Transgenerational Genetic Effects in Mouse Models Of

Home , Epistasis, Ligand (biochemistry)

TRANSGENERATIONAL GENETIC EFFECTS IN MOUSE MODELS

OF COMPLEX TRAITS

VICKI R. NELSON

Submitted in partial fulfillment of the requirements

For the degree of Doctor of Philosophy

Dissertation Adviser: Dr. Joseph Nadeau

Department of Genetics

CASE WESTERN RESERVE UNIVERSITY

August, 2010 CASE WESTERN RESERVE UNIVERSITY

SCHOOL OF GRADUATE STUDIES

We hereby approve the thesis/dissertation of

______

candidate for the ______degree *.

(signed)______(chair of the committee)

______

(date) ______

*We also certify that written approval has been obtained for any proprietary material contained therein. Table of Contents

List of Tables ...... 7

List of Figures ...... 9

Acknowledgements ...... 11

List of Abbreviations ...... 12

Chapter I. Heritability of Phenotype ...... 15

Mendelian Genetics and Human Disease ...... 17

Non-Mendelian Genetics ...... 18

Non-Mendelian Genetics & Human Disease ...... 19

Segregation Distortion ...... 20

Epigenetic Modifications ...... 22

DNA methylation ...... 24

Histone Modification and Chromatin Structure ...... 27

Non-coding RNA ...... 30

Transgenerational effects ...... 35

Transgenerational epigenetic inheritance ...... 35

Transgenerational epistasis ...... 37

Grandparental Effects ...... 38

Chapter II. Testicular Germ Cell Tumors ...... 40

Testicular Cancer in Humans ...... 41

Histological Subtypes ...... 42

Diagnosis and Treatment ...... 44

Cancer Genetics ...... 47

Testicular Cancer Genetics ...... 48

Cancer Epigenetics ...... 49

Epigenetics in germ cells ...... 51

Testicular Cancer in Mice ...... 51

A Mouse Model for TGCTs ...... 52

Mouse Genetics and Testicular Cancer ...... 55

The AID/APOBEC Family ...... 61

Chapter III. Transgenerational genetic effects of the paternal Y chromosome on daughter’s phenotypes ...... 68

Abstract ...... 69

Introduction ...... 70

Materials and Methods ...... 72

Mice ...... 72

Phenotype Analysis ...... 73

Behavioral Testing ...... 74

Results ...... 77

Survey for transgenerational genetic effects ...... 77

Behavioral Testing ...... 84

Discussion...... 87

Chapter IV. The Role of Apobec1 in TGCT Susceptibility, Stem Cell

Derivation and transgenerational epistasis with Dnd1Ter ...... 90

Abstract ...... 91

Introduction ...... 92

Materials and Methods ...... 94

Mice ...... 94

TGCT survey ...... 94

Derivation of mouse embryonic stem cells ...... 94

Results and Discussion ...... 95

IV.1 Apobec1 deficiency has lineage dependent transgenerational

effects on TGCT prevalence ...... 95

Complete deficiency of Apobec1 does not affect TGCT prevalence ...... 97

Partial deficiency of Apobec1 has a lineage dependant affect on

TGCT prevalence ...... 98

Partial and complete Apobec1 deficiencies in the parent exert

different effects on TGCT prevalence in offspring ...... 101

Grandparental rather than parental genotype determines TGCT risk ...... 103

Maternal but not paternal Apobec1 deficiency has a transgenerational

effect on TGCT prevalence in wild-type sons ...... 105

Partial Apobec1 deficiency affects stem cell derivation frequency ...... 109

IV.2 Apobec1 deficiency reduces TGCT prevalence through

transgenerational interaction with Dnd1Ter ...... 112

Transgenerational interaction between maternally-inherited Apobec1

and parental Dnd1Ter increases TGCT risk in null/+ males ...... 115

Wild-type males do not show evidence of transgenerational effects on

TGCTs...... 117

TGCT prevalence in double-mutant males results from additive effects

of Apobec1null and Dnd1Ter ...... 117

IV.3 Interactions between Dnd1 and Apobec1 affect embryonic viability ...... 119

Parental genotypes affect mutant viability in Dnd1 – Apobec1

interaction test crosses ...... 119

Loss of mutant embryos results from a fertilization bias or pre-

implantation defect ...... 120

Maternal Apobec1null reduces the number of Apobec1 deficient male

offspring ...... 124

Parental Dnd1Ter affects segregation of Dnd1 alleles in male offspring

through interaction with Apobec1 ...... 127

Segregation in Females ...... 129

Maternal Apobec1 deficiency reduces the viability of Apobec1

deficient offspring ...... 130

Parental Dnd1Ter affects segregation of Dnd1 alleles in female

offspring through interaction with Apobec1 ...... 133

Parental zygosity for Apobec1null affects Dnd1 allele segregation in

male offspring ...... 135

Dnd1Ter and Apobec1null alleles have an additive effect on the number

of double-mutant offspring ...... 137

Summary ...... 141

Chapter V. Summary and Future Directions ...... 145

Summary ...... 146

Transgenerational genetic effects are common and large ...... 146

Apobec1 as a novel TGCT modifier ...... 148

Transgenerational interactions between Dnd1Ter and Apobec1null ...... 148

Future Directions ...... 150

Are other phenotypes affected by transgenerational effects of the Y

chromosome in CSS-Y daughters? ...... 152

Do transgenerational effects occur in other organisms? ...... 154

Do transgenerational effects contribute to conventional CSS QTLs? ...... 155

How are transgenerational genetic effects transmitted? ...... 157

What is the mechanism affecting segregation in Dnd1-Apobec1

interaction tests?...... 159

Do genetic interactions between Apobec1 and Dnd1 reflect physical or

biological interacts between gene products? ...... 161

Chapter VI. Appendices ...... 163

References ...... 178

List of Tables

Table 1 Timeline of Early Mouse Development ...... 54

Table 2 Frequency of unconventional (transgenerational or social) effects

in CSS panels...... 78

Table 3 TGCT susceptibility is reduced by complete Apobec1 deficiency...... 96

Table 4 Partial and complete Apobec1 deficiencies in the paternal lineage

exert different effects on TGCT prevalence in offspring...... 102

Table 5 TGCT prevalence in males of a Dnd1Ter – Apobec1null interaction

cross ...... 113

Table 6 TGCT prevalence in males of a Dnd1Ter – Apobec1null interaction

cross...... 116

Table 7 Segregation of males in the Apobec1null/+ - Dnd1Ter/+ interaction

test ...... 123

Table 8 Genotype ratios in reciprocal Apobec1null – Dnd1Ter interaction

test crosses...... 125

Table 9 Average litter size in normal in interaction test crosses...... 126

Table 10 Parental effects on allele segregation in male offspring ...... 128

Table 11 Segregation of females in the Apobec1null/+ - Dnd1Ter/+

interaction test ...... 131

Table 12 Ratio of Male:Female offspring is Mendelian in all crosses

tested...... 132

Table 13 Allele segregation in female offspring...... 134

Table 14 Effects of partial and complete Apobec1 deficiency on Dnd1Ter

segregation ...... 136

Table 15 Double-mutant offpring are reduced due to additive, not

epistatic, interactions...... 140

Table 16 –Segregation in Interaction Test Crosses ...... 144

List of Figures

Figure 1 Study design testing for effects of the paternal Y chromosome on

daughters’ phenotypes...... 75

Figure 2 ‘B6’ test versus B6 control females in the B6-ChrA/J and B6-

ChrPWD CSS surveys...... 79

Figure 3 Elevated plus maze and open field tests for anxiety-related

behavior...... 86

Figure 4 Partial Apobec1 deficiency has lineage dependent effects on

TGCT prevalence in partially deficient sons...... 99

Figure 5 TGCT susceptibility in null/+ male offspring is determined by

grandparental Apobec1 genotype...... 104

Figure 6 Lineage dependent effects of parental partial Apobec1 deficiency

on TGCT prevalence in wild-type sons...... 106

Figure 7 Apobec1 deficiency has a transgenerational effect on TGCT

prevalence through the maternal lineage...... 107

Figure 8. Apobec1null affects TGCT prevalence and stem cell derivation

efficiency in a lineage dependant manner...... 110

List of Appendices

Appendix I Complete Data set for Phenotyping Screen ...... 164

Appendix II Complete dataset for Open Field testing ...... 166

Appendix III Complete data set for Elevated Plus Maze Testing ...... 167

Appendix IV Frequency and Magnitude of Phenotypic Effects in B6-

ChrA/J CSS panel ...... 168

Appendix V Magnitude of Phenotypic Effects in B6-ChrPWD CSS panel ...... 169

Appendix VI Complete trait values for multigenic traits in B6-ChrA/J and

B6-ChrPWD panels ...... 170

Appendix VII Reduced TGCT prevalence in 129-Chr2MOLF males ...... 177

Acknowledgements

I would like to acknowledge the many scientists who generously provided their data to the National Institute of Genetics and Jackson Laboratory’s Mouse Phenotype Databases and Drs. Toshihiko Shiroishi and Toyoyuki Takada for providing access to their B6- ChrMSM database, making possible the studies of transgenerational effect frequency and magnitude discussed in Chapter III.

I would like to acknowledge Dr. Haifeng Shao for assistance with the analysis of effect size discussed in Chapter III.

I would like to acknowledge Dr. Nicholas Davidson for kindly providing the 129.Apobec1null mice reported on in Chapter IV.

I would like to acknowledge Dr. Paul Tesar for his expertise and assistance with the culture and genotyping of E3.5 embryos and stem cell derivation experiments reported on in Chapter IV.

I would like to acknowledge Dr. Philip Anderson for assistance with genotyping of Dnd1 and Apobec1 mutants reported on in Chapter IV

I would like to acknowledge Dr. Gemma Casadesus and Jennifer Reeves for advice and guidance with the behavior tests.

I would like to thank Diane Lui and Vihas Abraham for their assistance in genotyping and TGCT surveys throughout the course of these studies.

I would like to thank Dr. Philip Anderson, Dr. Jason Heaney and Jennifer Zechel for many insightful discussions and their willingness to share the joys of complex and unpredictable data in the world of TGCTs.

List of Abbreviations

CSS(s) – Chromosome Substitution Strain(s)

mRNP - Messenger RiboNucleoProtein

RdDM - RNA-directed DNA methylation

TGCT – Testicular Germ Cell Tumor

Mouse Nomenclature:

(+/+)c – wild-type 129S1/SvImJ mice obtained from Jackson Labs and bred as an isolated

colony; used as controls screened concurrently with these studies

(+/+)p – wild-type 129 mice published in previous studies

(+/+)wt – wild-type 129 mice obtained from parental test crosses containing one or more

mutations on the 129 background

♀ x ♂ -- All test crosses are given female x male unless otherwise indicated

Transgenerational Genetic Effects In Mouse Models

Of Complex Traits

Abstract

VICKI R. NELSON

Genetics has been invaluable in advancing the understanding of complex trait and disease inheritance, providing insight to the genes and pathways underlying heritable phenotypes.

However, the variants contributing to many highly heritable human diseases have remained largely undetectable or ‘missing’ in biomedical research. Many possibilities exist for why the causative variants may remain undetected including the additive effects of many genes with small effects, overestimates of heritability, epistatic interactions between variants and epigenetic inheritance.

The goal of my project was to characterize transgenerational genetic effects, resulting from genetic variants in previous generations that are not inherited in the at-risk individuals, and their role in the inheritance of complex phenotypes. This project involved two components. First, I examined the frequency and magnitude of transgenerational effects using Y-chromosome substitution strains (CSSs) to generate genetically identical females with genetically distinct parents and found that transgenerational genetic effects occur at similar rates and with similarly large effects

13 compared to conventional risk loci in CSSs. I concluded that transgenerational effects contribute to phenotypic inheritance at an appreciable frequency and magnitude. Second,

I identified Apobec1 as a novel genetic modifier of testicular cancer risk and characterized the lineage-specific and transgenerational effects of Apobec1, an RNA- editing enzyme, on the prevalence of testicular germ cell tumors (TGCTs) and efficiency of stem cell derivation. Finally, I identified transgenerational genetic epistasis between

Apobec1 deficiency and Dnd1Ter, an established TGCT risk enhancer, affecting TGCT prevalence and allele segregation in offspring. I concluded that RNA biology, and possibly RNA-editing, play a role in TGCT pathogenesis and possibly in mediating transgenerational inheritance.

Chapter I.

Heritability of Phenotype

The association between genotype and phenotype lies at the center of genetic research.

In recent years, a greater understanding of human disease and complex trait inheritance

has been achieved through the identification of genes underlying many highly heritable

phenotypes. Investigation of traits inherited in a simple Mendelian pattern had been the

primary focus until advances in technology made available genome-wide, high

throughput technologies necessary for dissecting complex traits. These technologies

allow study of complex trait inheritance including many prevalent human disorders with

a strong, unidentified hereditable component such as diabetes, cancer and heart disease.

Despite these advances, genes underlying many common diseases have remained remarkably elusive. In many instances known genetic variants account for only a small portion of disease heritability, often less than 10% (Altshuler et al., 2008). This observation suggests that many of the determinants underlying disease risk remain undetected or ‘missing’. The identification of this ‘missing heritability’ has gained increasing attention within the field.

Since traditional gene-based modes of discovery have been of limited use in many traits and diseases, modes of inheritance other than ‘gene to phenotype’ are being explored with increasing frequency as possible explanations for the unidentified contributors. In

this project, mouse models of complex traits and human disease were utilized to

investigate the role of transgenerational genetic effects on inheritance and examine the unconventional phenomenon that individual phenotype is substantially affected by non-

inherited genes in the ancestral generations.

Mendelian Genetics and Human Disease

Fundamentally, genetics is the study of inheritance and the passage of phenotype between generations. Conventionally, this occurs by the transmission of genes resulting in discrete traits. Principles governing this passage were first described by Gregor Mendel long before the identification of genes as discreet regions of DNA. Mendelian genetics, underlying many simple diseases, refers to those phenotypes whose heritability is governed by the central tenants based on Mendel’s 19th century experiments (Mendel,

1866; Monaghan and Corcos, 1984). Principally, Mendelian traits are determined by a single gene locus and result from the combination of two inherited “factors”, later identified as genes, contributed equally by each parent.

The principles governing inheritance of Mendel’s “factors” were later described as

Mendel’s Laws. First, when gametes are produced, only one of the two factors is transmitted to offspring. These factors segregate at random such that an equal number of gametes containing either copy are produced. Second, each pair of factors separates at random independent from each other pair. These observations form the basis for the 1:1

“Mendelian” segregation of heterozygous single-gene traits under normal conditions.

Using these same principles, genotype ratios can be predicted when additional segregating alleles are introduced in the parental generations, such as 1:2:1 segregation in offspring of two heterozygous parents. Exceptions were later identified regarding genes in physical proximity to each other allowing for genetic mapping studies correlating traits to physical positions on chromosomes (Sturtevant, 1921).

Mendelian diseases are those that result from the influence of a single gene which obeys

Mendel’s Laws. The association of phenotype with discrete genes utilizing these

principles has led to major advances in clinical care resulting from an understanding of

the underlying biology and heritability of the diseases. Most single-gene diseases are rare

in comparison to complex, multigenic diseases. However, these diseases are often more

severe making an understanding of risk inheritance and identification of at risk

individuals essential.

Examples include neurofibromatosis (attributable to mutations in NF1), cystic fibrosis

(CFTR), and Tay-Sachs disease (HEXA). These diseases result from the inheritance of a

mutant alleles in a single causative gene. These mutations may result in a loss of normal

gene function, often seen in recessive inheritance, or gain of abnormal gene function,

often in diseases that follow a dominant pattern of inheritance. In many cases the disease causing allele is passed directly between generations. In others spontaneous mutations

without prior family history are common.

Non-Mendelian Genetics

Mendel’s first law of genetics states that alleles at a locus will segregate equally to

offspring of a heterozygous parent. Originally, segregation was monitored only by the manifestation of phenotype, using phenotype as a proxy to deduce genotype. Many non-

Mendelian traits, where segregation deviates significantly from the expected Mendelian ratios, have been reported. Phenotypes may appear as non-Mendelian either because they are multigenic, resulting from the combination of many genes which independently do

conform to Mendelian genetics, or because the gene is altered by non-sequence based

factors. Traits in the second category contributed to the foundation of epigenetics,

originally an all encompassing term referring to phenomenon which could not be

explained using conventional Mendelian principles.

During his experiments, Mendel raised the idea that the trait evident in the individual was a result of two factors inherited from the parents. Over the years these factors were termed genes and identified as distinct regions of DNA (Avery et al., 1944; Hershey and

Chase, 1952). Associating traits with causative genes provided a wealth of information

and knowledge about many simple Mendelian traits. However, many complex

phenotypes remain unexplained by gene-based inheritance and a return to a broader

definition of Mendel’s “factors” may be integral to uncovering the mechanisms by which

phenotype is realized. Many non-Mendelian phenotypes have now been attributed to

other mechanisms or genome modifications which themselves may be inherited in a

Mendelian manner. Several non-traditional mechanisms of inheritance have been identified, including epigenetic modifications and RNA-based transmission, and have been shown to decouple the traditional association of phenotype and genotype.

Non-Mendelian Genetics & Human Disease

Many human diseases have also been attributed to non-Mendelian mechanisms. Such non-traditional mechanisms include repeat expansion or parental imprinting. Other diseases are non-Mendelian because the sequence itself is not inherited in a traditional

manner. For example, the genes may be located on sex chromosomes or the

mitochondrial genome.

Phenotype may be determined preferentially by factors inherited from one parent such

that the same alleles or mutations have different effects depending on the direction of inheritance. Maternal or paternal effects may be mediated through a variety of mechanisms including epigenetic changes and RNA-based transmission. Examples of lineage-specific effects are included in discussion of various mechanisms.

Segregation Distortion

While the gene may adhere to a traditional association between genotype and phenotype, a change in the frequency with which alleles are inherited in gametes may also result in

apparent non-Mendelian inheritance. Non-Mendelian segregation may result from a

variety of mechanism divided here into three groups based on the developmental period

during which the effect occurs – pre-fertilization, post-meiotic, and post-fertilization. Pre-

fertilization distortion can be observed when one allele is preferentially selected during

meiotic division. For example, non-Mendelian segregation was reported in mice at the

ovum mutant (Om) locus (Shendure et al., 1998). The cause of altered segregation ratios was later found to be the preferential extrusion of one allele in the polar body of the oocyte during the second meiotic division (Wu et al., 2005). In examples of pre- fertilization distortion, non-Mendelian segregation is typically observed in inheritance of alleles from one parental sex, usually the female (Lyttle, 1993).

Non-Mendelian segregation can also be observed as a result of post-meiotic effects. In this case, an allele may affect the viability of the gamete or may provide a gain or loss of advantage in fertilization. In one well characterized example, males heterozygous at the t-complex transmit the t-haplotype to greater than the expected 50% of offspring, up to

99% (Lyon, 2003). t-haplotypes affect embryonic development, male fertility and can result in segregation distortion of the male germ cells (Schimenti, 2000). Through a syncytium, gene products can be actively shared between developing haploid gametes resulting in phenotypic equality between mature gametes, making the advantage of t sperm a rare exception (Veron et al., 2009). Sperm of t/+ males have a defect in sperm motility, attributed to several t complex distorters (Tcd1-4) which cause a flagellar defect enhancing the transmission rate of Tcr, t complex responder. In contrast to most transcripts, Tcr is expressed post-meiotically in hapoloid spermatids and tethered to prevent transport to neighboring cells. Translation of Tcr mRNA after individualization of spermatozoa allows Tcr to repair the flagellar defect only in t sperm resulting in a selective advantage (Schimenti, 2000; Veron et al., 2009). Consequently, the t allele is inherited at a greatly increased frequency.

Lastly, segregation distortion may result from post-fertilization effects on embryonic or neonatal survival. Many homozygous transgenic knockouts result in early embryonic or neonatal lethality through their effects on a variety of systems and pathways. In less severe cases, a deletion or mutation may affect viability to a lesser degree allowing survival of some but not all offspring of a given genotype. While segregation ratios are normal at fertilization they later skew dramatically and are evident at or shortly after

birth. Since the result of these mechanisms is the same, altered segregation ratios,

identification of the time-point when deviation first appears is an essential first step to

identifying the underlying mechanism reducing in segregation distortion.

Epigenetic Modifications

Reports of stable inheritance patterns not explained by identifiable sequence mutations

date back to the early twentieth century (Rakyan et al., 2001). More recently, increased

consideration of epigenetic modification has allowed an understanding of previously

inexplicable phenomena - paramutation in maize (Brink, 1973; Martienssen, 1996),

position effect variegation in drosophila (Moore et al., 1983; Spofford, 1959), and sex

chromosome dosage compensation (Corry et al., 2009; Mank, 2009). Epigenetic

inheritance through stable germ-line transmission of DNA methylation state and non-

coding RNA-mediated gene silencing have been identified in mammals (Goldberg et al.,

2007).

While the genetic sequence remains unchanged, epigenetic variation can generate

heritable variability in phenotype and gene expression. Epigenetics is a broad term with

many different meanings. Beginning as a field of study interested in the inheritance of

phenotype, the term was first used by Conrad Waddington to define a branch of biology

interested in the interaction between genes and their products (Morange, 2009). The field originally concerned phenomena that could not be explained by known genetic principles and has evolved to investigation of the connection between genotype and phenotype.

Still fueled by unconventional phenomena and inheritance patterns, current epigenetic research focuses on the study of stable changes in gene expression or phenotype in the absence of DNA sequence changes that can be heritable across mitotic or meiotic divisions (Bernstein and Allis, 2005; Goldberg et al., 2007).

Epigenetic also refers to modifications (or epimutations) which are generally accepted to be any non-coding changes to the genome including DNA methylation or chromatin modification (Martin and Zhang, 2007). While not all epigenetic inheritance patterns can be attributed to epigenetic modifications, many have been associated with epigenetic changes leading to the shared terminology. An epimutation produces an altered epigenetic state (or epiallele) often with an effect on regulating gene expression. An epimutation may be metastable, generated through natural random variation, or probabilistic, generated under the influence of a particular genetic or environmental stimuli (Rakyan and Beck, 2006). A heritable epimutation refers to an epiallele which is stable across generations – this may be either metastable or probabilistic. Heritability of an epiallele is not directly coupled with transgenerational epigenetic inheritance, the direct germ-line transmission of the epigenetic state. While transgenerational epigenetic inheritance results from the sequence-independent transmission of an epimutation, not all heritable epialleles are independent of a corresponding change in DNA sequence. A

DNA sequence change or gene deletion may exert its effects by changing the epigenetic state of the genome causing a heritable epigenetic phenotype and recreating the epiallele in subsequent generations without resulting from the direct inheritance of the epigenetic state itself (Youngson and Whitelaw, 2008).

Epimutation comes in many styles and degrees providing a wide range of mechanisms to finely modulate gene expression which allows flexible regulation and fine tuning of gene

expression. The ability for an organism to evolve and adapt within a single generation

and pass the advantageous epialleles to subsequent generations could be advantageous to survival allowing a quicker increase in fitness than evolution through sequence based mutation alone (Bonduriansky and Day, 2009; Youngson and Whitelaw, 2008).

Epimutation may occur with a variety of locations (e.g. histone tails or DNA), modification types (e.g. methylation or acetylation) and extents of modification (e.g. mono- or tri-methylation). Epigenetic modifications can then interact in different patterns adding to the complexity of the epiallele. For example, histone tail methylation may interact with other methylated sites on the same tail (in cis) or those on a different histone (in trans) (Jaenisch and Bird, 2003; Martin and Zhang, 2007; Rakyan et al.,

2001). The variety of types and locations of epigenetic modification adds countless

levels of complexity to the genome and phenotypic variability to the organism.

DNA methylation

DNA methylation is a mechanism of epigenetic inheritance in many organisms, including mammals, and is the most widely recognized mechanism of epigenetic modification. The majority DNA methylation occurs at CpG dinucleotides, with 70% of genomic CpGs being methylated (Rakyan et al., 2001). A high frequency of C to T conversion makes

CpG dinucleotides less common than expected in the genome with an estimated five-fold loss of CpGs in the genome (Gonzalgo and Jones, 1997). A large portion of CpGs are

contained in CpG islands, clusters of CpG dinucleotides that show the expected

frequency of CpGs, that often occur near or within essential regulatory sequences such as

gene promoters and remain largely unmethlyated (Zardo et al., 2005). Overall, DNA

methylation reduces genomic instability and helps to ensure proper gene regulation

throughout development and cellular differentiation (Zardo et al., 2005). DNA

methylation is largely credited with the inactivation of transposable elements and

repetitive sequence elements which could otherwise compromise genomic stability

(Gonzalgo and Jones, 1997). However, methylated cytosine is highly mutagenic,

increasing the already high frequency of C to T conversion in the genome. The high

mutagenic potential of cytosine methylation may explain the relative scarcity and strict

regulation of methylation within CpG islands(Egger et al., 2004). Aberrant DNA

methylation at CpGs can be seen in early carcinogenesis and has been hypothesized to

contribute to the sequence mutation and disease progression (Egger et al., 2004; Feinberg

and Tycko, 2004; Jones and Baylin, 2002).

Methylation patterns are maintained during replication by the DNA methyltransferase,

Dnmt1 (Rakyan et al., 2001). Having fewer mechanisms than DNA transcription to

protect against error, methylation patterns encounter relatively little resistance to

mutation compared to genomic sequences. Where evolution of DNA sequence requires

many generations, methylation allows fast, somatically heritable spatial and temporal

regulation of gene expression within an individual and can provide an adaptive advantage in the face of rapid environmental change (Rakyan et al., 2001).

Additionally, methylation has been identified as a mechanism underlying some human disease phenotypes. For example, Fragile X Syndrome, a common cause of mental retardation, results from expansion of a CGG trinucleotide repeat sequence

(microsatellite) on Chromosome X. Expansion of the microsatellite repeats causes a change in the normal methylation patterns controlling FMR1 expression (Godler et al.,

2010; Naumann et al., 2009). Under normal circumstances a boundary exists between the unmethylated FMR1 promoter and upstream hypermethylation. In Fragile X Syndrome this boundary is lost and methylation spreads to the FMR1 promoter resulting in gene silencing and a loss of the fragile X mental retardation protein (FMRP) (Naumann et al.,

2009).

Imprinting

Imprinting is a process in which genes are marked with lineage-specific methylation patterns during gametogenesis. Inheritance of these patterns, which may be specific to maternal or paternal inheritance, result in the expression or silencing of associated sequences. In each generation these patterns are erased and reset to reflect the parental lineage. Genetic imprinting alters the phenotypic result of a particular sequence through methylation patterns regulating gene expression. For example, loss of imprinting at

11p15.5 and subsequent loss of appropriate gene regulation results in Beckwith-

Wiedemann Syndrome characterized by large birth size and predisposition to many types of tumors.

A classic example of parental imprinting in human disease results from the parent-

specific methylation of 15q11-12 (Robin, 2007). Parental direction dictates the nature of

the disorder despite causative deletions of the same chromosomal region. Deletion of the

region on the paternally inherited chromosome results in Prader-Willi Syndrome

(Horsthemke and Buiting, 2006). Due to imprinting, the maternal alleles of causative

genes, including SNRPN and NDN, are silenced (Nicholls et al., 1998). Deletion of the

active paternal copies results in manifestation of the syndrome characterized by short stature, polyphagia and mild mental retardation (Grody and Noll, 2007). Conversely maternal deletion of paternally-silenced genes in the region results in Angelman

Syndrome characterized by developmental delay, movement disorders and a happy

demeanor (Grody and Noll, 2007).

Histone Modification and Chromatin Structure

Histones, or nucleosomes, are octameric complexes around which DNA is wrapped to

form higher order chromatin structures. Histones are highly evolutionarily conserved

proteins with positively-charged N-terminal tails that can be covalently modified through

acetylation, methylation, phosphorylation, ubiquitination, sumoylation and ribosylation

(Shilatifard, 2006). Histone tail modifications can alter chromatin structure and correlate

with chromatin compaction or relaxation. Through chromatin modulation, histone

modification can regulate many cellular process including gene transcription, replication and DNA repair (Peterson and Laniel, 2004).

While many histone modifications have been identified, practicality dictates that only a few can be examined in a given study. Trimethylation of H3K4 (H3K4me3) and H3K27

(H3K27me3) are often used in tandem as the pattern of methylation at these two sites can reliably differentiate between active and repressed sequences. H3K4me3 is present on actively transcribed genes and H3K27me3 on repressed sequences (Esteller, 2007).

Acetylation

Histone acetylation is catalyzed by histone acetyltransferases (HATs) through the enzymatic transfer of an acetyl group from acetyl-coA to a target lysine residue. Histone acetylation is consistently linked with a more open chromatin structure and gene expression (Choi and Howe, 2009; Gorisch et al., 2005; Grunstein, 1997). Acetylation neutralizes a positive charge on the histone and creates a more open chromatin structure

(Shahbazian and Grunstein, 2007). Eliminating the positive charge has been proposed to lessen the attraction between the positively charged histone and negatively charged DNA

(Shahbazian and Grunstein, 2007). As might be expected since acetylation causes a more open conformation, many proteins associated with transcriptional activation – for example, Gcn5, CBP and SRC-1 – possess histone acetyltransferase activity (Bhaumik et al., 2007). Histone acetylation is reversed by histone deactylases (HDACs). The balance between HAT and HDAC in a particular cell or tissue regulates the cellular histone levels. Many complexes which repress gene transcription contain subunits with HDAC activity, including SMRT and NURD (Bhaumik et al., 2007). Histone acetylation can occur at several different lysine (K) residues in a variety of combinations. Among the

more common histone acetylation sites are H3K9 (Histone 3 Lysine 9), H3K14 and

H4K12 (Bhaumik et al., 2007).

Methylation

Methylation is mediated by histone methyltransferases, which are generally specific to a subset of H3 or H4 residues. In comparison to HATs, histone methyltransferases show much greater specificity for particular histone residues (Bannister and Kouzarides, 2005).

Histone methylation can occur on either lysine or arginine (R) residues in the histone tails

(Shilatifard, 2006). Arginine residues can be mono- or di-methylated (Kouzarides, 2007;

Shilatifard, 2006). The protein arginine methyltransferase (PMRT1) and coactivator arginine methyltransferase (CARM1) are both necessary for arginine methylation

(Shilatifard, 2006). Methylation of H3R17 and H4R3 have been identified and are both associated with transcriptional activation (Li et al., 2007).

Lysine residues can be mono-, di- or tri-methylated (Shilatifard, 2006). Commonly methylated sites include H3 lysines 4, 9, 27 and 36 as well as H4K20 (Bhaumik et al.,

2007). Histone lysine methylation may be either repressive or activating. H3K9 and

H3K27 are common repressive marks usually associated with silenced genes and chromatin condensation. SET-domain containing proteins catalyze methylation at such residues that are often repressive modifications. For example, Suv39h1 catalyzes H3K9 methylation and methylation of H3K27 is catalyzed by Ezh2 (Bhaumik et al., 2007).

H3K4 is a common active histone mark that demonstrates a strong correlation with active

gene expression. K4 methylation is mediated by Set1, part of the COMPASS complex

identified in yeast (Li et al., 2007).

Histone methylation is a reversible modification and histone tails may also undergo

demethylation. It is important to note that methylation or demethylation is not an “all or

none” process. A tri-methylated lysine residue may undergo demethylation to a mono- or

di-methylated state rather than a complete lack of methylation. A growing number of

histone demethylases are being identified including LSD1 and the JHDM gene families

(Anand and Marmorstein, 2007; Bhaumik et al., 2007).

Phosphorylation

Histone phosphorylation is usually induced during cell division (Li et al., 2007). Many

phosphorylation events do not directly correlated with gene expression or gene silencing.

For example, phosphorylation of H2A is induced in response to DNA-damage. H3S10

(Serine 10) phosphorylation is an active histone mark correlating with active gene

transcription. Kinases such as Jil-1 mediate this phosphorylation event. Phosphorylation

of H4S1 has been identified in mice and Drosophila, and results in chromatin compaction. Unlike other histone modifications, phosphorylation mediated by Sps1, is associated with gametogenesis and has not yet been shown to modify chromatin structure or alter gene expression (Bhaumik et al., 2007).

Non-coding RNA

Non-coding RNAs have been implicated in gene regulation both directly and through control of epigenetic modification. It is well documented in mammals and flies that non- coding RNA plays a key role in regulating chromatin structure rearrangements to allow

X-chromosome dosage compensation (Kind and Akhtar, 2007; Mendjan and Akhtar,

2007). RNAi-mediated mechanisms have been identified that allow both transcriptional and post-transcriptional gene-silencing. Double-stranded RNA has also emerged as a mechanism for eliciting de novo RNA-directed DNA methylation (RdDM) at homologous sequences resulting in gene silencing (Jones et al., 2001). Small regulatory

RNAs including miRNAs, piRNAs and siRNAs involved in epigenetic regulation of the genome have become an increasing focus in research.

miRNA miRNAs are transcribed by RNA Polymerase II as primary miRNA (pri-miRNA) transcripts which are cleaved through RNA-induced silencing complex (RISC) and Dicer processes (Maccani and Marsit, 2009). The processed RNA is trafficked to the mRNA target through the RISC. miRNA regulates gene expression through post-transcriptional repression by pairing to a target mRNA transcript (Hutvagner and Zamore, 2002).

Repression can result by degradation through Argonaute-catalyzed mRNA cleavage or by blocking access of the normal translational machinery. miRNAs have been implicated in many disease processes including cardiac hypertrophy in response to stress and the development of several cancer types as oncogenes or tumor suppressors (Garzon et al.,

2009; Maccani and Marsit, 2009).

piRNA

Piwi-interacting RNAs (piRNAs) are small, 24 to 30 nucleotide, non-coding RNAs and

crucial to germline development. Three Piwi homologs (Miwi, Miwi2 and Mili) are

present in the mouse and are expressed at high levels in testis. Disruption of these

homologs result in a block of piRNA production and male sterility due and degeneration

of the male germline following arrest of spermatogenesis prior to completing the first

round of meiotic division (Klattenhoff and Theurkauf, 2008). piRNAs do not appear to

be active in the mammalian female germ line as mutations in the Piwi homologs do not

affect fertility (Seto et al., 2007). Conversely, in Drosophila, piRNAs have been

implicated in disruption of oogenesis and promote transcriptional silencing through

heterochromatin formation (position-effect variegation) (Klattenhoff and Theurkauf,

2008). Heterochromatic regulation could allow piRNAs to suppress transcription and

directly regulate gene expression.

siRNA and RdDM

RNA-directed DNA methylation is a process in which siRNAs direct DNA

methyltransferases to complementary DNA sequences. Characterized initially in plants, the shared pathway in yeast suggests that the conserved mechanisms may extend to higher animals (Verdel et al., 2009). In plants, small double stranded RNAs are generated through processing by Dicer-like proteins. The proteins are combined with

RISC (RNA-induced silencing complex) machinery including Argonaute family members which guide the methyltransferase to target loci (Chinnusamy and Zhu, 2009).

RdDM underlies many important regulatory epigenetic process including paramutation,

32 imprinting and transcriptional regulation through control of methylation and possibly demethylation (Chinnusamy and Zhu, 2009).

mRNPs: P-bodies and stress granules

Regulation of cytoplasmic mRNAs is also accomplished post-transcriptionally in cytoplasmic mRNP (messenger ribonucleoprotein) granules – P-bodies (mRNA processing bodies) and stress granules (Buchan and Parker, 2009). P bodies form as a result of RNA-mediated translational repression and are involved in posttranscriptional regulation of gene expression (Balagopal and Parker, 2009; Eulalio et al., 2007). mRNAs silenced by miRNA-mediated repression are localized to P-bodies and may be stored for later return to translational activation or may be actively degraded (Chan and Slack,

2006). P bodies contain a large concentration of proteins involved in mRNA degradation both through deadenylation and removal of the poly(A) 3’ tail as well as decapping machinery that removes the 5’ cap (Eulalio et al., 2007). As a result, P body components may leave an mRNA susceptible to 5’-to-3’ or 3’-to-5’ degradation. The number and size of P bodies can vary from cell to cell and is dependent on the stage of the cell cycle and cellular proliferation (Yang et al., 2004). Unlike stress granules, translation initiation factors and ribosomal subunits are largely absent in P bodies (Parker and Sheth, 2007).

Stress granules are mRNPs that form during decreased translation initiation either through a stress response or due to inhibition of translation and contain mRNAs stalled in the process of translation initiation (Buchan and Parker, 2009; Kedersha et al., 1999).

Stress granules typically contain mRNA, 40S ribosomal subunits, and eukaryotic

initiation factor subunits (including eiF2 and eiF4 subunits; discussed further in Chapter

II) (Anderson and Kedersha, 2006; Kedersha et al., 2002; Kedersha et al., 1999). Stress

granules are believed to function in translational repression, given that components are

translational repressors and their formation frequently correlates with a decrease in global

translation initiation (Anderson and Kedersha, 2009). However, it is still unclear whether

the formation of stress granule is strictly necessary for global repression (Fujimura et al.,

2009; Mokas et al., 2009). Additionally, localization of apoptotic factors in stress

granules suggests a role in regulating cell death and their formation often correlates with

increased cell survival during stress (Buchan and Parker, 2009; Eisinger-Mathason et al.,

2008).

Evidence suggests that stress granules and P-bodies can transiently associate and

exchange components (Kedersha et al., 2005; Mollet et al., 2008). The mRNPs

constituting a stress granule are dynamic and protein exchange is rapid (Parker and Sheth,

2007). mRNAs within P-bodies have also been shown to return to translation which has led to hypotheses that mRNPs within P-bodies can exchange proteins to form translationally competent mRNP complexes (Bhattacharyya et al., 2006). Additionally, many proteins observed in P-bodies have also been shown to accumulate in stress bodies following an elicited stress response (Kedersha et al., 2005; Mollet et al., 2008).

Moreover, similar RNA granules in mammalian cells may play a role in the transmission

of RNAs to offspring. Maternal mRNA storage granules share many proteins with P

bodies including decapping machinery and similarly function in translational repression

of maternal mRNAs (Anderson and Kedersha, 2006). Additionally, chromatoid bodies in

male germ cells also contain similar protein components including those related to miRNA processing (Parker and Sheth, 2007).

Transgenerational effects

In some instances, phenotype may manifest through epigenetic information and cannot be

explained by inherited DNA sequences. Such transgenerational effects may occur as a result of inherited epialleles in the absence of gene transmission (transgenerational epigenetic inheritance), or through an interaction between current and ancestral genes

(transgenerational epistasis).

Transgenerational epigenetic inheritance

Transgenerational epigenetic inheritance can be difficult to establish unequivocally. In

maternal transmission, multiple generations are present during fetal development

allowing alternative explanations for phenotypic inheritance. This necessitates multigenerational studies which demonstrate an effect in the F3 generation or beyond. As the

developing embryo (F1) and the embryo’s germ cells (the future F2 generation) are all

present within the mother (P1) at the same time, a stimulus during this period may appear

to produce a transgenerational inheritance pattern which can be accounted for in each

generation by exposure to the original stimulus. In the absence of further exposure, this

effect would be expected to extinguish in the F3 generation, the first generation not

exposed to the original stimulus, unless a heritable germ-line epimutation is resulting in

transgenerational epigenetic inheritance. Transgenerational inheritance can be identified

more clearly in paternally transmitted epimutations (Pembrey, 2002).

An important example of transgenerational inheritance in mice comes from an engineered

mutation in Kit where the phenotypic white-spotting of the tip of the feet and tail were

inherited in both mutant and wildtype offspring (Rassoulzadegan et al., 2006). A

corresponding reduction in Kit expression occurred in both mutant and wild-type mice

inheriting the white-spotting phenotype. Preliminary work showed that the phenotype

could be transmitted through the injection of RNA derived from the sperm of males

carrying the engineered Kit mutation into single-cell wild-type embryos. Similar findings

were shown following injection of two microRNAs that target Kit mRNA (Grandjean et

al., 2009; Rassoulzadegan et al., 2006; Wagner et al., 2008).

Interestingly, a second example involves Kitl, the ligand for Kit. Mice that are

heterozygous for the Slgb mutation in Kitl develop spontaneous TGCTs at an increased rate on the 129/Sv inbred background (Heaney et al., 2008). Surprisingly, wild-type sons of males carrying the Slgb mutation are at a reduced risk for TGCTs demonstrating the

inheritance of phenotype in the absence of inheriting the mutation (Heaney et al., 2008).

Conversely, sons of females carrying the mutation develop TGCTs at the baseline rate.

Interestingly, in this case the effect is not only transgenerational, affecting wild-type

offspring, but is also dependent on which parent carries the Slgb mutation.

Evidence of transgenerational effects is limited in humans. There are few multigenerational pedigrees available to study and there have been few studies searching specifically for links between phenotype and parental genotype. Although it is clear that the parent’s lifestyle and early fetal environment influences children evidence supporting a molecular effect is rare (Aghajanyan and Suskov, 2009; Painter et al., 2008). The controls necessary to eliminate other non-sequence based contributors to phenotype such as social and environmental difference are largely absent. There is evidence suggesting transgenerational epigenetic inheritance in humans from colon cancer (Hitchins et al.,

2007). An individual with hereditary nonpolyposis colorectal cancer was found to have abnormal silencing of MLH1, a mismatch repair gene, by DNA methylation in the absence of DNA mutation in the region. The epimutation was present in all three germ layers suggesting that was inherited through the parental germ line. However, without testing related individuals the possibility that the epimutation spontaneously arose early during development cannot be excluded.

Transgenerational epistasis

The wimp mutation in Drosophila is one example where a mutation in the parent interacts with a gene in the individual’s genome to affect viability in a lineage dependant manner.

Wimp interacts with hairy (h) to result in lethality of h/+ offspring when wimp is present maternally. In this case, the transgenerational effect can be attributed to wimp mRNA deposited in the oocyte premeiotically which allows the gene product to interact with the paternally contributed hairy to result in lethality of h/+ heterozygotes during early development. In the reciprocal cross, if wimp is present paternally, no effect is seen and

37 h/+ heterozygotes are fully viable. Twenty-three of sixty five mutations tested showed a similar interaction with maternal wimp, likely attributable to the effect of maternal RNA loading in the Drosophila oocyte (Parkhurst and Ish-Horowicz, 1991).

In a second example a transgenerational interaction results through heterochromatic changes. In this case, the maternally-inherited hyperactive HopTum-1 allele of JAK kinase interacts with parental modifiers (24 of 37 tested) independent of the modifier’s inheritance. This interaction causes an increase or decrease in tumor susceptibility depending on the modifier present. Hyperactivity of JAK kinase supports transmission of changes in the heterochromatin which were transmitted to subsequent generations along with the change in tumor incidence (Xing et al., 2007).

A third example of transgenerational epistasis was identified which affects the incidence of testicular germ cell tumors (TGCTs) in mice where the interacting parental allele is not restricted to acting through the maternal lineage and cannot be explained simply by maternal loading of mRNA (discussed further in Chapter II) (Lam et al., 2007).

Although, it remains possible that mRNAs may be packaged in both male and female germ cells resulting in the observed interaction.

Grandparental Effects

In the examples of transgenerational inheritance discussed, the causative allele is present in the parental generation or in some cases the experiments necessary to determine whether the effect is dependent on parental or more ancestral alleles have not been

performed. Using chromosome substitution strains derived from C57BL/6J and A/J, an

association was found between grandparental origin and a previously identified locus associated with ethanol consumption indicating the presence of second-generation epigenetic mechanism of phenotypic inheritance. The identified QTL on chromosome 2 was manifest only in F2 males derived from the C57BL/6J x C57BL/6J-Chr2A grandparent combination (Lesscher et al., 2009). Although the causative allele was present in the F1 parents and the F2 males, unlike in transgenerational inheritance, the phenotype in F2 males was dependent on the grandparental origin of the allele. In light of transgenerational inheritance, the possibility is raised that not all of the observed genetic effects may be attributable directly to the genome in the individual but may manifest in that individual as a result of epigenetic changes remaining from prior generations.

Due to the difficulty of finding multigenerational pedigrees and limited ability to control for environmental exposures, many reports suggesting heritable grandparental effects in humans have not been definitive (Lumey, 1992; Pembrey et al., 2006). A prospective three generation study on risk for human depression showed that the increased risk associated to individuals with parental history of depression was also dependent on grandparental phenotype. No association was seen between parent and child where the grandparent was unaffected (Weissman et al., 2005).

Chapter II.

Testicular Germ Cell Tumors

Testicular cancer is the most common malignancy affecting young men. More than 90% of testicular cancers result from testicular germ cells tumors (TGCTs). Despite strong heritability, the only susceptibility loci identified in genome-wide studies are the gr/gr deletion on chromosome Y and KITLG which occur in only a small fraction of cases. The

129 inbred strain of mice is the only strain known to develop spontaneous TGCTs at an appreciable rate with 5% of males presenting with at least 1 TGCT by 4 weeks of age.

TGCTs in mice are teratomas and teratocarcinomas that most closely resemble TGCTs in human adolescents.

Testicular Cancer in Humans

Testicular cancer is the most common malignancy affecting young men aged 15-34, accounting for greater than 1% of all male neoplasms (Buetow, 1995). Testicular cancer is most prevalent in males of European descent, particularly in northern and western

Europe (Buetow, 1995; Skakkebæk et al., 2007). Incidence is increasing world-wide and more than doubled in many European countries between 1945 and 1995 (Buetow, 1995).

The increase in incidence has been most prevalent in young men where TGCTs are most common; little change has been observed in men aged 65 years and over (Schottenfeld et al., 1980).

Testicular Germ Cell Tumors

More than 90% of testicular tumors originate from germ cells (Baharami et al., 2007).

Unlike most cancers where incidence increases exponentially with age, testicular cancer

has three distinct peaks which correspond to distinct histological subtypes(Nicholson and

Harland, 1995). The first peak occurs around 2 years of age and includes pediatric

tumors which are believed to originate during embryogenesis. These are the rarest forms

of testicular tumors and consist of yolk sac tumors, teratomas and teratocarcinomas

which most closely resemble the TGCTs seen in the strain 129 mouse model. The largest

peak occurs in the third decade of life (age 20-29) and consists of seminomas and

nonseminomas. A final peak occurs during the sixth decade (age 50-59) and consists of

spermatocytic tumors and seminomas (Buetow, 1995).

Histological Subtypes

Testicular Germ Cell Tumors are divided into seminomas and nonseminomas.

Seminomas are then subdivided again into typical seminomas and spermatocytic

seminomas. Nonseminomas include embryonal carcinoma, yolk sac tumors,

choriocarcinoma and teratoma. Although they are distinct histological categories, 60% of

TGCTs are mixed tumors consisting of two or more subtypes.

Seminomas

Most seminomas, 82-85%, are so called “typical” seminomas. These tumors occur most

frequently in men in their thirties and less commonly in the following decades. However,

they are the most common tumor type in men over age 65. Typical seminomas are

characterized by a slow growth rate meaning failed treatment may not be evident for

many years (Wein et al., 2007).

Spermatocytic seminomas in contrast are most prevalent in men over age 50 and account

for up to 12% of seminomas (Wein et al., 2007). In contrast to other adult TGCT types,

spermatocytic seminomas rarely if ever metastasize (Thackray and Crane, 1976;

Weitzner, 1976).

Nonseminomas

Embryonal carcinoma (EC) cells are undifferentiated, malignant cells which resemble

pluripotent embryonic cells (Wein et al., 2007). EC cells are present in 40% of TGCTs, most often as part of a mixed tumor, and are a risk factor for metastasis (Wein et al.,

2007).

Yolk Sac tumors are the most common subtype seen in prepubertal boys. Over 80% of yolk sac tumors are confined to the testis at diagnosis. However, the cases which do metastasize follow a distinct pattern of metastasis from adult tumors (Wein et al., 2007).

Choriocarcinoma is an invasive and destructive type of TGCT which occurs most frequently in the 2nd and 3rd decade of life. Patients often have aggressive metastatic

disease at diagnosis. Presentation is usually characterized by symptoms related to the

secondary tumors, frequently in lung or brain, rather than the TGCT itself (Wein et al.,

2007).

Teratomas most frequently present in the 1st-3rd decades of life and consist of

differentiated tissues originating from 2-3 germ layers. Teratomas do not contain EC

cells, although they can occur together in mixed tumors, and may metastasize. When

metastatic, a teratoma is highly resistant to chemotherapy and radiation even as part of a

mixed tumor. (Wein et al., 2007)

Carcinoma in situ

Carcinoma in situ (CIS) is a preinvasive lesion characterized by intratubular germ cell

neoplasia, an overgrowth or abundance of germ cells within the seminiferous tubules, and

is a precursor to TGCTs. 50% of men identified to have CIS develop malignant disease

within 5 years. In the Danish population, the incidence of CIS is 0.8% which correlates

with the lifetime risk of TGCT among Danish men. Surface proteins in CIS resemble those that are highly expressed on primordial germ cells (germ cell precursors or PGCs)

in utero around 8-12 weeks in development. This finding may suggest that CIS or the

tumorigenic potential of germ cells initiates early during embryonic development even

for adult onset TGCTs which progress through CIS. (Wein et al., 2007)

Diagnosis and Treatment

Testicular cancer classically presents as a painless swelling or enlargement of the testis, but up to 46% of TGCT patients present with testicular pain (Abeloff et al., 2004). Most cases of TGCT are unilateral on initial presentation with the right side preferentially effected (Bower et al., 1997; Buetow, 1995). Cryptorchidism, a risk factor for TGCT, is also seen more frequently in the right than the left testis (Wein et al., 2007). Grossly, teratomas are usually large (5-10cm) heterogeneous combinations of tissues derived from all three embryonic germ layers – ectoderm, endoderm and mesoderm. Germ cell tumors

in adult populations metastasize in 60% of cases (Carver et al., 2007). Metastasis has been reported in pediatric teratomas, but the incidence of metastasis is believed to be less frequent than in adult cases (Ciftci et al., 2001; Hasegawa et al., 2006). Metastatic

disease follows a predictable spread through the lymphatic system progressing first

through the retroperitoneal lymph nodes at the level of the renal vessels (Behrman et al.,

2004). While most metastases resemble the primary tumor histologically, a teratoma may take on a different histological appearance at the site of metastasis (Kumar et al., 2005).

Adult testicular cancer shows a good response to platinum-based chemotherapy, only

10% of case are resistant to therapy, meaning most patients undergo a complete recovery(Paul et al., 2004). Pediatric or prepubertal teratomas, however, are often chemoresistant, not responding to chemotherapy (Carver et al., 2007). This chemoresistance makes surgical resection the treatment of choice in the pediatric population (Carver et al., 2007). Despite a cure rate over 80% for pediatric testicular

cancer, the need for surgical removal of the testis and surrounding tissues in a young

population makes early identification of disease susceptibility and generation of new

treatments especially important (Behrman et al., 2004; Horwich et al., 2006). Treatment

in this young population leaves survivors at risk for delayed, long-term side effects of

therapy including cardiovascular toxicity, infertility and renal failure that may not present

for decades after the initial treatment (Horwich et al., 2006). The long-term ramifications

of treatments such as chemotherapy and radiation over 50-60 years have not been

thoroughly explored as most cancers affect older populations closer to the end of life.

Additionally, 10% of survivors will relapse within the first two years and an additional

4% develop cancer in the contralateral testis (Abeloff et al., 2004).

Although both originate from germ cells, pediatric TGCTs are different from adult cases.

As discussed above, pediatric TGCTs are predominantly yolk sac tumors, teratomas and teratocarcinomas which rarely metastasize and are resistant to chemotherapy. Adult

TGCTs are seminomas and nonseminiomas which metastasize frequently and are readily treated with chemotherapy. Additionally, the pediatric TGCTs lack isochromosome 12p which is a common cytogenetic mutation present in adult cases. Alternatively, pediatric

TGCTs often have characteristic deletions of Chromosome arms 1p and 6q (Behrman et al., 2004).

Risk Factors

Risk factors for testicular germ cell tumors (TGCTs) include cryptorchidism or undescended testis, sterility, reduced fertility, testicular feminization and testicular dysgenesis, all of which relate to the underlying principle of disrupted germ cell development (Dieckmann and Pichlmeier, 2004; Kumar et al., 2005). Although there are several known risk factors for TGCTs, they are often poor predictors of an individual’s risk. Cryptorchidism, one of the most widely recognized risk factors, 5-10% of men with

cryptorchidism develop TGCT, is absent in 90% of men with germ cell tumors (Abeloff

et al., 2004). Family history is the strongest known risk factor suggesting that genetic or other hereditary factors are contributors to the individual’s risk.

Cancer Genetics

Cancer is a diverse disease characterized by unregulated growth, the accumulation of gene mutations and DNA damage. The initial mutation may be inherited through the germ-line or induced upon exposure to environmental stimuli or deleterious replication errors. Oncogenes encode native genes which result in cancer when inappropriately activated. Oncogenic mutations occur in genes that signal cell proliferation or survival

(Liu, 2004). Oncogenic mutations usually produce constitutively active alleles or eliminate the normal response to inhibitory signals allowing unregulated growth. A single mutation producing a novel or enhanced function is often sufficient to disrupt normal physiology to result in cancer initiation making most oncogenic mutations dominant. For example, constitutively active mutations in the growth factor receptor

KIT, a component of a cell survival pathway, are common in soft tissue tumors (Kumar et al., 2005).

In contrast, a tumor suppressor functions normally to inhibit cell growth. A single gene copy is usually sufficient to maintain normal function and mutation of both alleles is necessary for cancer to initiate. Mutations in tumor suppressors are usually recessive, eliminating the protein’s normal inhibitory function. For example, p53 (TP53) normally triggers cell death in the presence of DNA damage. Inactivation of p53 prevents a damaged cell from inducing apoptosis allowing unregulated growth and thereby eliminating a key pathway for preventing further mutations (Mendelsohn et al., 2001).

Testicular Cancer Genetics

There is a 4-6 fold increase in risk associated with an affected father and an 8-10 fold

increase between brothers (Lindelöf and Eklund, 2001). This is much higher than the

inherited risk associated with most cancers. A family history of cancer rarely predicts an

increase in risk greater than 4-fold (Hemminki and Chen, 2006; Rapley et al., 2003).

About 1/3 of patients with TGCT can be identified as genetically predisposed (Nicholson

and Harland, 1995). Despite strong heritability, only weakly associated loci have been

identified in most linkage studies (Horwich et al., 2006).

The gr/gr deletion on the Y chromosome is one of two genetic mutations which have

been identified to play a role in TGCT and is present in only 3% of familial testicular

cancers (Linger et al., 2007; Nathanson et al., 2005). gr/gr is a 1.6 megabase deletion in

the AZFc region on the Y chromosome. The association with TGCTs was identified

using a candidate gene approach based on the association between AZFc deletions and infertility, a known risk factor for TGCTs (Jacobsen et al., 2000; Lynch et al., 2005;

Nathanson et al., 2005; Repping et al., 2003). The gr/gr deletion is present in 1.3% of

unaffected males; the frequency is increased to 2% in males who lack a family history of

TGCT and present in 3% of affected males with a family history of TGCT (Nathanson et

al., 2005). Interestingly, men with gr/gr, a paternally inherited deletion on the Y chromosome, are at a 4-fold greater risk if the family history of TGCT is maternal rather than paternal (Nathanson et al., 2005). This may suggest that the effect of the paternally inherited gr/gr deletion is enhanced when combined with unidentified risk factors inherited through the maternal lineage.

The second genetic factor identified was KITLG, the ligand for the KIT receptor

(Kanetsky et al., 2009; Rapley et al., 2009). A significant association was identified in a genome-wide association study for SNPs associated with TGCT with chromosome 12

(Rapley et al., 2009). Additional follow up demonstrated that an increase in risk was associated with at least 7 markers within KITLG between a 2-3 fold increase in TGCT risk. Futhermore, this finding is consistent with prior studies in the mouse model which have identified a 2-fold increase in risk due to deletions of Kitl (Stevens, 1967b).

Cancer Epigenetics

Regulation of gene expression through DNA methylation often goes awry in cancer cells producing a genome-wide decrease in methylation (Rakyan et al., 2001).

Hypomethylation is associated with the inappropriate activation of normally silent genes, including oncogenes, in the diseased cells (Feinberg et al., 2002; Feinberg and

Vogelstein, 1983). Methylation abnormalities have recently been shown to cause, not merely result from, tumor development. Mice with an insertional inactivation of Dnmt1 develop cancer at rates up to 80% (Gaudet et al., 2003). Localized DNA hypermethylation may also be present at specific sequences, including promoter CpG islands. Aberrant methylation is not merely an unfortunate side effect seen in some cancers, but may be as common in the initiation of disease as gene mutation (Ehrlich,

2000).

Evidence of epigenetic involvement in cancer initiation can also be found for histone modification. Histone acetyl transferases (HATs) have been identified as altered in solid and hematologic cancers. Alterations of the transferase genes themselves or associated proteins can result in downstream changes in gene expression across the genome or localized to specific oncogenic subsets (Ellis et al., 2009). The Tip60 HAT is part of a conserved transcriptional complex, NuA4, that modulates acetylation of known oncogenes following DNA damage and has been mutated in human cancers including lymphoma and breast cancer (Ellis et al., 2009). Two targets, p53 and Myc, are

associated with the mouse models of TGCT. Mutation of Tip60 results in hypo-

acetylation of p53 and defect in p53-mediated apoptosis (Squatrito et al., 2006). Trp53 is

a known tumor modifier increasing tumorigenesis on the TGCT susceptible 129/Sv background (Donehower et al., 1992; Harvey et al., 1993a). Apobec1, tested in this

study, stabilizes c-myc mRNA (Anant and Davidson, 2000). Histone deacetylases

(HDACs) have also been implicated in tumorigenesis of many cancer types including

colon and breast cancers. Class I HDACs regulate proliferation and apoptosis and Class II

regulate angiogenesis (Ellis et al., 2009). Proliferation, apoptosis and angiogenesis are all

process that are frequently deregulated in cancer. Specifically, deregulation of

deacetylases activity through chromosomal translocations has been identified in acute

promyelocytic leukemia. HDACs complex with retinoic acid receptors and in the

presence of retinoic acid release transcriptional arrest of target genes (Ellis et al., 2009).

Retinoic acid also prevents differentiation of male PGCs during embryogenesis and been

proposed as a causative agent in TGCT tumorigenesis (Giuliano et al., 2005).

Epigenetics in germ cells

During PGC development permissive marks remain consistently high. Repressive marks

increase during development and both marks are high when PGCs enter the genital ridge potentially marking the ability of PGCs to differentiate into germ cells (Seki et al., 2005).

An abundance of bivalent domains containing both permissive and repressive marks is

seen in early germ cells and has been hypothesized to keep transcription on hold but

poised for rapid activation. As such, many protein coding genes, including inactive

genes, contain both active and repressive marks at this stage (Bernstein et al., 2006).

Expression of Blimp1 is one of the early indicators of cells which will become lineage

restricted germ cells. Blimp1 can bind chromatin modifying enzymes such as histone

deacetylases contributing to repression of transcriptional activity in PGC precursors (Yu

et al., 2000). In PGCs, Blimp1 interacts with Pmrt5, a histone methyltransferase, causing methylation of H2A and H4 (Bedford and Richard, 2005). In the absence of Blimp1,

PGCs do not form suggesting the importance of proper epigenetic regulation to

development and the germ lineage (Yu et al., 2000).

Testicular Cancer in Mice

Familial testicular cancer in humans is rare and the number of multigenerational

pedigrees is small making genetic studies difficult. As a result, a model system is

essential to speed progress in the field. Mice produce large litters with a short

developmental period allowing easy access to multigenerational pedigrees through

controlled breeding. The ability to fix genetic and environmental variation and generate a

large homogeneous population enhances the ability to detect genes with small

51 contributions to disease susceptibility. Using mice also provides the ability to examine the effect of genetic factors in prior generations on the development of TGCT in sons and grandsons, information that is difficult to obtain in humans.

A Mouse Model for TGCTs

TGCTs in mice occur spontaneously at appreciable, measurable rates only in the 129 family of inbred strains and are almost unknown in others (Stevens, 1967b; Stevens and

Hummel, 1957). TGCT incidence ranges from 1-5% in males of the 129 inbred strains

(Stevens and Hummel, 1957). Several genetic mutations alter tumor susceptibility on the

129 background and can provide insight to the pathways responsible for disease development. TGCTs in mice bear close resemblance to pediatric TGCTs: both originate during fetal development and form teratomas or teratocarcinomas composed of multiple cell and tissue types (Stevens and Hummel, 1957; Youngren et al., 2003). Most cases of

TGCT in mice are unilateral and display a 75% left-sided predominance. Laterality is also observed in humans, particularly in pediatric populations, with a right-sided predominance (Buetow, 1995).

Male Germ Cell Development

TGCTs originate from primordial germ cells (PGCs), the embryonic precursors to germ cells. PGCs do not originate in the gonad. Rather, they can be first detected in the extraembryonic mesoderm (the yolk sac and allantois) at embryonic day (E) 7 (De Felici,

2000; Matsui, 1998; McLaren, 1999; Takabayashi et al., 2001). Cells commit to the germ cell lineage while in the extra-embryonic tissues and later migrate to arrive in the

developing gonad. During migration, PGCs proliferate substantially from 100 cells to a

population of 25,000 when they reach the genital ridge at E11.5 (Tam and Snow, 1981).

At E13.5, male PGCs stop proliferation and enter mitotic arrest until shortly after birth

(Adamah et al., 2006).

Development of TGCTs

TGCTs are unique in that the cell of origin and time of tumor initiation are both known allowing examination of the cellular environment during the precise period of tumorigenesis. Through the use of steel mutants that contain a deletion of KIT ligand

(Kitl) and lack PGCs in the homozygous state (Sl/Sl), Leroy Stevens demonstrated that

the potential for tumorigenesis is dependent on the presence of germ cells effectively

demonstrating that the testicular tumors were in fact TGCTs (Stevens, 1967c). To

determine the time of initiation, genital ridges from E11 to E13 fetuses were grafted into

129 males. Tumor incidence peaks in grafts of susceptible genital ridges obtained during

the developmental period between E11 and E12.5 (Stevens, 1967c). Thus 129 testicular

tumors originate between E11 and E12.5 from PGCs, adult germ cell precursors.

In mice, TGCTs originate as undifferentiated embryonal carcinoma (EC) cells in the

fetus. The EC cells mature shortly after birth and have the potential to further

Table 1 Timeline of Early Mouse Development ~E 0 1 cell stage; Decondensation of male pronucleus, exchange of protamines for histones(Weaver et al., 2009) ~E1.0 2 cell stage: Active demethylation of male genome nearly complete; Passive demethylation of female genome started(Swales and Spears, 2005) (AID/Apobec proposed to serve in demethylation(Conticello et al., 2007)) Many of the maternally contributed mRNAs have been degraded(Piko and Clegg, 1982) Activation of zygotic gene expression(Piko and Clegg, 1982) ~E1.5 2-4 cell stage: Xist expressed from paternal X chromosome(Okamoto et al., 2004) 4-8 cell stage: Silencing of paternal X chromosome evident by loss of RNA PolII(Okamoto et al., 2004) E2 Morula; Genome almost completely demethylated(Weaver et al., 2009) 3.0 Blastocyst; Inner cell mass (ICM) first apparent 4.0 Arrival of blastocyst in uterus, “hatching” from zona pellucida 4.5 Implantation: Remethylation of genomic DNA Xp is no longer inactive; Random X inactivation occurs in epiblast(Okamoto et al., 2004) 6.0 Early differentiation of cell layers begins 6.5 Gastrulation 7.0 ~100 PGCs visible in extraembryonic mesoderm/allantois (Matin, 2005) 7.5 PGCs identifiable by Blimp1 expression(Ohinata et al., 2005) Dnd1α expression in allantois(Matin and Nadeau, 2005) 8.0 All three germ layers present PGCs enter embryo proper & begin migration through hindgut endoderm PGCs show low H3K9me2; high H3K27me3, H3K4me2/3 and H3K9Ac(Hajkova et al., 2008) Hypothesized origin of TGCTs with an increased frequency of bilateral tumors 8.5 Dnd1Ter mutants first show evidence of PGC deficiency Dnd1 expression in neurectoderm (Youngren, 2005) 9.5 Widespread expression of Dnd1 (neural tube, hindgut, etc)(Youngren et al., 2005) 10.5-11.5 Migration of PGCs into genital ridge 11.0-12.5 Onset of TGCT tumorigenesis in 129 males(Stevens, 1967c) 11.5 PGCs lose H3K9me3, H3K27me3 and H3K9Ac; increase NAP-1 and HIRA(Hajkova et al., 2008) Dnd1 expression in genital ridge(Youngren et al., 2005) 11.5-12.5 DNA methylation reduced in germ cells; biallelic expression from imprinted genes 12.0 90% demethylation of germ cell genome (Gallou-Kabani et al., 2007; Gluckman et al., 2007) 12.5-14.5 Increased Dnd1 expression in male (decrease in female) (Youngren et al., 2005) 13.5 PGCs number 25,000 Sexual differentiation occurs; Sry expression Male PGCs enter mitotic arrest (regulated by Stra8 & retinoic acid)(Koubova et al., 2006) 14.5-17.5 Male PGCs establish paternal imprinting(Weaver et al., 2009) 15.5 Proliferating clusters of PGCs seen in Ter mutant males(Youngren et al., 2005) 16.0 Remethylation of PGC genome(Gluckman et al., 2007) Postnatal Female PGCs establish maternal imprinting(Weaver et al., 2009)

differentiate (Stevens, 1967b). The resulting tumors, like human teratomas, contain a

variety of tissues derived from all 3 embryonic germ layers at various stages of

differentiation (Stevens, 1967b; Stevens and Hummel, 1957). Teratomas largely lack

organization but some basic structure, such as the association of glandular epithelium

with ducts, may be maintained (Stevens, 1967b). The earliest time point at which TGCTs

have been identified is E15. At E15, foci of EC cells may be seen rupturing the

seminiferous tubles and beginning to invade the interstitium.

Germ cell tumors cannot develop in the complete absence of germ cells. However, where

PGCs are present, a trend exists among genetic models with tumor incidence inversely

related to the number of surviving germ cells. For example, deletion of Kitl reduces germ cell number 75% in heterozygotes (Mahakali Zama et al., 2005). KitlSlJ heterozygotes have a TGCT incidence of 14%, increased from 5% in wild-type (Stevens, 1967c). In

Dnd1Ter/Ter males where approximately 10-12 germ cells (of the expected 25,000) survive,

94% of males develop TGCTs (Noguchi and Noguchi, 1985). Likewise, TGCT risk has

also been linked to infertility and abnormal germ cells phenotypes in humans(Buetow,

1995; Raman et al., 2005).

Mouse Genetics and Testicular Cancer

Testicular cancer is a complex disease involving multiple independently segregating

genes. The absence of TGCTs in inbred strains outside of 129 strains provides evidence

for genetic regulation. Among more than 11,000 progeny examined in backcrosses

involving a variety of inbred strains only one had an identifiable TGCT. In mice, genetic

modifiers interact with 129 susceptibility genes to alter TGCT susceptibility and the

observed incidence rather than being independently necessary or sufficient for

tumorigenesis. Examining the interaction between these genes provides insight into the

pathways and interactions underlying cancer susceptibility.

Mendelian Modifiers of TGCT Susceptibility

Several mutations are known which alter the TGCT incidence in 129 males. These

modifier genes are mutations including Dnd1Ter, KitlSlJ, Trp53, Ay and Pten which act on

TGCTs only within the context of the 129 susceptibility genes.

Dnd1Ter

The Ter allele is a spontaneous point mutation in the dead-end (Dnd1) gene on

Chromosome 18 (Youngren et al., 2005). Dead-end is an orthologue to the zebrafish

dead end (dnd) gene which is responsible for PGC survival and migration (Weidinger et

al., 2003). Ter introduces a single C to T mutation in a CG rich coding region of Dnd1.

This conversion introduces a stop codon at amino acids 178 and 190 in protein isoforms

DND1- and DND1- respectively resulting in a truncated non-functional protein

(Youngren et al., 2005). DND1- is required for PGC viability (Bhattacharya et al.,

2007). Dnd1Ter/Ter mice consequently have few germ cells and are infertile on all

examined backgrounds (Stevens, 1973). On the 129 background, Dnd1Ter also increases

TGCT susceptibility (Stevens, 1973). The reduced number of PGCs that reach the

genital ridge continue to proliferate past the point of normal mitotic arrest (E13.5) and

divide appreciably until E15.5 (Noguchi and Noguchi, 1985). TGCTs develop from the

reduced PGC population at a high rate. Tumor prevalence is 94% in Dnd1Ter/Ter males,

with 75% developing bilateral disease (Noguchi and Noguchi, 1985). Prevalence is 17%

in heterozygotes (Noguchi and Noguchi, 1985).

Dnd1 Expression has been identified in the embryo as early as E7.5, when PGCs are first

identifiable, and is widespread by E9.5 (Youngren et al., 2005). Corresponding with

tumorigenesis at E12.5, Dnd1 expression is up-regulated in XY gonads from E12.5 to

E14.5 (Youngren et al., 2005). Expression is down-regulated in XX gonads during the

same time period (Youngren et al., 2005). Dnd1 expression then continues in the testis as

well as heart, spleen and intestine, throughout adult life (Youngren et al., 2005). Dnd1

shares 48% amino acid identity with A1cf, the binding subunit of the APOBEC1 RNA-

editing complex, including an RNA recognition motif (RRM) (Blanc et al., 2001a;

Youngren et al., 2005). The Dnd1 RRM is located upstream of the stop codon introduced

by the Ter mutation. Dnd1 blocks miRNA-mediated repression of mRNA allowing

expression (Kedde et al., 2007). Dnd1 appears to block miRNA-mediated degradation of

mRNAs in perinuclear granules by binding and restricting target RNAs to the nucleus

(Slanchev et al.).

Kitl

The kit ligand gene (Kitl) is located on chromosome 10 and encodes the growth factor

(also known as mast cell growth factor or stem cell factor) which binds and activates the

oncogenic kit receptor (Kit). Mutations in Kitl produce deficiencies in hematopoiesis,

gametogenesis, and melanogenesis (Copeland et al., 1990). A complete signaling

pathway including both kit ligand and the kit receptor is required for germ cell survival

(Dolci et al., 1991). Kitl mutants, including the steel alleles, have a reduced germ cell

population and infertility. The KitlSlJ allele (SteelJ or SlJ) is a semi-dominant spontaneous

mutation resulting from a 640-kb deletion which includes the Kitl gene (Bedell et al.,

1996). When introduced to the 129 background, heterozygous KitlSlJ/+ mice have a

tumor incidence of 14%. Homozygous KitlSlJ/KitlSlJ mice are PGC deficient and

embryonic lethal (Stevens, 1967a).

Somatic KIT mutations have been reported in human TGCTs, with mutations appearing

more frequently in patients with bilateral tumors (Looijenga et al., 2003; Rapley et al.,

2004). However, in mice an increase in tumor prevalence carrying Kit mutations was not

found (Lam and Nadeau, 2003). Tumorigenic mutations in the human kit ligand gene

(KITLG) have also been identified (Kanetsky et al., 2009; Rapley et al., 2009).

Trp53

Trp53 (p53) is a well-characterized tumor suppressor located on Chromosome 11 that

causes cell cycle arrest to allow repair of DNA damage. Trp53 mediates germ cell apoptosis and functions in the normal reduction of the germ cell population during development. Loss of this regulation results in an increased number of abnormal germ cells and reduced fertility – two known risk factors for TGCT (Yin et al., 1998). The human p53 gene (TP53) is the most frequently mutated gene in human cancers, occurring in around 50% of all cancer cases (Soussi and Lozano, 2005). However, p53 mutations are not associated with human testicular cancer except in rare instances where TGCTs

develop as part of Li-Fraumeni syndrome, a rare clinical syndrome of familial soft tissue

tumors linked to germ-line p53 mutations (Hartley et al., 1989).

Mice with inactivating mutations in Trp53 display an increased susceptibility to tumors.

The tumor types depend on predisposition of the genetic background. In 129/Sv mice,

Trp53null individuals develop TGCTs at an increased rate: 35% of homozygous

Trp53null/Trp53null males and 15% of heterozygotes develop TGCTs (Donehower et al.,

1992; Harvey et al., 1993b).

Pten

Pten (phosphatase and tensin homolog) is a tumor suppressor located on Chromosome

19. PTEN is a lipid phosphatase which plays a role in cell proliferation, differentiation, apoptosis and cell migration (Cantley and Neel, 1999; Di Cristofano and Pandolfi, 2000).

PTEN is frequently mutated in human cancers with a frequency similar to that of p53

(Stokoe, 2001). All Pten knockout mice examined developed bilateral TGCTs as a result of impaired mitotic arrest and increased proliferative capacity (Kimura et al., 2003). Pten

is essential for normal germ cell differentiation and regulation of the germ cell

population.

The Ay mutation is a large 150kb deletion in the agouti coat color locus on Chromosome

2 which deletes the genes Raly and Eif2s2 inducing ectopic expression of Agouti

(Michaud et al., 1994). Ay is a dominant mutation which is associated with obesity,

diabetes and a predisposition to spontaneous tumors (Carpenter and Mayer, 1958; Plocher and Powley, 1976). Despite the increased susceptibility to most spontaneous or induced

tumors, presence of the Ay mutation on the 129 background results in a significant

reduction of TGCT incidence (Lam et al., 2004). The decrease in TGCT incidence is

attributable to the heterozygous deletion of Eif2s2, a subunit of the translation initiation

factor eIF2 (Heaney et al., 2009b).

Gene Interaction Tests

In studying the genetics of complex diseases, exploring the interplay between multiple

genes is integral to reaching an understanding of disease progression and susceptibility.

Intercrosses performed in mouse models of TGCT have identified interactions between

modifiers of disease susceptibility. Genes are said to display an interaction when the

effect of the modifiers together is different from the expected additive effect. Analysis is

limited to identification of statistical interactions between genes which must then be

followed up with further studies to determine the nature of biological interaction.

Transgenerational interactions in TGCT

A series of pair-wise interaction tests utilizing heterozygote intercrosses demonstrated a

trans-generational interaction between Dnd1Ter and six different TGCT modifiers (KitlSlJ,

Trp53null, Ay, CSS M19, M19-A2 and M19-C2) (Lam et al., 2007; Lam et al., 2004). The

interaction was seen with all six TGCT modifiers implicating Dnd1Ter in a nontraditional,

transgenerational mechanism of interaction. If a TGCT modifier was present in either

parent, an increase in TGCT prevalence was observed in Dnd1Ter/+ males independent of

the second TGCT modifier’s inheritance (Lam et al., 2007). All offspring carrying the

Ter mutation, including those that do not inherit a second modifier, display increased

TGCT risk relative to parental mice with the identical genotype (Lam et al., 2007). This interaction is unique in that the interacting genes are not present together in the affected individual. Dnd1Ter is present in the progeny; the second modifier mutation is present in the parent. The mechanism of this interaction has not been identified and it remains

unknown whether the mode of interaction is related to a unique property of TGCTs or is a more widely observed mechanism which has remained previously unidentified.

The AID/APOBEC Family

Dnd1 shares greatest homology to A1cf (previously Acf) suggesting that Dnd1 may have similar functions in RNA-binding or RNA-editing. A1cf is known to form a complex with the cytidine deaminase Apobec1 to allow RNA-editing. mRNA targets can be modified post-translationally through RNA-editing to change the nucleotide sequence to include bases which are not encoded in the genomic DNA. Numerous RNA-editing enzymes, including cytidine and adenosine deaminases, have been described and are well-conserved in mammals as a mechanism for nucleotide conversion (Chan et al.,

1997). Outside mammals, RNA-editing has not been identified (Chan et al., 1997).

However, DNA-editing and DNA deamination are conserved throughout vertebrates.

The deaminase Apobec1 was the founding member of the AID/APOBEC (Activation- induced deaminase/apolipoprotein B-editing catalytic subunit 1) family. This family consists of Apobec1, Apobec2, Apobec3 (APOBEC3A to H in humans) and AID.

Apobec1

Apobec1 is a cytidine deaminase producing cytosine to uracil conversion. Apobec1 was

first identified through its role in the physiological truncation of apolipoprotein B (ApoB)

from the full transcript encoding ApoB-100 to the shorter ApoB-48 (Chan et al., 1997).

Apobec1 edits the mRNA transcript before it leaves the nucleus introducing an early stop codon which results in translation of ApoB-48, the initial 48% of the full ApoB transcript

(Chan et al., 1997). Editing of ApoB occurs only in the presence of Apobec1 and

associated cofactors (Hirano et al., 1996). Apobec1 is widely expressed in many tissues

including lung, spleen, heart, kidney, intestine, oocytes, ovary, and testis (Smith et al.,

2007).

In addition to enzymatic RNA-editing activity, Apobec1 is an RNA-binding protein with

broad specificity binding to AU or U rich targets with a preference for UUUN(A/U)U

motifs (Anant and Davidson, 2000).. Editing of ApoB mRNA is dependent on Apobec1

RNA-binding activity, localized to the amino-terminal half of the protein (Anant and

Davidson, 2000). However, RNA-binding by APOBEC1 itself is not sufficient to allow

editing in the absence of associated complementation factors, such as A1cf (Anant et al.,

1995). In addition to binding A1cf and ApoB RNA, Apobec1 also binds GRY-RBP, an

RNA binding protein with sequence homology to A1cf. GRY-RBP binds to A1cf, inhibits

binding of A1cf to ApoB RNA and decreases RNA editing of ApoB RNA (Blanc et al.,

2001b). Addition of A1cf is sufficient to rescue the decrease in RNA editing suggesting

that GRY-RBP may be binding and sequestering A1cf preventing its interaction with

Apobec1.

The targeted deletion of Apobec1 results in complete loss of ApoB mRNA-editing and

ApoB-48 in all tissues (Hirano et al., 1996). In mice heterozygous for Apobec1

deficiency, phenotypic abnormalities in RNA-editing are tissue specific. RNA-editing

remains at wild-type levels in the intestine but is reduced in other tissues such as the

heart. Homozygous knockout mice appear healthy, fertile and aside from a complete lack

of Apobec1 RNA-editing do not display any phenotypic abnormalities (Hirano et al.,

1996). Overexpression of Apobec1 leads to stabilization of c-myc, Cox2, TNF-α and IL-2

mRNA and has been shown to increase cancer incidence (discussed below) (Anant and

Davidson, 2000; Hirano et al., 1996). Deletion of Apobec1 in the mouse knockout model

decreases Cyp7a1 through post-transcriptional regulation of mRNA stability (Anant and

Davidson, 2000; Xie et al., 2009).

Aside from editing of ApoB, Apobec1 also edits Eif4g2 (Nat1, Novel Apobec Target 1).

Eif4g2 is related to Eif4g which is the scaffolding component assembling the other subunits of the eIF4 complex regulating translation initiation. eIF4 works in conjunction with eIF2 to regulate the rate of translation in response to stress. The eIF4 complex delivers the mRNA to the 40s ribosomal subunit. eIF2-GTP delivers the initiating tRNA to the 40s subunit controlling the rate of translation (DeGracia et al., 2002). Deletion of

Eif2s2 decreases TGCT risk in 129/Sv male mice (Heaney et al., 2009a).

Apobec2

Apobec2 is the only member of the AID/Apobec gene family found in all examined

vertebrate species; Apobec1 and Apobec3 are specific to mammals (Mikl et al., 2005).

Apobec2 is the most divergent of the Apobec genes. It is predominantly expressed in

cardiac and skeletal muscle and shows no evidence of either in vivo or in vitro nucleotide editing activity (Liao et al.). However, Apobec2 can associate with Apobec1 or A1cf and

could result in a down-regulation of Apobec1 RNA-editing through this physical

interaction (Anant et al., 2001). Expression of Apobec2 is enhanced by tumor necrosis factor-α or interleukin-1β through a NF-κB response element in the promoter (Matsumoto et al., 2006). Mice homozygous for the deletion of Apobec2 are healthy, fertile and no phenotypic abnormalities are detectable up to 1 year of age (Mikl et al., 2005).

Apobec3

Apobec3 is a DNA–deaminase abundantly expressed in lymphatic tissue (spleen and bone marrow) (Mikl et al., 2005). In humans, several of the 7 known APOBEC3s act as host restriction factors in viral infection, such as HIV and HPV, or in suppressing retroelement transposition (Chiu and Greene, 2008; Vartanian et al., 2008; Zhang et al.). APOBEC3G,

3F and 3C have been shown to function in preventing HIV infection by deaminating the

first strand of DNA replication intermediates in humans (Mariani et al., 2003). The role

of other human APOBEC3s as well as the single Apobec3 in mice remains unknown but

has also been proposed to function in repressing transposition. However, the repression

of endogenous retrotransposons occurs specifically in the male germ line where Apobec3

is not expressed or expressed only at very low levels in mouse (Mikl et al., 2005). It is

unknown whether Apobec3 confers resistance to retroviruses. Homozygous deletion of

Apobec3 does not affect development, survival or fertility (Mikl et al., 2005). APOBEC3

physically interacts with DND1 and binds mRNA to inhibit miRNA-mediated

repression.(Bhattacharya et al., 2008) However, Apobec3 is poorly expressed in wild type mouse testis making its involvement with Dnd1 and TGCT risk uncertain.

Apobec4

Apobec4 is the newest identified member of the AID/APOBEC family (Rogozin et al.,

2005). Apobec4 is expressed primarily in testis making it of particular interest in relation to TGCTs and potential association with Dnd1. Like Apobec2, Apobec4 is an ancestral gene which is conserved in all jawed vertebrates (Conticello, 2008). Apobec4 has low sequence similarity with the other Apobec enzymes making its ability to function as a deaminase unclear. However, greatest similarity is shared with Apobec1(Conticello,

2008).

Activation-induced deaminase

Activation-induced deaminase (AID) is closely related to the APOBEC1 protein.

However, AID is found only in B-lymphocytes (Mikl et al., 2005). Unlike APOBEC1,

AID is not restricted to mammals and is found in all vertebrates. AID functions as a

DNA cytidine deaminase and targets immunoglobulin DNA allowing diversity in antibody production (Neuberger et al., 2003).

Apobec1 complementation factor

Apobec1 complementation factor (A1cf) is an RNA binding protein that functions in

combination with Apobec1 and is required for Apobec1 RNA-editing. A1cf is expressed

predominantly in adult liver, small intestine and kidney (Blanc et al., 2005a).

Embryonically, at E12.5 A1cf is expressed the heart, spinal cord and lungs (Blanc et al.,

2005a). A1cf mediates both protein-protein interaction and protein-RNA interaction to

facilitate and regulate C-to-U RNA-editing through the APOBEC1 RNA-editing

complex. The homozygous deletion of A1cf results in embryonic lethality due to

preimplantation failure. Mice homozygous for the targeted deletion of Apobec1 however

are fully viable suggesting that A1cf may have a second, unidentified function that does

not involve Apobec1 (Blanc et al., 2005a). In heterozygous matings (+/- x +/-) a greater

number of mutant offspring is observed than expected. Rather than the expected

Mendelian 2:1 ratio of heterozygous to wild-type offspring, a 10:1 ratio is observed.

The Apobec family, RNA-editing and Cancer

Multiple studies have looked at the role of the APOBEC gene family in cancer development. Apobec1, Apobec2, and Apobec3 in mouse can induce cancer when overexpressed suggesting that they may be proto-oncogenes (Navaratnam and Sarwar,

2006). Overexpression of Apobec1 in the liver is associated with hepatic dysplasia and hepatocellular carcinoma (Hirano et al., 1996). In human colon cancer, Apobec1 mRNA

is significantly increased (Lee et al., 1998). Similarly, deletion of Apobec1 has been

associated with a reduced number of colorectal adenomas in Apcmin/+ (adenomatous

polyposis coli) mice which normally develop adenomas at a high rate (Blanc et al.,

2005b). A functional APOBEC1 editing complex is lost in many human tumors, either

through the loss of APOBEC1 or of associated components (Greeve et al., 1999). Further studies demonstrated that human APOBEC1 and APOBEC3 can trigger DNA mutation through promiscuous deoxy-cytosine deamination when overexpressed with each enzyme maintaining some inherent target specificity(Harris et al., 2002). The function of

Apobec1 in cytidine deamination provides a possible explanation for the increased cancer incidence upon overexpression as well as the reduced tumor burden observed with

Apobec1 deletion. .

Chapter III.

Transgenerational genetic effects of the paternal Y chromosome on daughter’s

phenotypes

Abstract

Aims: Recent evidence suggests that transgenerational genetic effects contribute to phenotypic variation in complex traits. To test for the general occurrence of these effects and to estimate their strength, we took advantage of chromosome substitution strains

(CSSs) of mice where the Y chromosome of the host strain has been replaced with the Y chromosome of the donor strain. Daughters of these CSS-Y males and host strain females are genetically identical and should be phenotypically indistinguishable in the absence of transgenerational genetic effects of the fathers’ Y chromosome on daughters’ phenotypes.

Materials & methods: Assay results for a broad panel of physiological traits and

behaviors were compared for genetically identical daughters of CSS-Y males and host

strain females from the B6-ChrA/J and B6-ChrPWD panels of CSSs. In addition, behavioral

traits including specific tests for anxiety-related behaviors were tested in daughters of B6-

Chr129 and 129-ChrB6 CSS-Y males. Results: Across a panel of 41 multigenic traits

assayed in the B6-ChrA/J panel of CSSs females and 21 multigenic traits in the B6-

ChrPWD panel females, the frequency and strength for transgenerational genetic effects

were remarkably similar to those for conventional inheritance of substituted

chromosomes. In addition, we found strong evidence that the Y chromosome from the

129 inbred strain significantly reduced anxiety levels among daughters of B6-Chr129

CSS-Y males. Conclusion: We found that transgenerational genetic effects rival

conventional genetic effects in frequency and strength, we suggest that some phenotypic

variation found in conventional studies of complex traits are attributable in part to the

69 action of genetic variants in previous generations, and we propose that transgenerational genetic effects contribute to the ‘missing heritability’.

Introduction

In recent years, a greater understanding of phenotypic variation and human disease has been achieved through characterization of the genetic architecture of complex traits and identification of complex trait genes (QTLs) (Altshuler et al., 2008; Frazer et al., 2009).

However, despite unprecedented analytical and technological advances, genes underlying many common diseases have remained remarkably elusive. In most instances, the cumulative effects of known genetic variants account for an unexpectedly small portion of heritability (Altshuler et al., 2008; Hirschhorn, 2005; Manolio et al., 2009). As a result, many of the genetic determinants underlying phenotypic variation and disease risk have not yet been detected. Among the usual explanations for ‘missing heritability’ are overestimates of heritability, unexplored regions of the genome, untested classes of genetic variants, and the action of many rare genetic variants (Hirschhorn, 2005; Maher, 2008;

Manolio et al., 2009).

Inheritance of epigenetic changes could contribute to phenotypic variation in the absence of DNA sequence differences (Nadeau, 2009). The molecular basis for these epigenetic effects could be DNA methylation (Anway et al., 2005; Johannes et al., 2009; Morgan et al., 1999; Rakyan et al., 2003; Skinner and Anway, 2005), histone modifications

(Hammoud et al., 2009), or possibly small RNAs (Grandjean et al., 2009;

Rassoulzadegan et al., 2006; Wagner et al., 2008). Many examples of transgenerational

effects resulting from environmental exposures have been reported (Anway et al., 2005;

Chang et al., 2006; Matthews and Phillips, 2010; Skinner, 2007; Skinner and Anway,

2005). Perhaps more interesting from a genetic and evolutionary perspective are transgenerational genetic effects where variants in one generation affect phenotypes in subsequent generations without inheritance of the original genetic variant(Nadeau, 2009).

Under these conditions, traits still show heritability, but the association between genotype and phenotype in studied individuals is weakened or lost. Published mammalian examples that have overt phenotypic consequences include pigmentation defects

(Rassoulzadegan et al., 2006), embryogenesis and adult growth (Grandjean et al., 2009), cardiac hypertrophy (Wagner et al., 2008) and testicular cancer (Heaney et al., 2008; Lam et al., 2007). Background genetic variation, social influences and environmental factors greatly complicate discovery of transgenerational genetic effects, especially in humans.

With animal models however, these complications can usually be precisely controlled, thereby enabling rigorous tests for genetic variants that have persistent phenotypic effects across generations.

Two major questions in studies of transgenerational genetic effects concern the frequency of affected traits and the strength of their phenotypic effects. In particular, are traits that show these unusual inheritance patterns common or rare, and are their phenotypic effects strong or weak, compared to QTLs that are inherited in the conventional manner?

Our test for the frequency and strength of transgenerational genetic effects is based on the observation that although the father’s Y chromosome is not transmitted to daughters,

71 phenotypic effects might nevertheless be epigenetically inherited. To control genetic background so that transgenerational genetic effects can be attributed uniquely to the Y chromosome, we used chromosome substitution strains (CSSs) (Nadeau et al., 2000;

Singer et al., 2004). A CSS is made by substituting a single chromosome from a donor strain on an inbred host strain background (Figure 1A). The resulting strain is identical to the original inbred host strain except for homozygosity (or hemizygosity) for the substituted chromosome. Daughters of these males do not inherit the substituted Y chromosome and are therefore genetically identical to females from the host strain

(Figure 1B). By controlling the influence of potentially confounding genetic, social and environmental factors, we found striking evidence for frequent and strong phenotypic changes in daughters’ that is attributable in a transgenerational genetic manner to the paternal Y chromosome.

Materials and Methods

Mice: C57BL/6J-Chr Y<129S1/SvImJ> (B6-Y129, a B6 male with its Y chromosome derived from 129, JR #005547) and 129S1/SvImJ-Chr Y (129-YB6, a 129 male with its Y chromosome derived from B6, JR #005548) were derived as described previously (Anderson et al., 2009a; Hammond et al., 2007) and maintained with repeated backcrossing to C57BL/6J (B6, JR #000664) and 129S1/SvImJ (129, JR #002448) strain females, respectively to control for new mutations and genetic drift among inbred strains

(Jackson Laboratory, Bar Harbor, Maine). We refer to these males generically as CSS-Y and to daughters of CSS-Y males versus host females as ‘B6’ versus B6, and ‘129’ versus

129. Control females for these studies were obtained from our independent C57BL/6J

and 129S1/SvImJ colonies. We note that ‘B6’ and ‘129’ test females are genetically

identical to B6 and 129 control females, respectively.

To test for substitution of the pseudoautosomal region of the X chromosome in CSS-Y

daughters, a SNP (rs30590889) was identified that distinguishes the pseudoautosomal

region of the X and Y chromosomes from the host and donor strains. This SNP introduces an AciI restriction site at base 166428342 (NCBI Build 37). The region was

PCR amplified (Forward: CCCATGTGTTTGTTTTCCCT, Reverse:

CGGGGTGACAGAGGAGAAT) and digested with AciI. CSS-Y daughters were homozygous for the host strain allele indicating that the inherited paternal X chromosome did not carry material derived from the substituted Y chromosome, as expected given obligate recombination between the pseudoautosomal region of the X and Y chromosomes (Palmer et al., 1997; Perry et al., 2001) and repeated backcrossing to the host strain.

Phenotype Analysis: Data were obtained for 120 traits tested in the C57BL/6J-ChrA/J

CSS panel (Singer et al., 2004) and 38 traits tested in the C57BL/6J-ChrPWD CSS panel

(Gregorova et al., 2008) from the Mouse Phenome Database (www.jax.org/phenome,

(January 2010)). Mitochondrial CSSs were excluded from this analysis. In addition, data for the B6-ChrMSM CSS panel (Takada et al., 2008; Takahashi et al., 2008) were also

excluded in this study because the single multigenic trait that differed significantly

between daughters of B6-ChrYMSM males and C57BL/6J females was insufficient for a

rigorous analysis.

Frequency of traits with significant phenotypic effects: The first step was to identify

CSSs, for each trait, that differed significantly from the host strain (p< 0.05 after

Bonferroni correction for multiple testing), then multigenic traits were selected where 3

or more CSSs showed such differences (excluding ‘B6’ in this calculation), next among

these multigenic traits the frequency (percentage) of traits that showed significant

phenotypic variation relative to the host strain was calculated separately for each CSS

and for ‘B6’, and finally the average percentage across specific strains or combinations of strains was calculated (cf.Table 2).

Average phenotypic effect: For each CSS, the strength of the phenotypic effect for each multigenic trait was calculated as the difference between the trait value for that CSS and the parental host strain, and was expressed as a function (percentage) of the difference between the corresponding inbred host and donor strains (Shao et al., 2008). Then separately for each CSS and ‘B6’, an average effect was calculated by averaging the

individual phenotypic effects for all multigenic traits differing significantly between that

CSS or ‘B6’ and the host strain. Finally, the average percentage across specific

combinations of strains was calculated (cf.Table 2)

Behavioral Testing: Behavioral testing was performed by the Case Western Reserve

University School of Medicine Rodent Behavior Core (http://neurowww.case.edu/crbc/).

Mice were housed in the testing facility and handled by Rodent Behavior Core staff 7-10 days prior to testing. Females were 2-3 months of age at the beginning of testing and

Figure 1 Study design testing for effects of the paternal Y chromosome on daughters’ phenotypes. (A) Generation of substitution strains for the Y chromosome. Males were backcrossed to the C57BL/6J host strain, with selection for males at each of at least 10 backcross generations to reconstitute the genetic background of the host strain[23,24]. (B) Genetic identity for daughters of CSS and host strain males. (C) Controlling for social effects. Male parents and siblings were removed at birth from home cages and then one each of the two test and two control females (total of four females) were housed together after weaning.

(A) (B)

(C)

75 were age-matched such that the age difference between test and control cohorts was no greater than 2 days. To control for social effects that may result from housing females with test or control males, male parents were removed from mating cages prior to birth and male siblings removed prior to postnatal day 3. Females included in the study were raised with at least one female sibling prior to weaning. After weaning, females were housed in groups of four, one each 129, ‘129’, B6 and ‘B6’, to control for estrus cycle and social influences (Figure 1C). A total of 16 replicates of these groups of four were tested, for a total of 64 females in the study. These females were derived from 23 different males to minimize impact of possible parent-specific effects within the four test and control strains. Finally, cages were coded and sent for behavioral testing with the genotype removed to prevent bias during testing.

Phenotyping Screen: Phenotyping for a panel of 42 behavioral traits was performed using a modified SHIRPA protocol (Shao et al., 2008), which included indicators for gross defects in motor function, sensory and autonomic function, mood and behavior. A complete list of traits is provided in Appendix I.

Open-field Test: Mice were placed in an open field for 15 minutes. Anxiety-prone behavior was measured by determining the exploratory pattern of the mouse over a 15 minute test.

Elevated Plus Maze: Mice were placed in the center of an elevated 4-arm maze with two open arms and two enclosed arms. Anxiety associated behavior was determined by

counting the number of times mice entered open or closed arms as well as the time spent

in each arm.

Analysis: Analysis was performed by comparing each test group to both the host and

donor strains (Student’s t-test), with the significance threshold set at p<0.05 after

Bonferroni correction for multiple testing.

Results

Survey for transgenerational genetic effects

Phenotypic variation among daughters of B6-ChrYA/J and B6-ChrYPWD males as well as among CSSs for autosomes and for the X and Y chromosomes was surveyed to characterize transgenerational effects for occurrence (frequency (%) of traits that differed significantly) and strength (average phenotypic effect for multigenic traits). We focused on a total of 120 traits for the B6-ChrA/J CSS panel (January 2010) and 38 traits for the

B6-ChrPWD panel (Gregorova et al., 2008). Multigenic traits were then identified by

selecting those where at least three CSSs differed from B6, excluding ‘B6’ from this calculation. A total of 41 traits in females and 23 in males remained for the B6-ChrA/J panel, including 22 behavioral, 7 cardiac and 12 hematologic traits in females and 9 behavioral, 4 cardiac and 10 hematologic traits in males. A total of 21 traits in females and 26 traits in males remained for the B6-ChrPWD panel, including 17 hematologic in

females, 22 hematologic in males, 3 obesity-related traits and bone mineral density.

Several traits are highlighted to provide a sense of the nature of the phenotypic variation

between ‘B6’ females and the CSSs (Figure 2; a complete list is provided in

Table 2 Frequency of unconventional (transgenerational or social) effects in CSS panels. Frequency of unconventional (transgenerational or social) effects and average phenotypic effect in daughters of CSS-Y males and conventional genetic effects in females of the B6-ChrA/J and B6-ChrPWD CSS panels. Gray cells highlight results for ‘B6’ females.

A. % traits with significant Average phenotypic B6‐ChrA/J phenotypic variation effect Chromosome Females Males Females Males Transgeneration ‘B6’ al effects (Y ‐ father) 36.6% 85.7% Y (brother) 30.0% 73.6% Conventional X 34.1% 17.4% 74.3% 92.6% effects Autosomes 46.5% 35.9% 94.2% 82.0%

B. % traits with significant Average phenotypic B6‐ChrPWD phenotypic variation effect Chromosome Females Males Females Males Transgeneration ‘B6’ al effects (Y ‐ father) 9.5% 128.2% Y (brother) 3.8% 80.9% Conventional X 21.4% 13.5% 145.0% 142.9% effects Autosomes 11.1% 9.7% 113.7% 179.0%

Figure 2 ‘B6’ test versus B6 control females in the B6-ChrA/J and B6-ChrPWD CSS surveys. Results highlighted in gray represent significant differences from C57BL/6J. ‘B6 test and B6 control groups are boxed to highlight the primary contrast in this test. P<0.05 after Bonferroni correction for multiple hypothesis testing (January 2010; Shao et al., 2008; Singer et al., 2004). A. Mean platelet volume (fL) for B6-ChrA/J CSSs. B. QT interval (ms) for B6-ChrA/J CSSs. C. Total fatty acids (mg/dl) for B6-ChrA/J CSSs. D. Startle reflex (response to airpuff) for B6-ChrA/J CSSs. E. Plasma triglyceride (mg/dl) for B6-ChrPWD CSSs. F. Bone mineral density (g/cm2) for B6-ChrPWD CSSs. A.

Figure 2 (Con’t)

Appendix VI) In particular, we show four representative traits for the B6-ChrA/J panel

(mean platelet volume, QT interval, total fatty acid level and startle reflex), and two

representative traits for the B6-ChrPWD panel (plasma triglycerides and bone mineral

density). The number of CSSs that differed from B6 ranged from three (plasma

triglyceride) to seventeen for mean platelet volume. In each case, ‘B6’ females showed

phenotypic differences that were generally similar in strength to differences found in

other CSSs.

For these multigenic traits, we then compared the occurrence and strength of

transgenerational versus conventional effects in these two CSS panels. On average for the

B6-ChrA/J panel, 46.5% of the multigenic traits tested in females for each autosomal CSS

(range 29.3-61.0% for individual autosomal CSS strains) and 34.1% of multigenic traits in B6-ChrXA/J females were significantly changed relative to B6 females (Table 2).

The frequency of affected traits was somewhat lower for males (35.9% for autosomal

CSSs with range 17.4-65.6%, 17.4% for B6-ChrXA/J males, and 30% for B6-ChrYA/J males (Table 2). Remarkably, for ‘B6’ females, 36.6% of multigenic traits differed from

B6 females, a frequency that was similar to other CSSs in the panel.

Results for the multigenic traits for the B6-ChrPWD panel revealed similar patterns of

variation (Table 2). In particular, the average frequency of affected traits was 11.1%

(range 4.8-19.0%) in females for autosomal CSSs and 21.4% (19.0% in X.1 and 23.8% in

X.3) for X chromosome CSSs. Again, the frequency of affected traits was lower in males than in females, with 9.7% (range 0 – 42.3%) of traits showing significant variation for

autosomal CSSs, 13.5% for X Chromosome CSSs (7.7 and 19.2% for X.1 and X.3), and

3.8% for B6-ChrYPWD. For ‘B6’ females, 9.5% of the traits differed significantly from B6

females. Together these results suggest that transgenerational effects were as common as

conventional genetic effects that result from the direct action of substituted

chromosomes.

We next focused on effect size as a measure of the strength of phenotypic effects.

Average effect size was calculated as the percent of the difference between the host and

donor strain that was attributable to the substituted chromosome. Interestingly, average

effect size was similar between ‘B6’ daughters of B6-ChrYA/J males and other strains in

the B6-ChrA/J panel. Among the 41 multigenic traits tested in females of the B6-ChrA/J panel, 15 were significantly different between ‘B6’ and B6 females. The average effect size of these differences in ‘B6’ was 85.7%, which was remarkably similar to the average effect size of 94.2% (range 80.2-115.2%) in autosomal CSS females and 74.3% in B6-

ChrXA/J females (Table 2). Among ‘B6’ daughters of B6-YPWD males, the average

phenotypic effect was 128.2%, which was remarkably similar to the average effect

among B6-ChrXPWD (145.0%) and autosomal CSS females in the panel (113.7%, range

59.6-242.3%) (Table 2).

Behavioral Testing

The similar frequency and size of phenotypic effects in ‘B6’ test and B6 control females

suggest that transgenerational genetic effects play a large role in the inheritance of

complex traits. However, the possibility remains that the effects do not result from

84 transgenerational effects attributable to the substituted paternal Y chromosome but instead from other social or environmental factors. We therefore designed a study utilizing ‘B6’ and ‘129’ as test females, and B6 and 129 as control females to test directly for transgenerational effects of the paternal Y chromosome under conditions that rigorously control for social and environmental factors. Social effects that may result from the presence of males were minimized by removing male parents prior to birth and removing male siblings shortly after birth. To control social influences after weaning, females were housed in cohorts containing one age-matched female from each of four test groups (B6, ‘B6’, 129, and ‘129’females), ensuring that each test mouse in the cohort was exposed to the same environmental and social conditions affecting other mice in the cage (Figure 1C).

An initial behavioral phenotyping survey suggested changes in anxiety-related phenotypes (Appendix I). We therefore performed open-field and elevated plus maze testing to examine these phenotypes in detail.

Open-field and elevated plus maze (EPM) assays were used to test directly for anxiety- related phenotypes. ‘B6’ test and B6 control females showed similar measures of total activity, total distance traveled and average velocity (calculated as the distance travelled per second of testing) during the open-field test, as well as total number of entrances into arms of the maze during EPM testing (Appendices II-III). Anxiety was measured as a decrease in the amount of time spent in the center region of the open-field and in parallel a decrease in the proportion of entrances into and percent of time spent in

Figure 3 Elevated plus maze and open field tests for anxiety-related behavior. (A) ‘129’ test and 129 control females, and (B) ‘B6” test and B6 control females. Sixteen independent tests were made, with four mice in each test (cf. Figure 1C) and a total of 64 mice. For the elevated plus maze test, the percent of time spent in and entrances into the open rather than closed arms of the maze was measured, and for the open field test, the time spent in the center of the open field was measured. Data shown as mean ± SEM, *p<0.05.

open arms of the EPM. Anxiety-related measures in ‘129’ test females were not

significantly different from the 129 control females, suggesting that the paternal ChrYB6 chromosome did not affect anxiety in ‘129’ daughters (Figure 3A).

By contrast, a significant increase in the time spent in the center region of the open-field was observed in ‘B6’ test females compared to the genetically-identical B6 control females (Figure 3B). In addition, in ‘B6’ females, we found a significant increase in the percent of time spent in open arms of the EPM and a corresponding, non-significant increase in the percent of entrances into open arms, suggesting that ‘B6’ females have a decreased level of anxiety compared to the genetically-identical B6 control females.

Thus at least one factor associated with the paternal 129-derived Y chromosome led to a heritable epigenetic change that reduced anxiety in ‘B6’ females.

Discussion

We found that transgenerational genetic effects are both common and strong among daughters of males with different Y chromosomes. With conventional modes of inheritance, daughters of CSS-Y males and genetically identical host strain females should be phenotypically indistinguishable. However, the frequency of affected traits and the strength of their effects in daughters of CSS-Y males were remarkably similar to those observed in females with a substituted autosome or X chromosome, and to males with a substituted autosome or with a substituted X or Y chromosome (Table 2). In addition, results based on the careful design of behavioral tests in ‘B6’ and ‘129’ females strongly argue that transgenerational rather than social and environmental factors led to 87 reduced anxiety in ‘B6’ daughters of B6-ChrY129 males. These results are especially surprising given the relatively small number of genes on the Y chromosome. At least three important questions emerge: first, do other chromosomes lead to transgenerational effects, second, do transgenerational effects occur in humans, and third, what is the molecular basis for these effects?

These transgenerational effects appear to depend on interactions between the host strain background and epigenetic factors related to specific Y chromosomes. In particular, the paternal 129-derived Y chromosome affected anxiety-related behaviors during open-field and elevated plus maze testing on the C57BL/6J but not the 129S1/SvImJ genetic background, suggesting that combinations of factors, one in fathers and the other in daughters jointly determine phenotypic outcome. Similar interactions across generations have been reported previously (Heaney et al., 2008; Lam et al., 2007).

Heritable epigenetic changes could contribute to ‘missing heritability’ in humans and model organisms. The association between genotype and phenotype is central to many studies of heritable traits. However, ongoing genome-wide association studies (GWAS) to discover these associations have yielded a surprising and unexpected result, namely that most genetic variants elude discovery (Manolio et al., 2009). Among the explanations that are being actively investigated are over-estimates of heritability, unexplored regions of the genome, untested classes of genetic variants, and action of many rare variants. We propose that transgenerational genetic effects contribute to

‘missing heritability’. The present study together with related reports suggest that

88 heritable epigenetic effects are as common and as strong as genetic variants whose phenotypic effects are inherited in the conventional manner (Heaney et al., 2008; Lam et al., 2007; Rassoulzadegan et al., 2006). In addition, two recent studies show that these effects can persist for multiple generations (DA Buchner, SN Yazbek, VRN and JHN, submitted and in preparation). A carefully designed study for the same traits in the same population is urgently needed to measure the relative impact of transgenerational and conventional inheritance.

Several molecular mechanisms could mediate transgenerational effects. Considerable evidence supports heritable changes in DNA methylation and histone modifications

(Hammoud et al., 2009; Rakyan et al., 2001) . However, growing evidence from plants, flies, worms and mice implicate aspects of RNA biology such as small RNAs (Aravin and Hannon, 2008; Grandjean et al., 2009; Malone and Hannon, 2009; Rassoulzadegan et al., 2006; Wagner et al., 2008), RNA binding proteins that edit RNA (Youngren et al.,

2005) and control access of miRNA to target mRNAs (Kedde et al., 2007), and RNA editing enzymes that also methylate DNA (Morgan et al., 2004; Popp et al.). Several of these processes control translation in RNA granules that are abundant in gametes in both males and females (Anderson and Kedersha, 2006; Anderson and Kedersha, 2009; Parker and Sheth, 2007). Delineating the sequence of molecular events that initiate epigenetic changes in one generation and lead to phenotypic changes in subsequent generations is perhaps the major question in studies of transgenerational effects.

Chapter IV. The Role of Apobec1 in TGCT Susceptibility, Stem Cell Derivation and transgenerational epistasis with Dnd1Ter

Abstract

The Ter mutation in Dnd1 causes germ cell deficiency and a dramatic increase in the

incidence of testicular germ cell tumors (TGCTs) on a susceptible background. Dnd1

shows sequence homology to A1cf, an RNA-binding subunit of the APOBEC1 editing complex. A1cf acts as a chaperone for the catalytic enzyme Apobec1, a cytidine deaminase that generates C to U/T transitions in target mRNAs. In this chapter we identify several non-conventional, parental and transgenerational effects of Apobec1 on three phenotypes – TGCT prevalence, stem cell derivation efficiency and allele segregation. Unlike conventional genetic tests comparing phenotypes in distinct genetic groups, to test for non-conventional effects we compare groups of genetically identical animals. Several tests are discussed in this chapter and in many the genetic differences are not between the phenotyped cohorts but in their parents.

Utilizing an Apobec1 targeted knockout mouse, we show that Apobec1 is a TGCT modifier on the strain 129 background. Apobec1null acts as an enhancer of TGCT

prevalence through the paternal germ line and a suppressor through the maternal germ

line. We identified a maternal, transgenerational effect on wild-type littermates who inherit the same parentally determined TGCT risk as their mutant litter-mates. Through interaction crosses, we identify transgenerational interactions between Dnd1 and Apobec1 which alter TGCT susceptibility and bias allele segregation in Apobec1null/+ and Dnd1Ter/+ single-mutants. Apobec1null acts additively, rather than epistatically, with Dnd1Ter to

determine phenotype and is the only gene identified that interacts with Dnd1 to affect allele segregation in double-mutant offspring.

Introduction

Testicular cancer is the most common malignancy affecting young men aged 15-34

(Buetow, 1995). More than 90% of testicular cancers result from testicular germ cells

tumors (TGCTs) (Baharami et al., 2007). Family history is the strongest known risk

factor with a 4-6 fold increase in sons and an 8-10 fold increase in brothers of affected

individuals (Lindelöf and Eklund, 2001). Despite strong heritability, the only

susceptibility factors identified in genome-wide studies are the gr/gr deletion on

chromosome Y and mutations in Kitl (Kanetsky et al., 2009; Nathanson et al., 2005).

Known genetic risk factors account for less than 10% of cases with an established family

history of TGCT. Despite strong heritability, mapping, linkage and gene discovery has

proven difficult making a mouse model of TGCT essential to furthering our

understanding of the underlying genetic risk.

The 129 inbred strain of mice is the only strain known to develop spontaneous TGCTs at

an appreciable rate with 7% of males presenting with at least 1 TGCT by 4 weeks of age

(Stevens, 1967b; Stevens and Hummel, 1957). TGCTs in mice are teratomas and

teratocarcinomas that most closely resemble pediatric TGCTs (Stevens and Hummel,

1957; Youngren et al., 2003). In mice and humans, TGCTs arise from primordial germ

cells, embryonic precursors to germ cells (Stevens, 1967c). Many modifier genes have

been identified which alter the prevalence of TGCTs on the 129 genetic background.

These modifiers provide insight into the regulation of TGCT pathogenesis. Further insight has been made through the generation of double-modifier 129 mice to identify interactions between established modifiers.

The Dnd1Ter mutation is a point mutation in Dnd1 that introduces a premature stop codon and is one of the most potent a genetic modifier of TGCTs (Youngren et al.,

2005). Dnd1Ter decreases germ cell number and causes sterility in homozygotes in all inbred strains examined (Stevens, 1973). On the 129 background, Dnd1Ter causes an increase in TGCT prevalence to 19% in heterozygous and 94% in homozygous males

(Noguchi and Noguchi, 1985). Through an unknown mechanism, Dnd1 prevents miRNA-mediated silencing allowing cell specific expression (Kedde et al., 2007). Dnd1 shares sequence similarity with the RNA-binding subunit of Apobec1 complementation factor (A1cf, previously Acf), a component of the APOBEC1 RNA-editing complex

(Blanc et al., 2001a; Youngren et al., 2005). This similarity supports the hypothesis that

Dnd1, like A1cf, functions in RNA-editing and in turn that RNA-editing mutants may alter TGCT prevalence.

Apobec1 is the catalytic component of the APOBEC1 complex; Apobec1 is a cytidine deaminase producing cytosine to uracil conversion in mRNA transcripts. In addition to enzymatic function, APOBEC1 is an RNA-binding protein with broad specificity.

However, in the absence of a complementation factor, such as A1cf, enzymatic activity is lost (Anant et al., 1995). The targeted deletion of Apobec1 (Apobec1null) results in the complete loss of RNA-editing (Hirano et al., 1996). In mice heterozygous for the

93 deletion however, phenotypic abnormalities in RNA-editing are tissue specific.

Homozygous knockouts appear healthy and fertile despite a loss of Apobec1-mediated

RNA-editing.

Materials and Methods

Mice: 129S1/SvImJ (JR002448, previously known as 129/SvJ and 129S3/SvImJ) were obtained from the Jackson Laboratory (Stock number 002448; Bar Harbor, Maine). Both

Dnd1Ter and Apobec1null mice were backcrossed from the 129/Sv genetic background.

All mice in this study were maintained on a standard 5010 rodent chow diet (PMI

Nutrition International; Saint Louis, Missouri). Mice were housed in the Case Western

Reserve University Animal Resource Center and maintained on a 12:12-hour light/dark cycle. Mice were genotyped using PCR-based genotyping assays for Apobec1 as previously described (Hirano et al., 1996; Youngren et al., 2005).

TGCT survey: 3-5 week old males were euthanized and incisions were made in the abdomen to expose the testes. TGCTs are identifiable through macroscopic inspection by abnormalities in size, color, shape or texture of the testis (stevens and Little, 1954). Mice were scored for the presence of unilateral or bilateral TGCTs. TGCT prevalence was determined as the frequency of males affected with either unilateral or bilateral TGCT.

Statistical analyses were performed using a chi-square test.

Derivation of mouse embryonic stem cells: Mouse ES cell lines were derived as described previously (Anderson et al., 2009b; Brook and Gardner, 1997). Briefly,

blastocysts were flushed from the uterus at embryonic day 3.5 (E3.5) and individual

blastocysts explanted onto γ-irradiated mouse embryo fibroblasts (MEFs). After 5-6 days

the inner cell masses (ICMs) were picked from the plate and incubated for 5 minutes at

room temperature in trypsin-EDTA. The ICMs were partially dissociated individually and plated individually onto a feeder layer of irradiated MEFs. After 5 days, individual wells were trypsinized and passaged into a single well of a 6-well plate (9.6 cm2 surface area). ES cell colonies became readily evident between days 2-7. Colonies were individually picked and dissociated for further expansion. To minimize variability, comparison of ES cell line derivation efficiency between test and control groups was performed during an overlapping time period and all reagents used were identical. ES cell derivation efficiency was analyzed using the chi-square goodness-of-fit test and the significance threshold for all calculations was set at p<0.05 after Yates’ correction for continuity.

Results and Discussion

IV.1 Apobec1 deficiency has lineage dependent transgenerational effects on TGCT

prevalence

To examine the role of Apobec1 in TGCT susceptibility, a mouse strain carrying a targeted deletion of Apobec1 on the 129 background (Apobec1null) was obtained from Dr.

N. Davidson (Washington University, St. Louis, MO). Intercrosses that generated males of 3 genotypes: wild-type littermate controls (+/+), heterozygotes with a single copy of

Apobec1 (null/+) and homozygous null mutants (null/null).

Table 3 TGCT susceptibility is reduced by complete Apobec1 deficiency.

Complete Apobec1 deficiency (null/null) causes a reduction in TGCT susceptibility on the 129 background, indicated as a reduction in the percentage of males affected (%

Affected). χ2 values indicate comparison to wild-type 129 (+/+)p controls. Control 129 males [(+/+)c] were surveyed for TGCTs concurrently with the test population providing a baseline TGCT prevalence which is in agreement with a recently published value for

129 males [(+/+)p](Lam et al., 2007).

Genotype N # Affected % Affected χ2 P value 338 14 4.1% 4.76 0.03 null/null 208 15 7.2% 0.01 NS (+/+)c 7.0% (+/+)p

26 males with at least 1 TGCT were observed in the first approximately 550 males

screened. The fathers of 25/26 affected individuals carried at least one copy of the

Apobec1 deletion (Apobec1null). In contrast, wild-type and heterozygous sons of mothers

who were Apobec1 deficient appeared to be at decreased risk for TGCTs. Suggesting

that parental origin affected susceptibility. Given this observation, the experimental

paradigms examining TGCT prevalence were designed to test for parent-of-origin effects

in the parental and grandparental generations as well as transgenerational effects of the

mutant alleles that may affect wild-type offspring.

Complete deficiency of Apobec1 does not affect TGCT prevalence

To test whether Apobec1 affected TGCT susceptibility, we surveyed homozygous

Apobec1null/null mice with a complete deficiency of Apobec1 to determine TGCT

prevalence (Table 3). We tested for effects of complete Apobec1 deletion on TGCT prevalence by comparing the prevalence observed in males with a complete Apobec1 deficiency to wild-type 129S1/SvImJ (129) controls. Control 129 males ((+/+)c) were surveyed for TGCTs concurrently with the test population providing a baseline TGCT prevalence (7.2%, Table 3), which was in agreement with a recently published value for

129 males ((+/+)p) of 7% (Lam et al., 2007). Males with a complete deficiency of

Apobec1 were affected with TGCTs at a rate of 4.1% (Table 3), a reduction in TGCT

prevalence by approximately 43% males suggesting a small suppressive effect on TGCT

risk. A reduction in tumor risk upon deletion of Apobec1 is consistent with the effects

seen in other cancer types (Blanc et al., 2007; Hirano et al., 1996; Lee et al., 1998).

Although, 43% is a significant reduction in tumor prevalence, it can be difficult to

appreciably demonstrate a reduction in TGCT prevalence from a baseline value of 7% as

there is a very limited range between 0% and 7% to detect changes. The effects of tumor

suppressors can be observed much more readily when compared to a higher baseline

frequency. Future studies could be performed to further characterize complete Apobec1

deficiency as a TGCT suppressor. Other known TGCT modifiers such at 129S1/SvImJ-

Chr19MOLF, which increases TGCT prevalence on the 129 background (to approximately

80-90%), allow a much greater range in which to characterize the suppressive effects of

Apobec1 deficiency. It is important to note that while the use of a sensitizer to increase

the baseline frequency provides more statistical power to the study, it also introduces the

potential for interaction between the sensitizing mutation used and the mutant of interest.

The use of multiple sensitizers would be beneficial as a control to identify interactions

between the mutant alleles and separate the effects attributable of Apobec1 deletion.

Partial deficiency of Apobec1 has a lineage dependant affect on TGCT prevalence

The Apobec1null deletion eliminates all Apobec1 RNA-editing activity when homozygous.

However, in heterozygotes the effect of partial Apobec1 deficiency on RNA-editing

activity is tissue-specific. For example, Apobec1-mediated RNA-editing of

Apolipoprotein B mRNA remains at wild-type levels in intestine but is reduced in heart

suggesting that the effect of partial deletion is dependent on tissue specific levels of

baseline expression(Hirano et al., 1996). There are no known targets of Apobec1 in the

testis to determine whether RNA-editing in the testis is affected by partial or complete

deletion we also tested the effects of partial Apobec1 deficiency on TGCT susceptibility.

Figure 4 Partial Apobec1 deficiency has lineage dependent effects on TGCT prevalence in partially deficient sons. TGCT prevalence is decreased by when Apobec1null is inherited through the female germ line and increased through the male germ line. * indicates p< 0.05 relative to baseline TGCT prevalence in 129 (+/+)c control males

null/+ We performed reciprocal Apobec1 x (+/+)c crosses and surveyed heterozygous

(null/+) offspring for TGCTs. To test for parent-of-origin effects, the direction of

inheritance was maintained through either the male or female lineage for at least three generations. Partial deficiency of Apobec1 affected TGCT prevalence in null/+ males

depending on the ancestral lineage of the inherited null allele (Figure 4). Inherited through the female germ line, partial Apobec1 deficiency acted as a TGCT suppressor reducing prevalence in Apobec1null/+ sons to zero. Variants which reduce TGCT prevalence to zero are rare on the 129/Sv background; Apobec1null is the first where the

gene involved has been identified. 129- Chr18MOLF males also do not develop TGCTs,

but it is unclear from the congenic surveys whether that is the result of a single QTL or

combined effects of multiple TGCT suppressors on the chromosome (Anderson et al.,

2009b). Chr2MOLF has also been predicted to reduce TGCT frequency to zero on the

129/Sv background (Anderson, 2009) and preliminary data supports the hypothesis that

Chr2MOLF contains at least one TGCT suppressor (Appendix VII).

Conversely, when the deficiency was inherited paternally Apobec1null acted as a TGCT

enhancer. 14% of males were affected, a two-fold increase relative to (+/+)c controls.

The TGCT prevalence around 15% resulting from the enhancer effect of male Apobec1null

is similar to published values for many established heterozygous TGCT modifiers

including Dnd1Ter, SteelJ and Trp53null (Donehower et al., 1992; Harvey et al., 1993a;

Noguchi and Noguchi, 1985; Stevens, 1967b).

100

Partial and complete Apobec1 deficiencies in the parent exert different effects on

TGCT prevalence in offspring

Since Apobec1 has different effects as a partial or complete deletion in sons and effects of the deficiency are parent-of-origin specific, we asked whether partial and complete

Apobec1 deficiency in the parent resulted in the same TGCT prevalence in Apobec1null/+

males. We compared genetically identical Apobec1null/+ sons of reciprocal Apobec1null/+ x

null/null (+/+)c and Apobec1 x (+/+)c crosses. Where the mutation was maternally inherited

Apobec1null/+ sons of partially and completely deficient mothers were not affected with

TGCTs (Table 4), suggesting that a partial Apobec1 deletion is sufficient to disrupt

normal Apobec1 function through the female germ line and suppress TGCTs in offspring.

Further reduction of maternal Apobec1 through complete deletion does not change the

effect on TGCTs. Partial paternal Apobec1 deficiency correlated with a greater

prevalence of TGCTs in null/+ sons than complete deficiency (Table 4). The TGCT

prevalence in sons of partially deficient fathers was significantly increased compared to

(+/+)c controls, while sons of homozygous fathers develop TGCTs at the baseline rate

indicating that partial and complete Apobec1 deficiency affect prevalence differently

through the paternal germ line. These results suggest that the enhancer effect of partial

Apobec1 deficiency in the paternal lineage does not result from insufficiency of the

protein. If that were the case, complete deletion would be expected to result in a similar

or more severe phenotype rather than restoring the TGCT prevalence to baseline rates.

101

Table 4 Partial and complete Apobec1 deficiencies in the paternal lineage exert different effects on TGCT prevalence in offspring. Null/+ males inheriting the allele maternally are at a similar, reduced risk for TGCTs when mothers are partially (null/+) or completely (null/null) deficient for Apobec1. In contrast, partial and complete deletion have different effects on TGCT prevalence in null/+ sons. Sons of partially deficient fathers are at significantly increased risk, while sons of completely deficient fathers develop TGCTs at the baseline rate observed in wild- type control males. χ2 values indicate comparison to (+/+)c controls; significance was determined as p<0.05 after correction for multiple testing.

Genotype Parental Cross N # Affected % Affected χ2 P value

null/+ x (+/+)c 186 0 0% 14.5 0.0001

null/null x (+/+)c 179 0 0% 13.9 0.0002 null/+ (+/+)c x null/+ 132 19 14% 10.2 0.001

(+/+)c x null/null 189 15 7.9% 0.1 NS

(+/+)c (+/+)c x(+/+)c 208 15 7.2%

102

Grandparental rather than parental genotype determines TGCT risk

To determine whether the observed lineage effect was due specifically to the direction of

parental or grandparental inheritance, crosses were performed in which the ancestral

lineage was switched in the parental or grandparental generation (Figure 5). For

example, null/+ males inheriting the null deletion through the female germ line (≥2 generations of female inheritance) were mated to wild-type females changing the direction of inheritance from the “ancestrally female” lineage to male. Null/+ males inheriting the ancestrally female allele through their father were obtained from this mating and screened for TGCTs (Figure 5A). The TGCT prevalence was compared to the prevalence observed in males inheriting the deficiency directly through the female and male lineages (Figure 4). No null/+ males inheriting the ancestrally female deficiency paternally were affected with TGCTs. The reduction in TGCTs was seen in males inheriting the “female” allele (inherited at least 2 generations through the female lineage) through the father or mother. The TGCT prevalence in these males was significantly reduced relative to both the increased TGCT prevalence observed in males inheriting the null allele directly through the male germ line and the baseline in (+/+)c

controls. Reciprocal experiments were also performed to test the effect of maternal

inheritance of the ancestral male null allele with similar results (Figure 5B). Null/+ sons

inheriting the ancestrally male allele maternally showed an increase TGCT prevalence

resembling inheritance through the male rather than female lineage. These reciprocal

experiments suggest that earlier generations, rather than parental genotype, underlie the

lineage dependent effects of partial Apobec1 deletion on TGCT prevalence.

103

Figure 5 TGCT susceptibility in null/+ male offspring is determined by grandparental Apobec1 genotype. TGCT prevalence in offspring correlates with the grandparental Apobec1null direction of inheritance. (a) The TGCT suppressive effect of the ancestrally female Apboec1null allele is reset following two generations of inheritance through the male germ line seen as an increase in TGCT prevalence in sons inheriting the female allele after switching the direction in inheritance for 2 generations. (b) Similarly, the enhancer effect of the ancestrally male Apboec1null allele is reversed after switching the direction of inheritance for two generations. * indicates p< 0.05 using χ2 goodness of fit test.

(a)

(b)

104

We then asked whether maintaining the new direction of inheritance for a second

generation was sufficient to eliminate or reverse the lineage effect from the ancestral

parent of origin to reflect the parental and grandparental direction of inheritance. We

maintained the new lineage for a second generation to test the effects of grandparental

direction of partial Apobec1 deletion on TGCT prevalence (Figure 5). We found that the

TGCT prevalence in null/+ males was changed to reflect the new direction of inheritance

after the second generation suggesting that factors marking the lineage and controlling

the TGCT phenotype were changed or “reset” after two consecutive generations of the

new lineage. In these experiments the observed TGCT prevalence corresponds with the

grandparental, rather than parental, direction of inheritance. This may suggest that the

grandparental Apobec1null direction of inheritance was responsible for the lineage specific

effects of partial Apobec1 deletion on TGCT prevalence. Further studies would be

necessary to determine definitively whether the lineage effect is determined solely by the

grandparental direction of inheritance or if two consecutive generations of a specific

lineage are necessary to generate the lineage specific phenotypes.

Maternal but not paternal Apobec1 deficiency has a transgenerational effect on

TGCT prevalence in wild-type sons

Parent-of-origin effects on TGCT prevalence in wild-type offspring have been identified

in established TGCT modifiers such as KitlSlgb (see Transgenerational Epigenetic

Inheritance, Chapter I)(Heaney et al., 2008). Additionally, Dnd1Ter, which shares

sequence homology with the Apobec1 complementation factor (A1cf), has also been

shown to influence TGCT prevalence through transgenerational epistasis (see

105

Figure 6 Lineage dependent effects of parental partial Apobec1 deficiency on TGCT prevalence in wild-type sons. TGCT prevalence is decreased by maternal partial Apobec1 deficiency when present in the maternal lineage but not through the male germ lineage. * indicates p< 0.05 relative to baseline TGCT prevalence in 129 (+/+)c control males

106

Figure 7 Apobec1 deficiency has a transgenerational effect on TGCT prevalence through the maternal lineage. Transgenerational suppression of TGCTs by maternal Apobec1 deficiency (null/+) is seen in F1 wild-type offspring (a). The suppressed phenotype is inherited transgenerationally to the F2 and F3 generations through both male and female transmission and is independent of null inheritance in the affected males. In contrast, the increased TGCT prevalence observed in null/+ offspring of Apobec1 deficient fathers is not inherited transgenerationally through either germ line as a significant effect on TGCT prevalence is not seen in F1 wild-type sons or the following generations. * indicates p< 0.05 relative to 129 (+/+)c control males.

(a)

(b)

107

Transgenerational interactions in TGCT, Chapter II) (Lam et al., 2007). To test whether

partial Apobec1 deficiency in the parent has any transgenerational effect on TGCT

prevalence in wild-type (+/+)wt sons, we compared the TGCT prevalence in F1 (+/+)wt

null/+ and null/+ littermates from reciprocal Apobec1 x (+/+)c crosses (Figure 6). As in

heterozygous sons, a significant difference in prevalence was seen in (+/+)wt males

depending on parental direction. (+/+)wt sons of Apobec1 deficient mothers showed a

reduced TGCT prevalence while sons of deficient fathers showed the expected baseline

TGCT prevalence suggesting a transgenerational effect of the null allele through the

female but not the male lineage.

To test whether the effect was heritable independent of parental deficiency we selected

null/+ wild-type F1 offspring (+/+)wt from reciprocal Apobec1 x (+/+)c crosses and

backcrossed to 129 (+/+)c controls (Figure 7). We then screened the (+/+)wt F2 and F3

males for TGCTs. In the case that a stable, heritable epigenetic modification triggered

the transgenerational effect on TGCT prevalence seen in F1 males, a similar TGCT

prevalence would be seen in both the F2 and F3 sons in these crosses. In the event that

the effect resulted from in utero exposure to the null allele the reduction in TGCT

prevalence be seen in the children (F1) and grandchildren (F2) of deficient females but

would extinguish in the F3 generation. In these tests, the null allele was present only in

the F0 parents and F1 littermates. The F1 – F3 males screened for TGCTs did not inherit

null the Apobec1 allele and are genetically identical to the 129 (+/+)c controls.

108

In reciprocal crosses (Figure 7), TGCT prevalence correlated with the ancestral

Apobec1null genotypes in the F0 generation. In the case of partial Apobec1 deficiency in

the male, the TGCT prevalence in F1 (+/+)wt sons did not differ from the expected

baseline prevalence in wild-type. As expected, during continued backcrossing of (+/+)wt offspring derived from this mating, TGCTs were observed at the baseline rate regardless of whether the ancestrally “male” allele was transmitted through a male or female wild- type parent in subsequent generations.

In contrast, maternal Apobec1 deficiency significantly reduced the prevalence of TGCTs in both (+/+)wt and null/+ F1 males. The suppressive effect of the female lineage was

also observed in the F2 and F3 (+/+)wt males as a significant reduction in TGCT

prevalence in (+/+)wt sons relative to (+/+)c controls. Inheritance of the “female”

suppressive effect was independent of parental direction and did not require presence of the Apobec1null allele in the subsequent generations to maintain the phenotype.

Partial Apobec1 deficiency affects stem cell derivation frequency

129/Sv is the only mouse strain which develops TGCTs at an appreciable rate.

Strikingly, the 129 strain also has a consistently higher stem cell derivation efficiency compared to other inbred strains. Previous studies using a chromosome substitution strain showed a reduction in both TGCT prevalence and derivation efficiency on the 129 background suggesting a possible correlation between the two traits with factors on chromosome 18 (Anderson et al., 2009b). We tested the effects of Apobec1 deficiency on stem cell derivation of null/+ cells from either the male or female lineage (Figure 8).

109

Figure 8. Apobec1null affects TGCT prevalence and stem cell derivation efficiency in a lineage dependant manner. (a) Inheritance through the female germ line reduces both TGCT prevalence and derivation efficiency on the 129 background in null/+ and inheritance through the male germ line increases both phenotypes in null/+ and stem cell derivation efficiency in (+/+)wt males relative to 129 controls. (b) Similarly, inheritance through the female germ line reduces both phenotypes in (+/+)wt males and inheritance through the male germ line increases stem cell derivation efficiency in (+/+)wt males relative to 129 controls.

(a)

(186) (9) (208) (24) (132) (6)

(b)

(186) (9) (208) (24) (132) (6)

110

We found that derivation efficiency from early embryos was correlated with the TGCT prevalence seen in null/+ males obtained from the same lineage. In the male lineage,

TGCT prevalence was increased from 7% to 14% in null/+ males. Correspondingly, stem cell derivation was increased from 33% to 50% null/+ and 67% in wild-type. In the female lineage, a suppressive effect was seen on TGCTs reducing prevalence to 0% in null/+ males. Correspondingly, stem cell derivation was decreased to 22% in null/+ and

0% in wild-type. While additional embryos are required to test the statistical significance of these results, the trends suggest that Apobec1 deficiency has an effect on stem cell derivation which is lineage specific and affects derivation from both mutant and wild- type embryos. This provides further evidence to suggest a link between stem cell derivation efficiency and TGCT development. Additionally, this suggests a link between

Apobec1 function, presumably RNA editing, and stem cell derivation.

111

IV.2 Apobec1 deficiency reduces TGCT prevalence through transgenerational

interaction with Dnd1Ter

A previous study identified a transgenerational interaction between the Ter allele and the

parental TGCT modifier gene (Lam et al., 2007). Ter/+ males have an increased

prevalence of TGCTs when a second TGCT modifier gene is present in the parental

generation. All six TGCT modifiers tested with Ter resulted in a similar increase in

TGCT prevalence in Ter/+ sons that do not inherit the second modifier mutation. To test

whether Apobec1 deficiency also interacts transgenerationally with the Ter allele in

offspring to affect TGCT prevalence, we performed interaction test crosses involving the

heterozygous Ter mutation (Dnd1Ter/+) and Apobec1 deficiency (Apobec1null). To test for

transgenerational interactions we compared the TGCT prevalence in Dnd1Ter/+males

(Dnd1Ter/+, Apobec1+/+) obtained from the interaction test cross with the prevalence in

Ter/+ males from an isolated Ter colony. Males in the interaction test cross were affected with TGCTs at a rate of 21.0% (Table 5), which was significantly reduced relative to the prevalence in the isolated cross suggesting that parental Apobec1 deficiency suppresses TGCT risk through a transgenerational interaction with the inherited Ter/+ allele. The observed reduction in TGCT prevalence is strikingly different from all six previously tested modifiers in that TGCT prevalence is reduced rather than increased in Dnd1Ter/+ sons through the interaction with the parental modifier.

112

Table 5 TGCT prevalence in males of a Dnd1Ter – Apobec1null interaction cross

Offspring Genotype # # % % P (Dnd1, Apobec1) N Affected Expected Affected Expected χ2 value Test for Ter/+, +/+ 124 26 39.0 21.0% 31.5% 6.3 0.01 trans -5 generational +/+, null/+ (m) 163 14 0 8.6% 0% # 4x10 interactions +/+, null/+ (p) 159 17 15.1 10.7% 9.5% 0.3 NS

Internal +/+, +/+ 213 14 15.4 6.6% 7.2% 0.1 NS controls Test for Ter/+, null/+ 189 52 56.6 27.5% 29.9% 0.5 NS epistasis

(m) maternal null inheritance; (p) paternal null inheritance # calculated using Fisher’s exact test

113

All mice included in this series of experiments were on the same 129S1/SvImJ (129)

background and maintained through repeated backcrossing to 129 mice obtained from the same 129 control colony to minimize the potential for spontaneous mutation or genetic drift between the test and control groups examined in this study. In all interaction cross comparisons, the control values are obtained from crosses in isolated colonies performed concurrently with the interaction test crosses. It is important to note that the observed frequency in Ter/+ offspring from the interaction test cross (21.0%) is not significantly different from the previously published TGCT prevalence in Ter/+ heterozygotes of 17%

(Noguchi and Noguchi, 1985). We found a TGCT prevalence of 31.5% in Dnd1Ter/+

males on the 129S1/SvImJ background, a significant increase compared to the published

values (p=4x10-6). However, the previous studies testing TGCT prevalence in Dnd1Ter/+

males were performed on a different 129 substrain, 129T1/Sv, which may contribute to

the variation between published values and those observed in these experiments.

Throughout, we continue to use the values we observed as controls as these mice were

screened on the same background, screening was performed concurrently with test males,

and littermates of males screened in the control colony served as parents in the interaction

test making them the most related control group.

In separate crosses, partial Apobec1 deficiency acted as a TGCT suppressor in the female

germ line and an enhancer in the paternal germ line. We tested whether the sex of the

Apobec1 deficient parent affected TGCT prevalence in Ter/+ sons by comparing the

prevalence in sons of Apobec1 deficient mothers and sons of Apobec1 deficient fathers.

The prevalence in Ter/+ sons of deficient mothers (22.0%) and deficient fathers (19.1%)

114

were not significantly different indicating that although the effect of parental Apobec1

deficiency is sex-specific in isolated crosses, deficiency in either parent interacts with Ter

in sons to reduce TGCT risk.

Transgenerational interaction between maternally-inherited Apobec1 and parental

Dnd1Ter increases TGCT risk in null/+ males

We hypothesized that mutations in Apobec1 may affect TGCT risk because of the

similarity between Dnd1 and A1cf. Since the Ter mutation in Dnd1 interacts

transgenerationally with Apobec1 deficiency and previously tested modifiers we asked

whether mutations in Apobec1 would interact transgenerationally as well by comparing

the TGCT prevalence in Dnd1+/+, Apobec1null/+ sons from the interaction test cross to the expected prevalence based on the isolated Apobec1null colony.

Since Apobec1 deficiency has lineage-specific effects on TGCT frequency in separate

control crosses, sons inheriting the Apobec1null allele maternally or paternally were

analyzed separately. The expected values were calculated taking into account the parent of origin and zygosity of the Apobec1 deficient parent and weighted to reflect the number of males screened under those conditions (Table 6). It is striking that although Apobec1

deficiency has divergent effects in the maternal and paternal lineage of separate crosses,

TGCT prevalence in null/+ males from the interaction test cross did not vary

significantly depending on the direction of inheritance (8.6% and 10.7% respectively).

Where maternal Apobec1 deficiency was protective in isolated crosses, an appreciable

number of TGCTs were observed in males inheriting the Apobec1null allele maternally, a

115

Table 6 TGCT prevalence in males of a Dnd1Ter – Apobec1null interaction cross. Data shown in Table 4, is shown here separated by parental cross. No significant differences were seen between genetically identical offspring from different parental crosses pooled in Table 4. # # % % Genotype Parental Cross N Affected Expected Affected Expected * p Ter/+; Apobec1+/- TOTAL 189 Ter/+ x Apobec1/+ 25 5 1.8 20.0% 7.3% 0.01 Apobec1+/- x Ter/+ 11 5 1.6 45.5% 14.1% 0.003 *Calculated Ter/+; Apobec1+/- x 129 10 6 3.4 60.0% 34.1% NS using Internal 12.6 33.2% Control Values 129 x Ter/+; Apobec1+/- 38 12 31.6% NS Ter/+ x Apobec1-/- 17 4 6.1 23.5% 35.0% NS Apobec1-/- x Ter/+ 88 20 31.2 22.7% 35.5% NS Ter/+; +/+ TOTAL 124 Ter/+ x Apobec1/+ 28 3 8.8 10.7% 31.5% 0.04 Apobec1+/- x Ter/+ 19 2 6.0 10.5% 31.5% NS Ter/+; Apobec1+/- x 129 26 7 8.2 26.9% 31.5% NS 129 x Ter/+; Apobec1+/- 51 14 16 27.5% 31.5% NS +/+; Apobec1/+ TOTAL 322 Ter/+ x Apobec1/+ 24 2 2.4 8.3% 9.2% NS Apobec1+/- x Ter/+ 17 2 0.0 11.8% 0.0% NS Ter/+; Apobec1+/- x 129 30 4 0.0 13.3% 0.0% NS 129 x Ter/+; Apobec1+/- 69 6 6.4 8.7% 9.2% NS Ter/+ x Apobec1-/- 66 9 5.3 13.6% 8.1% NS Apobec1-/- x Ter/+ 116 8 0.0 6.9% 0.0% NS +/+; +/+ TOTAL 213 Ter/+ x Apobec1/+ 34 4 2.5 12% 7.2% NS Apobec1+/- x Ter/+ 61 5 4.4 8.2% 7.2% NS Ter/+; Apobec1+/- x 129 49 3 3.5 6.1% 7.2% NS 129 x Ter/+; Apobec1+/- 69 2 5.0 2.9% 7.2% NS

116

significant increase relative to genetically identical males obtained from separate crosses.

A significant change in TGCT prevalence was not observed in null/+ males inheriting the

allele paternally between the interaction and separate crosses. This suggests that only

through the female lineage can the inherited null allele interact transgenerationally with

Ter/+ opposing the protective effects of maternal Apobec1 deficiency on TGCT

susceptibility. Since the null allele only acts transgenerationally through the female

lineage in separate crosses, this finding is perhaps not unexpected.

Wild-type males do not show evidence of transgenerational effects on TGCTs

Although, wild-type offspring from Apobec1 deficient females did show a reduction in

TGCT prevalence in separate crosses, wild-type males were affected at the baseline rate

in the interaction test crosses (Table 5). (+/+)wt males were affected at a rate of 6.6%,

comparable to (+/+)c and (+/+)p controls (7.2% and 7.0% (Lam et al., 2007)). This

suggests that the increased prevalence in Dnd1Ter/+, Apobec1+/+ sons and reversal of the

protective effect of maternal Apobec1 deficiency in Dnd1+/+, Apobec1null/+ sons result

from specific interactions between the inherited and parental mutations rather than from pre-meiotic effects of the parental mutations which would be evident in all offspring regardless of genotype.

TGCT prevalence in double-mutant males results from additive effects of

Apobec1null and Dnd1Ter

To test for traditional genetic interactions between Dnd1 and Apobec1, double mutant

males (Dnd1Ter/+, Apobec1null/+) were surveyed for TGCTs. Testing was performed by

comparing the TGCT prevalence in double-mutants with the predicted prevalence based

117

on an additive model of gene interaction. The predicted prevalence, 29.9%, was

calculated using the observed frequencies for single-mutant and wild-type littermate

controls as previously described (Lam et al., 2007). The observed TGCT prevalence in double-mutants, 27.5%, did not differ significantly from the predicted prevalence and fits an additive model of gene interaction (Table 5).

118

IV.3 Interactions between Dnd1 and Apobec1 affect embryonic viability

It was first noted while examining Ter/+; Apobec1+/- double mutant males for testicular

tumors that double mutants were appearing less frequently in the survey than the 25% predicted by Mendelian segregation. A study was undertaken to investigate this

observation more carefully. For the TGCT screen, two crosses were initially performed,

a pair of reciprocal crosses in which two TGCT modifiers, Dnd1Ter and Apobec1null, were

Ter/+ present in heterozygote parents. In the reciprocal crosses (all listed ♀ x ♂: Dnd1 x

Apobec1null/+ and Apobec1null/+ x Dnd1Ter/+) offspring of 4 genotypes are expected at

equal rates, Dnd1Ter/+ ;Apobec1+/+ (Ter/+), Dnd1+/+ ;Apobec1null/+ (null/+); Dnd1Ter/+

;Apobec1null/+ (double mutant or Ter/+, null/+) and Dnd1+/+ ;Apobec1+/+ (wild-type,

(+/+)wt).

Parental genotypes affect mutant viability in Dnd1 – Apobec1 interaction test

crosses

In one heterozygous interaction test cross, Apobec1null/+ x Dnd1Ter/+, but not the reciprocal

cross, reduced numbers of mutant male offspring were observed relative to wild-type

littermates. Females were not tested during this preliminary survey as it occurred

secondary to a TGCT screen in which only males were included. Double mutant, single

mutant, and wild-type offspring were expected in an equal (1 Ter/+, null/+ : 1 Ter/+ : 1

null/+ : 1 (+/+)wt) Mendelian ratio. In all cases, we assumed that the viability and

frequency of wild-type offspring is unaffected and representative of the expected number

of offspring in each genotype. In testing for deficiencies in each genotype, we therefore

119

set the expected number of offspring equal to the number of wild-type littermates

observed. Strikingly, in addition to a reduction in the number of double mutant males, the numbers of both single mutant heterozygous offspring (Ter/+ and null/+) were also

reduced. The total number of mutant male offspring was reduced by 73% indicative of a

significant deviation from the expected Mendelian ratio (0.2:0.3:0.3:1,Table 7). This was

unexpected as the Apobec1 wild-type and null alleles as well as the Dnd1 wild-type and

Ter alleles segregate in the predicted 1:1 Mendelian ratio in separate, reciprocal

heterozygous crosses suggesting that the heterozygous mutations themselves do not cause

a reduction in viability or cause segregation bias (Table 7). In separate crosses,

heterozygous and homozygous Apobec1null and Dnd1Ter mutants are healthy, viable and

appear in the expected numbers. These observations suggest that the segregation

abnormalities observed result from transgenerational interactions between the Apobec1null and Dnd1Ter mutations as the alleles show biased segregation only when both alleles are

present in the parental generation, although not necessarily in the same parent, but require

that only one of the mutant alleles be inherited in the affected males. Additionally, the

observation of segregation distortion in one test cross and not the reciprocal suggests that

there is an effect of parental origin from one or both mutants affecting the interaction.

Loss of mutant embryos results from a fertilization bias or pre-implantation defect

Since segregation is 1:1 in both Ter/+ and null/+ separate reciprocal control crosses and

the genes are located on separate autosomes, we assume that gametes are produced in the

normal Mendelian ratio in heterozygous parents as a result of independent assortment. If

gametes were produced in non-Mendelian ratios a divergence from the 1:1 ratio would be

120

expected in separate crosses and in reciprocal crosses. The observation that wild-type

and mutant alleles are inherited in equal number from both male and female heterozygous

parents in separate crosses leads to the conclusion that segregation distortion results

following maturation of the gametes and the assumption that gametes are produced from

heterozygous Dnd1Ter and Apobec1null parents in predicted ratios. This leads to the hypothesis that the reduction in single and double mutants observed resulted from either a bias in fertilization or a reduction in viability post-fertilization.

To distinguish between these hypotheses and begin identifying the underlying mechanism of loss we screened litters during embryonic development in the reciprocal heterozygote crosses to identify the developmental time point at which non-Mendelian segregation ratios first appeared (Table 7). We found that the ratio of genotypes in the

Apobec1null/+ x Dnd1Ter/+ test cross was non-Mendelian by embryonic day 3.5 and in

agreement with the ratios observed at E12.5 and at weaning (age 3-4 weeks) indicating that mutant embryos are lost prior to implantation (Table 8). Additionally, when flushing the uterus to obtain E3.5 embryos, no unfertilized eggs or deteriorating embryos were identified. Resorptions at E12.5 were also notably absent and normal litter size was maintained in both reciprocal crosses (Table 9). These observations suggest that the non-Mendelian segregation ratios results from a bias in fertilization rather than post-fertilization, preimplantation lethality. Were the embryos dying following fertilization and prior to implantation, we would expect to see a large number of deteriorating embryos at E3.5 as

121 well as a significant reduction in litter size to account for the substantial loss of mutant offspring.

122

Table 7 Segregation of males in the Apobec1null/+ - Dnd1Ter/+ interaction test

Segregation was significantly skewed from expected Mendelian ratios in males from the

Apobec1null/+ ♀ x Dnd1Ter/+ ♂ but not the reciprocal Dnd1Ter/+ ♀ x Apobec1null/+♂ cross.

Offspring Dnd1Ter/+ ♀ x Apobec1null/+♂ Apobec1null/+ ♀ x Dnd1Ter/+ ♂ Nobs Nexp %obs %exp Genotype Nobs Nexp %obs %exp 27 32 24% 25% Ter/+; null/+ 13 64 11% 25% 30 32 26% 25% Ter/+; +/+ 19 64 17% 25% 25 32 22% 25% +/+; null/+ 19 64 17% 25% 32 32 28% 25% +/+; +/+ 64 64 56% 25% 117 128 Total Males 115 256 11 15% Mutants lost 141 73% 2.4ChiSquare 103.9 Not Significant pvalue 3x10‐23

123

Maternal Apobec1null reduces the number of Apobec1 deficient male offspring

Since the number of mutant male offspring is reduced in the Apobec1null/+ x Dnd1Ter/+

cross but not the reciprocal (Table 7), we hypothesize that the parental origin of either the

Apobec1null or Dnd1Ter alleles affected the segregation of Apobec1 alleles in the offspring.

First, we tested the hypothesis that Apobec1 has a maternal effect on segregation reducing

inheritance of the mutant null allele. If Apobec1null decreases viability in a maternal-

specific manner, an effect on viability would be expected only when the Apobec1null allele is inherited through the female. If the effect of Apobec1null is not maternal-specific in the interaction cross, viability should be reduced when Apobec1null is inherited from

either parent. To test this, the direction of inheritance for Apobec1null was changed from

maternal to paternal while the direction of Ter/+ inheritance remained unchanged (Table

10a). When the Apobec1null direction of inheritance was changed from maternal to

paternal, allele ratios of Apobec1 returned to the expected 1:1 Mendelian ratio. There was a significant change in the Apobec1 allele ratios between maternal and paternal inheritance of the null allele while the paternal direction of Dnd1Ter remained unchanged

suggesting that Apobec1 has a maternal effect on allele segregation reducing the number

of male offspring that inherit the mutant allele.

We then tested the hypothesis that the paternal origin of Dnd1Ter affected the segregation

of Apobec1 alleles in the male interaction cross offspring by changing the direction of

Dnd1Ter inheritance while maintaining the maternal direction of Apobec1 inheritance.

Segregation of Apobec1 remained significantly skewed when Dnd1Ter allele was present

124

null Ter Table 8 Genotype ratios in reciprocal Apobec1 – Dnd1 interaction test crosses. Non-Mendelian segregation in the Apobec1null/+ ♀ x Dnd1Ter/+ ♂ test cross was evident at embryonic day by 3.5 indicating that viability is affected between fertilization and E3.5.

Apobec1null/+ ♀ x Dnd1Ter/+ ♂ Timepoint Apobec1 +/+ Apobec1 null/+ Litter N +/+ Ter/+ +/+ Ter/+ Size E3.5 13 3 3 1 5.0 20 E12.5 16 7 10 2 7.2 35 Weaning 89 37 23 17 6.1 166

Dnd1Ter/+ ♀ x Apobec1null/+♂ Timepoint Apobec1 +/+ Apobec1 null/+ Litter N +/+ Ter/+ +/+ Ter/+ Size E3.5 6 7 6 3 7.3 22 Weaning 41 43 54 58 5.4 196

125

Table 9 Average litter size in normal in interaction test crosses. Litter size does not account for the loss of mutant mice observed in the Apobec1null/+ ♀ x Dnd1Ter/+ ♂ interaction test.

Apobec1 Apobec1 – Dnd1 Dnd1Ter/+ control cross interaction test control cross Maternal Genotype null/+ +/+ null/+ Ter/+ Ter/+ +/+ Paternal Genotype +/+ null/+ Ter/+ null/+ +/+ Ter/+ Avg. Litter Size 7.15 7.09 6.05 5.40 7.23 6.27 # Male 210 120 69 109 90 137 # Female 187 128 64 123 70 127 % Male 53 48 52 47 56 52

126

maternally instead of paternally. The parental Dnd1Ter genotype appears to have no

effect on the segregation of Apobec1 alleles (Table 10Table 11B) suggesting that Dnd1Ter

can affect Apobec1 segregation through either the maternal or paternal germ line. These

results suggest that the observed reduction in Apobec1null/+ offspring results from a

transgenerational epistasis between the maternally inherited Apobec1null allele and the parental Dnd1Ter allele which is not lineage-restricted.

Parental Dnd1Ter affects segregation of Dnd1 alleles in male offspring through

interaction with Apobec1

Since the number of Dnd1Ter mutant offspring is also reduced only in the Apobec1null/+ x

Dnd1Ter/+ cross and not the reciprocal, we then tested the hypothesis that Dnd1Ter has a

paternal effect on segregation reducing inheritance of the mutant Ter allele. We tested the

effects of Dnd1Ter parental origin by comparing the genotype ratios between offspring

which inherited Ter maternally or paternally while maintaining maternal Apobec1null. A

significant reduction in the number of Ter male offspring was observed in both instances,

but a statistical change in the segregation ratios was not observed when comparing

between maternal and paternal Dnd1 inheritance suggesting that the effect of Dnd1 in the

interaction cross was not lineage specific (Table 10C). It is interesting to note that a significant reduction in the number of Ter males was observed when Ter was inherited

paternally as in the original test cross but Apobec1null was also present paternally rather

than maternally. It is possible that there is a transgenerational paternal effect of Ter,

perhaps demonstrated in the reciprocal Apobec1null/+ x Dnd1Ter/+ test crosses, as well as a

second epistatic interaction between the Ter and null alleles when they are present

127

Table 10 Parental effects on allele segregation in male offspring

Allele segregation ratios for Apobec1 (A-B) and Dnd1 (C-D) in male offspring are non- Mendelian in some crosses. Testing indicated significant parental effect of Apobec1 (A, C) but not Dnd1 (B, D) on allele segregation. * indicates p<0.05 relative to expected 1:1 segregation following Bonferroni correction for multiple testing.

A) The effects of maternal v paternal Apobec1null on Apobec1 allele ratios

Apobec1 null Dnd1 Ter Apobec1 Ratio in Significant Males Change + : null (p value) Maternal 83:32* Paternal 0.0008 Paternal 122:107 Maternal 75:40* Maternal NS Paternal 65:52

B) The parental effects of Ter on Apobec1null allele ratios in offspring

Apobec1 null Dnd1 Ter Apobec1 Ratio in Significant Males Change + : null (p value) Paternal 83:32* NS Maternal Maternal 75:40* Paternal 122:107 NS Paternal Maternal 65:52

C) The effects of maternal v paternal Dnd1Ter on Dnd1 allele ratios

Apobec1 null Dnd1 Ter Dnd1 Ratio in Significant Males Change + : Ter (p value) Paternal 83:32* NS Maternal Maternal 79:36*

Paternal 140:89* NS Paternal Maternal 60:57

D) The parental effects of Apobec1 on Dnd1Ter allele ratios in offspring Apobec1 null Dnd1 Ter Dnd1 Ratio in Significant Males Change + : Ter (p value) Maternal 83:32* NS Paternal Paternal 140:89* Maternal 79:36* Maternal 0.006 Paternal 60:57

128

together in the same parent resulting in similar segregation defects making it difficult to

dissect the role of parental lineage on Ter in the segregation distortion observed in the

original Apobec1null/+ x Dnd1Ter/+ test cross.

The number of mutant offspring inheriting the Dnd1Ter allele is normal (1:1) in males

only when Ter is inherited maternally and null is inherited paternally. We next asked whether the parental direction of Apobec1 deficiency affects the segregation of Ter

alleles. To test the parental effects of Apobec1, we compared the ratio of Ter and wild-

type alleles in offspring of crosses in which Apobec1null/+ was present paternally or

maternally. Dnd1 segregation in male offspring is affected significantly by parental

origin of the Apobec1null mutation in maternal but not paternal inheritance of Ter (Table

10D). The number of Ter mutant males inheriting the allele maternally is reduced when

the mother is partially Apobec1 deficient or when both mutations are present together in a

double-mutant parent possibly suggesting that partial Apobec1 deficiency can affect

paternal Dnd1 segregation ratios through the maternal germ line transgenerationally and

though epistasis when they are present together in the same parental germ line.

Segregation in Females

Although a significant reduction in the number of mutant males was observed in the

Apobec1null/+ x Dnd1Ter/+ cross, males appeared in the expected Mendelian ratio in the

reciprocal Dnd1Ter/+ x Apobec1null/+ cross (Table 7). Changing the parental origin of both

Apobec1null/+ and Dnd1Ter/+ made a significant difference on the viability of male

offspring. To test whether female offspring were similarly affected, we compared the

129

observed genotype ratios to the expected 1:1:1:1 ratio. In both reciprocal heterozygote

crosses (Apobec1null/+ x Dnd1Ter/+ and Dnd1Ter/+ x Apobec1null/+), the ratios deviated significantly from the predicted Mendelian ratios suggesting that sex of the offspring plays a role in the observed segregation ratios and deficiency of mutant offspring (Table

11). However, the distribution of genotypes in female offspring is significantly different between the two crosses. In the Apobec1null/+ x Dnd1Ter/+ cross, the number of females

inheriting the maternal Apobec1null mutation is reduced by 81% (p=9x10-8). In the

reciprocal Dnd1Ter/+ x Apobec1null/+ cross, the number of females inheriting the

Apobec1null mutation is Mendelian at 1:1 but the number inheriting the paternal Dnd1Ter is reduced by 51%. In all interaction test crosses as well as separate Dnd1Ter and

Apobec1null control crosses, the male and female sexes segregate as expected and appear

in normal ratios (Table 12). This indicates that there is no gender preference in any of the

crosses meaning that male and females appear with comparable frequency suggesting that

the sex-specific bias observed in the allele segregation is not secondary to a loss of

individuals of that particular sex.

Maternal Apobec1 deficiency reduces the viability of Apobec1 deficient offspring

Since the number of Apobec1null mutant female offspring is reduced in the Apobec1null/+ x

Dnd1Ter/+ cross, as in male offspring, we performed the same series of tests to examine

the effects of Apobec1null parental origin on Apobec1 allele ratios (Table 13A). As in

male offspring, when the Apobec1null direction of inheritance was changed from maternal

to paternal, allele ratios returned to the expected 1:1 Mendelian ratio. There was also a

significant change between the Apobec1 allele ratios between maternal and paternal inheritance of the null allele while the paternal direction of Dnd1Ter remained unchanged

130

Table 11 Segregation of females in the Apobec1null/+ - Dnd1Ter/+ interaction test Segregation was significantly skewed from expected Mendelian ratios in females from both the Apobec1null/+ ♀ x Dnd1Ter/+ ♂ and the reciprocal Dnd1Ter/+ ♀ x Apobec1null/+♂ cross. However, loss was seen in females inheriting the Ter allele from the Dnd1Ter/+ ♀ x Apobec1null/+♂ cross and females inheriting the null allele from the Apobec1null/+ ♀ x Dnd1Ter/+ ♂ cross.

Offspring Dnd1Ter/+ ♀ x Apobec1null/+♂ Apobec1null/+ ♀ x Dnd1Ter/+ ♂ Nobs Nexp %obs %exp Genotype Nobs Nexp %obs %exp 14 26 17% 25% Ter/+; null/+ 4 25 8% 25% 13 26 16% 25% Ter/+; +/+ 18 25 35% 25% 29 26 35% 25% +/+; null/+ 4 25 8% 25% 26 26 32% 25% +/+; +/+ 25 25 49% 25% 82 104 Total Females 51 100 22 28% Mutants lost 49 65% 12.4 ChiSquare 37.2 0.006 pvalue 4x10‐8

131

Table 12 Ratio of Male:Female offspring is Mendelian in all crosses tested.

CROSS (♀ X ♂) MALE FEMALE RATIO χ2 p-value Ter/+ X 129 32 39 1:1 0.7 NS 129 X Ter/+ 51 46 1:1 0.6 NS Apobec1+/- x 129 43 38 1:1 0.6 NS 129 x Apobec1+/- 57 43 1:1 0.2 NS Ter/+ x Apobec1+/- 76 82 1:1 0.2 NS Apobec1+/- x Ter/+ 52 51 1:1 0.01 NS Ter/+, Apobec1+/- x 129 117 113 1:1 0.07 NS 129 x Ter/+, Apobec1+/- 230 207 1:1 1.2 NS Ter/+ x Apobec1-/- 38 28 1:1 1.5 NS Apobec1-/- x Ter/+ 232 215 1:1 0.6 NS

132

again suggesting that Apobec1 has a maternal effect of allele segregation reducing the

number of female offspring that inherit the mutant allele.

We then asked whether the parental origin of Ter affects the segregation of maternal

Apobec1 (Table 13B). As in males, no significant difference in the ratio was observed

suggesting that Dnd1Ter can act through either the maternal or paternal germ line. These

results, and those seen in male offspring, suggest segregation distortion of Apobec1 null

and wild-type alleles results from a transgenerational interaction between the maternally

inherited Apobec1null allele and the Dnd1Ter allele in the parental generation which is not

lineage-restricted.

Parental Dnd1Ter affects segregation of Dnd1 alleles in female offspring through

interaction with Apobec1

The number of Dnd1Ter mutant female offspring is also affected in one (Dnd1Ter/+ x

Apobec1null/+) but not the other (Apobec1null/+ x Dnd1Ter/+ ) heterozygous test cross, we

then tested the effects of Dnd1Ter parental origin on Dnd1 allele segregation as described

in males. Apobec1null was maintained in the male parent and a significant reduction was

observed in the number of Ter female offspring when Ter was inherited maternally or

paternally. The segregation ratios were not significantly changed when comparing maternal and paternal Dnd1 inheritance (Table 13C). It is interesting to note however that similar to what was seen in males, we also observed a significant reduction in the number of Ter females when Ter was inherited maternally when Apobec1null was also

present maternally, rather than the 1:1 ratio observed when Apobec1null was present

133

Table 13 Allele segregation in female offspring. Allele segregation ratios for Apobec1 (A-B) and Dnd1 (C-D) in female offspring are non- Mendelian in some crosses. Testing indicated significant parental effect of Apobec1 (A) but not Dnd1 (B) on Apobec1 allele segregation. Dnd1 segregation was not affected by the parental origin of either Dnd1 (C) or Apobec1 (D). * indicates p<0.05 relative to expected 1:1 segregation following Bonferroni correction for multiple testing.

A) The effects of maternal v paternal null on Apobec1 allele ratios Apobec1 null Dnd1 Ter Apobec1 Ratio in Significant Females Change + : null (p value) Maternal 43:8* Paternal 9x10-5 Paternal 109:92 Maternal 84:24* Maternal 2x10-5 Paternal 39:43

B) The effects of maternal v. paternal Ter on Apobec1 allele ratios Apobec1 null Dnd1 Ter Apobec1 Ratio in Significant Females Change + : null (p value) Paternal 43:8* NS Maternal Maternal 84:24* Paternal 109:92 NS Paternal Maternal 39:43

C) The effects of maternal v paternal Ter on Dnd1 allele ratios

Apobec1 null Dnd1 Ter Dnd1 Ratio in Significant Females Change + : Ter (p value) Paternal 29:22 NS Maternal Maternal 79:29*

Paternal 130:68* NS Paternal Maternal 55:27*

D) The effects of maternal v. paternal null on Dnd1 allele ratios Apobec1 null Dnd1 Ter Dnd1 Ratio in Significant Females Change + : Ter (p value) Maternal 29:22 Paternal NS Paternal 130:68* Maternal 79:29* Maternal NS Paternal 55:27*

134

paternally. These results again suggest that the defects in Ter segregation are not under

simple parental control. It remains possible that there are two separate effects -- a

transgenerational lineage-specific effect of Ter as well as a second conventional epistasis

between the Ter and null alleles present together in the same parent.

We also tested the effects of Apobec1null on Dnd1 allele ratios in females and did not find a significant difference between females inheriting Ter maternally and paternally

(Table 13D). However, the observed ratios were Mendelian (1:1) in females only when

Ter is inherited paternally and the mother is Apobec1null/+. In all other instances, the

segregation ratios differed significantly from 1:1. The number of females inheriting the

Ter allele maternally is reduced when the father is partially Apobec1 deficient or when both mutations are present together in a double-mutant parent again possibly suggesting epistasis between Apobec1null and Dnd1Ter when they are present together in the same

parental germ line.

Parental zygosity for Apobec1null affects Dnd1 allele segregation in male offspring

Paternal inheritance was a statistically significant enhancer of TGCTs in offspring of

heterozygous fathers (Table 4, 15.9%) but an effect was not detected in offspring of

homozygous fathers (7.9%). No difference was seen in TGCT prevalence in males of

mothers that were either heterozygous or homozygous for Apobec1null. Because partial

and complete Apobec1 deficiency had different effects in paternal inheritance, we tested the effects of parental zygosity for Apobec1null on Dnd1 allele segregation by

135

Table 14 Effects of partial and complete Apobec1 deficiency on Dnd1Ter segregation

Apobec1 Dnd1 Ter Dnd1 Ratio in Significant Dnd1 Ratio Significant males Change in females Change + : Ter (p value) + : Ter (p value) null/+ 83:32* 29:22 Paternal 0.006 NS null/null 116:88 110:88 null/+ 60:57 55:27* Maternal 4x10-5 NS null/null 67:17* 25:3*

136

comparing Dnd1 allele ratios in offspring inheriting the Dnd1Ter allele from the same

parent of origin with a second parent either partially or completely deficient for Apobec1

(Table 14). In male offspring, a significant difference was observed in the Dnd1 allele

ratios between sons of null/+ rather than null/null mothers. It is interesting to note

however that when Ter was inherited paternally (and Apobec1null maternally) a reduction

was observed in males born to partially rather than completely Apobec1 deficient females

while, in contrast, when Ter was inherited maternally a reduction was observed in Ter

males born to completely rather than partially Apobec1 deficient males. While zygosity

for the null allele and the extent of Apobec1 deficiency does make a difference of allele

segregation in male offspring through either maternal or paternal lineage the direction of

the effect is opposite in male and female parents. Interestingly, partial and complete

deletion in either parent appeared to have the same effect on Ter inheritance in females.

Dnd1Ter and Apobec1null alleles have an additive effect on the number of double-

mutant offspring

The separate analysis of Dnd1 and Apobec1 segregation allowed the identification of transgenerational effects altering the viability of mice with genotypes which, in independent crosses, are entirely viable. This analysis identified crosses which, under intercross conditions, Dnd1 and Apobec1 appeared in ratios other than the 1:1 ratio predicted by Mendel. This analysis was limited in that it was not able to determine whether the skewed segregation or deficiency of mutant genotypes was independent of the second mutation or resulted from an absence of double heterozygotes. The analysis cannot rule out traditional epistatic interaction and the possibility that individual

137

segregation values appeared skewed due to the loss of double mutants without also

considering segregation in the context of both genes.

In Mendelian genetics segregation of two unlinked heterozygous mutations, as in the intercrosses, the probability of inheriting each mutation is 50%. Independent of Apobec1 each animal has a 50% chance of inheriting Dnd1Ter. Each animal then has, independent

of their Dnd1 genotype, a 50% chance of inheriting Apobec1null. The probability of any

animal inheriting both Dnd1Ter and Apobec1null can be predicted as the product of these

separate probabilities (50% x 50%) such that 25% or ¼ of the offspring from the

intercross tests are expected as double heterozygotes. In many of the interaction test

crosses, fewer double-mutant offspring were observed than would be predicted by

Mendelian segregation. As discussed however, in many cases, the independent

segregation of Dnd1 or Apobec1 does not agree with the 1:1 Mendelian prediction of

50%. To account for these observations, the probabilities of inheriting Dnd1Ter and

Apobec1null were adjusted to reflect the actual observed probability of inheritance under

each intercross condition to test whether the interaction caused a loss of double

heterozygotes due to a gene-gene interaction in those individuals or whether it can be

attributed to the reduced probability of inheriting either gene independently.

To determine whether the reduction in the number of double-mutants was due to additive

effects of the abnormalities in Dnd1 and Apobec1 segregation observed in single mutants or was the result of epistasis between the mutations, we compared the observed number of double-mutants in each cross to the expected number derived from the proportion of

138 offspring inheriting each mutation independently. The expected frequency was determined using following equation and the observed frequencies for independent

Dnd1Ter and Apobec1null inheritance:

f(Dnd1Ter/+; Apobec1null/+) = f(Dnd1Ter/+) x f(Apobec1null/+).

In all crosses, the frequency of double mutants observed was in agreement with the expected values based an additive model of interaction (Table 15). There was no additional effect on segregation in the double mutants, which would be seen as a significant difference between the number of double mutants observed in the cross and the number predicted based on the segregation frequency of the alleles. This suggests that there are no epistatic interactions between the inherited genes within the individual double mutants affecting viability or gene segregation.

139

Table 15 Double-mutant offpring are reduced due to additive, not epistatic, interactions.

Parental Genotype MALE OFFSPRING FEMALE OFFSPRING (Dnd1, Apobec1) MOTHER FATHER # # p # # p Predicted Observed Predicted Observed Ter/+, +/+ +/+, null/+ 19 21 NS 6 6 NS +/+, null/+ Ter/+, +/+ 8 11 NS 2.5 3 NS Ter/+, null/+ 129/Sv 7 4 NS 2.5 2 NS 129/Sv Ter/+, null/+ 20 17 NS 16 17 NS

140

Summary

In the first section of this chapter we establish Apobec1 as a novel modifier of TGCT

prevalence on the 129 background. This is an interesting finding as, in addition to Dnd1,

it implicates RNA biology in general and mRNA editing specifically in the etiology of

TGCTs. We also describe lineage-specific effects in which inheritance of the same

Apobec1null allele has divergent effects when inherited through the male and female germ line. Through the male germ line, Apobec1null acts as a traditional TGCT modifier

increasing TGCT prevalence in null/+ males and having no effect on wild-type

littermates. Through the female germ line we identified transgenerational genetic effects of the Apobec1null allele. Male offspring with and without the inherited mutation were at a significantly reduced risk for developing TGCTs. Additionally, this reduced risk could be passed through wild-type male or females to their male offspring to at least the F3 generation.

In the second section, since Apobec1 was identified as a candidate TGCT modifier through similarity between Apobec1 complementation factor and Dnd1, we tested for interactions between the Dnd1Ter with Apobec1null mutant alleles. We describe

transgenerational interactions between Dnd1Ter with Apobec1null that change the

frequency of TGCTs observed in both Ter/+ sons and null/+ sons. Unlike prior

transgenerational tests with Dnd1Ter, we observed a decrease in TGCT prevalence in

Ter/+ sons in the interaction cross relative to separate crosses. Additionally, we

identified an increase in TGCT prevalence of null/+ sons inheriting the allele maternally

relative to those in independent crosses, the first time that a transgenerational effect has

141

been observed between an inherited modifier and parental Dnd1Ter. We also demonstrate

the absence of a traditional epistasis between the modifiers in double mutant sons.

In the third section we describe and characterize an observation that single and double

mutant offspring were appearing at a reduced frequency in the Dnd1Ter - Apobec1null interaction test crosses. (A complete summary of all segregation ratios for the crosses discussed in section III.3 can be seen in Table 16.) We found that maternal Apobec1null

causes a reduction in the number of offspring inheriting the null allele in both male and

female offspring whenever Ter/+ is present in either parent. Separately, we found that

Dnd1Ter also reduces the number of Ter offspring in the interaction crosses. Although,

the rules governing the inheritance of Ter interaction are not as clear, several general

comments can be made. First, the interaction of Dnd1Ter with Apobec1null is dependent

on the severity of the Apobec1 deletion with null/+ and null/null parents having different

effects in some cases. Second, parental lineage plays a role in the interaction as is evident in the different ratios in reciprocal crosses. The reduced number of double heterozygotes seen under intercross conditions can be attributed to two separate non-

interacting effects on gene segregation or viability.

The absence of an epistatic or additive effect in the double heterozygotes, the traditional

test group for gene-gene interactions, suggests that this interaction does not occur through

conventional interaction mechanisms within in the individuals carrying the mutations.

This is also evident as an effect on viability can also be seen as a reduction in the number

of single heterozygotes, both Ter/+ and null/+ offspring, observed under different cross

142 conditions. Additionally, the reduction in single heterozygotes cannot be attributed to the individual’s genotypes as the mutants are viable in independent crosses providing additional evidence that the deviation from Mendelian segregation results from an interaction between these two mutations, even if it is not in the conventional manner.

143

Table 16 –Segregation in Interaction Test Crosses

Parental Genotype Sample Size Apobec1 Segregation Dnd1 Segregation (Dnd1, Apobec1) (wildtype:null) (wildtype:Ter) MOTHER FATHER F M FEMALE MALE FEMALE MALE +/+, null/+ 129/Sv 108 158 1:1 1:1 - - 129/Sv +/+, null/+ 120 191 1:1 1:1 - - Ter/+, +/+ 129/Sv 41 127 - - 1:1 1:1 129/Sv Ter/+, +/+ 46 79 - - 1:1 1:1 Ter/+, +/+ +/+, null/+ 82 117 1:1 1:1 2.3:1 1:1 +/+, null/+ Ter/+, +/+ 51 115 5.4:1 2.6:1 1:1 2.6:1 Ter/+, null/+ 129/Sv 108 115 3.5:1 1.9:1 2.7:1 2.2:1 129/Sv Ter/+, null/+ 201 229 1:1 1:1 1.9:1 1.6:1

144

Chapter V. Summary and Future Directions

145

Summary

Genetics has been invaluable in advancing the understanding of trait and disease inheritance and

providing an understanding of the causative mutations underlying many heritable phenotypes.

However, the variants contributing to many highly heritable human diseases have remained largely undetectable or ‘missing’ (Manolio et al., 2009). Many possibilities exist for why the

‘missing heritability’ may remain undetected including the additive effects of many genes with small effects, epistatic interactions between variants and epigenetic inheritance.

The goal of my project was to characterize transgenerational genetic effects, those that result from genetic variants in previous generations that are not present in the at-risk individuals, and their role in the inheritance of complex phenotypes. The project involved two components.

First, I examined the frequency and magnitude of transgenerational effects using Y-chromosome substitution strains to generate genetically identical females with genetically distinct parents and found that transgenerational genetic effects occur at similar rates and with similarly large effects compared to conventional QTLs in CSSs. Second, I identified Apobec1 as a novel genetic modifier of TGCT prevalence and characterized the lineage-specific and transgenerational effects of Apobec1 deficiency. Finally, I identified transgenerational genetic epistasis between

Apobec1 deficiency and Dnd1Ter, an established TGCT risk enhancer, affecting TGCT

prevalence and allele segregation in offspring.

Transgenerational genetic effects are common and large

In Chapter III, we address two important questions regarding transgenerational genetic

inheritance; are the frequency and magnitude of transgenerational genetic effects on phenotype

146

similar compared to QTLs that are inherited in a conventional manner? We designed a test for

the frequency and magnitude of transgenerational genetic effects using mouse CSSs. Daughters

of CSS-Y males do not inherit the substituted Y chromosome and are genetically identical to

females of the host strain. Using the CSS-Y males provided a unique opportunity for

comparison between transgenerational effects, in CSS-Y daughters, and conventional genetic

effects tested in the CSS panels. A variety of phenotypes have been tested in CSS panels

providing an abundance of data on conventional QTLs for comparison. We compared

genetically identical host strain females and CSS-Y daughters to identify phenotypic changes in the CSS-Y daughters that could be attributable to transgenerational effects of the Y-chromosome substitution in the fathers. We found that phenotypic changes in daughters of CSS-Y males, attributable to transgenerational and social effects, occurred at a comparable frequency and with comparably large effects relative to phenotypic changes in CSS females. This suggested that transgenerational effects are both common and large. In these studies however, the possibility remained that some or all of the phenotypic changes observed could result from confounding variables that may not have been stringently controlled for including social or environmental effects, such as being housed with fathers or brothers with different Y chromosomes prior to weaning.

Next, we designed a study to test for transgenerational genetic effects in CSS-Y daughters while controlling for the influence of potentially confounding genetic, social and environmental factors. Using behavioral tests we identified a significant change in anxiety-related phenotypes between daughters of B6 and B6-ChrY129 males attributable to transgenerational genetic effects

rather than social or environmental factors.

147

Apobec1 as a novel TGCT modifier

In Chapter IV, we identify Apobec1 as a novel modifier of TGCT prevalence. We then characterized lineage-specific effects identifying partial Apobec1deficiency as an enhancer of

TGCT risk when inherited through the male lineage and a suppressor through the female lineage.

We then identified transgenerational effects of Apobec1 through the female lineage where

Apobec1 deficiency also exerts a suppressive effect on wild-type male offspring which is maintained even in the absence of the Apobec1 deficiency for at least 3 generations.

Finally, we identified a lineage-specific effect on stem cell derivation efficiency in mutant and wild-type offspring which corresponded with the lineage-specific effects on TGCT prevalence.

An increase in derivation efficiency was observed from embryos of Apobec1 deficient fathers and decreased in those from deficient mothers. The lineage-specific effect supports the conclusion that Apobec1 deficiency has a different role in the male and female germ lines. The correlation between trends in TGCT prevalence and stem cell derivation also provides evidence supporting the hypothesis that TGCT susceptibility and stem cell derivation efficiency share genetic determinants (Anderson et al., 2009b).

Transgenerational interactions between Dnd1Ter and Apobec1null

Next, we performed genetic interaction crosses to test for interactions between Apobec1 deletion and the Dnd1Ter mutation. Through this cross, we identified a reduction in TGCT prevalence in

Dnd1Ter /+, Apobec1+/+ sons resulting from a transgenerational epistasis between the inherited Ter allele and parental Apobec1 deficiency. Apobec1 is the first TGCT modifier tested which

148

resulted in a decreased TGCT prevalence in Ter/+ sons. In all six other TGCT modifiers tested,

a significant increase in prevalence was observed (Lam et al., 2007). Additionally, we identified

a transgenerational interaction in Apobec1null/+ sons which eliminated the protective effects of

maternal Apobec1 deficiency. This is the first Dnd1Ter interaction test cross in which

transgenerational effects were observed in sons that did not inherit Ter.

Lastly, we identified a transgenerational epistasis between Dnd1Ter and Apobec1null resulting in non-Mendelian segregation and a reduction in the number of single and double mutant mice observed under some, but not all, combinations of parental direction of inheritance. We identified a maternal and transgenerational effect reducing the number of offspring inheriting the

Apobec1null mutation. Mutant and wild-type Apobec1 alleles appeared in equal number when

they were inherited through the male germ line, indicating a maternal effect, and were only

affected by maternal inheritance when the Ter mutation was also present in one of the parents,

indicating a transgenerational interaction between the inherited Apobec1 alleles and the parental

Ter allele.

We also describe a deficiency in the number of intercross offspring inheriting the Ter allele.

Dnd1 segregation was also influenced by the parental direction of inheritance. Either maternal

Apobec1null or paternal Dnd1Ter, in combination with the lineage-independent presence of the

second mutation in the cross, was sufficient to produce a reduction in the number of offspring

inheriting the Ter allele. A deficiency in the number of Ter/+ mice was observed from both

double-mutant mothers and fathers and raised the alternative hypothesis that an epistatic

interaction between Dnd1 and Apobec1 in double-mutant parents could influence allele

149

segregation. We did not, however, observe an epistatic interaction affecting TGCT prevalence or

the number of double-mutant offspring. The lack of epistasis in double-mutant offspring may

also suggest that independent effects of maternal Apobec1null and paternal Dnd1Ter rather than

epistasis between the alleles in double-mutant parents is responsible for the reduction is Ter/+

offspring born to double-mutant parents. The observation that Apobec1null and Dnd1Ter can both

act in the transgenerational interaction as either the inherited or parental mutant provides further support for the hypothesis that the genes act in similar pathways or mechanism. Among the other TGCT modifiers tested previously, an effect was only seen in mice inheriting the Dnd1Ter allele; transgenerational interactions were not identified in mice inheriting any of the other six variants tested (Lam et al., 2007).

Future Directions

Our results suggest that transgenerational genetic effects make significant contributions to heritability. Given the elusiveness of genetic contributors to many phenotypes, including many common human diseases, we propose that transgenerational effects may contribute greatly to heritability in these cases. If transgenerational effects are frequent contributors to ‘missing heritability’ as our findings suggest, it is perhaps not surprising that traditional DNA-based surveys have had limited success to clinical studies. It may be beneficial instead to investigate parental, or even grandparental, genomes rather than searching for associated loci in the affected individuals. In our studies, the individual’s own genome only provided a small part of the genetic story. For example, it is not until the parental genes are also considered that we can begin to account for the genetic causes of phenotypic variation observed in CSS-Y daughters.

150

In some cases, consideration of which parent carries a particular allele can be just as important as

considering the parental genome in the first place. For example, in examining Apobec1null/+

males, we screened genetically identical males inheriting the null allele from both the maternal

and paternal lineages (Figure 4). If parental origin is not considered, the TGCT prevalence in these males is 7.8%. In this situation, the observed prevalence of 7.8% would be similar to the baseline rate of 7.2% and Apobec1 would have been dismissed as a candidate TGCT modifier.

Instead, by taking into account parental origin, we identified a complex, interesting role of

Apobec1 in TGCT susceptibility.

Apobec1 was originally identified as a candidate gene in TGCT susceptibility following the identification of Dnd1 as the gene mutated in Ter mutant. The Apobec1 complementation factor shares sequence homology with Dnd1 leading to the hypothesis that RNA-editing, and specifically the APOBEC family of enzymes, is involved in the pathology of TGCT formation.

We identified a significant effect of Apobec1 on TGCT biology further implicating RNA-editing in TGCT susceptibility and pathogenesis. However, no edited target mRNAs have been identified in testis or germ cells for either Apobec1 or Dnd1. Dnd1 participates in the regulation of miRNA-mediated gene silencing (Kedde et al., 2007); how or if Ter’s effects on TGCT susceptibility are miRNA-mediated has not been tested. Aside from RNA-editing, Apobec1 can also stabilize RNA transcripts through an unidentified mechanism providing a second action through which Apobec1 could exert effects on TGCT prevalence, stem cell derivation or allele segregation (Anant and Davidson, 2000; Xie et al., 2009). While it seems clear that both Dnd1 and Apobec1 are involved in regulating gene expression through RNA it is unclear whether

151

either or both are acting through transcriptional or post-transcriptional regulation and whether

they act in shared roles or pathways.

Are other phenotypes affected by transgenerational effects of the Y chromosome in CSS-Y

daughters?

In Chapter III we describe an analysis of published phenotypic data in B6-ChrA/J and B6-ChrPWD consomic panels suggesting that transgenerational effects are of a similar frequency and magnitude as traditional QTLs identified in CSSs. However, these tests were performed by a multiple different investigators and designed to look for traditional QTLs such that we cannot rule out the possibility that study design did not control for social or environmental influences.

We tested for transgenerational effects while stringently controlling for other confounding effects and identified a significant change in anxiety in daughters of B6-ChrY129 fathers attributable to transgenerational genetic effects of the paternal Y chromosome and suggesting that at least a portion of the phenotypic effects observed in the other studies results from transgenerational effects. A more extensive characterization of possible phenotypes in daughters of B6-ChrY129 and 129-ChrYB6 males while controlling for genetic, social and environmental

confounding effects is necessary to definitely address the frequency, variety and magnitude of

phenotypic effects attributable to transgenerational effects of the parental Y chromosome.

Phenotypic characterization could be performed using the same transgenerational study design

described in Chapter III to stringently control for confounding effect and testing an extensive

array on phenotypes in addition to behavior such as metabolic, hematologic, bone or cardiac

traits.

152

Our results also suggest that the interaction between the daughters’ genetic background and

paternal Y chromosome variants alters the effects seen in daughters. For example, while Y129 in fathers decreases anxiety in daughters on the B6 background relative to paternal YB6, no effect of

the Y chromosomes was seen in daughters on the 129 background. Testing of additional CSS

panels using the controlled study design could be performed to test the interactions between

genetic background and the substituted Y chromosome. In our database analysis, by

coincidence, the panels analyzed were all on the B6 background and those in our direct behavior

tests also involved the B6 parental strain. Characterizing phenotypic changes in daughters of

B6-ChrY129, B6-ChrYA, B6-ChrYPWD and B6-ChrYMSM males controlling for confounding

influences could allow us to distinguish transgenerational effects attributable to particular Y

chromosomes without adding the additional complexity of differences between the daughters’

genomes. Performing the tests on the same background, we could potentially begin associating

the phenotypic changes observed in daughters with Y chromosome variants between the fathers.

Evaluation of other strains would be necessary to evaluate the role of the paternal Y chromosome

on backgrounds other than B6 and demonstrating that the transgenerational effect of the Y

chromosome that we identified is not restricted to the B6 host genome. A more extensive

characterization of phenotypes in the 129-ChrYB6 daughters is a step in this direction. However,

while testing a second background other than B6 is important for evaluating the applicability of

generalizing from the effects observed with B6, testing different Y chromosomes on the same

host background is a preferred first step in dissecting the interaction between the daughter and

paternal genomes across a wider variety of strains. Aside from the convenience of having CSS

strains readily available for use, the genetic variability in the Y chromosome is much smaller

153 than what is seen in the remainder of the genome due to both the small fraction of the genome accounted for and the restricted recombination on the Y chromosome. These attributes make associating phenotypic changes with genetic variants much easier when variation is limited to the paternal Y chromosomes rather than when variation is spread throughout the daughter’s genome.

Do transgenerational effects occur in other organisms?

Throughout this body of work, we discuss transgenerational genetic effects in mouse models.

Our evidence suggests that transgenerational genetic effects do contribute to phenotype decoupling the individual’s genotype from the manifestation of phenotype. We suggest that this role for parental genes may contribute to ‘missing heritability’. It is of particular interest in the context of human health care whether transgenerational effects may also contribute to the heritability of disease. However, we cannot generate inbred strains, chromosome substitutions or even stringently control for confounding variables in human studies making the authoritative identification of transgenerational effects in humans impossible. We can however, adapt conventional linkage analysis and associate studies to consider parental information particularly in diseases, such as testicular cancer, where genomic variants have been remarkably elusive and transgenerational effects may be more likely to have an effect.

While studies in humans are not practical, we can begin by testing for transgenerational genetic effects in other animal models. For example, two rat chromosome substitution panels, FHH-BN and SS-BN, are available. By performing similar studies with CSS-Y males, we could test for the frequency and magnitude of transgenerational genetic effects in rats for comparison to the size and frequency of effects in mice. Given the relative similarity between the two species, this

154

is a relatively small step in the translation of our observations toward human disease. However,

identifying similar effects in rats would provide support for the hypothesis that transgenerational

effects also occur in other organisms.

Do transgenerational effects contribute to conventional CSS QTLs?

It is surprising that we found phenotypic effects were as common in daughters of CSS-Y

daughters as they were in conventional CSS females that are homozygous for the substituted

chromosomes, especially given the scarcity of genes on the Y chromosome. This raises the

possibility that a portion of the QTLs identified in CSS strains may also be, in part, attributable

to non-conventional mechanisms such as transgenerational, social and environmental effects. It

would be interesting to dissect the contributions in conventional QTLs attributable to

transgenerational genetic effects rather than conventional genetic effects. In studies based on

CSSs, parents and offspring are genetically identical making the contributions from the parents’

and individual’s genomes indistinguishable.

Special tests can be designed, however, to dissect the various contributions to phenotype in

conventional QTLs. These tests require that the substituted chromosome be present only in the

parental generation. To accomplish this, the parents must be heterozygous, rather than

homozygous, for the substituted chromosome and offspring selected which inherited non-

recombinant copies of the host strain chromosomes. These studies can be performed by

intercrossing, for example, (B6 x B6-ChrA)F1 parents resulting in ‘B6’ animals, genetically identical to the B6 controls, B6/A heterozygotes and mice homozygous for the substituted chromosome, genetically identical to the CSS.

155

The logistics of these studies can be difficult as the size of the substituted chromosome increases

due to recombination making the number of animals inheriting the non-recombinant chromosome increasingly rare. It would be costly and labor intensive, but possible, to perform

the tests on an entire CSS panel. Adding an additional layer of complexity, substituted

autosomes can be inherited from either parent. Rather than an F1 intercross, backcrossing a

heterozygous F1 to a host strain mate will also provide progeny which are genetically identical to

the host strain. Reciprocal crosses in which the substituted chromosome is present in either the

male or female parent can be performed to test for transgenerational effects attributable to the

substituted chromosome in the male or female germ lines. While it would be a large undertaking

to perform this series of crosses, and characterize a comprehensive series of tests for phenotypic

changes in an entire CSS panel a small number of chromosomes could be selected and

thoroughly analyzed to provide a better idea of the extent to which transgenerational genetic

effects contribute to conventional QTLs in the CSS strains.

A more feasible undertaking for most studies would be to test conventionally identified QTLs

that have been mapped to smaller congenic or consomic fragments. These smaller regions could

be tested as described for the CSSs to determine the contributions to the QTL that come from

conventional, transgenerational or social effects. These tests would be uncomplicated by the

high recombination rates of the larger regions. Rather than systematically testing CSSs for

transgenerational effects, this approach could still merge conventional CSS studies with a

dissection of conventional and transgenerational genetic effects allowing investigators to

definitively separate the effects on a case by case basis for regions of interest.

156

How are transgenerational genetic effects transmitted?

Perhaps the most important question remaining is how parental genes affect phenotypes in

offspring. Daughters of CSS-Y males provide an excellent model for examining the mechanism

underlying transmission of phenotype independent of genotype. Since the only genetic change is

present in the fathers, any inherited factors must be transmitted through sperm. Isolating sperm

from CSS-Y and host strain males would allows us to isolate the cell type harboring the

transmitted information for testing. There are three general mechanisms which can be tested to

identify changes which may serve as the mechanism of transmission – RNA, DNA methylation

and histone modification.

Total RNA, including mRNA and small regulatory RNAs, can be isolated and sequenced to

identify quantitative and qualitative changes in sperm RNAs between host strain and CSS-Y

males. Sperm RNA could affect phenotype in offspring through the passage of functional

mRNA transcripts which could undergo translation during early embryonic development. Since

active transcription of the zygotic genome starts as early as the 1-2 cell stage in mice it is not

clear whether paternally transmitted mRNA transcripts are likely to affect phenotypes in

progeny. Additionally, small regulatory RNAs could be transmitted to zygotes in sperm.

Transmitted small RNAs such as miRNAs, piRNAs and siRNAs could directly regulate

translation, for example through miRNA-mediated post-transcriptional repression, or indirectly

by targeting subsequent epigenetic modifications to the zygotic genome, for example through

RNA-directed DNA methylation.

157

To investigate the possibility that epigenetic changes to the rest of the inherited paternal genome are responsible for transgenerational effects, genomic DNA can be isolated from sperm.

Genome-wide assays for DNA methylation, such as bisulfate-based sequencing assays or methylated DNA immunoprecipitation followed by sequencing or microarray analysis, could be performed to identify differences between CSS-Y and host strain sperm. One could imagine that a substantial change to the genome, such as substituting an entire chromosome in a CSS strain, could causes widespread trans changes in DNA methylation patterns to the other chromosomes.

Were those methylation patterns transmitted and maintained in progeny, they could contribute to the phenotypic changes observed. A trans effect acting across the genome could explain the wide variety of phenotypes affected in CSS-Y daughters.

Changes to histone content or histone modifications could similarly be modified throughout the genome. Immunoprecipitation for specific histone modifications coupled with sequencing or microarrays could be used to identify changes in the distribution of modifications. Since approximately 90% of histones are replaced with protamines in mature sperm, the logistical concerns of obtaining a large enough sample to perform assays for specific histone modifications may be impractical. Rather, mapping the distribution of histones remaining in mature sperm could also provide insight to inheritance through chromatin conformation. The gain or loss of regions maintaining histones during spermatogenesis may have functional relevance and isolating DNA fragments based on the associated histones would be expected to provide a larger yield than selecting for individual modifications.

158

Lastly, it is important to note, that although we tested only for transgenerational effects in

daughters, the sperm population would contain both X and Y sperm. To remove the Y-

containing sperm, sperm could be separated by fluorescence activated cell sorting using a

fluorescent stain for DNA based on the small difference in DNA content between X- and Y-

containing sperm (Garner, 2001). It is possible that relevant, biological changes could be

identified in RNA or epigenetic marks from a mixed population of X- and Y-containing sperm,

but isolating and analyzing X-containing sperm separately would remove the possibility that

identified changes are present only in the Y-containing sperm and not truly reflective of effects

on daughters. Because of the time and resources required to sort sperm based on the X and Y

chromosome, genome-wide assays could alternatively be performed on a mixed population and

later verified in a population of isolated X-containing sperm.

What is the mechanism affecting segregation in Dnd1-Apobec1 interaction tests?

We identified a transgenerational interaction between Dnd1 and Apobec1 resulting in a reduced number of offspring inheriting the Ter and null mutations. Our time course experiments indicate that the ‘loss’ of the mutant alleles occurs prior to E3.5 and normal Mendelian ratios in isolated crosses suggest that wild-type and mutant gametes are produced in equal number. Observations such as normal litter size and the absence of deteriorating embryos at E3.5 or later suggest that a fertilization bias, rather than early embryonic lethality, is the cause of the observed non-

Mendelian segregation in these crosses. However, additional studies are necessary to test whether fertilization or embryonic lethality is responsible. To determine whether gametes are produced in equal number in Ter and null mutants, single-cell PCR-based genotyping of mature sperm and eggs could provide a direct test for allele ratios in gametes of Ter/+ and null/+ male

159

and female heterozygotes (Luo et al., 2009). It is expected that mutant and wild-type alleles will

appear in equal number but before performing further tests to determine the cause of a

fertilization bias it would be important to demonstrate unequivocally that gametes are produced

in the expected Mendelian ratios.

Next, tests could be performed to determine whether fertilization is biased under the intercross

conditions. For example, considering the Apobec1null/+ x Dnd1Ter/+, a reduction in the number of

null mutants and Ter male progeny was observed in vivo. In vitro fertilization starting with

isolated eggs from Apobec1null/+ females and sperm from Ter/+ males could be performed and resultant embryos genotyped to determine the Mendelian ratios. Zygotes could be observed during and following fertilization until genotyping to ensure that no embryos deteriorate or appear otherwise unviable. A deviation from Mendelian ratios in these embryos would suggest that a bias in fertilization is responsible.

If in vitro studies indicate a deviation from Mendelian ratios at fertilization, additional tests could be performed using isolated eggs from null/+ females and sperm from Ter/+ males to test the individual steps in fertilization and identify defects in the process relative to control tests between eggs from wild-type 129 females with Ter/+male sperm or between null/+ female eggs and 129 male sperm. These tests could include assays for sperm-egg binding, induction of the sperm acrosome reaction and egg penetration (Lu and Shur, 1997). Identification of the particular step or steps in fertilization where wild-type gametes provide a selective advantage would be essential to designing further experiments to determine how Dnd1 or Apobec1 interferes with the normal process.

160

Do genetic interactions between Apobec1 and Dnd1 reflect physical or biological interacts

between gene products?

We identified genetic interactions between Apobec1 deficiency and Dnd1Ter that could suggest a physical interaction between the gene products. However, the interactions we identified were all transgenerational. That is, the mutant alleles were present in different generations – one was inherited in the progeny and the second was present only in the parental generation. The presence of transgenerational epistasis in single-mutant and the absence of conventional epistasis in double-mutant animals may suggest that a direct interaction between the resulting proteins in the affected offspring is unlikely. Rather, the genes may act in converging pathways.

Alternatively, RNAs and epigenetic modifications inherited from one mutant parent could affect the expression or function of the second mutation in the offspring.

Since both DND1 and APOBEC1 contain RNA-recognition motifs and function through binding to target RNA sequences, it would be interesting to identify the target RNAs for each protein.

Using antibodies for DND1 and APOBEC1 separately, protein-RNA complexes could be isolated from germ cells and cataloged through sequencing or microarray. Identification of the protein targets could provide insight to the downstream pathways regulated through miRNA repression with DND1, RNA-editing via APOBEC1 or other unidentified mechanisms associated with the binding of these proteins. An extensive characterization of the RNAs affected by either or both proteins could allow identification of overlapping RNA targets or shared target pathways affected in germ cells and contributing to the transgenerational epistasis affecting TGCT prevalence and other phenotypes in offspring independent of whether the two proteins function as part of the same protein complex.

161

Additionally, the identification of target RNAs would provide target sequences to test for the mechanistic effects of the proteins. APOBEC1 is an RNA-editing enzyme which affects TGCT prevalence; however, no edited RNAs have been identified in testis or germ cells. If candidate sequences were identified, those RNAs could be tested for C to U/T changes in the RNA sequences. C to U/T changes in the target mRNAs could serve as a direct mechanism for

Apobec1 to change gene expression patterns in the testis resulting in TGCT formation. The absence of these changes in RNAs bound by APOBEC1 could suggest that APOBEC1 has a novel role in regulating RNA biology separate from activity as an RNA-editing enzyme.

Identification of edited mRNAs would provide candidate genes and pathways for further TGCT studies in mouse and human.

162

Chapter VI. Appendices

163

Appendix I Complete Data set for Phenotyping Screen

1 1 0 1 1

0.00 0.00 0.00 y 57.5 4.02 4.51 4.92 4.62 36.88 52.25 32.13 Trunk Curl

Activit Locomotor

2.5 0.20 0.33 0.26 0.94 0.75 0.16 2.31 to

2.81 1.06 1.56 3.31 0.30 0.43 0.43 0.53 Positional Passivity Move Time

0 0 0 0 0 0 0 0.00 0.16 0.16 0.25 0.25 0.06 0.00 0.09 0.00 Urination Presence Presence Urination

0.25 0.31 0.38 0.69 1.19 0.32 1.63 1.31 0.06 0.75 0.44 0.09 0.00 0.33 0.26 Defecation Presence Presence Defecation

2 2 0 y 0.25 0.09 0.12 2.13 2.63 0.22 0.06 0.13 1.94 1.88 0.00 0.09 0.12 Touch Escape

Activit Spontan. 0.5 4 4 3 3 0 0.18 0.18 0.18 1.44 1.56 0.18 0.44

0.00 0.00 0.00 Tail Elevation Position Body

0 0 0 0 0 0.18 0.33 0.30 2.43 2.69 0.17 0.94 0.94 0.00 0.00 0.00 Pelvic Elevation Presence Tremors 0 0 0 0 0 y 2 2 2 2 0 0.00 0.00 0.00 0.00 0.00 0.00 Gait

Respirator Rate

0.21 0.18 0.24 1.69 2.12 0.23 1.56 2.06

y 0 0 0 0 0 Startle Response 0.00 0.00 0.00

0 0 0 0 0

Hair Morpholog 0.00 0.00 0.00

0 0 0 0 0

Palerbral clousure 0.00 0.00 0.00

Hair Length 0 0 0 0 0

‐ 0 0 0 0 0 0.00 0.00 0.00 Pilo erection 0.00 0.00 0.00 Coat Color

3.63 0.41 3.56 0.43 2.44 0.29 2.25 0.35 0.55 0.60 0.80 0.41 22.44 23.13 22.63 21.43 Transfer Arousal Weight

B6 ‘B6’ ‘129’ 129 B6 ‘B6’ ‘129’ 129

164

Appendix I (con’t)

1 0 1 1 1 0.00 0.00 0.00 Righting Contact 0 0 0 0 0 0.00 0.00 0.00 Reflex Righting 0 0 0 0 0 0.00 0.00 0.00 Presence Salivation

0 0 0 0 0

0.00 0.00 0.00 Presence Lacrimation 1 0 1 1 1 0.00 0.00 0.00 Color Skin 0 0 0 0.09 0.00 0.09 0.06 0.06 Tone Limb 1 1 0 1 1 0.00 0.00 0.00 Tone Body 1 0.5 0.00 0.12 0.17 0.18 0.88 0.69 0.33 0.31 0.22 2.06 2.25 0.24 0.88 0.56 Pinch Toe Vocalization 0 0 0.09 0.12 0.14 1.06 1.31 0.17 1.13 1.19 0.5 0.18 0.18 0.00 0.00 0.63 Reflex Corneal

Aggression 0.09 0.16 0.09 1.06 1.44 0.18 1.25 1.06 Reflex Pinna

y 1 1 0 1 1 0.81 0.14 0.12 0.18 0.16 0.44 0.25 0.88 0.00 0.00 0.00 Response Whisker Irritabilit

1.5

0.29 0.24 0.27 1.88 2.06 0.27 1.75 1.81 1.56 0.18 0.18 0.18 0.18 0.44 0.38 Dowel Biting Placement Visual

0 0

1 1 0 1 1 0.06 0.09 0.06 0.09 0.00 0.00

0.00 0.00 0.00 Negative Geotaxis Limb Grasping

B6 ‘B6’ ‘129’ 129 B6 ‘B6’ ‘129’ 129

165

Appendix II Complete dataset for Open Field testing

0.01 0.01 0.00 0.01 0.6% 9.9% 2.2% 6.7% Time

Center

% in

5.25 4.79 3.87 3.70 Max. 16.63 27.01 16.88 27.54 (cm/s) Velocity

(º) 0.34 0.64 0.52 0.53 0.59 0.52 0.16 0.58 Turn angle Mean

‐ ‐

9.39 7.12 2.94 5.93 8.69 15.94

111.19 102.56 Frequency

Outer

8.26 (s) 14.70 11.48 20.75 881.89 639.16 846.39 697.53 Duration

3.80 8.13 9.88 14.11 10.93 21.44

166.94 148.06 Frequency

Middle

9.49 9.97 6.23 (s) 15.18 12.79 36.00 180.09 146.98 Duration

5.05 4.02 2.72 0.98 2.00 6.44 56.69 46.25

Frequency

Center

5.84 4.18 8.57 3.23 5.55 (s) 80.99 17.84 55.72 Duration

2.11 (º) 33.66 32.43 20.65 34.61 34.58 52.81 19.53 Mean Heading

‐ ‐

(cm) Total 340.88 267.10 349.02 276.34 moved Distance 7743.95 2281.08 7387.79 2227.88

3.12 0.96 2.02 3.85 3.21 3.10 3.48 3.51 ‐ ‐ (º/s) Mean velocity Angular

SEM SEM SEM SEM Mean Mean Mean Mean

Paternal Genotype B6 ‘B6’ ‘129’ 129 166

Appendix III Complete data set for Elevated Plus Maze Testing

B6 ‘B6’ ‘129’ 129 Mean SEM Mean SEM Mean SEM Mean SEM Hub Time (sec) 60.7 3.7 58.5 6.6 53.2 4.5 47.6 3.5 Open Left Time (sec) 31.3 4.2 33.3 6.1 27.8 7.6 26.1 6.3 Open Right Time (sec) 14.7 2.9 28.9 4.5 13.2 4.1 14.9 3.6 Total Open Time (sec) 46.0 6.1 62.2 7.5 41.0 8.6 41.0 9.1 % Open Time (sec) 15.3 2.0 20.7 2.5 13.7 2.9 13.7 3.0 Closed Top Time (sec) 85.7 6.0 88.8 9.4 93.0 5.5 98.2 5.4 Closed Bottom Time (sec) 109.0 8.7 92.5 9.3 120.9 8.2 115.8 9.0 Total Closed Time (sec) 194.7 7.4 181.3 8.0 213.8 8.5 214.0 9.1 Open Left Explorations 11.2 0.6 12.3 0.8 12.9 1.1 11.7 0.4 Open Right Explorations 9.5 0.8 10.7 1.0 8.5 0.9 7.9 0.7 Total Open Explorations 20.7 1.0 23.0 1.4 21.4 1.5 19.6 0.8 % Open explorations 32.4 1.1 38.7 1.9 35.1 1.4 39.1 1.0 Closed Top Explorations 20.1 1.6 15.8 1.7 16.6 1.5 14.9 1.1 Closed Bottom Explorations 23.8 1.8 20.8 1.4 22.9 1.6 16.1 1.3 Total Closed Explorations 43.9 2.9 36.6 2.5 39.4 2.2 31.1 1.8 Total Explorations 64.6 3.6 59.6 3.4 60.8 3.2 50.7 2.5 Open Left Entrances 2.9 0.3 3.0 0.4 1.8 0.3 2.0 0.4 Open Right Entrances 1.5 0.3 2.4 0.3 1.2 0.4 1.3 0.3 Total Open Entrances 4.4 0.6 5.4 0.6 3.0 0.7 3.3 0.6 % open entrances 24.7 2.2 29.8 2.4 14.2 2.9 16.6 3.1 Closed Top Entrances 6.4 0.5 6.4 0.4 7.4 0.4 7.4 0.4 Closed Bottom Entrances 6.7 0.7 6.1 0.6 8.9 0.4 7.3 0.4 Total Closed Entrances 13.1 1.1 12.4 0.8 16.3 0.5 14.8 0.6 Total Entrances 17.5 1.5 17.9 1.2 19.3 0.9 18.0 0.9 Closed Head Dips 2.8 0.4 2.3 0.5 0.9 0.2 0.9 0.1 Open Head Dips 0.8 0.3 1.9 0.4 0.4 0.2 0.7 0.3

167

Appendix IV Frequency and Magnitude of Phenotypic Effects in B6-ChrA/J CSS panel

Females Males % Avg. Effect % Avg. Effect CSS affected Size affected Size Unconventional ‘B6’ effects Y‐fathers 36.5% 85.7% Y 30.0% 73.6% X 34.1% 74.3% 17.4% 92.6% Conventional 1 29.3% 108.4% 56.5% 75.3% Effects 2 61.0% 84.5% 47.8% 71.0% 3 36.6% 91.7% 43.5% 101.5% 4 48.8% 94.4% 26.1% 53.0% 5 61.0% 97.5% 26.1% 71.2% 6 48.8% 89.2% 21.7% 88.4% 7 46.3% 80.2% 39.1% 87.4% 8 39.0% 93.7% 39.1% 82.2% 9 46.3% 90.8% 26.1% 106.4% 10 43.9% 93.6% 52.2% 70.0% 11 61.0% 97.3% 21.7% 81.1% 12 48.8% 105.0% 65.6% 74.0% 13 36.6% 83.6% 20.0% 98.1% 14 56.1% 98.3% 26.1% 88.8% 15 48.8% 87.3% 39.1% 83.4% 16 36.6% 82.2% 30.4% 79.4% 17 56.1% 96.5% 43.5% 78.9% 18 41.5% 115.2% 39.1% 86.6% 19 36.6% 99.5% 17.4% 80.9% Average Autosomal 46.5% 94.2% 35.9% 82.0%

168

Appendix V Magnitude of Phenotypic Effects in B6-ChrPWD CSS panel

Females Males % Avg. Effect % Avg. Effect CSS affected Size affected Size Unconventional ‘B6’ effects Y‐fathers 9.5% 128.2% Y 3.8% 80.9% X.1 19.0% 142.1% 19.2% 90.1% Conventional X.3 23.8% 147.9% 7.7% 195.8% Effects 2 9.5% 93.0% 42.3% 150.8% 5 9.5% 91.6% 26.9% 216.0% 6 9.5% 67.7% 0.0% 45.0% 11.1 9.5% 90.8% 7.7% 106.4% 11.2 14.3% 93.6% 3.8% 70.0% 11.3 9.5% 97.3% 4.8% 81.1% 12 14.3% 105.0% 3.8% 74.0% 14 9.5% 98.3% 3.8% 88.8% 16 19.0% 82.2% 0.0% 79.4% 17 4.8% 96.5% 7.7% 78.9% 18 9.5% 115.2% 11.5% 86.6% 19 14.3% 99.5% 3.8% 80.9% Average Autosomal 11.1% 113.7% 9.7% 179.0%

169

Appendix VI Complete trait values for multigenic traits in B6-ChrA/J panel (a) females and (b) males and B6-ChrPWD panel (c) females and (d) males

(a) Average phenotypic values for multigenic traits tested in B6‐ChrA/J panel females

Trait A/J B6 ‘B6' A1 A2 A3 A4 A5 A6 stretch_attends 10.90 3.50 6.12 9.00 4.75 2.88 1.88 1.88 6.75 defecation 3.12 0.56 1.38 1.00 1.62 1.00 2.50 0.88 1.38 arena_entries 0.00 7.94 8.12 7.62 12.40 13.20 6.12 14.50 4.50 rearing_perimeter 0.75 8.94 9.50 4.38 9.75 7.88 0.38 13.20 2.12 line_crossings 7.5 109.0 148.0 99.0 164.0 117.0 92.4 170.0 82.1 tot_activity 8.3 118.0 158.0 103.0 174.0 128.0 101.0 184.0 85.9 constant1 20.2 40.8 43.4 40.1 60.0 52.1 47.8 59.8 42.8 constant2 24.6 39.7 49.0 47.8 60.0 48.6 54.2 53.8 43.9 accel2 9.0 16.3 13.1 16.1 17.8 14.6 17.2 14.9 14.1 accel3 6.1 19.6 14.2 14.5 19.8 13.2 18.9 19.2 11.9 WBC 4.36 8.23 9.21 9.87 11.40 8.62 7.31 8.58 7.59 pct_BASO 0.14 0.38 0.40 0.60 0.54 0.54 0.25 0.41 0.56 MCV 44.6 47.8 45.5 46.8 45.5 45.2 45.5 44.7 44.4 MCH 14.8 15.6 16.6 15.3 14.9 14.9 15.3 14.7 15.2 MPV 4.8 6.2 4.6 4.6 4.5 4.5 4.6 4.5 4.4 CHOL 69.9 89.9 84.0 78.1 80.0 74.1 69.1 62.4 73.9 HDL 60.4 73.4 65.4 59.9 61.9 60.6 55.5 52.5 65.4 GLU 168.0 202.0 215.0 177.0 174.0 200.0 201.0 203.0 214.0 TFA 2.47 3.14 2.33 2.61 2.65 2.39 2.42 2.19 2.22 HR 622.0 758.0 755.0 763.0 741.0 753.0 732.0 725.0 744.0 PQ 21.5 23.3 23.9 24.1 24.0 20.1 21.0 24.6 23.4 QT 49.9 40.7 42.4 42.3 42.5 39.5 43.9 42.9 41.5 QT_Dis 27.3 18.1 17.2 19.1 17.1 19.9 22.6 22.6 19.9 RR 98.1 79.2 79.5 78.7 81.2 79.8 83.1 83.3 80.8 pulse 572.0 661.0 628.0 604.0 595.0 595.0 657.0 578.0 610.0 bp 94.6 131.0 114.0 121.0 114.0 129.0 108.0 115.0 125.0 LYM 4.93 7.33 8.35 8.35 10.10 7.65 6.35 7.57 6.55 EOS 0.09 0.15 0.14 0.29 0.16 0.13 0.17 0.13 0.14 BASO 0.01 0.03 0.04 0.06 0.06 0.05 0.02 0.03 0.04 tremor 0.00 0.50 0.00 0.00 0.00 0.00 0.00 0.00 0.00 twitch 0.50 1.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 transfer_arousal 1.62 2.50 2.00 1.75 2.00 2.00 1.62 2.00 1.50 urination_arena 0.00 0.88 0.38 0.00 0.38 0.50 0.13 0.00 0.25 pelvic_elevation 0.44 2.00 2.00 2.00 1.00 2.00 2.00 2.00 2.00 tail_elevation 0.80 1.50 1.00 1.12 1.00 1.00 1.00 1.00 1.00 positional_passivity 0.81 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 startle_response 1.81 2.31 1.75 2.00 2.38 2.00 2.38 2.50 1.50 salivation 0.69 1.00 1.00 1.00 0.63 1.00 1.00 0.00 1.00 touch_escape 1.12 1.88 1.50 1.75 1.75 1.88 2.00 1.50 1.00 corneal_reflex 1.38 1.00 1.00 1.00 1.00 1.12 1.00 1.00 1.00 hindlimb_susp 1.38 1.00 1.62 1.00 0.88 1.00 0.00 0.00 0.75

170

(a) con’t

Trait A7 A8 A9 A10 A11 A12 A13 A14 A15 stretch_attends 7.12 1.50 3.25 3.62 2.50 4.12 11.00 6.62 10.00 defecation 0.50 2.38 0.88 1.50 1.00 2.12 1.20 1.75 1.00 arena_entries 12.50 9.62 11.10 9.62 12.00 9.38 3.00 8.00 9.50 rearing_perimeter 10.60 10.00 8.38 6.38 9.12 9.25 14.60 8.38 9.50 line_crossings 150.0 89.0 141.0 90.1 165.0 109.0 71.8 118.0 101.0 tot_activity 163.0 100.0 150.0 96.8 174.0 119.0 86.4 126.0 112.0 constant1 56.5 50.1 58.9 56.2 54.0 54.1 33.6 50.1 55.0 constant2 60.0 49.8 60.0 52.9 60.0 60.0 47.6 58.6 54.5 accel2 13.9 12.9 15.9 11.2 15.8 13.8 9.4 22.0 12.4 accel3 14.5 15.6 20.0 12.4 12.5 14.1 17.2 19.9 13.2 WBC 11.00 10.20 8.68 7.56 8.37 7.16 7.82 9.04 8.57 pct_BASO 0.25 0.33 0.60 0.30 0.65 0.60 0.33 0.39 0.39 MCV 45.5 45.3 45.0 44.9 45.9 46.4 45.4 45.2 44.6 MCH 15.5 15.2 15.2 15.3 15.2 15.1 15.0 14.9 14.3 MPV 5.0 4.6 4.4 4.6 4.5 4.5 4.9 4.5 4.4 CHOL 83.9 74.2 83.0 77.4 73.6 75.5 86.6 77.5 75.3 HDL 66.4 56.7 65.9 62.0 59.6 62.5 72.3 59.6 59.3 GLU 194.0 196.0 218.0 187.0 196.0 233.0 205.0 200.0 197.0 TFA 2.46 2.24 2.85 2.28 2.01 1.97 2.09 1.98 1.80 HR 736.0 717.0 759.0 706.0 723.0 777.0 758.0 705.0 717.0 PQ 23.3 24.2 23.2 24.5 21.9 22.9 23.6 24.8 24.0 QT 43.2 44.0 41.7 42.6 43.5 40.9 41.0 43.6 42.8 QT_Dis 20.9 23.3 23.4 26.7 21.9 24.2 20.7 23.9 19.3 RR 81.9 84.6 79.1 86.0 83.4 78.6 79.4 86.0 84.2 pulse 622.0 659.0 628.0 616.0 596.0 608.0 640.0 611.0 621.0 bp 124.0 111.0 118.0 113.0 110.0 112.0 122.0 108.0 118.0 LYM 9.82 9.28 7.65 6.69 7.48 6.42 7.03 8.16 7.65 EOS 0.18 0.14 0.15 0.18 0.14 0.08 0.13 0.13 0.12 BASO 0.03 0.03 0.05 0.02 0.06 0.04 0.03 0.04 0.04 tremor 0.00 0.00 0.00 0.13 0.00 0.00 0.00 0.00 0.00 twitch 0.00 0.13 0.00 0.00 0.00 0.00 0.00 0.00 0.00 transfer_arousal 2.00 2.00 2.00 2.00 1.75 2.00 2.00 2.00 2.00 urination_arena 0.13 0.38 0.63 0.25 0.13 0.13 0.20 0.13 0.00 pelvic_elevation 1.00 2.12 2.00 2.00 1.50 2.00 2.00 2.00 2.00 tail_elevation 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 positional_passivity 0.00 0.00 0.29 0.00 0.25 0.00 0.00 0.00 0.13 startle_response 1.62 1.50 1.50 1.38 1.25 1.38 1.60 1.00 1.25 salivation 1.00 1.00 0.75 0.50 0.88 1.00 1.00 1.00 1.00 touch_escape 1.25 1.25 1.38 1.12 1.12 1.88 1.40 1.12 1.12 corneal_reflex 1.00 1.12 1.00 1.00 1.25 1.00 1.00 2.00 1.00 hindlimb_susp 0.88 1.00 0.38 0.88 1.75 1.88 1.20 1.00 1.00

171

(a) con’t

Trait A16 A17 A18 A19 AX stretch_attends 8.88 3.88 11.20 4.38 4.88 defecation 0.13 0.25 0.75 1.25 0.88 arena_entries 11.00 8.38 6.88 9.50 12.20 rearing_perimeter 6.50 12.00 5.75 15.80 10.90 line_crossings 152.0 124.0 115.0 132.0 176.0 tot_activity 159.0 136.0 121.0 149.0 187.0 constant1 45.2 54.8 60.0 50.8 43.5 constant2 47.9 59.0 54.0 60.0 52.8 accel2 13.6 17.0 15.2 14.2 13.0 accel3 15.6 16.6 18.0 17.1 17.0 WBC 8.21 12.00 9.29 9.25 8.53 pct_BASO 0.31 0.53 0.34 0.39 0.24 MCV 45.9 46.1 44.6 46.6 47.5 MCH 15.4 15.2 14.9 15.6 15.7 MPV 4.4 4.5 4.6 4.6 5.0 CHOL 79.8 73.6 73.4 81.0 84.1 HDL 63.7 57.1 56.3 64.0 67.5 GLU 214.0 179.0 201.0 244.0 199.0 TFA 1.98 2.50 2.18 2.26 2.63 HR 735.0 704.0 740.0 742.0 763.0 PQ 24.4 23.8 22.0 24.1 21.9 QT 41.4 43.0 40.8 41.5 41.9 QT_Dis 20.8 25.8 22.2 20.6 20.0 RR 82.2 85.9 81.4 81.3 78.9 pulse 652.0 641.0 649.0 568.0 616.0 bp 111.0 117.0 110.0 123.0 118.0 LYM 7.35 10.80 8.39 8.40 7.67 EOS 0.12 0.21 0.13 0.13 0.16 BASO 0.03 0.06 0.03 0.04 0.02 tremor 0.25 0.00 0.00 0.00 0.00 twitch 0.25 0.00 0.00 0.00 0.00 transfer_arousal 2.00 1.88 1.88 2.00 1.88 urination_arena 0.13 0.25 0.25 0.25 0.38 pelvic_elevation 2.00 2.00 2.00 2.00 2.00 tail_elevation 1.00 1.00 1.12 1.00 1.25 positional_passivity 0.25 0.00 0.13 0.00 0.13 startle_response 1.62 1.12 1.12 1.38 1.75 salivation 1.00 1.00 1.00 1.00 1.00 touch_escape 1.62 1.25 1.12 2.00 1.38 corneal_reflex 1.00 1.00 1.00 1.00 1.00 hindlimb_susp 1.00 1.00 2.00 1.00 1.50

172

(b) Average phenotypic values for multigenic traits tested in B6‐ChrA/J panel males

(b) con’t

(d) Average phenotypic values for multigenic traits tested in B6‐ChrPWD panel males

Appendix VII Reduced TGCT prevalence in 129-Chr2MOLF males During a survey of incipient CSS strains derived from strain 129 and mus musculus molosenous (MOLF), two chromosomes - chromosome 2 and chromosome 18 – showed statistical evidence indicating at least one QTL significantly reducing TGCT prevalence (Anderson, 2009). Further studies of the 129-Chr18MOLF CSS and 8 congenic strains identified three TGCT QTLs on MOLF chromosome 18 (Anderson et al., 2009b). Here, 129-Chr2MOLF males were screened for TGCTs. Preliminary screening supports the hypothesis that there is at least one QTL on MOLF chromosome 2 reducing TGCT prevalence relative to 129. χ2 values indicate χ2 goodness of fit test including Yates’ correction for continuity, p values are not corrected for multiple testing.

Strain N # Affected % Affected χ2 P value 129-Chr2MOLF 86 0 0.0% 7.6 0.005

129 208 15 7.2%

References

(January 2010). "Mouse Phenome Database Website." from http://www.jax.org/phenome. Abeloff, M., J. Armitage, et al. (2004). Testicular Cancer. Clin. Oncol. Philadelphia, Elsevier Inc. Adamah, D.J.B., P.J. Gokhale, et al., 2006. Dysfunction of the mitotic:meiotic switch as a potential cause of neoplastic conversion of primordial germ cells. Int. J. Androl. 29: 219–227. Aghajanyan, A. and I. Suskov, 2009. Transgenerational genomic instability in children of irradiated parents as a result of the Chernobyl Nuclear Accident. Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis 671(1-2): 52- 57. Altshuler, D., M.J. Daly, et al., 2008. Genetic Mapping in Human Disease. Science 322(5903): 881-888. Anand, R. and R. Marmorstein, 2007. Structure and Mechanism of Lysine-specific Demethylase Enzymes. J. Biol. Chem. 282(49): 35425-35429. Anant, S. and N.O. Davidson, 2000. An AU-Rich Sequence Element (UUUN[A/U]U) Downstream of the Edited C in Apolipoprotein B mRNA Is a High-Affinity Binding Site for Apobec-1: Binding of Apobec-1 to This Motif in the 3' Untranslated Region of c-myc Increases mRNA Stability. Mol. Cell. Biol. 20(6): 1982-1992. Anant, S., A.J. Macginnitie, et al., 1995. apobec-1, the Catalytic Subunit of the Mammalian Apolipoprotein B mRNA Editing Enzyme, Is a Novel RNA-binding Protein. J. Biol. Chem. 270(24): 14762-14767. Anant, S., D. Mukhopadhyay, et al., 2001. ARCD-1, an apobec-1-related cytidine deaminase, exerts a dominant negative effect on C to U RNA editing. Am J Physiol Cell Physiol 281(6): C1904-1916. Anderson, P. and N. Kedersha, 2006. RNA granules. J. Cell Biol. 172(6): 803-808. Anderson, P. and N. Kedersha, 2009. RNA granules: post-transcriptional and epigenetic modulators of gene expression. Nat Rev Mol Cell Biol 10(6): 430-436. Anderson, P.D. (2009). Genetic Control of Testicular Germ Cell Tumor Susceptibility in Mice. Genetics. Cleveland, Ohio, Case Western Reserve University. Ph.D.: 130. Anderson, P.D., M.-Y. Lam, et al., 2009a. The Role of the Mouse Y Chromosome on Susceptibility to Testicular Germ Cell Tumors. Cancer Res. 69(8): 3614-3618. Anderson, P.D., V.R. Nelson, et al., 2009b. Genetic Factors on Mouse Chromosome 18 Affecting Susceptibility to Testicular Germ Cell Tumors and Permissiveness to Embryonic Stem Cell Derivation. Cancer Res. 69(23): 9112-9117. Anway, M.D., A.S. Cupp, et al., 2005. Epigenetic Transgenerational Actions of Endocrine Disruptors and Male Fertility. Science 308(5727): 1466-1469. Aravin, A.A. and G.J. Hannon, 2008. Small RNA Silencing Pathways in Germ and Stem Cells. Cold Spring Harbor Symp. Quant. Biol. 73: 283-290. Avery, O.T., C.M. Macleod, et al., 1944. Studies on the Chemical Nature of the Substance Inducing Transformation of Pneumococcal Types: Induction of Transformation by a Desoxyribonucleic Acid Fraction Isolated from Pneumococcus Type III. J. Exp. Med. 79(2): 137-158. Baharami, A., J.Y. Ro, et al., 2007. An overview of testicular germ cell tumors. Arch. Pathol. Lab. Med. 131(8): 1267-1280.

Balagopal, V. and R. Parker, 2009. Polysomes, P bodies and Stress granules: States and Fates of Eukaryotic mRNAs. Curr. Opin. Cell Biol. 21(3): 403-408. Bannister, A.J. and T. Kouzarides, 2005. Reversing histone methylation. Nature 436(7054): 1103-1106. Bedell, M.A., L.S. Cleveland, et al., 1996. Deletion and Interallelic Complementation Analysis of Steel Mutant Mice. Genetics 142(3): 935-944. Bedford, M.T. and S. Richard, 2005. Arginine Methylation: An Emerging Regulatorof Protein Function. Mol. Cell 18(3): 263-272. Behrman, R.E., R.M. Kliegman, et al. (2004). Gonadal and Germ Cell Neoplasms. Nelson Textbook of Pediatrics. Philadelphia, Elsevier Science. Bernstein, B.E., T.S. Mikkelsen, et al., 2006. A Bivalent Chromatin Structure Marks Key Developmental Genes in Embryonic Stem Cells. Cell 125(2): 315-326. Bernstein, E. and C.D. Allis, 2005. RNA meets chromatin. Genes Dev. 19(14): 1635- 1655. Bhattacharya, C., S. Aggarwal, et al., 2008. Mouse Apolipoprotein B Editing Complex 3 (APOBEC3) Is Expressed in Germ Cells and Interacts with Dead-End (DND1). PLoS ONE 3(5): e2315. Bhattacharya, C., S. Aggarwal, et al., 2007. The mouse dead-end gene isoform a is necessary for germ cell and embryonic viability. Biochem. Biophys. Res. Commun. 355: 194-199. Bhattacharyya, S.N., R. Habermacher, et al., 2006. Relief of microRNA-Mediated Translational Repression in Human Cells Subjected to Stress. Cell 125(6): 1111- 1124. Bhaumik, S.R., E. Smith, et al., 2007. Covalent modifications of histones during development and disease pathogenesis. Nat Struct Mol Biol 14(11): 1008-1016. Blanc, V., J.O. Henderson, et al., 2001a. Mutagenesis of Apobec-1 Complementation Factor Reveals Distinct Domains That Modulate RNA Binding, Protein-Protein Interaction with Apobec-1, and Complementation of C to U RNA-editing Activity. J. Biol. Chem. 276(49): 46386-46393. Blanc, V., J.O. Henderson, et al., 2005a. Targeted Deletion of the Murine apobec-1 Complementation Factor (acf) Gene Results in Embryonic Lethality. Mol. Cell. Biol. 25(16): 7260-7269. Blanc, V., J.O. Henderson, et al., 2005b. Deletion of the AU-Rich RNA Binding Protein Apobec-1 Reduces Intestinal Tumor Burden in Apcmin Mice. Cancer Res. 67(18). Blanc, V., J.O. Henderson, et al., 2007. Deletion of the AU-rich RNA binding protein Apobec-1 reduces intestinal tumor burden in Apc(min) mice. Cancer Res. 67(18): 8565-8573. Blanc, V., N. Navaratnam, et al., 2001b. Identification of GRY-RBP as an apolipoprotein B RNA-binding protein that interacts with both apobec-1 and apobec-1 complementation factor to modulate C to U editing. . J. Biol. Chem. 276(10): 10272-83. Bonduriansky, R. and T. Day, 2009. Nongenetic Inheritance and Its Evolutionary Implications. Annu. Rev. Ecol. Syst. 40(1): 103-125.

Bower, M., E.S. Newlands, et al., 1997. Treatment of men with metastatic non- seminomatous germ cell tumours with cyclical POMB/ACE chemotherapy. Ann. Oncol. 8(5): 477-483. Brink, R.A., 1973. Paramutation. Annu. Rev. Genet. 7(1): 129-152. Brook, F.A. and R.L. Gardner, 1997. The origin and efficient derivation of embryonic stem cells in theâ€‰mouse. Proc Natl Acad Sci U S A 94(11): 5709-5712. Buchan, J.R. and R. Parker, 2009. Eukaryotic Stress Granules: The Ins and Outs of Translation. Mol. Cell 36(6): 932-941. Buetow, S., 1995. Epidemiology of testicular cancer. Epidemiol. Rev. 17(2): 433-49. Cantley, L.C. and B.G. Neel, 1999. New insights into tumor suppression: PTEN suppresses tumor formation by restraining the phosphoinositide 3-kinase/AKT pathway. Proc Natl Acad Sci U S A 96(8): 4240-4245. Carpenter, K.J. and J. Mayer, 1958. Physiologic Observations on Yellow Obesity in the Mouse. Am J Physiol 193(3): 499-504. Carver, B.S., H. Al-Ahmadie, et al., 2007. Adult and Pediatric Testicular Teratoma. Urol. Clin. North Am. 34(2): 245-251. Chan, L., B.H.-J. Chang, et al., 1997. Apobec-1 and apolipoprotein B mRNA editing. Biochim. Biophys. Acta Gene Struct. Expression 1345: 11-26. Chan, S.-P. and F.J. Slack, 2006. microRNA-Mediated Silencing Inside P Bodies. RNA Biology 3(3): 97-100. Chang, H., M.D. Anway, et al., 2006. Transgenerational Epigenetic Imprinting of the Male Germline by Endocrine Disruptor Exposure during Gonadal Sex Determination. Endocrinology 147(12): 5524-5541. Chinnusamy, V. and J.-K. Zhu, 2009. RNA-directed DNA methylation and demethylation in plants. Sci. China Ser. C (Life Sci) 52(4): 331-343. Chiu, Y.-L. and W.C. Greene, 2008. The APOBEC3 Cytidine Deaminases: An Innate Defensive Network Opposing Exogenous Retroviruses and Endogenous Retroelements. Annu. Rev. Immunol. 26(1): 317-353. Choi, J.K. and L.J. Howe, 2009. Histone acetylation: truth of consequences? Biochem. Cell Biol. 87(1): 139-150. Ciftci, A.O., M. Bingl-Kololu, et al., 2001. Testicular tumors in children. J. Pediatr. Surg. 36(12): 1796-1801. Conticello, S.G., 2008. The AID/APOBEC family of nucleic acid mutators. Genome Biology 9(6). Conticello, S.G., M.-A. Langlois, et al., 2007. DNA Deamination in Immunity: AID in the Context of Its APOBEC Relatives Adv. Immunol. 94: 37-73. Copeland, N.G., D.J. Gilbert, et al., 1990. Mast cell growth factor maps near the steel locus on mouse chromosome 10 and is deleted in a number of steel alleles. Cell 63(1): 175-183. Corry, G.N., B. Tanasijevic, et al., 2009. Epigenetic regulatory mechanisms during preimplantation development. Birth Defects Res. C. Embryo Today Rev. 87(4): 297-313. De Felici, M., 2000. Regulation of primordial germ cell development in the mouse. Int. J. Dev. Biol. 44(6): 575-580.

Degracia, D.J., R. Kumar, et al., 2002. Molecular Pathways of Protein Synthesis Inhibition During Brain Reperfusion[colon] Implications for Neuronal Survival or Death. J. Cereb. Blood Flow Metab. 22(2): 127-141. Di Cristofano, A. and P.P. Pandolfi, 2000. The Multiple Roles of PTEN in Tumor Suppression. 100(4): 387-390. Dieckmann, K. and U. Pichlmeier, 2004. Clinical epidemiology of testicular germ cell tumors. World J. Urol. 22(1): 2-14. Dolci, S., D.E. Williams, et al., 1991. Requirement for mast cell growth factor for primordial germ cell survival in culture. Nature 352(6338): 809-811. Donehower, L.A., M. Harvey, et al., 1992. Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours. Nature 356(6366): 215-221. Egger, G., G. Liang, et al., 2004. Epigenetics in human disease and prospects for epigenetic therapy. Nature 429(6990): 457-463. Ehrlich, M., Ed. (2000). DNA Alterations in Cancer: Genetic and Epigenetic Changes. Natick, MA, EatonPublishing. Eisinger-Mathason, T.S.K., J. Andrade, et al., 2008. Codependent Functions of RSK2 and the Apoptosis-Promoting Factor TIA-1 in Stress Granule Assembly and Cell Survival. Mol. Cell 31(5): 722-736. Ellis, L., P.W. Atadja, et al., 2009. Epigenetics in cancer: Targeting chromatin modifications. Mol. Cancer Ther. 8(6): 1409-1420. Esteller, M., 2007. Cancer epigenomics: DNA methylomes and histone-modification maps. Nat. Rev. Genet. 8(4): 286-298. Eulalio, A., I. Behm-Ansmant, et al., 2007. P-Body Formation Is a Consequence, Not the Cause, of RNA-Mediated Gene Silencing. Molecular and Cellular Biology 27(11): 3970-3981. Feinberg, A.P., H. Cui, et al., 2002. DNA methylation and genomic imprinting: insights from cancer into epigenetic mechanisms. Semin. Cancer Biol. 12(5): 389-398. Feinberg, A.P. and B. Tycko, 2004. The history of cancer epigenetics. Nat Rev Cancer 4(2): 143-153. Feinberg, A.P. and B. Vogelstein, 1983. Hypomethylation distinguishes genes of some human cancers from their normal counterparts. Nature 301(5895): 89-92. Frazer, K.A., S.S. Murray, et al., 2009. Human genetic variation and its contribution to complex traits. Nat Rev Genet 10(4): 241-251. Fujimura, K., J. Katahira, et al., 2009. Microscopic dissection of the process of stress granule assembly. Biochim. Biophys. Acta 1793(11): 1728-1737. Gallou-Kabani, C., A. Vige, et al., 2007. Nutri-epigenomics: lifelong remodelling of our epigenomes by nutritional and metabolic factors and beyone. Clin Chem Lab Med 45(3): 321-327. Garner, D.L., 2001. Sex-sorting Mammalian Sperm: Concept to Application in Animals. J. Androl. 22(4): 519-526. Garzon, R., G.A. Calin, et al., 2009. MicroRNAs in Cancer. Annu. Rev. Med. 60(1): 167- 179. Gaudet, F., J.G. Hodgson, et al., 2003. Induction of Tumors in Mice by Genomic Hypomethylation. Science 300(5618): 489-492. Giuliano, C.J., J.S. Kerley-Hamilton, et al., 2005. Retinoic acid represses a cassette of candidate pluripotency chromosome 12p genes during induced loss of human

embryonal carcinoma tumorigenicity Biochim. Biophys. Acta Gene Struct. Expression 1731(1): 48-56. Gluckman, P.D., M.A. Hanson, et al., 2007. Non-genomic transgenerational inheritance of disease risk. Bioessays 29(2): 145-154. Godler, D.E., F. Tassone, et al., 2010. Methylation of novel markers of fragile X alleles is inversely correlated with FMRP expression and FMR1 activation ratio. Hum. Mol. Genet. 19(8): 1618-1632. Goldberg, A.D., C.D. Allis, et al., 2007. Epigenetics: a landscape takes shape. Cell 128(4): 635-8. Gonzalgo, M.L. and P.A. Jones, 1997. Mutagenic and epigenetic effects of DNA methylation. Mutation Research/Reviews in Mutation Research 386(2): 107-118. Gorisch, S.M., M. Wachsmuth, et al., 2005. Histone acetylation increases chromatin accessibility. J. Cell Sci. 118(24): 5825-5834. Grandjean, V., P. Gounon, et al., 2009. The miR-124-Sox9 paramutation: RNA-mediated epigenetic control of embryonic and adult growth. Development 136(21): 3647- 3655. Greeve, J., H. Lellek, et al., 1999. Absence of APOBEC-1 mediated mRNA editing in human carcinomas. Oncogene Res. 18(46): 6357-66. Gregorova, S., P. Divina, et al., 2008. Mouse consomic strains: Exploiting genetic divergence between Mus m. musculus and Mus m. domesticus subspecies. Genome Res. 18: 509-515. Grody, W.W. and W.W. Noll (2007). Molecular Diagnosis of Genetic Diseases. Henry's Clinical Diagnosis and Management by Laboratory Methods. R.A. Mcpherson and M.R. Pincus. Philadelphia, PA, Saunders Elsevier. Grunstein, M., 1997. Histone acetylation in chromatin structure and transcription. Nature 389(6649): 349-352. Hajkova, P., K. Ancelin, et al., 2008. Chromatin dynamics during epigenetic reprogramming in the mouse germ line. Nature 452(7189): 877-881. Hammond, S., R. Zhu, et al., 2007. Chromosome X modulates incidence of testicular germ cell tumors in Ter mice. Mamm. Genome 18(12): 832-838. Hammoud, S.S., D.A. Nix, et al., 2009. Distinctive chromatin in human sperm packages genes for embryo development. Nature 460(7254): 473-478. Harris, R.S., S.K. Petersen-Mahrt, et al., 2002. RNA editing enzyme APOBEC1 and some of its homologs can act as DNA mutators. Mol. Cell 10(5): 1247-53. Hartley, A., J. Birch, et al., 1989. Are germ cell tumors part of the Li-Fraumeni cancer family syndrome? Canc Genet Cytogenet 42(2): 221-6. Harvey, M., M.J. Mcarthur, et al., 1993a. Genetic background alters the spectrum of tumors that develop in p53- deficient mice. 7(10): 938-943. Harvey, M., M.J. Mcarthur, et al. (1993b). Genetic background alters the spectrum of tumors that develop in p53- deficient mice. 7: 938-943. Hasegawa, T., K. Maeda, et al., 2006. A case of immature teratoma originating in intra- abdominal undescended testis in a 3-month-old infant. Pediatr. Surg. Int. 22(6): 570-2. Heaney, J.D., M.-Y.J. Lam, et al., 2008. Loss of the Transmembrane but not the Soluble Kit Ligand Isoform Increases Testicular Germ Cell Tumor Susceptibility in Mice. Cancer Res. 68(13): 5193-5197.

Heaney, J.D., M.V. Michelson, et al., 2009a. Deletion of eIF2beta suppresses testicular cancer incidence and causes recessive lethality in agouti-yellow mice. Hum. Mol. Genet.: ddp045. Heaney, J.D., M.V. Michelson, et al., 2009b. Deletion of eIF2beta suppresses testicular cancer incidence and causes recessive lethality in agouti-yellow mice. Hum. Mol. Genet.: ddp045. Hemminki, K. and B. Chen, 2006. Familial risks in testicular cancer as aetiological clues. Int. J. Androl. 29(1): 205-210. Hershey, A.D. and M. Chase, 1952. Independent functions of viral protein and nucleic acid in growth of bacteriophage. J. Genet. Psychol. 36(1): 39-56. Hirano, K.-I., S.G. Young, et al., 1996. Targeted Disruption of the Mouse apobec-1 Gene Abolishes Apolipoprotein B mRNA Editing and Eliminates Apolipoprotein B48. J. Biol. Chem. 271(17): 9887-9890. Hirschhorn, J.N., 2005. Genetic Approaches to Studying Common Diseases and Complex Traits. Pediatr. Res. 57(5 Part 2): 74R-77R. Hitchins, M.P., J.J.L. Wong, et al., 2007. Inheritance of a Cancer-Associated MLH1 Germ-Line Epimutation. New Engl. J. Med. 356(7): 697-705. Horsthemke, B. and K. Buiting, 2006. Imprinting defects on human chromosome 15. Cytogenet. Genome Res. 113(1-4): 292-299. Horwich, A., J. Shipley, et al., 2006. Testicular germ-cell cancer. Lancet 367: 12. Hutvagner, G. and P.D. Zamore, 2002. A microRNA in a Multiple-Turnover RNAi Enzyme Complex. Science 297(5589): 2056-2060. Jacobsen, R., E. Bostofte, et al., 2000. Risk of testicular cancer in men with abnormal semen characteristics: cohort study. Br. Med. J. (Clin. Res. Ed). 320(7264): 789- 792. Jaenisch, R. and A. Bird, 2003. Epigenetic regulation of gene expression: how the genome integrates intrinsic and environmental signals. Nat. Genet. 33: 245-254. Johannes, F., E. Porcher, et al., 2009. Assessing the Impact of Transgenerational Epigenetic Variation on Complex Traits. PLoS Genet 5(6): e1000530. Jones, L., F. Ratcliff, et al., 2001. RNA-directed transcriptional gene silencing in plants can be inherited independently of the RNA trigger and requires Met1 for maintenance. Curr. Biol. 11(10): 747-757. Jones, P.A. and S.B. Baylin, 2002. The fundamental role of epigenetic events in cancer. Nat Rev Genet 3(6): 415-428. Kanetsky, P.A., N. Mitra, et al., 2009. Common variation in KITLG and at 5q31.3 predisposes to testicular germ cell cancer. Nat Genet 41(7): 811-815. Kedde, M., M.J. Strasser, et al., 2007. RNA-Binding Protein Dnd1 Inhibits MicroRNA Access to Target mRNA. Cell 131(7): 1273-1286. Kedersha, N., S. Chen, et al., 2002. Evidence That Ternary Complex (eIF2-GTP- tRNAiMet)-Deficient Preinitiation Complexes Are Core Constituents of Mammalian Stress Granules. Mol. Biol. Cell 13(1): 195-210. Kedersha, N., G. Stoecklin, et al., 2005. Stress granules and processing bodies are dynamically linked sites of mRNP remodeling. J. Cell Biol. 169(6): 871-884. Kedersha, N.L., M. Gupta, et al., 1999. RNA-Binding Proteins Tia-1 and Tiar Link the Phosphorylation of Eif-2Î± to the Assembly of Mammalian Stress Granules. J. Cell Biol. 147(7): 1431-1442.

Kimura, T., A. Suzuki, et al., 2003. Conditional loss of PTEN leads to testicular teratoma and enhances embryonic germ cell production. Development 130(8): 1691-1700. Kind, J. and A. Akhtar, 2007. Cotranscriptional recruitment of the dosage compensation complex to X-linked target genes. Genes Dev. 21: 2030-2040. Klattenhoff, C. and W. Theurkauf, 2008. Biogenesis and germline functions of piRNAs. Development 135(1): 3-9. Koubova, J., D.B. Menke, et al., 2006. Retinoic acid regulates sex-specific timing of meiotic initiation in mice. Proc Natl Acad Sci U S A 103(8): 2474-2479. Kouzarides, T., 2007. Chromatin Modifications and Their Function. Cell 128(4): 693- 705. Kumar, V., A. Abbas, et al. (2005). Robbins and Cotran Pathological Basis of Disease. Philadelphia, Elsevier Inc. Lam, M.-Y.J., J.D. Heaney, et al., 2007. Trans-generational epistasis between Dnd1Ter and other modifier genes controls susceptibility to testicular germ cell tumors. Hum. Mol. Genet. 16(18): 2233-2240. Lam, M.-Y.J. and J.H. Nadeau, 2003. Genetic control of susceptibility to spontaneous testicular germ cell tumors in mice. APMIS 111(1): 184-191. Lam, M.-Y.J., K.K. Youngren, et al., 2004. Enhancers and Suppressors of Testicular Cancer Susceptibility in Single- and Double-Mutant Mice. Genetics 166: 925- 933. Lee, R., K.-I. Hirano, et al., 1998. An alternatively spliced form of apobec-1 messenger RNA is overexpressed in human colon cancer. Gastroenterology 115(5): 1096- 103. Lesscher, H., M. Kas, et al., 2009. A grandparent-influenced locus for alcohol preference on mouse chromosome 2. Pharmacogenetics & Genomics 19(9): 719-29. Li, B., M. Carey, et al., 2007. The Role of Chromatin during Transcription. Cell 128(4): 707-719. Liao, W., S.H. Hong, et al., APOBEC-2, a cariac- and skeletal muscle-specific member of the cytidine deaminase supergene family. Biochem. Biophys. Res. Commun. 260: 398-404. Lindelöf, B. and G. Eklund, 2001. Analysis of hereditary component of cancer by use of a familial index by site. Lancet 358(9294): 1696-1698. Linger, R., D. Dudakia, et al., 2007. A physical analysis of the Y chromosome shows no additional deletions, other than Gr/Gr, associated with testicular germ cell tumour. Br. J. Cancer 96: 357-361. Liu, E.T. (2004). Oncogenes and Suppressor Genes: Genetic Control of Cancer. CECIL Textbook of Medicine. L. Goldman and D. Ausiello. Philadelphia, W. B. Saunders Company. Looijenga, L.H.J., H.D. Leeuw, et al., 2003. Stem Cell Factor Receptor (c-KIT) Codon 816 Mutations Predict Development of Bilateral Testicular Germ-Cell Tumors. Canc Res 63: 7674-7678. Lu, Q. and B.D. Shur, 1997. Sperm from beta 1,4-galactosyltransferase-null mice are refractory to ZP3-induced acrosome reactions and penetrate the zona pellucida poorly. Development 124(20): 4121-4131. Lumey, L., 1992. Decreased birthweights in infants after maternal in utero exposure to the Dutch famine of 1944-1945. Paediatr. Perinat. Epidemiol. 6(2): 240-53.

Luo, M., X. Cui, et al., 2009. Genetic Structures of Copy Number Variants Revealed by Genotyping Single Sperm. PLoS ONE 4(4): e5236. Lynch, M., D.S. Cram, et al., 2005. The Y chromosome gr/gr subdeletion is associated with male infertility. Mol. Human Reprod. 11(7): 507-512. Lyon, M.F., 2003. Transmission ratio distortion in mice. Annu. Rev. Genet. 37: 393-408. Lyttle, T., 1993. Cheaters sometimes prosper: distortion of mendelian segregation by meiotic drive. Trends Genet. 9: 205-210 Maccani, M.A. and C.J. Marsit, 2009. Epigenetics in the Placenta. Am. J. Reprod. Immunol. 62(2): 78-89. Mahakali Zama, A., F.P. Hudson, Iii, et al., 2005. Analysis of Hypomorphic KitlSl Mutants Suggests Different Requirements for KITL in Proliferation and Migration of Mouse Primordial Germ Cells. Biol. Reprod. 73(4): 639-647. Maher, B., 2008. Personal genomes: The case of the missing heritability Nature 456: 18- 21. Malone, C.D. and G.J. Hannon, 2009. Small RNAs as Guardians of the Genome. Cell 136(4): 656-668. Mank, J.E., 2009. The W, X, Y and Z of sex-chromosome dosage compensation. Trends Genet. 25(5): 226-233. Manolio, T.A., F.S. Collins, et al., 2009. Finding the missing heritability of complex diseases. Nature 461(7265): 747-753. Mariani, R., D. Chen, et al., 2003. Species-specific exclusion of APOBEC3G from HIV-1 virons by Vif. Cell 114: 21-31. Martienssen, R., 1996. Epigenetic phenomena: Epigenetic phenomena: Paramutation and gene silencing in plants. Curr. Biol. 6(7): 810-813. Martin, C. and Y. Zhang, 2007. Mechanisms of epigenetic inheritance. Curr. Opin. Cell Biol. 19(3): 266-272. Matin, A. and J.H. Nadeau, 2005. Search for Testicular Cancer Gene Hits Dead-End. Cell Cycle 4(9): 1136-1138. Matsui, Y., 1998. Developmental fates of the mouse germ cell line. Int. J. Dev. Biol. 42: 1037-1042. Matsumoto, T., H. Marusawa, et al., 2006. Expression of APOBEC2 is transcriptionally regulated by NF-kappaB in human hepatocytes. FEBS Lett. 580(3): 731-735. Matthews, S.G. and D.I.W. Phillips, 2010. Minireview: Transgenerational Inheritance of the Stress Response: A New Frontier in Stress Research. Endocrinology 151(1): 7-13. Mclaren, A., 1999. Signaling for germ cells. Genes Dev. 13(4): 373-376. Mendel, G., 1866. Versuche über Plflanzen-hybriden. Verhandlungen des naturforschenden Vereines in Brünn: 3-47. Mendelsohn, J., P.M. Howley, et al. (2001). The Molecular Basis of Cancer. Philadelphia, W.B. Saunders Company. Mendjan, S. and A. Akhtar, 2007. The right dose for every sex. Chromosoma 116: 95- 106. Michaud, E.J., S.J. Bultman, et al., 1994. A molecular model for the genetic and phenotypic characteristics of the mouse lethal yellow (Ay) mutation. Proc. Natl. Acad. Sci U S A 91(7): 2562-2566.

Mikl, M.C., I.N. Watt, et al., 2005. Mice Deficient in APOBEC2 and APOBEC3. Mol. Cell. Biol. 25(16): 7270-7277. Mokas, S., J.R. Mills, et al., 2009. Uncoupling Stress Granule Assembly and Translation Initiation Inhibition. Mol. Biol. Cell 20(11): 2673-2683. Mollet, S., N. Cougot, et al., 2008. Translationally Repressed mRNA Transiently Cycles through Stress Granules during Stress. Mol. Biol. Cell 19(10): 4469-4479. Monaghan, F. and A. Corcos, 1984. On the origins of the Mendelian laws. J. Hered. 75(1): 67-69. Moore, G.D., D.A. Sinclair, et al., 1983. Histone Gene Multiplicity and Position Effect Variegation in Drosophila Melanogaster. Genetics 105(2): 327-344. Morange, M., 2009. What history tells us XVII. Conrad Waddington and the nature of life. J. Biosci. (Bangalore) 34(2): 195-198. Morgan, H.D., W. Dean, et al., 2004. Activation-induced Cytidine Deaminase Deaminates 5-Methylcytosine in DNA and Is Expressed in Pluripotent Tissues. J. Biol. Chem. 279(50): 52353-52360. Morgan, H.D., H.G. Sutherland, et al., 1999. Epigenetic inheritance at the agouti locus in the mouse. Nat. Genet. 1999(23): 314-318. Nadeau, J.H., 2009. Transgenerational genetic effects on phenotypic variation and disease risk. Hum. Mol. Genet. 18(R2): R202-210. Nadeau, J.H., J.B. Singer, et al., 2000. Analysing complex genetic traits with chromosome substitution strains. Nat. Genet. 24(3): 221-225. Nathanson, K.L., P.A. Kanetsky, et al., 2005. The Y Deletion gr/gr and Susceptibility to Testicular Germ Cell Tumor. Am. J. Hum. Genet. 77(6): 1034-1043. Naumann, A., N. Hochstein, et al., 2009. A Distinct DNA-Methylation Boundary in the 5'- Upstream Sequence of the FMR1 Promoter Binds Nuclear Proteins and Is Lost in Fragile X Syndrome. Am. J. Hum. Genet. 85(5): 606-616. Navaratnam, N. and R. Sarwar, 2006. An Overview of Cytidine Deaminases. Int. J. Hematol. 83(3): 195-200. Neuberger, M.S., R.S. Harris, et al., 2003. Immunity through DNA deamination. Trends Biochem. Sci. 28: 305-312. Nicholls, R.D., S. Saitoh, et al., 1998. Imprinting in Prader-Willi and Angelman syndromes. Trends Genet. 14(5): 194-200. Nicholson, P. and S. Harland, 1995. Inheritance and testicular cancer. Br. J. Cancer 71(2): 421-6. Noguchi, T. and M. Noguchi, 1985. A recessive mutation (ter) causing germ cell deficiency and a high incidence of congenital testicular teratomas in 129/Sv-ter mice. J. Natl. Cancer Inst. 75(2): 385-92. Ohinata, Y., B. Payer, et al., 2005. Blimp1 is a critical determinant of the germ cell lineage in mice. Nature 436(7048): 207-213. Okamoto, I., A.P. Otte, et al., 2004. Epigenetic Dynamics of Imprinted X Inactivation During Early Mouse Development. Science 303(5658): 644-649. Painter, R., C. Osmond, et al., 2008. Transgenerational effects of prenatal exposure to the Dutch famine on neonatal adiposity and health in later life. BJOG 115(10): 1243- 1249. Palmer, S., J. Perry, et al., 1997. A gene spans the pseudoautosomal boundary in mice. Proc Natl Acad Sci U S A 94(22): 12030-12035.

Parker, R. and U. Sheth, 2007. P Bodies and the Control of mRNA Translation and Degradation. Mol. Cell 25(5): 635-646. Parkhurst, S.M. and D. Ish-Horowicz, 1991. wimp, a dominant maternal-effect mutation, reduces transcription of a specific subset of segmental genes in Drosophila. Genes Dev. 5: 341-357. Paul, W.S., S. Hans, et al., 2004. Resistance to Platinum-Containing Chemotherapy in Testicular Germ Cell Tumors Is Associated with Downregulation of the Protein Kinase SRPK1. Neoplasia 6: 297-301. Pembrey, M.E., 2002. Time to take epigenetic inheritance seriously. Eur. J. Hum. Genet. 10(11): 669-71. Pembrey, M.E., L.O. Bygren, et al., 2006. Sex-specific, male-line transgenerational responses in humans. Eur. J. Hum. Genet. 14(2): 159-66. Perry, J., S. Palmer, et al., 2001. A Short Pseudoautosomal Region in Laboratory Mice. Genome Res. 11(11): 1826-1832. Peterson, C. and M. Laniel, 2004. Histones and histone modifications. Curr. Biol. 14(14): R546-51. Piko, L. and K.B. Clegg, 1982. Quantitative changes in total RNA, total poly(A), and ribosomes in early mouse embryos. Developmental Biology 89(2): 362-378. Plocher, T.A. and T.L. Powley, 1976. Effect of hypophysectomy on weight gain and body composition in the genetically obese yellow (Ay/a) mouse. Metabolism 25(5): 593-602. Popp, C., W. Dean, et al., Genome-wide erasure of DNA methylation in mouse primordial germ cells is affected by AID deficiency. Nature 463(7284): 1101- 1105. Rakyan, V.K. and S. Beck, 2006. Epigenetic variation and inheritance in mammals. Curr. Opin. Genet. Dev. 16(6): 573-577. Rakyan, V.K., S. Chong, et al., 2003. Transgenerational inheritance of epigenetic states at the murine AxinFu allele occurs after maternal and paternal transmission. Proc Natl Acad Sci U S A 100(5): 2538-2543. Rakyan, V.K., J. Preis, et al., 2001. The marks, mechanisms and memory of epigenetic states in mammals. Biochem. J. 356(1): 1-10. Raman, J.D., C.F. Nobert, et al., 2005. Increased Incidence of Testicular Cancer in Men Presenting with Infertility and Abnormal Semen Analysis. J. Urol. 174(5): 1819- 1822. Rapley, E.A., G.P. Crockford, et al., 2003. Localisation of susceptibility genes for familial testicular germ cell tumour. APMIS 111(1): 128-135. Rapley, E.A., S. Hockley, et al., 2004. Somatic mutations of KIT in familial testicular germ cell tumours. British Journal of Cancer 90(2397-2401). Rapley, E.A., C. Turnbull, et al., 2009. A genome-wide association study of testicular germ cell tumor. Nat Genet 41(7): 807-810. Rassoulzadegan, M., V. Grandjean, et al., 2006. RNA-mediated non-mendelian inheritance of an epigenetic change in the mouse. Nature 441(7092): 469-474. Repping, S., H. Skaletsky, et al., 2003. Polymorphism for a 1.6-Mb deletion of the human Y chromosome persists through balance between recurrent mutation and haploid selection. Nat Genet 35(3): 247-251.

Robin, N.H. (2007). Patterns of Genetic Transmission. Nelson Textbook of Pediatrics. R.M. Kliegman, R.E. Behrman, H.B. Jenson and B.F. Stanton. Philadelphia, PA, Saunders Elsevier. Rogozin, I.B., M.K. Basu, et al., 2005. APOBEC4, a New Member of the AID/APOBEC Family of Polynucleotide (Deoxy)Cytidine Deaminases Predicted by Computational Analysis. Cell Cycle 4(9): 1281-1285. Schimenti, J., 2000. Segregation distortion of mouse t haplotypes the molecular basis emerges. Trends Genet. 16(6): 240-243. Schottenfeld, D., M. Warshauer, et al., 1980. The epidemiology of testicular cancer in young adults. Am. J. Epidemiol. 112(2): 232-46. Seki, Y., K. Hayashi, et al., 2005. Extensive and orderly reprogramming of genome-wide chromatin modifications associated with specification and early development of germ cells in mice. Developmental Biology 278(2): 440-458. Seto, A.G., R.E. Kingston, et al., 2007. The Coming of Age for Piwi Proteins. Mol. Cell 26(5): 603-609. Shahbazian, M.D. and M. Grunstein, 2007. Functions of Site-Specific Histone Acetylation and Deacetylation. Annu. Rev. Biochem. 76(1): 75-100. Shao, H., L.C. Burrage, et al., 2008. Genetic architecture of complex traits: Large phenotypic effects and pervasive epistasis. Proc Natl Acad Sci U S A 105(50): 19910-19914. Shendure, J., J.A. Melo, et al., 1998. Sex-restricted non-Mendelian inheritance of mouse Chromosome 11 in the offspring of crosses between C57BL/6J and (C57BL/6J x DBA/2J)F1 mice. Mamm. Genome 9(10): 812-815. Shilatifard, A., 2006. Chromatin Modifications by Methylation and Ubiquitination: Implications in the Regulation of Gene Expression. Annu. Rev. Biochem. 75(1): 243-269. Singer, J.B., A.E. Hill, et al., 2004. Genetic Dissection of Complex Traits with Chromosome Substitution Strains of Mice. Science 304(5669): 445-448. Skakkebæk, N.E., E.R.-D. Meyts, et al., 2007. Testicular cancer trends as 'whistle blowers' of testicular developmental problems in populations. Int. J. Androl. 30(4): 198-205. Skinner, M.K., 2007. Epigenetic transgenerational toxicology and germ cell disease. Int. J. Androl. 30: 393-397. Skinner, M.K. and M.D. Anway, 2005. Seminiferous Cord Formation and Germ-Cell Programming: Epigenetic Transgenerational Actions of Endocrine Disruptors. Ann. N. Y. Acad. Sci. 1061: 18-32. Slanchev, K., J. Stebler, et al., Control of Dead end localization and activity - Implications for the function of the protein in antagonizing miRNA function. Mech. Dev. 126(3-4): 270-277. Smith, C.M., J.H. Finger, et al., 2007. The mouse Gene Expression Database (GXD): 2007 update. Nucleic Acids Res 35(Database issue): D638-D642. Soussi, T. and G. Lozano, 2005. p53 mutation heterogeneity in cancer. Biochemical and Biophysical Research Communications 331(3): 834-842. Spofford, J.B., 1959. Parental Control of Position-Effect Variegation: I. Parental Heterochromatin and Expression of the White Locus in Compound-X Drosophila Melanogaster. Proc Natl Acad Sci U S A 45(7): 1003-1007.

Squatrito, M., C. Gorrini, et al., 2006. Tip60 in DNA damage response and growth control: many tricks in one HAT. Trends Cell Biol. 16(9): 433-442. Stevens, L., 1967a. The biology of teratomas. Adv Morphog 6: 1-31. Stevens, L., 1967b. The biology of teratomas. Adv. Morphog. 6: 1-31. Stevens, L., 1967c. Origin of testicular teratomas from primordial germ cells in mice. J. Natl. Cancer Inst. 38(4): 549-52. Stevens, L., 1973. A new inbred subline of mice (129-terSv) with a high incidence of spontaneous congenital testicular teratomas. J. Natl. Cancer Inst. 50(1): 235-42. Stevens, L. and K. Hummel, 1957. A description of spontaneous congenital testicular teratomas in strain 129 mice. J. Natl. Cancer Inst. 18(5): 719-47. Stevens, L. and C. Little, 1954. Spontaneous Testicular Teratomas in an Inbred Strain of Mice. Proc. Natl. Acad. Sci. U. S. A. 40(11): 1080-1087. Stokoe, D., 2001. PTEN. Current Biology 11(13): R502-R502. Sturtevant, A.H., 1921. Linkage Variation and Chromosome Maps. Proc Natl Acad Sci U S A 7(7): 181-183. Swales, A.K.E. and N. Spears, 2005. Genomic imprinting and reproduction. Reproduction 130(4): 389-399. Takabayashi, S., Y. Sasaoka, et al., 2001. Novel growth factor supporting survival of murine primordial germ cells: evidence from conditioned medium of ter fetal gonadal somatic cells. Mol. Reprod. Dev 60(3): 384-396. Takada, T., A. Mita, et al., 2008. Mouse inter-subspecific consomic strains for genetic dissection of quantitative complex traits. Genome Res. 18(3): 500-508. Takahashi, A., A. Nishi, et al., 2008. Systematic analysis of emotionality in consomic mouse strains established from C57BL/6J and wild-derived MSM/Ms. Genes Brain Behav. 7(8): 849-858. Tam, P.P.L. and M.H.L. Snow, 1981. Proliferation and migration of primordial germ cells during compensatory growth in mouse embryos. J. Embryol. Exp. Morphol. 64(1): 133-147. Thackray, A. and W. Crane (1976). Seminoma. Pathology of the testis. R. Pugh. Philadelphia, Oxford: Blackwell Scientific. Vartanian, J.-P., D. Guetard, et al., 2008. Evidence for Editing of Human Papillomavirus DNA by APOBEC3 in Benign and Precancerous Lesions. Science 320(5873): 230-233. Verdel, A., A. Vavasseur, et al., 2009. Common themes in siRNA-mediated epigenetic silencing pathways. International Journal of Developmental Biology 53(2-3): 245-257. Veron, N., H. Bauer, et al., 2009. Retention of gene products in syncytial spermatids promotes non-Mendelian inheritance as revealed by the t complex responder. Genes & Development 23(23): 2705-2710. Wagner, K.D., N. Wagner, et al., 2008. RNA Induction and Inheritance of Epigenetic Cardiac Hypertrophy in the Mouse. Dev. Cell 14(6): 962-969. Weaver, J., M. Susiarjo, et al., 2009. Imprinting and epigenetic changes in the early embryo. Mamm. Genome 20(9): 532-543. Weidinger, G., J. Stebler, et al., 2003. dead end, a Novel Vertebrate Germ Plasm Component, Is Required for Zebrafish Primordial Germ Cell Migration and Survival. Current Biology 13(16): 1429-1434.

Wein, A.J., L.R. Kavoussi, et al., Eds. (2007). Campbell-Walsh Urology, Saunders. Weissman, M.M., P. Wickramaratne, et al., 2005. Families at High and Low Risk for Depression: A 3-Generation Study. Arch. Gen. Psychiatry 62(1): 29-36. Weitzner, S., 1976. Spermatocytic seminoma. Urology 7(6): 646-8. Wu, G., L. Hao, et al., 2005. Maternal Transmission Ratio Distortion at the Mouse Om Locus Results From Meiotic Drive at the Second Meiotic Division. Genetics 170(1): 327-334. Xie, Y., V. Blanc, et al., 2009. Decreased Expression of Cholesterol 7a-Hydroxylase and Altered Bile Acid Metabolism in Apobec-1-/- Mice Lead to Increased Gallstone Susceptibility. J. Biol. Chem. 284(25): 16860-16871. Xing, Y., S. Shi, et al., 2007. Evidence for Transgenerational Transmission of Epigenetic Tumor Susceptibility in Drosophila. PLoS Genet 3(9): e151. Yang, Z., A. Jakymiw, et al., 2004. GW182 is critical for the stability of GW bodies expressed during the cell cycle and cell proliferation. J. Cell Sci. 117(23): 5567- 5578. Yin, Y., B.C. Stahl, et al., 1998. p53-Mediated Germ Cell Quality Control in Spermatogenesis. Developmental Biology 204(1): 165-171. Youngren, K.K., D. Coveney, et al., 2005. The Ter mutation in the dead end gene causes germ cell loss and testicular germ cell tumours. Nature 435(7040): 360-4. Youngren, K.K., J.H. Nadeau, et al., 2003. Testicular cancer susceptibility in the 129.MOLF-Chr19 mouse strain: additive effects, gene interactions and epigenetic modifications. Hum. Mol. Genet. 12(4): Human Molecular Genetics,. Youngson, N.A. and E. Whitelaw, 2008. Transgenerational Epigenetic Effects. Ann. Rev. Genom. Hum. Genet. 9(1): 233-257. Yu, J., C. Angelin-Duclos, et al., 2000. Transcriptional repression by blimp-1 (PRDI- BF1) involves recruitment of histone deacetylase. Molecular and Cellular Biology 20(7): 2592-603. Zardo, G., F. Fazi, et al., 2005. Dynamic and reversibility of heterochromatic gene silencing in human disease. Cell Res. 15(9): 679-690. Zhang, W., M. Huang, et al., Conserved and non-conserved features of HIV-1 and SIVagm Vif mediated suppression of APOBEC3 cytidine deaminases. Cell. Microbiol. 0(ja).