species Cytb GenBank acc. no. Locality References Lemmus lemmus lemmus (Linnaeus, AF348392 Finland Fedorov & Stenseth 1758) (2001) L. lemmus lemmus (Linnaeus, 1758) AF348391 Norway Fedorov & Stenseth (2001) L. lemmus lemmus (Linnaeus, 1758) FJ025984 Sweden: Västerbotten Abramson et al. (2008) L. lemmus lemmus (Linnaeus, 1758) AY219145 Russia: Kola Peninsula Fedorov et al. (2003) L. lemmus lemmus (Linnaeus, 1758) FJ025985 Russia: Kola Peninsula Abramson et al. (2008) L. sibiricus (Kerr, 1792) AF348389 Russia: Yamal Peninsula Fedorov & Stenseth (2001) L. sibiricus (Kerr, 1792) AF348390 Russia: Yamal Peninsula Fedorov & Stenseth (2001) L. sibiricus (Kerr, 1792) AJ012672 Russia: Yakutia, Olenyok Gulf Fedorov et al. (1999) L. sibiricus (Kerr, 1792) AY219140 Russia: Taymyr Peninsula Fedorov et al. (2003) L. sibiricus (Kerr, 1792) [topotype AJ012671 Russia: Yamal Peninsula Fedorov et al. (1999) of this taxon] L. sibiricus (Kerr, 1792) AY219143 Russia: Taymyr Peninsula Fedorov et al. (2003) L. sibiricus (Kerr, 1792) [topotype FJ025981 Russia: Yakutia, Lena River Delta Abramson et al. (2008) of L. obensis bungei Vinogradov, 1926] L. sibiricus (Kerr, 1792) FJ025980 Russia: Yakutia, Lena River Delta Abramson et al. (2008) L. sibiricus (Kerr, 1792) FJ025986 Russia: Yamal Peninsula Abramson et al. (2008) L. sp. “Yakutia Mummy” N/A Russia: Yakutia, right bank of the Tirekhtyakh River, Lopatin et al. (2019) Indigirka River drainage [Pleistocene; calibrated 14C age = 41305–41885 B.P.] L. aff. sibiricus ‘Eastern Clade’ AJ012673 Russia: Yakutia, Indigirka River Delta Fedorov et al. (1999) L. aff. sibiricus ‘Eastern Clade’ KY754011 Russia: Yakutia, near Kolyma River Delta Steppan & Schenk (2017) L. aff. sibiricus ‘Eastern Clade’ AJ012674 Russia: Yakutia, west of Kolyma River Delta Fedorov et al. (1999) L. aff. sibiricus ‘Eastern Clade’ AY219144 Russia: Yakutia, near Kolyma River Fedorov et al. (2003) L. aff. sibiricus ‘Eastern Clade’ AY219141 Russia: New Siberian Islands, Kotelny Island Fedorov et al. (2003) L. aff. sibiricus ‘Eastern Clade’ AY219142 Russia: New Siberian Islands, Fadeyevsky Island Fedorov et al. (2003) L. aff. sibiricus ‘Eastern Clade’ FJ025977 Russia: Kamchatka Peninsula, Uzon Caldera Abramson et al. (2008) L. aff. sibiricus ‘Eastern Clade’ FJ025979 Russia: Kamchatka Peninsula, Uzon Caldera Abramson et al. (2008) L. aff. sibiricus ‘Eastern Clade’ AJ012678 Russia: Kamchatka Peninsula, Uzon Caldera Fedorov et al. (1999) L. aff. sibiricus ‘Eastern Clade’ KX455623 Russia: Magadan Region, Khinikanumsa River Abramson & Petrova (2018) L. aff. sibiricus ‘Eastern Clade’ KX455624 Russia: Magadan Region, Khinikanumsa River Abramson & Petrova (2018) L. aff. sibiricus ‘Eastern Clade’ KX455625 Russia: Magadan Region, Khinikanumsa River Abramson & Petrova (2018) L. aff. sibiricus ‘Eastern Clade’ KX455626 Russia: Magadan Region, Yama River Abramson & Petrova (2018) L. aff. sibiricus ‘Eastern Clade’ KX455627 Russia: Magadan Region, Yama River Abramson & Petrova (2018) L. aff. sibiricus ‘Eastern Clade’ KX455621 Russia: Kamchatka Peninsula, Ust’-Kamchatsk Abramson & Petrova (2018) L. aff. sibiricus ‘Eastern Clade’ KX455622 Russia: Yakutia, Verhoyansky District, Nelgekhe Abramson & Petrova [holotype of L. amurensis ognevi River (2018) Vinogradov, 1933] L. aff. sibiricus ‘Eastern Clade’ AJ012677 Russia: Wrangel Island Fedorov et al. (1999) [topotype of L. portenkoi Chernyavskii, 1967] L. amurensis Vinogradov, 1924 KX455628 Russia: Amur Region, Zeysky District, Pikan Abramson & Petrova [holotype of this taxon] (2018) L. amurensis Vinogradov, 1924 KX455629 Russia: Amur Region, Zeysky District, Pikan Abramson & Petrova (2018)

Ecologica Montenegrina, 40, 2021, 93-117 97

A NEW NORWEGIAN LEMMING SUBSPECIES FROM NOVAYA ZEMLYA

Species Cytb GenBank acc. no. Locality References L. amurensis Vinogradov, 1924 KX455630 Russia: Amur Region, Zeysky District, Pikan Abramson & Petrova (2018) L. amurensis Vinogradov, 1924 KX455631 Russia: Amur Region, Zeysky District, Pikan Abramson & Petrova (2018) L. amurensis Vinogradov, 1924 KX455632 Russia: Amur Region, Zeysky District, Pikan Abramson & Petrova (2018) L. amurensis Vinogradov, 1924 KX455633 Russia: Amur Region, Zeysky District, Pikan Abramson & Petrova (2018) L. amurensis Vinogradov, 1924 KX455636 Russia: Yakutia, Neryungri District, Nagorny Abramson & Petrova (2018) L. amurensis Vinogradov, 1924 KX455634 Russia: Yakutia, Neryungri District, Chulman Abramson & Petrova (2018) L. amurensis Vinogradov, 1924 KX455635 Russia: Transbaikalia, Chita River upstream Abramson & Petrova (2018) L. nigripes (True, 1894) [topotype of AY219164 USA: Alaska, Pribilof Islands, Saint George Island Fedorov et al. (2003) this taxon] L. nigripes (True, 1894) [lectotype KX455619 Russia: Kamchatka Peninsula, south-western coast, Abramson & Petrova of L. flavescens Vinogradov, 1926] probably Ust’-Bolsheretsk (2018) L. nigripes (True, 1894) [topotype of KT877362 Russia: Gichiga, west coast of Okhotsk Sea, Abramson et al. (2018) L. obensis chrysogaster Allen, 1903] Magadan Region L. nigripes (True, 1894) KX455620 Russia: Kamchatka Peninsula, south-western coast, Abramson & Petrova probably Ust’-Bolsheretsk (2018) L. nigripes (True, 1894) KX455618 Russia, Chukotka Peninsula, Khatyrka River Abramson & Petrova (2018) L. nigripes (True, 1894) AJ012675 Russia, east of Kolyma River Delta, north-western Fedorov et al. (2003) edge of the Chukotka Peninsula L. nigripes (True, 1894) AY219158 Canada: Yukon Fedorov et al. (2003) L. nigripes (True, 1894) AJ012676 USA: West Alaska Fedorov et al. (1999) L. nigripes (True, 1894) AY219146 USA: Alaska, Seward Peninsula Fedorov et al. (2003) L. nigripes (True, 1894) [topotype of AY219147 USA: Alaska, Point Barrow Fedorov et al. (2003) L. alascensis Merriam, 1900] L. nigripes (True, 1894) AY219148 USA: Alaska, Lake and Peninsula Fedorov et al. (2003) L. nigripes (True, 1894) AY219149 USA: Alaska Fedorov et al. (2003) L. nigripes (True, 1894) AY219152 USA: Alaska Fedorov et al. (2003) L. nigripes (True, 1894) [topotype of AY219153 USA: Alaska, Goodnews Bay Fedorov et al. (2003) L. minusculus Osgood, 1904] L. nigripes (True, 1894) AY219154 USA: Alaska Fedorov et al. (2003) L. trimucronatus (Richardson, 1825) AY219162 Canada: Nunavut, Kugluktuk Fedorov et al. (2003) [topotype of this taxon] L. trimucronatus (Richardson, 1825) AY219161 Canada: Nunavut Fedorov et al. (2003) L. trimucronatus (Richardson, 1825) AY219155 Canada: Nunavut Fedorov et al. (2003) L. trimucronatus (Richardson, 1825) AY219159 Canada: Nunavut Fedorov et al. (2003) L. trimucronatus (Richardson, 1825) AY219163 Canada: Northwest Territories Fedorov et al. (2003) L. trimucronatus (Richardson, 1825) AY219156 Canada: Northwest Territories Fedorov et al. (2003) L. trimucronatus (Richardson, 1825) AY219157 Canada: Northwest Territories Fedorov et al. (2003) L. trimucronatus (Richardson, 1825) AY219167 USA: Alaska Fedorov et al. (2003) L. trimucronatus (Richardson, 1825) AY219150 USA: Alaska Fedorov et al. (2003) L. trimucronatus (Richardson, 1825) AY219151 USA: Alaska Fedorov et al. (2003) Dicrostonyx torquatus (Pallas, AJ131441 Russia: Yakutia, near Kolyma River Fedorov (1999) 1778)* D. hudsonius (Pallas, 1778)* KY753975 Canada: Nunavut, Belcher Island Steppan & Schenk (2017) Synaptomys cooperi (Baird, 1857)* KY754162 USA: West Virginia, Allegheny Mountains Steppan & Schenk (2017) Myopus schisticolor (Lilljeborg, AF119263 N/A Conroy & Cook (1999) 1844)*

*These haplotypes were used as outgroup. N/A – not available.

To reconstruct ancestral coloration in Lemmus taxa, we applied Bayesian Binary MCMC (BBM) analysis implemented in RASP v. 3.2 (Yu et al. 2015) using the same input data as for the ancestral area reconstructions (see above). Two variants of coloration were coded as follows: (a) cryptic, and (b)

SPITSYN ET AL. aposematic. The analyses were run under JC+G evolutionary model with the following parameters: 10 MCMC chains, 500,000 generations, sampling every 100th generation, and temperature = 0.1.

Species delimitation and molecular diagnostics Molecular Operational Taxonomic Units (MOTUs) were delineated using two different approaches. First, we applied the Bayesian Poisson Tree Process (bPTP) model thorough online bPTP server (http://species.h- its.org/ptp) with 500,000 Markov Chain Monte Carlo (MCMC) generations and 15% burn-in (Zhang et al. 2013). Second, we computed the single-rate Poisson Tree Process (sPTP) model (p < 0.001) with online mPTP server (http://mptp.h-its.org) (Kapli et al. 2017). As an input tree, we used the maximum likelihood consensus phylogeny obtained from IQ-TREE analyses (see above). All outgroup taxa were removed from the input tree using an appropriate option of the servers. The molecular diagnosis of the new subspecies was designed using fixed nucleotide differences, which were estimated for each gene separately (cytb, COI, GHR, and RAG1) using a Toggle conserved sites tool of MEGA7 at 50 % level (Kumar et al. 2016). An alignment of haplotype sequences for the nominate subspecies and Novaya Zemlya Lemming was performed using the ClustalW algorithm implemented in MEGA7 (Kumar et al. 2016). Additionally, a mean p-distance to the nearest neighbor of each taxon under discussion based on the cytb and COI haplotypes (if available) was calculated in MEGA7 (Kumar et al. 2016).

Data availability The new sequences generated under this study are available from GenBank. Accession numbers for each specimen are presented in Table 1. The voucher specimens are available in the RMBH, Russian Museum of Biodiversity Hotspots, N. Laverov Federal Center for Integrated Arctic Research of the Ural Branch of the Russian Academy of Sciences (Arkhangelsk, Russia).

Results

Phylogenetic position of Novaya Zemlya Lemming Our molecular analyses of newly collected samples of the ‘Siberian’ lemming from Novaya Zemlya (Table 1, Fig. 1) indicate that it is a divergent phylogenetic lineage of the Norwegian Lemming (Figs 2-3), which does not share aposematic traits and has cryptic gray coloration. The mean uncorrected p-distance between the Fennoscandian and Novaya Zemlya lineages of Lemmus lemmus based on the cytb and COI gene fragments is 1.2% and 1.0%, respectively (Table 4). Furthermore, the Novaya Zemlya Lemming shares two diagnostic nucleotide substitutions in the GHR and RAG1 gene fragments compared with the nominate subspecies (Table 5).

Table 4. Genetic divergences (mean uncorrected p-distances, %) between Lemmus taxa (L. lemmus and L. amurensis species complexes) based on sequences of the mitochondrial cytb (below diagonal) and COI (above diagonal) genes.

Taxa LLC LLL LS LM* LSEC LA LT LN L. lemmus chernovi ssp. nov. [LLC] 1.0 2.2 N/A N/A N/A N/A N/A L. lemmus lemmus [LLL] 1.2 2.1 N/A N/A N/A N/A N/A L. sibiricus [LS] 2.0 2.3 N/A N/A N/A N/A N/A L. sp. “Yakutia Mummy” [LYM]* 1.7 2.0 2.2 N/A N/A N/A N/A L. aff. sibiricus ‘Eastern Clade’ [LSEC] 4.5 4.9 4.5 2.8 N/A N/A N/A L. amurensis [LA] 4.4 4.8 4.4 3.2 4.5 N/A N/A L. trimucronatus [LT] 10.6 11.8 11.4 9.4 11.0 10.5 N/A L. nigripes [LN] 8.7 9.8 10.1 7.8 8.9 8.4 7.2

*A frozen lemming mummy (14C age = 0.04 Ma) was collected from the Upper Pleistocene deposits in the Yana– Indigirka Lowland, Yakutia, and its tissue snip was sequenced for a cytb gene fragment (Lopatin et al. 2019). N/A – not available.

Ecologica Montenegrina, 40, 2021, 93-117 99

A NEW NORWEGIAN LEMMING SUBSPECIES FROM NOVAYA ZEMLYA

Figure 1. Ranges and habitats of the true lemmings (Lemmus). (A) Distribution map of Lemmus taxa. Ranges were digitized based on published data and our records (Table 1). Red circles indicate sampling localities of Novaya Zemlya Lemming (L. lemmus chernovi ssp. nov.): 1 – Malye Karmakuly Polar Station (type locality), 2 – Bezymyannaya Bay (Table 1). The topographic base of the map was created with Natural Earth Free Vector and Raster Map Data (www.naturalearthdata.com). The map was created using ESRI ArcGIS 10 software (www.esri.com/arcgis). (B, C, D) Habitats of Lemmus taxa: (B) Novaya Zemlya Lemming (type locality, Novaya Zemlya), (C) Norwegian Lemming (Kola Peninsula), and (D) Siberian Lemming (Taimyr Peninsula). (Photos: Vitaly M. Spitsyn [B, C] and Natalia A. Zubrii [D])

100

SPITSYN ET AL.

Figure 2. Maximum likelihood (IQ-TREE) phylogeny of Lemmus taxa based on the cytb gene haplotypes. The Novaya Zemlya Lemming (Lemmus lemmus chernovi ssp. nov.) is colored red. The numbers near nodes are ultrafast bootstrap support values/Bayesian posterior probabilities. The red asterisks indicate the putative species-level clades supported by bPTP and sPTP species-delimitation models. The scale bar indicates the branch length. Outgroup taxa (Dicrostonyx torquatus, D. hudsonius, Synaptomys cooperi, and Myopus schisticolor) are not shown.

Origin of Novaya Zemlya Lemming and its coloration patterns The fossil-calibrated phylogeny (Fig. 3A) revealed that the subspecies from Novaya Zemlya has been isolated from the Fennoscandian populations since the Eemian interglacial (mean age = 93 Ka, 95% HPD = 38–170 Ka). The generalized ancestral area reconstruction (S-DIVA + BayArea models) (Fig. 4, Table 6) suggested that the most recent common ancestor (MRCA) of the two subspecies of Lemmus lemmus has been widely distributed from Western Europe to Novaya Zemlya, most likely throughout the drying Arctic Shelf during a glacial event (probability = 96.6%). The Novaya Zemlya lineage was likely originated through a vicariance event associated with isolation of the insular population (probability = 95.9%).

Ecologica Montenegrina, 40, 2021, 93-117 101

A NEW NORWEGIAN LEMMING SUBSPECIES FROM NOVAYA ZEMLYA

Figure 3. Phylogeny and phylogeography of Lemmus taxa. (A) Fossil-calibrated ultrametric chronogram of Lemmus obtained with BEAST v. 1.10.4 for the cytb haplotype data set. Bars indicate 95% confidence intervals of the estimated divergence times (Ka). Red and black numbers near nodes are mean ages (Ka) and BPP of BEAST, respectively. Red stars indicate time calibrations: a stem lineage of the Lemmus clade with absolute age estimate 2,600 Ka and 95% soft upper bound 5,200 Ka (C1); and Lemmus sp. ‘Yakutia Mummy’ with absolute age estimate 40 Ka (C2). Outgroup taxa (Dicrostonyx torquatus, D. hudsonius, Synaptomys cooperi, and Myopus schisticolor) are not shown. (B) Median- joining haplotype network of Novaya Zemlya, Norwegian, and Siberian lemmings based on the cytb sequences (N = 17). Circle size is proportional to the number of available sequences belonging to a certain haplotype (smallest circle = one sequence). Small black dots indicate hypothetical ancestral haplotypes. Red numbers near branches indicate the number of nucleotide substitutions between haplotypes.

Our ancestral trait modeling (Fig. 5) suggests that the MRCA of the two subspecies of Lemmus lemmus has had a cryptic coloration (probability = 94.6%), and that bright coloration and specific antipredator behavior of the Fennoscandian populations are novel aposematic traits that have been originated since their isolation in a European refugium.

102

SPITSYN ET AL.

Figure 4. Ancestral area reconstruction (combined scenario: S-DIVA + BayArea models) of Lemmus taxa based on our fossil-calibrated BEAST v. 1.10.4 phylogeny. Black numbers near nodes are BEAST’s BPP.

Table 5. Polymorphism in the nuclear GHR and RAG1 gene sequences of Lemmus spp. Numbers in the top row refer to nucleotide positions within a condensed sequence alignment, letters are FASTA codes for nucleotides but with additional polymorphisms shown explicitly. Dots indicate a nucleotide matching the first sequence.

GHR RAG1 Taxon 268 377 439 719 812 860 294 332 399 436 440 546 599 707 L. lemmus lemmus A G C C C T G C G A C C C C

L. lemmus chernovi ssp. · · · · · C · · · · · · T · nov. L. sibiricus · · C/T C/T C/T C · C/T · A/G C/T C/T T ·

L. aff. sibiricus ‘Eastern A/C A/G C/T · C/T · A · A · · · T T Clade’

*GenBank data: MF074889 (GHR) and MF097872 (RAG1) [Russia: Yakutia, near Kolyma River Delta] (Steppan & Schenk 2017).

Ecologica Montenegrina, 40, 2021, 93-117 103

A NEW NORWEGIAN LEMMING SUBSPECIES FROM NOVAYA ZEMLYA

Figure 5. Ancestral coloration reconstruction (Bayesian Binary MCMC analysis) of Lemmus taxa based on our fossil- calibrated BEAST v. 1.10.4 phylogeny. Black numbers near nodes are BEAST’s BPP. The Lemmus trimucronatus + L. nigripes clade (cryptic coloration) is omitted. (Photos: Vitaly M. Spitsyn).

Species delimitation and evolutionary biogeography of the true lemmings Our Bayesian Poisson Tree Process (bPTP) and single-rate Poisson Tree Process (sPTP) species delimitation modeling based on cytb haplotypes returned identical results with five Molecular Operational Taxonomic Units (MOTUs) (Fig. 2; Appendix 1). Four of these MOTUs corresponded to the following species: L. aff. sibiricus ‘Eastern Clade’, L. amurensis, L. nigripes, and L. trimucronatus (Richardson, 1825) (see Appendix 1 and discussion section for detail). Conversely, L. lemmus (with its subspecies) and L. sibiricus were treated as a single MOTU. Our fossil calibrated phylogeny (Fig. 3A) indicated that the genus Lemmus most likely originated in the Early Pleistocene (mean age = 1.8 Ma; 95% HPD = 1.2-2.7 Ma) (Fig. 3A). The combined ancestral area model failed to reconstruct the place of its origin with certainty (Fig. 4), while the S-DIVA reconstruction suggested the Beringian origin of the genus (probability = 97.7%) (Table 6). The origin of the Lemmus trimucronatus complex’s MRCA was placed in the Middle Pleistocene (mean age = 0.64 Ma; 95% HPD =

104

SPITSYN ET AL.

0.37-1.02 Ma). It seems likely that this group has had the Nearctic origin with full support from the S-DIVA reconstruction but a rather low probability based on the combined model (50.0%). Lemmus trimucronatus is an entirely Nearctic species, while two isolates of L. nigripes on the both sides of the Bering Strait represent fragments of its former continuous range throughout the Beringian Land Bridge (probability = 99.8%) in the Middle Pleistocene (mean age = 0.22 Ma; 95% HPD = 0.10-0.41 Ma). The Lemmus lemmus complex and a clade containing L. lemmus, L. sibiricus, and the extinct L. sp. ‘Yakutia Mummy’ have had a North Asian origin by the S-DIVA reconstruction (probabilities = 97.0- 97.7%), although the BayArea model failed to resolve ancestral areas for those groups with certainty, suggesting the northern edge of Eurasia with the surrounding Arctic Shelf as a possible place (Fig. 4 and Table 6). The L. amurensis + L. aff. sibiricus clade was originated in North Asia with a subsequent intra-area radiation (probability = 73.4% by the combined scenario).

Table 6. The most probable ancestral areas of Lemmus clades inferred from two different statistical modeling approaches and the combined reconstruction. High support values (probability ≥70 %) are highlighted in bold.

Type of Probability of ancestral areas (%) Clades Ancestral areas* biogeographic Combined S-DIVA BayArea events* results Lemmus N Asia & N America Vicariance 97.7 uncertain 48.9 [P = 12.4%] [all four areas: 100.0] L. trimucronatus complex N America Dispersal 100.0 88.8 50.0 [P = 49.8%] [N Asia & N. America] L. nigripes North America – N Asia & N America Vicariance (Beringian 100.0 99.6 99.8 L. nigripes Asia Land Bridge) [P = 95.0%] L. lemmus complex Europe & Novaya Dispersal 97.7 98.0 49.5 Zemlya & N Asia [P = 18.4%] [N Asia] L. amurensis + L. aff. N Asia Intra-area radiation 100.0 46.9 73.4 sibiricus ‘Eastern Clade’ [P = 72.7%] L. lemmus + L. sibiricus + Europe & Novaya Dispersal 97.0 99.9 50.6 L. sp. ‘Yakutia Mummy’ Zemlya & N Asia [P = 33.8%] [N Asia] L. lemmus + L. sibiricus Europe & Novaya Vicariance 33.7 100.0 66.8 Zemlya & N Asia [P = 63.7%] L. lemmus lemmus – L. Europe & Novaya Vicariance 100.0 93.2 96.6 l. chernovi ssp. nov. Zemlya [P = 95.9%]

*Combined scenario.

Taxonomic description of Novaya Zemlya Lemming Based on an integrative analysis of mitochondrial, nuclear (Figs 2-3, Tables 4-5) and morphological data (Figs 6-7, Table 7), the Novaya Zemlya lineage of Lemmus lemmus is considered a new subspecies, which is described here.

Lemmus lemmus chernovi Spitsyn, Bolotov & Kondakov ssp. nov. Figs 6A, 7A-C, 7G-H, 7K-L, Table 7 Common name: Novaya Zemlya Lemming

Holotype: Male RMBH Lem005: type locality: Russia, Novaya Zemlya, Southern Island, near Malye Karmakuly Polar Station, 72.3822°N, 52.7506°E, altitude 17 m, wet saxifrage-roseroot communities, 23.vii.2015, Spitsyn leg. Paratypes: Russia, Novaya Zemlya, Southern Island: type locality, 27.vii–01.viii.2015, 11 specimens (RMBH Lem001 – Lem004, Lem006, Lem007, Lem011, Lem019, Lem022, Lem023, Lem027), Spitsyn leg.; near Malye Karmakuly Polar Station, 72.3575°N, 52.7799°E, altitude 27 m, dry lichen-moss rocky tundra, 1.viii.2015, 1 specimen (RMBH Lem028), Spitsyn leg.; near Malye Karmakuly Polar Station, 72.3934°N, 52.7566°E, altitude 40 m, dry lichen-moss rocky tundra, 23.vii.2015, 2 specimens (RMBH Lem008, Lem009), Spitsyn leg.; near Malye Karmakuly Polar Station, 72.4058°N, 52.8285°E, altitude 60 m, dry tundra with Dryas octopetala and Astragalus alpinus, 27.vii.2015, 2 specimens (RMBH Lem020,

Ecologica Montenegrina, 40, 2021, 93-117 105

A NEW NORWEGIAN LEMMING SUBSPECIES FROM NOVAYA ZEMLYA

Lem021), Spitsyn leg.; near Malye Karmakuly Polar Station, 72.3797°N, 52.7525°E, altitude 20 m, wet moss-sedge-willow tundra, 28–31.vii.2015, 4 specimens (RMBH Lem017, Lem018, Lem024, Lem025), Spitsyn leg.; near Malye Karmakuly Polar Station, 72.3739°N, 52.7167°E, altitude 28 m, stinkweed (Artemisia tilesii) assemblages, 5.viii.2015, 1 specimen (RMBH Lem031), Spitsyn leg.; Bezymyannaya Bay, 72.8°N, 52.5°E, 2017, 1 specimen (RMBH Lem029), local collector leg. Molecular diagnosis: The novel subspecies differs from Lemmus lemmus lemmus by fixed nucleotide substitutions in the mitochondrial cytb (12A, 36C, 189T, 441T, 573A, 726G, 765T) and COI (198C, 200A, 302T, 542A, 602C), and the nuclear GHR (860C) and RAG1 (599T) gene fragments (Tables 4-5). Differential diagnosis: The Novaya Zemlya Lemming differs from the nominate subspecies by having a cryptic coloration of dorsal surface that is dark gray with yellow and reddish hairs in adults (Fig. 6A) to reddish in juveniles, with an unclear longitudinal black stripe in anterior part from neck to nose (vs bright yellow coloration with black anterior part of the trunk and large black spots on head). The new subspecies is morphologically similar to Lemmus sibiricus but adult specimens from Novaya Zemlya could be distinguished from it by dorsal coloration with yellow and reddish hairs (vs brown and reddish hairs).

Figure 6. Dorsal view of lemming specimens: (A) Novaya Zemlya Lemming (Lemmus lemmus chernovi ssp. nov.) [holotype RMBH Lem005], and (B) Norwegian Lemming (L. lemmus lemmus) [RMBH Lem040, Kola Peninsula]. Scale bar = 10 mm. (Photos: Vitaly M. Spitsyn).

106

SPITSYN ET AL.

Figure 7. Comparison of crania, molar rows, and lower jaws of Novaya Zemlya (Lemmus lemmus chernovi ssp. nov.) [holotype RMBH Lem005] and Norwegian (L. l. lemmus) lemmings [specimen RMBH Lem040, Kola Peninsula]. (A, B, C) Crania of Novaya Zemlya Lemming: (A) dorsal view, (B) ventral view, and (C) lateral view. (D, E, F) Crania of Norwegian Lemming: (D) dorsal view, (E) ventral view, and (F) lateral view. Scale bar = 5 mm. (G, H) Molar rows of Novaya Zemlya Lemming: (G) maxillary, and (H) mandibular. (I, J) Molar rows of Norwegian Lemming: (I) maxillary, and (J) mandibular. Scale bar = 1 mm. (K, L) Lower jaw of Novaya Zemlya Lemming: (K) outer lateral view, and (L) inner lateral view. (M, N) Lower jaw of Norwegian Lemming: (M) outer lateral view, and (N) inner lateral view. Scale bar = 5 mm. (Photos: Vitaly M. Spitsyn).

Ecologica Montenegrina, 40, 2021, 93-117 107

A NEW NORWEGIAN LEMMING SUBSPECIES FROM NOVAYA ZEMLYA

Description: Holotype male (Figs 6A, 7A-C, 7G-H, 7K-L, Table 7). Body weight 74 g; body length 130 mm, tail 13 mm. Length of hind foot 15 mm. Length of upper molar row 8.5 mm, lower molar row 8.3 mm. Color of dorsal surface grayish yellow, with an unclear longitudinal black stripe in anterior part from neck to nose. Cheeks dark gray, nose brownish gray. Ventral surface light-colored, creamy-yellow. Tail creamy. Vibrissae up to 33 mm long, black with yellow apex. Rostrum shorter than 2/3 greatest skull length; nasals do not proceed beyond the frontal edge of the incisors, rear edge rounded; gnathic process not pronounced; premaxilla rounded. Lacrimals with small ledge on the back side. Zygomatic arches parallel, jugal bone broad. Zygomatic plate broad, with slightly concave frontal margin. Zygomatic notch shallow. Nasolacrimal foramen with irregular shape, broad. Interorbital region narrow. Braincase region broad, almost square, with concavities behind the zygomatic arches. Lambdoidal ridge well developed. Postglenoid foramen elongated. Diastema long, concave; incisive foramina long and narrow. Mesopterygoid fossa broad, biconcave; parapterygoid fossa large; auditory bulla large, drop-shaped. Lower jaw large, angular process, condylar process и coronoid process large, well developed. Maxillary incisors yellowish-orange. Morphological variability. Mean body length of the type specimens (±s.e.m.) 110.9±19.6 mm (min-max = 85-160 mm; n = 21). Color of dorsal surface grayish yellow in adults to reddish in juveniles, with an unclear longitudinal black stripe (Fig. 6A).

Table 7. Body and cranial measurements (mm) of Novaya Zemlya and Norwegian lemmings.

Lemmus lemmus chernovi ssp. nov. (Novaya Zemlya, type series, Lemmus lemmus lemmus (Kola Peninsula, adults, adults, N = 4) N = 3) Parameters Holotype Paratype Paratype Paratype Mean ± Mean ± Lem036 Lem035 Lem038 Lem005 Lem028 Lem019 Lem029 s.e.m. s.e.m. Body length 130 125 145 125 131±5 100 110 110 107±3 Tail length 13 12 15 13 13.3±0.6 11 12 12 11.7±0.3 Hind foot length 15 14 16 15 15.0±0.4 14 16 15 15.0±0.6 Greatest skull length 31.4 31.7 32.7 30.4 31.6±0.5 25.4 27.2 27.0 26.5±0.6 Interorbital breadth 4.1 4.0 N/A 4.2 4.1±0.1 4.0 4.4 4.0 4.1±0.1 Zygomatic breadth 21.8 21.4 23.4 21.2 22.0±0.5 18.4 19.4 18.4 18.7±0.3 Length of rostrum 8.7 8.7 9.3 8.3 8.8±0.2 N/A 7.3 6.9 7.1±0.2 Breadth of rostrum 6.5 6.5 6.9 6.4 6.6±0.1 5.5 5.5 5.6 5.5±0.0 Breadth of braincase 16.0 14.9 16.6 15.0 15.6±0.4 14.1 14.1 14.1 14.1±0.0 Height of braincase 10.5 10.1 11.5 10.2 10.6±0.3 9.5 9.5 9.1 9.4±0.1 Length of diastema 11.1 11.1 11.2 10.8 11.1±0.1 9.4 9.4 9.3 9.4±0.0 Length of incisive 6.2 6.6 6.6 6.2 6.4±0.1 5.2 5.9 6.4 5.8±0.3 foramina Breadth of incisive 1.3 1.3 1.5 1.4 1.4±0.0 1.0 1.1 1.2 1.1±0.1 foramina Palatal length 7.8 7.5 8.0 7.8 7.8±0.1 7.8 7.6 7.8 7.7±0.1 Postpalatal length 9.1 9.0 9.7 8.8 9.2±0.2 8.3 9.0 8.4 8.6±0.2 Breadth of 3.9 4.4 4.6 4.3 4.3±0.1 4.2 4.2 4.1 4.2±0.0 mesopterygoid fossa Length of bulla 9.9 9.1 9.9 8.2 9.3±0.4 7.9 7.9 7.9 7.9±0.0 Crown length of 8.5 8.6 8.9 8.2 8.6±0.1 7.2 7.2 7.2 7.2±0.0 maxillary molar row Crown length of 8.3 8.1 8.5 7.9 8.2±0.1 7.0 7.0 7.1 7.0±0.0 mandibular row

Etymology: This subspecies is named in memory of the late Academician of the Russian Academy of Sciences Yury I. Chernov (1934-2012), a prominent Russian zoologist, biogeographer, and Arctic explorer. Distribution and habitat: This subspecies is endemic to the Southern Island of Novaya Zemlya, while its reliable records from the Northern Island of this archipelago are unknown (Fig. 1A). It inhabits a broad range of meadow-like (Fig. 1B) and tundra habitats. Comments: The species delimitation modeling (Fig. 2) suggests that Lemmus lemmus and L. sibiricus may belong to one polymorphic species, although molecular distances between these taxa correspond to an interspecific difference (Tables 4-5) supporting the modern concept of two young allopatric species (Lagerholm et al. 2014, 2017; Abramson & Petrova 2018; Wilson & Reeder 2005; Wilson et al. 2017; Abramson et al. 2018).

108

SPITSYN ET AL.

Discussion

Discovery of a new Lemmus lemmus subspecies on Novaya Zemlya Here, we report on the unexpected discovery of a Norwegian Lemming lineage from Novaya Zemlya. This lineage shares a shallow genetic divergence from the nominate subspecies of Lemmus lemmus from Fennoscandia (1.2% and 1.0% by the cytb and COI gene fragments, respectively). Our fossil-calibrated phylogeny indicates that the Novaya Zemlya lineage was separated from Fennoscandian populations since the Eemian interglacial (mean age = 93 Ka). These novel results agree with the paleogenetic and DNA-based data that the Norwegian Lemming originated from a small population surviving the Last Glacial Maximum in an ice-free Scandinavian refugium (Fedorov & Stenseth 2001; Lagerholm et al. 2014) but we present the first evidence that other isolate of this species evolved simultaneously and independently on Novaya Zemlya. Hence, the MRCA of the Lemmus lemmus clade was widely distributed throughout the drying Arctic Shelf from Western Europe to Novaya Zemlya before the Eemian interglacial, as suggested based on our generalized ancestral area reconstruction (S-DIVA + BayArea models; probability = 96.6%). This broad range could have been originated during a cold event corresponding to the marine isotope stage (MIS) 6 [the penultimate glaciation], when lemmings abundantly occurred in Western (Lemmus lemmus) and Eastern (L. lemmus and L. sibiricus) Europe (Markova & Puzachenko 2017). The rising of the sea level during the subsequent Eemian interglacial (MIS 5) (Markova & Puzachenko 2017) was the most likely driver of isolation of Novaya Zemlya from the mainland followed by a vicariance event in the MRCA of L. lemmus.

Origin of aposematic traits in Norwegian Lemming Our ancestral trait modeling results reveal that aposematic coloration and behavior of the Norwegian Lemming are secondary adaptive traits, which were lacking in the MRCA of the Fennoscandian and Novaya Zemlya lineages. It seems likely that these traits rapidly evolved in the nominate subspecies of Lemmus lemmus in the Late Pleistocene (mean age = 93 Ka, 95% HPD = 38–170 Ka). A well-preserved frozen lemming mummy (Lemmus sp. ‘Yakutia Mummy’) was discovered recently from the Upper Pleistocene deposits in the Yana–Indigirka Lowland, Yakutia (Lopatin et al. 2019). This ancient lemming (calibrated 14C age = 40 Ka) represents a phylogenetic lineage sister to the L. lemmus + L. sibiricus clade (Fig. 3A and Table 4), and it shares gray coloration with yellowish hairs (Lopatin et al. 2019). Externally, it is rather similar to cryptically colored lemmings, e.g. Lemmus lemmus chernovi ssp. nov., L. sibiricus, and L. aff. sibiricus ‘Eastern Clade’. These findings indicate that our reconstruction is correct and that cryptic coloration should be considered an ancestral trait for the entire Lemmus clade.

Cryptic polar refugium on Novaya Zemlya Our discovery of an endemic insular subspecies of Lemmus lemmus aligns with a small body of earlier research indicating that Novaya Zemlya supported a cryptic glacial refugium for terrestrial fauna and flora during the Pleistocene epoch (Serebryanny & Malyasova 1998; Potapov et al. 2018). Dicrostonyx torquatus ungulatus Baer, 1841 was described as a subspecies endemic to Novaya Zemlya (Baranova & Gromov 2003), and needs future DNA-based studies as a possible additional example of a distant insular lineage in small rodents. The bumble bee species Bombus glacialis Friese, 1902 is known to occur on Novaya Zemlya, and, probably, on Wrangel Island (Potapov et al. 2018). This species did not cross the Kara Strait, a 56 km wide marine barrier, separating Novaya Zemlya from the Vaigach Island (Potapov et al. 2019). The Arctic charr Salvelinus alpinus (Linnaeus, 1758) populations in land-locked lakes on Novaya Zemlya share unique mtDNA haplotypes that may reveal their long-term (pre-glacial) existence there (Makhrov et al. 2019). Palynological data indicate the presence of large ice-free refugia with species-rich plant assemblages on Novaya Zemlya during the entire Pleistocene (Serebryanny & Malyasova 1998). Conversely, several mammal species can migrate to Novaya Zemlya from the mainland during the winter months, as it was shown for the reindeer Rangifer tarandus (Linnaeus, 1758) (Kvie et al. 2016), and the mountain hare Lepus timidus (Linnaeus, 1758) (Spitsyn & Bolotov 2020). It is clear that molecular genetic studies on animal groups with lower dispersal abilities such as sawflies (Hymenoptera: Symphyta) (Taegeret et al. 2006) and tadpole shrimps (Crustacea: Notostraca) could contribute to future understanding of the role of Novaya Zemlya as a cryptic polar refugium.

Preliminary hypothesis on evolutionary biogeography of the true lemmings Based on our time-calibrated phylogeny, ancestral area reconstruction, and available published data, the

Ecologica Montenegrina, 40, 2021, 93-117 109

A NEW NORWEGIAN LEMMING SUBSPECIES FROM NOVAYA ZEMLYA following evolutionary scenario for Lemmus taxa can be proposed. The basal split of the genus Lemmus into the two species complexes indicates that the MRCA of this group has had a trans-Beringian range. Therefore, it could have been originated in Beringia approximately 2,000 Ka ago or so. This date aligns well with an earlier fossil-calibrated phylogeny of the true lemmings and available fossil records (Abramson & Petrova 2018). The Eurasian group (Lemmus lemmus species complex) dispersed throughout the Far East and Siberia to the west approximately 560 Ka ago, during a short and mild glacial epoch (MIS 14) (Hao et al. 2015). Later, this continuous range was subdivided into several fragments in East Siberian mountains (approximately 400 Ka ago, L. amurensis and L. aff. sibiricus ‘Eastern Clade’ in Transbaikalia and Kolyma Highlands, respectively), Yana-Indigirka Lowland (approximately 260 Ka ago, L. sp. ‘Yakutia Mummy’), and an area west of the Lena River basin (the stem lineage of L. sibiricus and L. lemmus). The first split corresponds to a global interglacial event during MIS 11 stage (Melles et al. 2012) while the second event can be linked to a warm climatic episode at MIS 7 stage (Berger et al. 2016). After that, lemmings colonized Western Siberia, the Urals, Novaya Zemlya, and Europe (approximately 170 Ka ago, the MRCA of Lemmus sibiricus and L. lemmus). As it was noted above, this massive westward dispersal event coincides with the penultimate glacial maximum (MIS 6) 190-130 Ka ago, and is traced well in paleontological records (Markova & Puzachenko 2017). It is clear that the Beringia could have played a critical role in the evolutionary history of the true lemmings, as the basal split in the genus and at least one further divergence event (i.e. the intraspecific split in Lemmus nigripes) were likely associated with the opening and closure of this land bridge. Moreover, the emerged Bering Land Bridge and surrounding shelf areas most likely served as a corridor for migration of L. nigripes individuals with Nearctic haplotypes to the Chukotka Peninsula and of L. aff. sibiricus ‘Eastern Clade’ from the Kolyma Highland to the New Siberian Archipelago and Wrangel Island during the Last Glacial Maximum (approximately 18-25 Ka ago) (Elias & Brigham-Grette 2013).

Taxonomy and species richness of the true lemmings (Lemmus) The number of valid taxa in this genus is a matter of long-term debates (Pokrovski et al. 1984; Abramson et al. 2008; Abramson & Petrova 2018; Abramson et al. 2018; Lissovsky et al. 2019). Recently, a group of researchers lumped all these taxa except for one (Lemmus ‘trimucronatus’) into a single species, L. lemmus, which is thought to be widespread throughout Northern Eurasia from the Atlantic Coast to the Chukotka and Kamchatka peninsulas and Wrangel Island (Lissovsky et al. 2019). Similar concepts with one or two polymorphic and widespread Lemmus species were proposed repeatedly by earlier scholars (see review Abramson et al. 2008). However, this ‘lumping’ approach does not consider multiple morphological, genetic, and biogeographic evidences that strongly indicate the distinctiveness of these taxa and their origin in separate Pleistocene refugia (Fedorov et al. 1999, 2003; Fedorov 1999; Fedorov & Stenseth 2001; Wilson & Reeder 2005; Abramson et al. 2008, 2018; Lagerholm et al. 2014; Wilson et al. 2017; Abramson & Petrova 2018). It was shown that L. lemmus, L. sibiricus, and L. amurensis can hybridize with each other and that these three taxa shared a strong reproductive isolation from the Beringian species Lemmus nigripes (True, 1894) (Pokrovski et al. 1984). Several recent studies provided DNA sequences of topotypes for most nominal taxa described from Northern Eurasia and North America that can serve as the robust molecular basis for an integrative taxonomic revision (Fedorov et al. 2003; Abramson & Petrova 2018; Abramson et al. 2018). Based on these earlier works (Fedorov et al. 2003; Abramson et al. 2008, 2018; Abramson & Petrova 2018) and our own data, we separate six prospective species of the true lemmings, which are characterized here (see Appendix 1). Our view on the genus should be considered as a preliminary taxonomic hypothesis that needs future research efforts using nuclear DNA gene sequences and genomic datasets.

Acknowledgements The collection of lemmings from Novaya Zemlya in 2015 was performed during the ‘Floating University’ Scientific Expedition of the Northern Arctic Federal University. Russian Foundation for Basic Research supported I.N.B. and V.M.S. under grant No. 19-34-90012, and A.V.K. under grant No. 18-44-292001. The Ministry of Science and Higher Education of the Russian Federation supported this work as follows: project АААА-А17-117033010132-2 to V.M.S. and N.A.Z., and project АААА-А18-118012390161-9 to M.Y.G. and A.A.T. The Russian Science Fundation supported A.V.K. and I.N.B. under project No. 19-04-00066. We are grateful to the reviewers who helped us to improve earlier versions of this paper.

110

SPITSYN ET AL.

References

Abramson, N., Dokuchaev, N. & Petrova, T. (2018) Long-standing taxonomic and nomenclature issue of Lemmus obensis chrysogaster Allen, 1903 (Rodentia, Cricetidae) resolved. Mammalia, 82, 167–172. https://doi.org/10.1515/mammalia-2016-0081 Abramson, N. I., Kostygov, A. Y. & Rodchenkova, E. N. (2008) The taxonomy and phylogeography of Palaearctic true lemmings (Lemmus, Cricetidae, Rodentia): New insights from cyt b data. Russian Journal of Theriology, 7(1), 17–23. https://doi.org/10.15298/rusjtheriol.7.1.03 Abramson, N. I. & Petrova, T. V. (2018) Genetic analysis of type material of the Amur lemming resolves nomenclature issues and creates challenges for the taxonomy of true lemmings (Lemmus, Rodentia: Cricetidae) in the eastern Palearctic. Zoological Journal of the Linnean Society, 182(2), 465–477. https://doi.org/10.1093/zoolinnean/zlx044 Adkins, R. M., Gelke, E. L., Rowe, D. & Honeycutt, R. L. (2001) Molecular phylogeny and divergence time estimates for major rodent groups: evidence from multiple genes. Molecular Biology and Evolution, 18, 777–791. https://doi.org/10.1093/oxfordjournals.molbev.a003860 Allen, G. M. (1914) Mammals. Notes on the birds and mammals of the Arctic coast of east Siberia. Proceedings of the New England Zoölogical Club, 5, 49–66. Andersson, M. (2015) Aposematism and crypsis in a rodent: antipredator defence of the Norwegian lemming. Behavioral Ecology and Sociobiology, 69, 571–581. https://doi.org/10.1007/s00265-014- 1868-7 Bandelt, H. J., Forster, P. & Röhl, A. (1999) Median-joining networks for inferring intraspecific phylogenies. Molecular Biology and Evolution, 16(1), 37–48. https://doi.org/10.1093/oxfordjournals.molbev.a026036 Baranova, G. I. & Gromov, I. M. (2003) Rodentia. Catalogue of Type Specimens in the Collections of the Zoological Institute, 4, 1–100. Berger, A., Crucifix, M., Hodell, D. A., Mangili, C., McManus, J. F., Otto Bliesner, B., Pol, K., Raynaud, D., Skinner, L. C., Tzedakis, P. C., Wolff, E. W., Yin, Q. Z., Abe-Ouchi, A., Barbante, C., Brovkin, V., Cacho, I., Capron, E., Ferretti, P., Ganopolski, A., Grimalt, J. O., Hönisch, B., Kawamura, K., Landais, A., Margari, V., Martrat, B., Masson-Delmotte, V., Mokeddem, Z., Parrenin, F., Prokopenko, A. A., Rashid, H., Schulz, M. & Vazquez Riveiros, N. (2016) Interglacials of the last 800,000 years. Reviews of Geophysics, 54, 162–219. https://doi.org/10.1002/2015RG000482 Christoff, A. U., Vieira, E. M., Oliveira, L. R., Gonçalves, J. W., Valiati, V. H. & Tomasi, P. S. (2016) A new species of Juliomys (Rodentia, Cricetidae, Sigmodontinae) from the Atlantic Forest of Southern Brazil. Journal of Mammalogy, 97, 1469–1482. https://doi.org/10.1093/jmammal/gyw082 Conroy, C. J. & Cook, J. A. (1999) MtDNA evidence for repeated pulses of speciation within arvicoline and murid rodents. Journal of Mammalian Evolution, 6, 221–245. https://doi.org/10.1023/A:1020561623890 Coulson, S. J., Convey, P., Aakra, K., Aarvik, L., Ávila-Jiménez, M. L., Babenko, A., Biersma, E. M., Boström, S., Brittain, J. E., Carlsson, A. M., Christoffersen, K., De Smet, W. H., Ekrem, T., Fjellberg, A., Füreder, L., Gustafsson, D., Gwiazdowicz, D. J., Hansen, L. O., Holmstrup, M., Hullé, M., Kaczmarek, Ł., Kolicka, M., Kuklin, V., Lakka, H.-K., Lebedeva, N., Makarova, O., Maraldo, K., Melekhina, E., Ødegaard, F., Pilskog, H. E., Simon, J. C., Sohlenius, B., Solhøy, T., Søli, G., Stur, E., Tanasevitch, A., Taskaeva, A., Velle, G., Zawierucha, K. & Zmudczyńska-Skarbek, K. (2014) The terrestrial and freshwater invertebrate biodiversity of the archipelagoes of the Barents Sea; Svalbard, Franz Josef Land and Novaya Zemlya. Soil Biology and Biochemistry, 68, 440–470. https://doi.org/10.1016/j.soilbio.2013.10.006 Desmarest, A. G. (1822) Mammalogie ou description des espèces des Mammifères. Seconde partie, contenant les ordres des rongeurs, des edentes, des pachydermes, des ruminans et des cretaces. Chez Mme veuve Agasse, Imprimeur-Libraire, Paris, 556 pp. Drummond, A. J. & Rambaut, A. (2007) BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evolutionary Biology, 7(214). https://doi.org/10.1186/1471-2148-7-214 Drummond, A. J., Suchard, M. A., Xie, D. & Rambaut, A. (2012) Bayesian phylogenetics with BEAUti and the BEAST 1.7. Molecular Biology and Evolution, 29, 1969–1973. https://doi.org/10.1093/molbev/mss075 Elias, S. A. & Brigham-Grette, J. (2013) Late Pleistocene Glacial Events in Beringia. In: Elias, S. A. &

Ecologica Montenegrina, 40, 2021, 93-117 111

A NEW NORWEGIAN LEMMING SUBSPECIES FROM NOVAYA ZEMLYA

Mock, C. J. (Eds.), Encyclopedia of Quaternary Science. Elsevier Science Publishers B.V., Amsterdam, pp. 191–201. Ellerman, J. R. (1949) LXX. On the prior name for the Siberian Lemming and the genotype of Glis Erxleben. Annals and Magazine of Natural History Series, 12(2), 893–894. https://doi.org/10.1080/00222934908654032 Fedorov, V., Goropashnaya, A., Jarrell, G. H. & Fredga, K. (1999) Phylogeographic structure and mitochondrial DNA variation in true lemmings (Lemmus) from the Eurasian Arctic. Biological Journal of the Linnean Society, 66, 357–371. https://doi.org/10.1111/j.1095-8312.1999.tb01896.x Fedorov, V. B. (1999) Contrasting mitochondrial DNA diversity estimates in two sympatric genera of Arctic lemmings (Dicrostonyx, Lemmus) indicate different responses to Quaternary environmental fluctuations. Proceedings of the Royal Society B: Biological Sciences, 266, 621–626. https://doi.org/10.1098/rspb.1999.0681 Fedorov, V. B., Goropashnaya, A. V., Jaarola, M. & Cook, J. A. (2003) Phylogeography of lemmings (Lemmus): no evidence for postglacial colonization of Arctic from the Beringian refugium. Molecular Ecology, 12, 725–731. https://doi.org/10.1046/j.1365-294X.2003.01776.x Fedorov, V. B. & Stenseth, N. C. (2001) Glacial survival of the Norwegian lemming (Lemmus lemmus) in Scandinavia: inference from mitochondrial DNA variation. Proceedings of the Royal Society B: Biological Sciences, 268(1469), 809–814. https://doi.org/10.1098/rspb.2001.1584 Hall, T. A. (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series, 41, 95–98. Hao, Q., Wang, L., Oldfield, F. & Guo, Z. (2015) Extra-long interglacial in Northern Hemisphere during MISs 15-13 arising from limited extent of Arctic ice sheets in glacial MIS 14. Scientific Reports, 5(12103), 1–8. https://doi.org/10.1038/srep12103 Hinton, M. A. C. (1926) Monograph of the voles & lemmings (Microtinae), living and extinct. Richard Clay & Sons, Ltd., London, 488 pp. Hoang, D. T., Chernomor, O., von Haeseler, A., Minh, B. Q. & Vinh, L. S. (2017) UFBoot2: Improving the ultrafast bootstrap approximation. Molecular Biology and Evolution, 35, 518–522. https://doi.org/10.1093/molbev/msx281 Justiniano, R., Schenk, J. J., Balete, D. S., Rickart, E. A., Esselstyn, J. A., Heaney, L. R. & Steppan, S. J. (2015) Testing diversification models of endemic Philippine forest mice (Apomys) with nuclear phylogenies across elevational gradients reveals repeated colonization of isolated mountain ranges. Journal of Biogeography, 42, 51–64. https://doi.org/10.1111/jbi.12401 Kapli, P., Lutteropp, S., Zhang, J., Kobert, K., Pavlidis, P., Stamatakis, A. & Flouri, T. (2017) Multi-rate Poisson tree processes for single-locus species delimitation under maximum likelihood and Markov chain Monte Carlo. Bioinformatics, 33, 1630–1638. https://doi.org/10.1093/bioinformatics/btx025 Kausrud, K. L., Mysterud, A., Steen, H., Vik, J. O., Østbye, E., Cazelles, B., Framstad, E., Eikeset, A. M., Mysterud, I., Solhøy, T. & Stenseth, N. C. (2008) Linking climate change to lemming cycles. Nature, 456, 93–97. https://doi.org/10.1038/nature07442 Kerr, R. (1792) The animal kingdom, or zoological system, of the celebrated Sir Charles Linnæus: containing a complete systematic description, arrangement, and nomenclature, of all the known species and varieties of the mammalia, or animals which give suck to their young. Printed for A. Strahan, and T. Cadell, and W. Creech, Edinburgh, 644 pp. Kumar, S., Stecher, G. & Tamura, K. (2016) MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Molecular Biology and Evolution, 33, 1870–1874. https://doi.org/10.1093/molbev/msw054 Kvie, K. S., Heggenes, J., Anderson, D. G., Kholodova, M. V., Sipko, T., Mizin, I. & Røed, K. H. (2016) Colonizing the High Arctic: mitochondrial DNA reveals common origin of Eurasian Archipelagic Reindeer (Rangifer tarandus). PLoS ONE, 11(11), e0165237. https://doi.org/10.1371/journal.pone.0165237 Lagerholm, V. K., Norén, K., Ehrich, D., Ims, R. A., Killengreen, S. T., Abramson, N. I., Niemimaa, J., Angerbjörn, A., Henttonen, H. & Dalén, L. (2017) Run to the hills: gene flow among mountain areas leads to low genetic differentiation in the Norwegian lemming. Biological Journal of the Linnean Society, 121(1), 1–14. https://doi.org/10.1093/biolinnean/blw020 Lagerholm, V. K., Sandoval‐Castellanos, E., Ehrich, D., Abramson, N. I., Nadachowski, A., Kalthoff, D. C., Germonpré, M., Angerbjörn, A., Stewart, J. R. & Dalén, L. (2014) On the origin of the Norwegian

112

SPITSYN ET AL.

lemming. Molecular Ecology, 23, 2060–2071. https://doi.org/10.1111/mec.12698 Le Vaillant, M., Erlandsson, R., Elmhagen, B., Hörnfeldt, B., Eide, N. E. & Angerbjörn, A. (2018) Spatial distribution in Norwegian lemming Lemmus lemmus in relation to the phase of the cycle. Polar Biology, 41, 1391–1403. https://doi.org/10.1007/s00300-018-2293-6 Linnaei, C. (1758) Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis (Vol. 1). Imprensis Direct, Laurentii Salvii, Holmiae, 532 pp. Lissovsky, A. A., Sheftel, B., Saveljev, A. P., Ermakov, O. A., Kozlov, Y. A., Smirnov, D. G., Stakheev, V. V. & Glazov, D. M. (2019) Mammals of Russia: species list and applied issues. In: Titov, S. V. (Ed.), Archives of Zoological Museum of Moscow State University (Vol. 56). KMK Scientific Press, Moscow, pp. 1–191. Lobo, J., Costa, P. M., Teixeira, M. A. L., Ferreira, M. S. G., Costa, M. H., & Costa, F. O. (2013). Enhanced primers for amplification of DNA barcodes from a broad range of marine metazoans. BMC Ecology, 13(34), 1–8. https://doi.org/10.1186/1472-6785-13-34 Lopatin, A. V., Solomonov, N. G., Serdyuk, N. V., Maschenko, E. N., Mukha, D. V. & Agadjanyan, A. K. (2019) A finding of a frozen mummy of a lemming (Rodentia, Cricetidae, Lemmus) in the Upper Pleistocene of Yakutia. Doklady Biological Sciences, 489, 169–173. https://doi.org/10.1134/S0012496619060036 Makhrov, A. A., Bolotov, I. N., Spitsyn, V. M., Gofarov, M. Y. & Artamonova, V. S. (2019) Resident and anadromous forms of Arctic charr (Salvelinus alpinus) from North-East Europe: An example of high ecological variability without speciation. Doklady Biochemistry and Biophysics, 485, 119–122. https://doi.org/10.1134/S1607672919020066 Markova, A. K. & Puzachenko, A. Y. (2017) Small mammal fauna in Europe during the second half of the Middle Pleistocene. Fossil Imprint, 73(1–2), 48–66. https://doi.org/10.2478/if-2017-0002 Melles, M., Brigham-Grette, J., Minyuk, P. S., Nowaczyk, N. R., Wennrich, V., DeConto, R. M., Anderson, P. M., Andreev, A. A., Coletti, A., Cook, T. L., Haltia-Hovi, E., Kukkonen, M., Lozhkin, A. V., Rosén, P., Tarasov, P., Vogel, H. & Wagner, B. (2012) 2.8 Million Years of Arctic Climate Change from Lake El’gygytgyn, NE Russia. Science, 337, 315–320. https://doi.org/10.1126/science.1222135 Miller, G. S. & Kellogg, R. (1955) List of North American Recent Mammals. Bulletin of the United States National Museum, 205, 1–954. https://doi.org/10.5479/si.03629236.205 Miller, M., Pfeiffer, W. & Schwartz, T. (2010) Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In: 2010 Gateway Computing Environments Workshop (GCE). IEEE, New Orleans, LA, pp. 1–8. https://doi.org/10.1109/GCE.2010.5676129. Nguyen, L.-T., Schmidt, H. A., von Haeseler, A., Minh, B. Q. (2015) IQ-TREE: A fast and effective stochastic algorithm for estimating maximum likelihood phylogenies. Molecular Biology and Evolution, 32, 268–274. https://doi.org/10.1093/molbev/msu300 Pokrovski, A. V., Kuznetsova, I. A. & Cheprakov, M. I. (1984) Hybridological studies of reproductive isolation of the Lemmus palaearctic species (Rodentia, Cricetidae). Zoologicheskiĭ zhurnal, 63, 904– 911. Potapov, G. S., Kondakov, A. V., Filippov, B. Yu., Gofarov, M. Yu., Kolosova, Y. S., Spitsyn, V. M., Tomilova, A. A., Zubrii, N. A. & Bolotov, I. N. (2019) Pollinators on the polar edge of the Ecumene: taxonomy, phylogeography, and ecology of bumble bees from Novaya Zemlya. ZooKeys, 866, 85– 115. https://dx.doi.org/10.3897/zookeys.866.35084 Potapov, G. S., Kondakov, A. V., Spitsyn, V. M., Filippov, B. Yu., Kolosova, Yu. S., Zubrii, N. A. & Bolotov, I. N. (2018) An integrative taxonomic approach confirms the valid status of Bombus glacialis, an endemic bumblebee species of the High Arctic. Polar Biology, 41, 629–642. https://doi.org/10.1007/s00300-017-2224-y Rambaut, A., Drummond, A. J., Xie, D., Baele, G. & Suchard, M. A. (2018) Posterior summarization in Bayesian phylogenetics using Tracer 1.7. Systematic Biology, 67, 901–904. https://doi.org/10.1093/sysbio/syy032 Ronquist, F., Teslenko, M., van der Mark, P., Ayres, D. L., Darling, A., Höhna, S., Larget, B., Liu, L., Suchard, M. A. & Huelsenbeck, J. P. (2012) MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology, 61, 539–542. https://doi.org/10.1093/sysbio/sys029 Schenk, J. J., Rowe, K. C. & Steppan, S. J. (2013) Ecological opportunity and incumbency in the

Ecologica Montenegrina, 40, 2021, 93-117 113

A NEW NORWEGIAN LEMMING SUBSPECIES FROM NOVAYA ZEMLYA

diversification of repeated continental colonizations by muroid rodents. Systematic Biology, 62, 837– 864. https://doi.org/10.1093/sysbio/syt050 Serebryanny, L. & Malyasova, E. (1998) The quaternary vegetation and landscape evolution of Novaya Zemlya in the light of palynological records. Quaternary International, 45–46, 59–70. https://doi.org/10.1016/S1040-6182(97)00007-4 Spitsyn, V. M. & Bolotov, N. I. (2020) First record of Lepus timidus (Linnaeus, 1758) from Novaya Zemlya, Russian Arctic (Lagomorpha, Leporidae). Check List, 16, 59–61. https://doi.org/10.15560/16.1.59 Steppan, S. J. & Schenk, J. J. (2017) Muroid rodent phylogenetics: 900-species tree reveals increasing diversification rates. PLoS ONE, 12(8), e0183070. https://doi.org/10.1371/journal.pone.0183070 Taeger, A., Blank, S. M. & Liston, A. D. (2006) European sawflies (Hymenoptera: Symphyta) – a species checklist for the countries. In: Blank, S. M., Schmidt, S. & Taeger, A. (Eds.), Recent sawfly research: synthesis and prospects. Goecke & Evers, Keltern, pp. 399–504. Trifinopoulos, J., Nguyen, L. T., von Haeseler, A. & Minh, B. Q. (2016) W-IQ-TREE: a fast online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Research, 44(W1), W232–W235. https://doi.org/10.1093/nar/gkw256 Wilson, D. E., Lacher, T. E. & Mittermeier, R. A. (Eds.) (2017) Handbook of the Mammals of the World (Vol. 7. Rodents II). Lynx Edicions, Barcelona, 1008 pp. Wilson, D. E. & Reeder, D. M. (Eds.) (2005) Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Johns Hopkins University Press, Baltimore, MD, 2142 pp. Yu, Y., Harris, A. J., Blair, C. & He, X. (2015) RASP (Reconstruct Ancestral State in Phylogenies): a tool for historical biogeography. Molecular Phylogenetics and Evolution, 87, 46–49. https://doi.org/10.1016/j.ympev.2015.03.008 Zhang, J., Kapli, P., Pavlidis, P. & Stamatakis, A. (2013) A general species delimitation method with applications to phylogenetic placements. Bioinformatics, 29, 2869–2876. https://doi.org/10.1093/bioinformatics/btt499

114

SPITSYN ET AL.

Appendix 1

A brief taxonomic overview of the true lemmings (Lemmus spp.)

Order Rodentia Bowdich, 1821 Family Cricetidae Fischer, 1817 Genus Lemmus Link, 1795 Type species: Mus lemmus Linnaeus, 1758.

Lemmus lemmus species complex Distribution: Northern Eurasia. Comments: This informal group contains four biological species, i.e. Norwegian L. lemmus (Linnaeus, 1758), Siberian L. sibiricus (Kerr, 1792), East Siberian L. aff. sibiricus ‘Eastern Clade’, and Amur L. amurensis Vinogradov, 1924 lemmings. Phylogenetically, L. lemmus and L. sibiricus are most closely related species (Table 4). These two species were not supported as separate MOTUs by the species delimitation modeling (Fig. 2). However, we consider them as young allopatric species that originated in distant Pleistocene refugia (Western Europe + Novaya Zemlya vs Siberia). The level of DNA divergences between L. lemmus and L. sibiricus corresponds well to interspecific differences (i.e. the mean cytb and COI p-distance >2%; several diagnostic nucleotide substitutions in the nuclear GHR and RAG1 gene fragments) (Tables 4-5). Conversely, the level of cytb divergence of these species from other taxa (4.4-4.9%) is at least twice their distance, as is the divergence between L. aff. sibiricus ‘Eastern Clade’ and L. amurensis (4.5%). The two latter taxa were fully supported as separate species-level units by our species delimitation modeling (Fig. 2).

Norwegian Lemming Lemmus lemmus (Linnaeus, 1758) Type locality: alpibus Lapponicus [Mountains of Lappmark, Sweden] (Linnaei, 1758). Synonyms: L. norvegicus Desmarest, 1822 [TL: Les montagnes de la Norwege et la Laponie suedoise <...> les montagnes de la Laponie russe] (Desmarest 1822; Wilson & Reeder 2005; Wilson et al. 2017); L. borealis Nilsson, 1829 [a replacement name for Mus lemmus Linnaeus, 1758] (Wilson & Reeder 2005; Wilson et al. 2017); Cuniculus iterator Gistel, 1850 [TL: Russian Lapland =Kola Peninsula, Russia] (Wilson & Reeder 2005; Wilson et al. 2017). Distribution: European mountain species with a disjunctive range: Fennoscandia (nominate subspecies) and Novaya Zemlya (L. lemmus chernovi ssp. nov.). Comments: The insular geographic race on Novaya Zemlya is isolated from the nominate subspecies by a 600 km wide marine barrier (Fig. 1A).

Siberian Lemming Lemmus sibiricus (Kerr, 1792) Type locality: The northern parts of the Uralian chain of mountains, and on the river Oby [cytb sequence of a topotype: AJ012671] (Kerr 1792; Fedorov et al. 1999). Synonyms: L. obensis Brants, 1827 [TL: Mouth of the Obi River, Siberia, Russia] (Ellerman 1949; Hinton 1926); L. obensis bungei Vinogradov, 1926 [TL: Mostakh Island near the Lena River mouth, Yakutia, Russia; cytb sequence of a topotype: FJ025981] (Abramson et al. 2008; Baranova & Gromov 2003); L. sibiricus West Palearctic sensu Abramson et al., 2008 (Abramson et al. 2008). Distribution: Euro-Siberian Arctic species. Arctic Europe east of the Kola Peninsula and Arctic Siberia up to the Lena Delta (Abramson et al. 2008; Abramson & Petrova 2018). Comments: L. obensis was considered a junior synonym of Kerr’s taxon based on a close proximity of the type localities and morphological data (Ellerman 1949). This solution was confirmed on the basis of molecular genetic research (Abramson et al. 2008). Topotypes of L. obensis bungei were considered belonging to L. sibiricus based on DNA sequence data (Abramson et al. 2008).

Amur Lemming Lemmus amurensis Vinogradov, 1924 Type locality: Near Pikan [River mouth] on Zeya River, Amursk Oblast [cytb sequence of the holotype: KX455628] (Baranova & Gromov 2003; Abramson & Petrova 2018). Synonyms: Not available.

Ecologica Montenegrina, 40, 2021, 93-117 115

A NEW NORWEGIAN LEMMING SUBSPECIES FROM NOVAYA ZEMLYA

Distribution: East Siberian mountain species with a restricted range: Transbaikalia, South Yakutia, and the Upper Amur Basin (Abramson & Petrova 2018). Comments: The taxonomy and distribution of this species was clarified recently based on DNA sequence data (Abramson & Petrova 2018).

East Siberian Lemming Lemmus aff. sibiricus ‘Eastern Clade’ Possible synonyms: Lemmus paulus Allen, 1914 [Kalaschowo, near the mouth of the Kolyma River, northeastern Siberia [cytb sequence of a possible topotype: AJ012674] (Allen 1914; Fedorov et al. 1999)]; L. obensis novosibiricus Vinogradov, 1924 [TL: Durnova Bay, Kotelny Island, New Siberian Islands, Russia; cytb sequence of a topotype: AY219141] (Fedorov et al. 2003; Baranova & Gromov 2003; Abramson & Petrova 2018); L. amurensis ognevi Vinogradov, 1933 [TL: a mountain pass from Inganni River (a tributary of the Barayi River flowing to the Aldan River) to Nelgese River (a tributary of the Adytcha River), approx. 64.40°N, 134.04°E, Verkhoyansk District, Yakutia, Russia; cytb sequence of the holotype: KX455622] (Baranova & Gromov 2003; Abramson & Petrova 2018); L. sibiricus portenkoi Chernyavskii, 1967 [TL: Environs of Mount Tundrovaya, Wrangel Island, Russia; cytb sequence of a topotype: AJ012677] (Fedorov et al. 1999; Baranova & Gromov 2003); L. sibiricus East Palearctic sensu Abramson et al., 2008 (Abramson et al. 2008). Distribution: East Siberian Arctic species: east of the Lena Delta via the Yana-Indigirka Lowlands and Kolyma Highlands to Kamchatka; New Siberian Islands; and Wrangel Island (Abramson & Petrova 2018). Comments: Abramson & Petrova (2018) applied the name L. ognevi to this species. However, L. paulus may be the oldest available name, although the type locality of this nominal taxon is uncertain. The Wrangel Island Lemming L. sibiricus portenkoi shares shallow divergence from other populations of East Siberian Lemming from mainland and the New Siberian Islands, and represents an intraspecific form of this species. The taxonomic status of this species needs special research efforts.

Lemmus trimucronatus species complex Distribution: Northern Asia east of the Kolyma River (Chukotka and Kamchatka peninsulas), and northern North America (Fedorov et al. 2003). Comments: This informal category contains two sister species, i.e. Beringian L. nigripes (True, 1894), and Canadian L. trimucronatus (Richardson, 1825) lemmings. The mean cytb p-distance between these taxa is as high as 7.2% (Table 4), and they were fully supported as separate species-level units by our species delimitation modeling (Fig. 2).

Canadian Lemming Lemmus trimucronatus (Richardson, 1825) Type locality: Point Lake, 65.2523°N, 113.1862°W, Mackenzie District, Northwest Territories, Canada [cytb sequence of a topotype: AY219162] (Miller & Kellogg 1955; Fedorov et al. 2003). Synonyms: Arvicola (Lemmus) helvolus Richardson, 1828 [TL: Near headwaters of one of southern tributaries of Peace River, or between there and Jasper House region, Alberta, Canada] (Miller & Kellogg 1955). Distribution: Nearctic species, the range of which covers northern North America from the eastern edge of Alaska through Yukon and Northwest Territories to Nunavut (Fedorov et al. 2003). Comments: Previously, this name was applied to both species-level clades of this species complex (Fedorov et al. 2003), and Lemmus trimucronatus was thought to occur in eastern Russia (Fedorov et al. 2003; Wilson & Reeder 2005; Abramson et al. 2008; Wilson et al. 2017; Abramson & Petrova 2018; Abramson et al. 2018). However, it is a Nearctic species, which, in contrast to the next taxon, did not cross the Bering Land Bridge.

Beringian Lemming Lemmus nigripes (True, 1894) Type locality: Saint George Island, approx. 56.5950°N, 169.5168°W, Pribilof Islands, Alaska, USA [cytb sequence of a topotype: AY219164] (Miller & Kellogg 1955; Fedorov et al. 2003). Synonyms: L. alascensis Merriam, 1900 [TL: Point Barrow, approx. 71.3338°N, 156.5970°W, Alaska, USA; cytb sequence of a topotype: AY219147] (Miller & Kellogg 1955; Fedorov et al. 2003); L. yukonensis Merriam, 1900 [TL: Charlie Creek (=Charley River), approx. 65.2968°N, 142.7363°W, Yukon River, Alaska, USA] (Miller & Kellogg 1955); L. obensis chrysogaster Allen, 1903 [TL: vicinity of Gichiga,

116

SPITSYN ET AL. approx. 61.9492°N, 160.3810°E, Magadan Region, Russia; cytb sequence of a topotype: KT877362] (Abramson et al. 2018); L. minusculus Osgood, 1904 [TL: Kakhtul River near its junction with Malchatna River, approx. 59.6514°N, 157.0733°W, Alaska, USA; cytb sequence of a topotype: AY219153] (Miller & Kellogg 1955; Fedorov et al. 2003); L. flavescens Vinogradov, 1926 [TL: Kamchatka, Russia; cytb sequence of the lectotype: KX455619] (Abramson & Petrova 2018); L. harroldi Swarth, 1931 [TL: Nunivak Island, approx. 60.3646°N, 166.2422°W, Alaska, USA] (Miller & Kellogg 1955). Distribution: Beringian species, the range of which covers northeastern Asia (Chukotka, northeastern edge of the Magadan Region, and a local isolate on Kamchatka) and northwestern North America (Aleutian Islands, Alaska, and western edge of Yukon) (Fedorov et al. 2003; Abramson & Petrova 2018). Comments: This species has no less than six synonyms introduced for samples from both sides of the Bering Strait. Most of these names were revised on the basis of sequenced topotypes (Fedorov et al. 2003; Abramson & Petrova 2018; Abramson et al. 2018). Several samples of Lemmus nigripes from Kamchatka and southern Chukotka share divergent cytb haplotypes, and populations in these regions can represent subspecies-level taxa. Hence, the intraspecific taxonomy of the Beringian Lemming needs to be revised based on an expanded molecular dataset.

Ecologica Montenegrina, 40, 2021, 93-117 117