Functional Analysis of The Homeobox Gene Tur-2 During Mouse Embryogenesis

Shao Jun Tang

A thesis submitted in conformity with the requirements for the Degree of Doctor of Philosophy Graduate Department of Molecular and Medical Genetics University of Toronto

March, 1998

Copyright by Shao Jun Tang (1998) National Library Bibriothèque nationale du Canada Acquisitions and Acquisitions et Bibiiographic Services seMces bibliographiques 395 Wellington Street 395, rue Weifington OtbawaON K1AW OttawaON KYAON4 Canada Canada

The author has granted a non- L'auteur a accordé une licence non exclusive licence alIowing the exclusive permettant à la National Library of Canada to Bibliothèque nationale du Canada de reproduce, loan, distri%uteor sell reproduire, prêter' distribuer ou copies of this thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la forme de microfiche/nlm, de reproduction sur papier ou sur format électronique.

The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts fkom it Ni la thèse ni des extraits substantiels may be printed or otherwise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation. Functional Analysis of The Homeobox Gene TLr-2 During Mouse Embryogenesis

Doctor of Philosophy (1998)

Shao Jun Tang

Graduate Department of Moiecular and Medicd Genetics

University of Toronto

Abstract

This thesis describes the clonhg of the TLx-2 homeobox gene, the determination

of its developmental expression, the characterization of its fiuiction in mouse mesodem

and penpheral nervous system (PNS) developrnent, the regulation of nx-2 expression in

the early mouse embryo by BMP signalling, and the modulation of the function of nX-2

protein by the 14-3-3 signalling protein during neural development.

TL.-2 is a murine horneobox gene related to the hurnan T-ce11 leukemia oncogene

HOXII. During early mouse development, 77x-2 is expressed in the ectodem and the primitive streak. In vivo and Ni vitro experiments dernomte that BMP2/4 signalling activates the expression of i7.x-2, suggesting that during mouse embryogenesis Th2 is a downstream target gene in a BMP signalling pathway. A targeted mutation of TLr-2 Ieads to early embryonic lethality, and the homozygous embryos display severe defects in the primitive streak and in mesoderm formation. The phenotype of TLx-2 mutant embryos demonstrate an essential role of TLc-2 in mouse mesoderm formation, a developmental process regulated by BMP 24signalling. These hdings suggest a BMPmx-2 signallhg

pathway required for mammaiian mesoderm development.

TLr-2 is specifïcally exgressed in the developing PNS after E9.0, including the sensory and autonomie ganglia derived fkom the neural crest. A role for 71.-2 in PNS development is suggested by the coincidence of the evolution of the T2x-2 expression pattern and the ontogenesis of the PNS. Overexpression of îE-2 in PC 12 cells suppresses neurite outgrowth induced by NGF, indicating that 7k-2 is a negative regulator of neural differentiation. Furthermore, TLX-2 is a transcription repressor as demonstrated by CO-transfectionassays. These results suggest that 77x-2 suppresses neuronal differentiation during the early phase of gangliogenesis. probably by its repression of neuronal gene expression.

TLX-2 is associated with the 14-3-3 q protein both in vitro and in vivo. The physiological significance of the physical interaction of TLX-2 and 14-3-3 q is demonstrated at several leveis: TLr-2 and 14-3-3 r] are CO-expressedin the developing

PNS and in PC 12 cells, 14-3-3 q enhances the nuclear localization of TLX-2, and 14-3-3 q and TLX-2cooperatively suppress neurite outgrowth of PC 12 cells. These results indicate that the function of the IXX-2 homeodomain is probably regulated by ce11 signalling mediated by 14-3-3 proteins.

This work contributes to an understanding of the function the Tlx-2 homeobox gene and of the regdation of the TLx-2 function during mouse embryogenesis. and provides novel insights into the molecular control of mouse mesoderm and PNS develo pment. Acknowledgments

I thank everyone who have encouraged and helped me during the course toward to my Ph. D.

My first debt is to the codttee members, Drs. Manuel Buchwald. Joe Culotti and Rod Mches, for their very helpful advice.

I thank Drs. Manuel Buchwald and Rod Mchess for their patient guidance. 1 am most grateful to Dr. Manuel Buchwald for his invaluable support, which has allowed me to finish this work.

1 owe a tremendous debt to my former supervisor, Dr. Martin L. Breitman. who sadly passed away when I initiated this work for the encouragement he was always willing to offer, even when he was suffering from the terminal illness of cancer.

1 thank ail members in the Buchwald and the McIness laboratones for their kindness, especially Zhan Lu, Jeff Lighâoot, Rob Cumming, Jasmine Wang, Linda

Parker, Geoff Clarke, and Lynda Ploder for their help. To the rnembers of the

Department of Genetics and the Program of Developmental Biology at the Hospital For

Sick Children, thanks for making this enviroment an exciting and fi-iendly place for science. 1 would especially like to thank Peny Howard, Michael Crackower. Ting-Chung

Suen, Pamela Hoodless, Jeff Wrana, and Ching-Chung Hui for their stimulating discussions and help.

Finally, 1 would like to thank al1 my family members, especially my wife and my parents for their love and enonnous support. Table of Contents

Abstract of Thesis ...... 1

Acknowledgments ...... III

Table of Contents ...... IV

List of Tables ...... -1X

List of Figures ...... IX

Chapter 1. Introduction ...... 1

1.1. Gastdation of the mouse embryo ...... 2

1.1.1. An overview ...... 2

1.1.2. Proliferation and movement of the epiblast cells ...... 4

1.1.3. Formation of the mouse mesodenn: embryonic and cellular aspects ...... 9

1.1.4. Molecular aspects ofmouse mesoderm development ...... 11

1.1.4.1. Inductive signais for mesoderm formation...... 11

1.1.4.2. The function of transcription factors during mouse

mesoderm development...... -16

1.2. Development of the mouse peripheral nervous system (PNS) ...... 18

1.2.1. Embryological and molecular aspects of the neural crest ongin ...... 18

1.2.2. Embryological and molecular aspects of mouse PNS development ...... -23

1.3. Regdation of the function of homeobox genes during developrnent ...... 32

1 .3.1 .The role of homeobox genes in development...... 32

1.3.2 . Regdation of the hinction of homeobox genes ...... -32 1.3.2.1 .Regulation of developmental expression of homeo box genes ...... 32

1.3.2.2. Regulation of the biologicai fhction of homeobox genes by mRNA

localization and translation ...... -37

1.3.2.3. Regdation of the biological activity of homeodomain proteins ...... -39

1.4. HOXl 1 and TLc homeobox-containing genes ...... 42

1.5 . Objectives of this midy ...... -44

1 .6 . References...... 45

Chapter 2. Regulation of mammalian mesoderm development

by a BMPlTix-2 signailhg pathway ...... 65

2.1. Absmct ...... -66

2.2. Introduction ...... 67

2.3. Materials and methods ...... -69

2.4. Results...... 71

2.4.1. Identification and early expression of 2%-2 ...... 71

2.4.2. Activation of Tl'-2 expression by BMP signalhg ...... 74

2.4.3. The TlX-2 targeted mutation causes early embryonic lethality ...... 80

2.4.4. Phenotypic effects of the TLr-2 mutation in the primitive streak,

mesodem and ectoderm of the homozygous embryo ...... 87

2.5. Discussion ...... -93

2.5.1. TLx-2 is a direct target gene for BMP signalling ...... 93

2.5.2. 77x-2 fiuictions as a mediator of BMP signalhg in primitive streak and mesoderm development ...... 95

2.6. References ...... -98

Chapter 3. TLX-2: a homeodomain transcription repressor that is expressed

in developing PNS and functions as a negative regulator for neuronal

differentiation...... -103

3.1. Abstract ...... 104

3 .2. Introduction ...... -105

3.3. Materials and methods ...... -106

3.4. Results...... 109

3 .4.1. 12r-2 expression in the prospective neural plate ridge of mouse embryo ...... 112

3.4.2. Developmental expression of Tlx-2 in mouse PNS ganglia...... -112

3.4.3. NGF-regulated TLr-2 expression in PC 12 cells...... 127

3.4.4. Overexpression of TLx-2 in PC 12 cells suppresses neuronal

differentiation induced by NGF ...... -121

3.4.5. TLX-2 is a transcription repressor in cultured cells ...... 121

3 .5 . Discussion...... -125

3 .6 . References...... -129

Chapter 4. Modulation of neural development by the interaction of TLX-2

homeodomain and 14-3-3 signalling protein...... -133

4.1 . Abstract ...... *...... 1 34 4.2. Introduction...... 135

4.3. Materials and methods ...... 136

4.4. Results...... 142

4.4.1. Interaction clonllig of the mouse 14-3-3 q gene ...... 142

4.4.2. Interaction of the TL, X.2 and 14-3-3 q proteins in vino and in vivo ...... 147

4.4.3. The enhancement of TLX-2nuclear localization by 14-3-3 q ...... 147

4.4.4. The overlapped expression patterns of 14-3-3 q and Tuc-2 in

the developing mouse PNS ...... 150

4.4.5. Co-expression of TLr-2 and 14-3-3 q in PC 12 cells ...... -153

4.4.6. Synergetic suppression of the neuite outgrowth of PC 12 cells

by TLX-2 and 14-3 -3 q ...... 153

4.5. Discussion ...... 158

4.6. References ...... 162

Chapter 5. Conclusions and future perspectives ...... 166

5.1. The function of 7ïx-2 in mouse gastnilation ...... 167

5.1.1. A summary of the TLr-2 function during mouse mesoderm development:

the phenotypes of 77k-2 mutant embryos...... 167

5.1.2. The cellular basis of rnesodem and streak phenotypes

in the mutant embryo ...... 168

5.1.3. The molecular basis for the mesoderm and streak phenotypes

in mutant embryos ...... -170 5 . 2. The function of TLx-2 during mouse PNS developrnent ...... -171

5.2.1. The role of 77i-2 in neural crest and PNS development ...... -171

5.2.2. The possible role of Tuc-2 in segregation of the prospective

neural crest cells ...... -172

5.2.3. nx-2 function in PNS development: Ni vivo approaches ...... 173

5.2.4. Tu.-2 is an ideal molecular marker for the study of PNS development:

a Lac2 transgenic mouse ...... -174

5.2.5. The human homologue of Th-2: a potential disease gene? ...... -175

5.3. Regdation of TLr-2 fiuiction by BMP signais...... 175

5.3.1. The BMPlTlx-2 pathway in mammalian mesoderm development:

implications ...... 175

5.3.2. A possible BMPTnx-2 pathway in PNS and neural crest development ...... 177

5-3.3. Identification of the transcription factor mediating the response

of 27x-2 to BMP signais...... -178

5.4. Regdation of the TLX-2 fhction by 14-3-3 proteins ...... -179

5.4.1. Interaction between TLX-2 and 14-3-3 proteins: a new perspective for

regulation of homeodomain proteins ...... 179

5-42Interaction between horneodornain and 14-3-3 proteins: a general theme? .....-179

5.4.3. Is TLX-2 coupled to specific cell signalhg pathways by 14-3-3 proteins? ..... 180

5.5. References ...... 182 List of Tables

Table 2-1: BMP2 induction of 7Ik-2 expression in in vitro cuihued E6.5 embryos...... 77

Table 2-2: Genotypes of oEspring from Tlx-2 heterozygote matings...... 83

Table 2-3: Genotypes of embryos fiom TLr-2 heterozygote matings...... 86

Table 4-1 : Cornparison of the neurite growth of PC 12 cells transfected with TIx.2. 14-3-3 q. or Tlx-2 + 14-3-3 q ...... -154

List of Figures

Figure 2- 1: The expression pattern of TL*-2 in the early mouse embryo ...... 72

Figure 2-2: Activation of 77k-2 expression by BMP.2 ...... -75

Figure 2-3: The targeted mutation of TLx-2 ...... 81

Figure 2-4: Phenotypes of the whole mount mutant embryos...... -84

Figure 2-5: Histological analysis of the mutant embryos...... -88

Figure 2-6: In situ analyses of the molecular markers for the primitive streak and mesodenn...... -91

Figure 3-1 : Progressive restriction of 7lx-2 expression in the prospective neural plate border of the mouse ernbryo...... IO

Figure 3-2: Spatial and temporal expression of Th-2 gene in the developing PNS .....113

Figure 3-3: Histological analysis of Tb-2 expression in the PNS ...... -116

Figure 3-4: Tk-2 is a neuronal differentiation suppressor in PC 12 cells...... -119

Figure 3-5: TLX-2 is a transcription repressor...... -173

Figure 4- 1 : The mouse 14-3-3 q cDNA ...... 143

Figure 4-2: In Viîro and In Vivo interaction of TLX-2 and 14-3 -3 q proteins ...... -145

Figure 4-3: Enhancement of the nuclear accumulaiion of TLX-2 by CO-transfection Figure 4-4: Overlapping expression of 14-3-3 r) and 7k-2 in the developing moue PNS...... -151

Figure 4-5: Synergestic suppression of neurite outgrowth of PC 12 celis by TLX-2 and 14-3-3 q ...... 1 55 Chapter 1

Introduction The discovery of homeobox containhg genes, initidy in Drosophila in 1984 and

later in many other species, has had a profound effect on the snidy of developmentai

biology. It has been widely recognized that they make up a major family of

I developmentai regdatory genes. in 1991, a member of this gene farnily, HOXI 1. was

identified as a T ce11 leukemia oncogene, suggesting a putative role of homeobox genes in

malignant transformation. This finding raised the question as to the normal function of

HOXI1 during mammalian development This study was initiated to characterize the

function of llx-2, one of the murine HOXll related genes. As presented Iater in this

thesis, Tlx-2 is involved in multiple developmental processes during mouse

embryogenesis. This Chapter presents an introduction to issues relevant to the

subsequent analyses of 77~-2function.

1.1. Gastrulation of the mouse embryo

1.1.1. An ove~ew

Gastmlation is an evolutionarily conserved developrnental process found in many

metazoan anirnals during their early ontogenesis. During this period, the embryo

undergoes dramatic structural changes, mainly resulting fiom extensive ce11 movement

and reorganization. As a result, the embryo becomes trilaminar with three germ layers -

ectoderm, mesodemi and endoderm. In addition, the basic body plan is laid down during

gastnilation, and many cells acquire positional information and become determined in

their developmental fate. Therefore, gastnilation is one of the most important early

developmental processes. The importance of this developmental event may be sensed fiom Lewis Wolpert7s famous statement that ' it is not birth, marriage or deaîh but

gastdation that is ûuiy the most important time in your life' (Stem and Ingham. 1992).

Mouse embryos begins to gastnilate at 6.5-6.75 days post coitum (d.p.c.). Before

this stage, the mouse embryo forms a cylinder structure consisting of an epiblast layer

and a primitive endoderm layer. As gastruiation begins, the epiblast at the posterior end

thickens and some of the epiblast cells migrate undemeath the ectoderm and forrn a

mesoderm layer. This rnesoderm-producing region is referred to the primitive streak. In

addition to mesoderm generation, cells fiom the primitive streak also contribute to the

formation of the definitive endoderm layer, fiom which the gut is derived. The primitive streak extends antenorly as development proceeds and reaches its full length at 7.5 d.p.c.

(E7.5) when the anterior end of the primitive streak reaches the distal region of the embryonic cylinder. By E7.5, a trilarninar embryo is fomed that consists of two epithelia, the ectoderm and the endoderm, and a mesenchpal layer of mesoderm. Afier the definite streak stage, the primitive streak begins to retreat in an antenor-postenor sequence, and by E9.0 it is no longer apparent in the embryo (Snell and Stevens. 1966:

Hogan, B. et al., 1994).

Fate mapping studies have led to insights about the cellular basis of mouse gastrulation. The embryonic ectoderm is the sole source of al1 definitive tissues in the mouse fetus as well as the extraernbryonic arnnion, yolk sac mesoderm, and allantois

(Beddington, 1981, 1982, 1983; Tarn, 1984). During gastrulation, the ingression of the embryonic ectodemal cells through the primitive streak, followed by the assortment and organization of the prospective mesodermd and endodemal cells, are the cellular events responsible for the formation of mesodemal and endodermal germ layers (Bellairs, 1986). The ce11 population remaining in the embryonic ectodem differentiates into the

defuitive ectodem. To generate the three definitive germ layers, the epiblast cells must

undergo active ce11 proliferation and extensive movements.

1. 1.2. Proliferation and movement of the epiblast ceUs

The rapid cell proliferation in the ectodem of gastnilating embryos is essential to

build up the ce11 population so as to sustain the continuous ce11 allocation to the definitive

germ layers. Snow (1977) estunated the speed of ce11 proliferation in early mouse

embryos and found that there is a 4.5 to 5 fold increase in the ce11 nurnber between 5.5

and 6.5 d. p. c. and about 21-fold increase between 6.5 and 7.5 d. p. c. Since the

mesoderm and the endoderm of the egg cylinder are made up of slowly dividing ce11

populations, the increase in the cell number of the embryo must be attributed to the

actively proliferating embryonic ectoderm. The epiblast ce11 cycle tirne is estimated at

4.8, 7.2, and 8.1 hours in the embryos of 6.5, 7.0, and 7.5 d. p. c.. respectively (Snow.

1977). To account for the more rapid increase in ce11 number at the beginning of gastnilation, Snow (1977) also suggested a proliferating zone in the embryonic ectoderm, where the cells must divide every 3-35 hours. Subsequent studies have confimieci the rapid ce11 proliferation in the embryonic ectoderm (Poelmann, 1980; Lawson et al.. 199 1 ), but the suggested proliferating zone has not been located yet. An analysis of the ceIl cycle kinetics of epiblast cells revealed that the G1 phase is extremely bnef and most of the ce11 cycle (over 55%) is spent at the S phase (Snow, 1977). In addition to generating cells for allocation, the rapid ce11 proliferation may also be necessary for providing the force to drive the ce11 movements during germ layer formation. For example. mouse embryos that have suffered a ciramatic loss of cells due to mitomycin-induced ce11 death postpone gastnilation until compensatory proliferation occurs in the embryonic ectoderm

(Snow and Tarn, 1979; Snow et al., 198 1; Tarn, 1988). Reducing ce11 nurnber by surgical means in pre-implantation embryos also resdted in a delay in gasmilation until at least

1,400- 1,500 cells were present in the embryonic ectoderm. This delay occurred despite an active proliferation in the embryonic ectoderm (Power and Tarn, 1993). These observations suggested that the omet of mouse gastnilation requires that ectoderrnal cells reach a threshold number and that ce11 proliferation alone is in~~cientto initiate or sustain gastdation.

Ce11 movements during gastnilation are remarkably organized with reference to the location of the primitive streak. For example, the cells in the ernbryonic ectoderm converge posteriorly into the primitive streak, but mesodemial cells leaving the primitive streak must reverse their direction of movement and spread anteriorly to cover the basal surface of the embryonic ectoderm. Analyses of the distribution of cells in chimeric embryos revealed that there is extensive intemiingling of cells in the embryonic ectoderm

(Beddington et al., 1990). Ce11 mWng as such appears to be incompatible with any definitive cornmitment of ce11 fate before gastmiation. However, studies on ce11 fate. by tracking the developmental fate of single ce11 clones, have reveaied a distinct segregation and regionaiization of ce11 populations in the embryonic ectodem of the pre-primitive streak and early primitive streak embryos (Lawson et al., 1991; Lawson and Pedersen,

1992). For example, groups of cells which are predisposed to form specific extraembryonic and ernbryonic structures are queued according to their cranio-caudal destinations in the future embryo and in order of their ingression though the primitive streak. Departure of cells fiom the embryonic ectodem occurs mainly through the

primitive streak, where the ectodermal cells lose their basement membrane. change shape,

and ingress to form a loosely organized mesenchyme (Solursh and Revel, 1978: Revel

and Solursh, 1978; Tarn and Meier, 1982). In situ rnarking experiments to track ce11

displacernent have showed that embryonic ectodemal cells are continuously recruited

into the primitive streak and celis originating from one side of the egg cylinder are

deployed to both sides of the embryonic axis, indicating that a random assortment of celis

occurs within the primitive streak (Tarn and Beddington, 1987; Lawson et al.. 199 1).

Clues regarding the cellular basis of the morphogenetic movement of cells during

gdationwere obtained by shidying the dtrastnicturai features of cells in or out of the

primitive streak. Ectodermal cells outside the primitive streak are columnar in shape.

contact each other by rnicroviili and filopodia-like structures, and are packed tightly into

an epithelium. In contrast, cells in the primitive streak elongate to a bonle shape. with a

broad base directed towards the endoderm and an apical comection with other

ectodermal cells through tight junctions. Cells that locate deeper in the primitive streak

eventually lose the apical process and become sphericai in shape. The basai part of the

bottie ce11 is relatively fiee of microvilli, but extensive clusters of filopodia are found. protmding from the ingressing ce11 towards the primitive endoderm (Hashimoto and

Nakatsuji, 1989). Once the cells detach from the epithelium, they round up. extend cell processes, and then migrate away from the primitive streak. On the bais of cellular morphology, it seems that embryonic ectodemal cells ingress through the primitive streak in several steps involving cell extension, anchoring to other ingressing ceils and the primitive endoderm, withdrawing apical connections, and moving into a deeper position.

Little is lmown about the molecular basis for the initiation of ce11 ingression. One possibility is a change in ce11 adhesivity. The direct involvement of severai ceil adhesion molecules in the gasaulation of vertebrate embryos have recently been assessed. In mouse embryos, cells in the primitive streak express cadherins that are specific to mesoderm and endoderm but not to ectoderm (Takeichi, 1988). A targeted mutation created in the N-cadherin results in malformations in somites, including reduced size. irregular shape and iess cohesion (Radice et al., 1997). These phenotypes may reflect an early defect in mesoderm patterning and differentiation during gastrulation. Expression of dominant-negative forms of C-cadherin and XBRT-cadherin in Xenopus embryos disrupts the gasû-uiation movement of the prospective mesoderm (Lee and Gurnbiner

1995; Kuhl et al. 1996). Furtherrnore, disruption of p-catenin, an intracellular protein binding to the cytoplasrnic domain of Etadherin and likely transducing its signal. leads to developmental anest during mouse gastnilation. No mesoderm formation is observed in the mutant embryos, and the ectodermal cells appear to detach from the epiblast and disperse into the proamniotic cavity (Haegel et al. 1995). Other ce11 adhesion molecules that are likely involved in mesoderm development include pl integrin, fibronectin and focal adhesion kinase (FAK). Mice with a pl integrin targeted mutation have a defect in embryonic endoderm morphogenesis that affects mesoderm formation (Fassler and

Meyer 1995; Stephens et al. 1995). Mutations in fibronectin and FAK genes cause incomplete mesoderm formation because of their ef5ects on cell adhesion and motility

(Ilic et al. 1995; George et al. 1993).

Initiation of ce11 ingression may also be induced by morphogenetic facton. For

example, growth factors such as fibroblast growth facton (FGF) and transforming growih

factors (TGF), which are known to induce mesoderm formation in amphibian embryos

(New et al., 1991), have been shown to cause locdized ce11 movement in the chick

blastoderm sirnilar to that of gastnilation (Mitrani et al., 1990% b; Mitrani and Shirnoni,

1990; Cooke and Wong, 199 1). In support of this notion, members of FGF gene family,

including Fgf3 (Wm-t), Fgf4, and Fgf-5 are expressed in the primitive streak of

gasrnilating mouse embryos (Wilkinson et al., 1988; Niswander and Martin, 1992; Haub

and Goldfarb, 199 1; Hebert et al., 199 1). Retinoid binding proteins and receptors are also

expressed in the primitive streak of mouse embryos 8.0 d. p. c., and it has been suggested

that retinoids, which may act as morphogens in other embryonic tissues such as Iimb bud,

may also be involved in gastdation (Ruberte et al., 199 1). The involvement of transcription factors in gastdation is exemplified by Brachyury (T), which appears to be required for mesodemai ce11 movement (see below). Multiple other transcription factors, including homeodomain and zinc fmger proteins such as Evx-l and Sno, are expressed in the primitive streak region (e. g. Murphy and Hill, 1991; Frohrnan et al.. 1990;

Wilkinson, et al., 1989; Gaunt, 1988; Dush and Martin, 1992; Blum et al.. 1992;

Hemnann, 1991; Nieto et al., 1992). However, the role of most of these genes in gastrulation remains to be determined. 1. 1.3. Formation of the mouse mesoderm: embryonic and cellular aspects

One of the most informative findings of fate mapping çtudies is that the precursors for different mesodemal cells are regionalized in the embryonic ectoderm before and during gastnilation. For example, when gasmilation begins, the precursors of the extraembryonic mesodenn are initiaily locdized in the posterior and lateral regions, while those for the embryonic mesoderm are found in al1 areas except the distal region of the embryonic ectoderm (Lawson and Pedersen, 1992). During gastmlation, cells destined for the extraembryonic (amnion and yolk sac) mesoderm and the craniofacial regions of the embryo are located nearest to the primitive streak and are the first to delaminate From the primitive streak (Tarn and Beddington, 1992). By contrast, the precurson for paraxial and lateral mesodenn which are destined for more caudal body parts pass through the primitive streak at a later stage (Tarn and Beddington, 1987; Tarn and Tan, 1992). Ce11 labeling experiments showed that cells at the postenor part of the primitive streak in the neural stage embryo are denved fiom the extreme anterior axial and paraxial epiblast progenitors in the earlier embryo (Lawson et ai., 1991). In addition. results of clona1 analyses suggested that allocation of cells to any specific mesodermal lineage is tightly regulated by the temporal order in which cells are recruited into or pass through the primitive streak (Lawson and Pedersen, 1992; Tmand Beddington, 1 987). The temporal order, on the other hand, is in part influenced by the position of the cell relative to the primitive streak.

Mesodemal cells leaving the primitive streak are initidly stacked up in multiple layers , and then gradually thin out towards the anterior region of the embryo and form a mesodemai ce11 sheet, which eventually covers embryonic ectoderm and primitive endoderm daces (Tm et al., 1993). Cell population kinetics studies have suggested that the mesodenn is a slowly dividing tissue and that the increase in the mesodermal population could be accounted for mainly by the continuous recniitment of cellç fiom the rapidly proliferating embryonic ectoderm (Snow, 1977; Poelmann, 1989).

Morphologically, the mesodermal cells are large stellate-shaped cells exhibithg many filopodia that make contacts with adjacent mesodemial cells as well as with basal laminae of the ernbryonic ectoderm and underlying endoderm. SEM examination reveals remarkable differences in the mesodermal cells at different regions. For example. the mesodemai cells leaving the primitive streak and those at the leading edge of the mesodermal ce11 sheet display feahires of migratory cells, extending many filopodia to the basal lamina or to the extracellular matrix undemeath the embryonic ectoderm (Tm et al., 1993). Cells facing the embryonic ectoderm typically have a Bat contour for maximal contact with the basal lamina and extend shon filopodia to adjacent cells. while cells facing the endoderm are much more loosely packed and send out nurnerous siender filopodia to neighbouring cells and to the underlying endoderm (Tarn et al., 1993).

Informative data on ce11 migration in the mesoderm have been collected by direct observation of ce11 movement. Nakatsuji et al (1986) performed time lapse studies on cultured embryos to examine mesodemal cell movement at different stages of gastrulatiion. They showed that in early primitive streak stage embryos mesodermal cells migrated as individuals. By mid-primitive streak stage, however, when a complete mesodermal layer is already established and there is not much space for migration, cells begin to move slowly and, instead of moving individually, become increasingly anached to adjacent mesodemal cells. In spite of inovement, the mesodemai cells start to be organized into

characteristic patterns during gastrulation. SEM examination of the mesoderm of the

primitive streak stage embryos revealed a pattern of circdar domains of mesodermal

cells, narned somitomeres (Tarn et al., 1993). The organhtion of mesodermal cells into

somitomeres argues for the lack of extensive ce11 intermingling and is compatible with

the notion that mesodemal cells after mid-primitive streak stage are rnaintained in a

cohesive sheet with a relatively stable neighbour relationship. Somitomeres formed during gastdation are the forerumers of the metamenc segments in cranial mesenchyme of the nedating embryos (Meier and Tarn, 1982).

1. 1.4. Molecular aspects of mouse mesoderm development

1. 1.4. 1. Inductive signals for mesoderm formation

According to the theory of rnesodermal induction fmt proposed by Nieuwkoop and Ogi (Stern and Ingham, 1992), the embryonic ectoderm cells must first receive inductive signals to initiate gastrulation and mesoderm formation. This developmental phenornena has been most extensively studied in Xenopus embryos, but sirnilar events are believed to occur in other vertebrates.

Similar to the pre-primitive streak mouse embtyo, the Xenopus ernbryo at early cleavage stages can also be considered to consist of two ceil types: the prospective ectoderrnai ce11 in the animal hemisphere and the prospective endodermal ce11 in the vegetal haif of the embryo (Smith, 1989). As development proceeds, die equatorial region (marginal zone) between the animal and vegetal hemispheres forms mesoderm. It was proposed that mesoderm formation is the result of an ernbryonic induction, in which signals fiom the vegetai hernisphere induce the formation of mesoderm at the equatorial

region. This induction can be demonstrated by tissue jwtaposing experiments with

tissues from the animal and vegetal hemispheres. If cultured alone, the animal pole tissue

foms epidermis. However, if the animal pole is cultured in juxtaposition with a piece of

vegetal tissue, some of the ectodemal cells are induced to form mesodermal ce11 types

such as muscle, notochord and blood. This kind of classical embryology experiment

clearly demonstrates that the prospective endodermal cells at the vegetd hemisphere emit

signals that cminduce the prospective ectodermal cells to form mesoderm.

The question then becomes: what are the inductive signals? Several growth

factors stand out as candidates for the rnesoderm inducing signals in Xenopus embryos.

One of these is fibroblast growth factor (FGF). Kimelman and Kirschner (1987) and

Slack et ai. (1987) were among the fmt to show that FGF possesses mesoderm-inducing activity. Work carried out subsequently has demonstrated that FGF can induce ventral mesodermal tissue such as mesenchyme and mesothelium (Green et al.. 1990).

Consistent with this, expression studies showed that both bFGF mRNA and protein are present in early Xenopus embryos (Kimelman and Kirschner, 1987; Kimelman et al..

1988; Slack and Isaacs, 1989), and immunocytochemicai analyses revealed that aFGF and bFGF proteins are present in the marginal zone and vegetal pole during cleavage and blastula stages (Shiurba et ai., 1991). However, since both aFGF and bFGF lack a signal sequence and are therefore not efficiently secreted fiom cells, it is unlikely that either aFGF or bFGF is an endogenous mesodem-inducing factor. This problem appears to have been solved, at least in part, by a later finding that an another member of FGF family, named ernbryonic FGF (eFGF), is expressed in the blastula stage. Uniike aFGF and bFGF, eFGF has a signal sequence (Isaacs et al., 1992), and therefore is a strong

candidate as an endogenous mesodenn-inducing factor. More convincing evidence that

FGF plays roles in normal rnesoderm development cornes fiom dominant-negative

experiments. Overexpression of a truncated form of the FGF receptor, in which the

tyrosine kinase domain is deleted, resdts in the formation of embryos with mesoderm

abnormalities, including defects in notochord somites and ventral mesoderm (Amaya et

al., 1991; Amaya et al., 1993).

Another factor with a powerful mesoderm-inducing activity i s activin (Asashima

et ai., 1990; Smith et al., 199Oa; Albano et al., 1990; Sokol et al., 1990; Thomsen et al.,

1990), a member of TGF-J3superfamily. Al1 three types of activin, activin A, activin AB.

and activin B, have similar mesoderm-inducing abilities (Nakamura et al., 1992). Unlike

FGF which induces ventrai mesoderm, high concentrations of activin induce dorsal and

axial mesoderm such as notochord and muscle (Green et al., 1990). In support of a role

for activin in normal mesodem development, overexpression of a dominant-negative

form of the activin receptor in which the serinelthreonuie kinase domain is deleted results

in the formation of embryos that cornpletely Iack mesodem (Hemmati-Brivanlou and

Melton, 1992).

Bone morphogenetic protein 4 (BMP-4) is another rnember of the TGF-P family

that is closely related to Drosophila decapentaplegic, Xenopus Vg 1, and BMP-2 (Padgett

et ai., 1987; Weeks and Melton, 1987; Wozney et al., 1988; Lyons et al.. 1989). In contrast with activin, BMP-4 induces posterior/ventral rnesoderm (Koster et al.. 1991;

Dale et al., 1992; Jones et al., 1992). In addition, the effect of BMP-4 counteracts the effect of activin, so that treatment of animal caps sirnultaneously with activin and BMP-4

results in the formation of ventrai mesoderm (Dale et al., 1992; Jones et al.. 1992). This

result suggests that one role of BMP-4 in vivo is to modulate the effects of activin.

Dominant-negative experiments using the tnincated BMP type 1 receptor. in which the

kinase domain was deleted, supported a role of BMP-4in rnesoderrn development (Graff

et al., 1994; Suzuki et al., 1994). Expression of the tnincated receptor in the explant of

the prospective ventral mesoderm changed their fate fiom blood and mesenchyme to

dorsal mesoderm, resulting in differentiation of a large amount of muscle and. often.

notochord (Graff et al., 1994; Maeno et al., 1994). The effect of the tnincated receptor

could be overcome by injecting excess mRNA for wild-type receptor (Graff et al.. 1994).

These observations suggest a requirement for an active BMP-Iike signai for the

production of ventral mesodem.

Other factors have also been identified that can induce mesoderm or affect

mesoderm development in Xenopus embryos. These include members of the Wnt family

(McMahon and Moon, 1989; Smith and Harland 199 1; Sokol et al, 1991) and noggin

(Smith and Hadand, 1992; Smith et ai., 1993). The desof these factors in mesoderm

development have been reviewed by Smith (1993).

Far less is known about potential mesoderm indiicers in other vertebrate species.

The role of the factors homologous to the Xenopus mesoderm inductive signalling

components has begun to be assessed in mouse through expression studies and gene targeting experiments. Several members of the FGF farnily are expressed in early rnouse embryos (Niswander and Martin, 1992): Fd-3 RNA is expressed at highest levels in mesodemal cells as they leave the primitive streak and migrate laterally; Fgf-4 transcripts are detected in cells around the primitive streak; and Fgf-j RNA is expressed

in the posterior part of the primitive streak. In support of a role of FGF signalling in

mouse mesoderm development, a targeted mutation in one of the recepton (fj-1) for

FGFs causes mesodermal defects (Deng et at., 1994; Yamaguchi et al., 1994). The

mutant embryo can form mesoderm and the nascent mesoderm can differentiate into

diverse mesodemai subtypes, but mesodemal patteming is aberrant. The mesodermal

cells appear to accumulate in the primitive streak, particularly in the posterior region

(Yamaguchi et al., 1994). FGFR-1 was also suggested to play an essential role in ce11

proliferation during mouse gastrulation (Deng et al., 1994).

BMP-4 is expressed in the posterior primitive streak of mouse embryos,

suggesting a role of this factor in mesoderm formation and gastrulation (Winnier et al..

1995). Consistent with this notion, a targeted mutation of BMP-4 results in defects in

mesoderm and primitive streak formation (Winnier et al., 1995). Most BMP-4 mutant embryos do not proceed beyond the egg cylinder stage and show little or no mesodermal differentiation. Those that do develop to later stages display disorganized or truncated posterior structures and a reduction in extraembryonic mesoderm. including blood islands. A targeted mutation in BMP type I receptor causes a more severe phenotype

(Mishina et al., 1995). The mutant embryos do not form any mesoderm, probably due to the reduction of the ce11 proliferation in the epiblast (Mishina et al., 1995). Together. these studies indicate evolutionary conservation of the molecular mechanism of mesoderm induction initially characterized in Xenopus embryos. 1. 1. 4. 2. The function of transcription factors during mouse mesoderm

development

Transcription factors are another class of molecules that presumably play

important roles in gastnilation and mesodenn formation. Multiple homeobox containing genes are expressed in the epiblast, the primitive streak, and/or the nascent mesoderm.

These Uiclude Hox Al (Murphy and Hill, 1991; Sundin et al., 1WO), Hox BI (Murphy and Hill, 199 1; Frohman et al., 1990; Wilkinson et d., I989), Hox A3 (Gaunt et ai.. 1986;

Gaunt, 1987; Gaunt, 1988), Hox C8 (Gaunt, 1988), Hox BI (Wibson et al., 1989). Hox

B3 (Wilkinson et al., 1989), HUx A7 (Puschel et al., 199I), Evx-I (Bastian and Gruss.

1990; Dush and Martin, I 992), Goosecoid (Cho et al., 1991 ; Blum et al., 1W2), and Cdr-

I (Meyer and Gms, 1993). However, the role of most of these genes in gastnilation and mesoderm formation is largeiy not known. Targeted mutations created in some of these genes either have failed to cause obvious defects in gastnilation or have resulted in embryonic death prior to gastnilation (Copp, 1995). For example, it was expected that

Goosecoid would play a crucial role in gastrulation, as it is specifically expressed in the primitive streak and the node of the rnouse embryo and the Xenopus Goosecoid mRNA cm induce the formation of twinned body axes when injected into the ventral side of the

Xenopus embryo ((De Robertis et al., 1992). However, a targeted mutation in Goosecoid did not cause any defects in gastrulation (Yamadaet ai., 1995). While these results suggest that Goosecoid does not play a role in gasaulation, it is possible that there is a

Goosecoid-like activity in the mutant embryo to compensate the loss of Goosecoid. In addition, the potential role of Evx-1 in gastrulation suggested by its expression in the posterior primitive streak mesoderm has not been proven directly, since a targeted mutation of Evx-l resulted in early postimplantation lethality (Spyropoulos and Capecchi.

1994).

One of the most extensively studied mutations afEecting mouse gastrulation and

mesodem formation is Brochyu>y (7') (Beddington et al., 1992). Recent work has show

that Brachyury is a DNA binding transcription activator. In mouse, the expression of

Brachyury is first detected in the primitive streak at the onset of gastnilation. Expression

continues in the primitive streak throughout gastdation and cm be detected in ectodenn

adjacent to the streak and nascent mesoderm underlying the streak (Herrmann. 1992).

However, expression in the mesoderm disappears as mesodemal cells move away from

the streak and assume their lateral, paraxial or extraembryonic positions. At a later stage

(E8.5)only the head process and notochord continue to express high levels of Brachyury.

A natural mutation of Brachyury causes an embryonic lethality of the homozygotes around 10.5 d.p.c., and the homozygous embryos have distinct caudal abnormalities. The allantois fails to extend and, consequently, the embryo fails to form a placental co~ectionand is deprived of adequate nutritive supply. Somites posterior to the seventh pair of sornites are absent or abnomal. The central features of Erachyury homozygous mutant embryos are the apparent absence of a notochord and profound thickening of the primitive streak (Beddington et al., 1992). At an early stage, the mutation causes defects that include a severe disturbance of the primitive streak and an early cessation of mesoderm formation. In the heteroygote, the tail is short and often kinked. The notochord in the caudal region is abnormal during embryonic development. Therefore, the Brachyury gene has a key role in mesoderm formation during gastrulation in the mouse. Recent work suggests that the Brachywy gene is required for normal mesodemal

morphogenetic ce11 movement during gastnilation (Wilson et al., 1995).

HNF3P is a member of the winged-helix transcription factor family. During

gastruiation, HNF-3p is expressed in the node and notochord. A targeted mutation of this

gene resulted in the mutant embryo without the node and notochord. These results

demonstrated an esseniid role of HNF-3,û in the development of axial rnesoderm in

mouse embryos (Ang and Rossant, 1994; Weinstein et al., 1994).

1.2. Development of the mouse periphernl nervous system (PNS)

1.2.1. Embryological and molecular aspects of the neural crest origin

The peripheral nervous system is mainly denved fiom the neural crest, although the ectodermal placodes contribute to some of the cranid PNS components (Le Douarin.

1982). Much of the classical embryological work on the development of the vertebrate neural and PNS have been carried out on the chick embryo, but the results are largely applicable to the mouse.

The neural crest is a group of cells derived fiom the dorsal part of the neural tube, that rnigrate to many peripheral sites and evenhially give rise to a variety of ce11 types.

The terminal derivatives of the neural crest include the peripheral ganglia (cranial, sensory, sympathetic and parasympathetic ganglia), adrenomedullary cells, rnelanocytes and connective tissue of the face (Le Douarin, 1982). Classically, neural crest precunoe have been thought to be a segregated population in the gastnilating andor neunilating embryos. Fate mapping experiments suggest that the prospective neural crest cells are located between the prospective epidermis and the neural plate in gastdating/neunilating embryos. As neundation proceeds, the group of cells are located in neural folds and fmally in the dorsal neural tube when the tube is closed (Bromer-Fraser, 1995). Some recent fïndings add important insights regarding the fate determination of the neural crest cells. One observation is the muitipotency of the neural crest cells before or during migration. By labeling premigratory single neural crest cek with vital dye, Bramer-

Fraser and Fraser (1988; 1989) found that a single neural crest ce11 at the dorsal neural tube can contribute to divergent neural crest derivatives such as pigment cells. sensory and sympathetic neurons. Even der emigration from the neural tube. many migrating neural crest cells can still give rise to multiple phenotypes (Fraser and Bronner-Fraser,

1991). Therefore, environmental factors rnay play an essential role to determine the final fate of neural crest cells (Stemple and Anderson, 1992). The fmding that neural crest cells are multipotent is also consistent with in vitro studies that dernonstrate that multiple ce11 types can be denved fkom cultured neural crest cells (Sieber-Blum and Cohen. 1980:

Stemple and Anderson, 1992). These results, however, do not preclude the possibility of a partial restriction of the ce11 hte occurring for some specific neural crest cells before emigration. In fact, there are notable differences in the developmentai potential of the neural crest cells originating from the cranid region and those from the tnink region. For exarnple, the cranial neural crest cells can give rise to cartilage, while the tnink crest cells cannot, even after being grafled to the cranial region (Le Douarin, 1982).

Further experiments showed that not only cm single cells in the dorsal neural tube form multiple neural crest denvatives, but they often contribute to ce11 types in the dorsal neural tube, including roof plate cells and commissural neurons (Artinger et al., 1995). This result suggests a common lineage for neural crest and dorsal neural tube cell types.

On the other hand experiments with surgical ablation of the neurai fold or the dorsal

neural tube demonstrated that the ventral part of the neural plate or the neural tube can

also give rise to neural crest cells. This result indicates a developmentd potential of the

ventrai neural platehbe for neural crest differentiation (Schenon et al.. 1993). Together.

these data argue that the premigratory neural crest cells are not completely segregated in

the neural tube.

The characteristic location of the prospective neural crea at the junction between

the neural plate and prospective epidemiis in gastruiating/neunilating embryos. as

suggested by fate mapping studies, raises the possibility that an inductive interaction

between the prospective epidermis and the neural plate may play an important role for the

initial segregation of the neural crest. Experiments of tissue juxtaposition. initially conducted in amphibian ernbryos (Rollhauser-ter-Horst, 1979; Moury and Jaco bson.

1989) and recently in chick embryos (Selleck and Bromer-Fraser, 1995; Dickinson et al.,

1993, have supported this notion. For example, Selleck and Bronner-Fraser ( 1995) showed that when the prospective epidermis or the presumptive ventral neural plate taken fiom the gastdating embryos was cultured alone, neither of them gave rise to neural crest. However, when the nedplate was juxtaposed with epidermis in ovo or in vitro. neural crest cells diflerentiated at the junction as judged by the expression of neural crest markers such as HNK-I and Slug, and by the presence of neural crest denvatives (Selleck and Bromer-Fraser, 1995; Dickinson et al., 1995).

What are the molecular signals involved in this induction? It has been speculated that an absence of the ventralizing signals released nom the notochord is necessary for generating the dorsal phenotypes of the neural tube. The forrning neural tube/spinal cord has a characteristic donoventrai polarity, with neural crest cells, roof plate cells and cornmissurai neurons fomiing dorsally and motor neurons and floor plate cells differentiating ventraily. VentraI cell types are induced by the notochord. Grafting an extra notochord laterai to the neural tube can induce an extra floor plate and motor neurons (Van Straaten et al., 1988; Yamada et al., 1991) by means of a sonic hedgehog- mediated signal (Echelard et al.. 1993; Roelink et al., 1994). The grafted notochord also suppresses the expression of some dorsal markers such as Pm 3 (Goulding et al.. 1993).

Removd of the endogenous notochord, on the other hand, leads to the expansion of Pa3 expression nonnally restricted to the dorsal half of the neural tube (Goulding et al., 1993).

These results suggest that the notochord, most likely the sonic hedgehog signals released fiom the notochord, play a crucial role in the dorsoventral patterning of the neural tube.

In this scenario, the dorsal phenotype including neural crest cells might be a result from the Iack of the ventrdizing signals from the notochord and the floor plate. However. since neural crest cells still develop adjacent to the grafted notochord, the notochord cannot suppress this dorsal phenotype (Branner-Fraser. 1995). This raises the attractive hypothesis that dorsal ceIl types, including the neural crest cells, are actively determined by dorsalizing signais. In fact, there is increasing evidence regarding the existence of such dorsalizing signals (Basler et al., 1993). As suggested by the tissue juxtaposition experiments descnbed above, one might expect that some of these signals may be released from the presumptive epiderrnis. Members of the TGF-P superfamily are among the strong candidates to play roles in the dorsal patterning of the neural tubelneural plate. Neural crest cells cm be induced in vitro by exposure of neural plate explants to dorsalin- l @SL 1), a TGF-f3-related factor

(Basler et al., 1993). DSLI is expressed in the dorsal region of the neural rube. but not in the epidemal ectoderm. However, the expression of DSLI in the neural tube appears after neural crest cells have been specified (Basler et al., 1993; Nieto et al., 1994), indicating that DSLl is not a naturd inductive signal that initiates neural crest ce11 differentiation in vivo. In contrast, BW4 and BMP7 are expressed in the epidermal ectodem flanking the neural plate (Liem et al., 1995). Furthermore, recombinant BMP4 and BMP7 mimic the activity of the epidermai ectoderm by inducing neural crest cells

(Liem et al., 1994). Therefore, BMP-related factors are likely involved in the induction of the neural crest cells.

Other factors potentially involved in the induction of neural crest include the membes of the Wnt farnily. WN-l is expressed in the extrerne dorsal portion of the spinal cord. In addition, Wnt-i is ectopically expressed in the neural tube in regions of epidermal-neural tube contact in mice with extensive overgrowth of the neural tube

(Takada et al., 1994), indicating that the contact of the neural tube and epidennis can induce the expression of Wnt-1. In support of this notion, juxtaposition of the presumptive neural plate and epidermis results in the induction of Wnt-2 and Wnr-3a

(Branner-Fraser, 1995). However, the in vivo role of these Wnt factors in neural crest formation during development remains to be defined. Transcription factors play important rotes in the ceIl fate determination in various systems. However, the transcription factors that determine the segregation of neural crest have not been identified. One would expect that such factors are expressed in the edge of neural plate. The expression pattern of the TLr-2 homeobox gene in gastnilatingheudating mouse embryos matches this expectation, and thus suggests a role of this horneodomain transcription factor in this developmental process (Chapter 3).

Slug is a zinc fmger transcription factor with a demonstrateci role in the migration of neural crest cells. Sïug is expressed in the neural crest cells emigrating fiom the neural tube. In addition, blocking the fiuiction of Slug by antisense oligonucleotides results in the suppression of the epithelial-mesemchymal transition of the neural crest cells, and thus inhibits the emigration of the prospective neural crest cells (Nieto et al., 1994).

However, because of its late expression, it is unlikely that this transcription factor plays a role in the segregation of neural crest fiom neural plate and prospective epidermis.

1.2.2. Embryological and molecular aspects of mouse PNS development

One of the major derivatives of neural crest is the PNS, including the sensory and autonomic nervous systems. The spinal sensory system of the PNS, including neurons and neuroglial cells of dorsal root ganglia (DRG), onginate entirely from the neural crest

(Le Douarin, 1982). Cranial sensory ganglion neurons, on the other hand, onginate fiom neural crest as well as fiom the cmnial ectodermal placodes, but the neuroglia of these ganglia are entirely derived fiom the neural crest (D'Arnica-Martel and Noden. 1983). In the autonomic system (inc luding sympathetic, parasympathetic and enteric ganglia), the neural crest ongin for ail neurons and associated glial cells has been conclusively demonstrated in quail-chick chimeras (Le Douarin, 1982).

As discussed in the previous section (1.2.1), neural crest cells are most likely multipotent before or during migration. This notion indicates that the environment of migratory routes and destinations of neural crest celIs are crucial for determining their fdce11 fates, as clearly demonstrated for the development of DRG. For example.

Detwiler (1934, 1937) showed that removing somites results in loss of the corresponding

DRGs, whereas additional DRGs develop in juxtaposition to grafted supemumerary somites. These results suggest that the formation of compact DRG requires an influence from sornites. In addition, the development of DRGs is strictly dependent upon their contact with the neural tube. Kalcheim and Le Douarian (1986) separated the developing

DRG fiom the neural tube by inserting a Silastic membrane next to the neural tube. and showed that this operation results in the complete absence of spinal ganglia at the levef of the operation. However, the DRG can be rescued if the Silastic membrane is impregnated with either neural tube e.xtract or a combination of laminin and brain-derived neurotrophic factor (BDNF)or bFGF (Kalcheim and Le Douarin, 1986; Kalcheim et al.,

1987; Kalcheim, 1989). These and other observations strongly suggest the environrnents where the neural crest cells reside andfor pass through must provide certain molecular signals such as growth factors for neural crest cells to determine their neural fates (Le

Douarin and Bupin, 1993).

DifTerentiation of sympathoadrenal precursor cells is perhaps the best-studied case showing environmental factors in fate determination of neural crest cells during PNS development. Both the chromafnn cells of the adrenal medulla and the sympathetic neurons denve from the neurai crest originated fiom the midtnink level (Le Douarin,

1982). Fully differentiated chromafnn cells can be converted to sympathetic-like neurons, without dividing, when treated with nerve growth factor (NGF) in vitro

(Unsicker et al., 1978; Ogawa et al., 1984; Doupe et al., 1985a b). AAer NGF induction, the chromafi celis grow out neurites, Form synapses (Ogawa et al.. 1984), and express neuron specific mRNAs (Anderson and Axel, 1985). This transdifferentiation can be blocked by glucocorticoids (GC) (Unsicker et ai., 1978), suggesting that the high local

GC synthesized in the adrenal cortex contributes to the differentiation of the neural crest cells to chromaffin cells. Based on these and other observations, it was proposed that adrenal chromaffin cells and sympathetic neurons share the sarne precursor cells (SA precursors) in the neural crest population, and that the choice of the ce11 fates of these precurson is detennined by the relative balance of NGF and GC in the local environment

(Landis and Patterson, 198 1). Subsequent work supports the existence of assumed SA precursors in the developing embryos. For example, Anderson and Axe1 (1 986) isolated bipotential precursor cells from the rat embryonic adrenal glands, which can differentiate into either sympathetic neurons or ch rom^ cells in vitro. In addition. Anderson et al.,

(1991) showed that individual progenitor cells within developing sympathetic ganglia transiently express both chromaffin- and neuron-specific markers. These data together support the existence of a SA progenitor that can differentiate into sympathetic neurons or chromaffin cells, depending upon local signals present in the environment.

How do these signals affect the fate choice of SA progenitors? It has become clear that GCs play a dual role in determinhg the fate of SA progenitors. They act both negatively to inhibit neuronal differentiation (Anderson and Axel, 1Ç86; Unsicker et al.. 1978) and positively to promote the expression of chromaffin-specific genes such as phenylethanolamine-N-methyitransferase (PNMT) (Bohn et al., 198 1; Seidl and

Unsicker, 1989). This dual action of GCs is consistent with the fact that the GC receptor is a transcription factor that can both activate and repress the expression of different target genes (Beato, 1989). Studies cmied out in PC 12 cells demonstrated that GCs can repress the transcription of neuronal specific genes, including peripherin (Leonard et al..

1987), SCGIO (Stein et al., 1988), and GAP-43 (Federoff et al.. 1988). Furthemore. consistent with the capability of GCs to induce PNMT expression (Jiang et al., 1989). the

PNMT promoter contains a functional positive glucocorticoid-responsive element (GRE)

(Ross et ai., 1990). Additional studies revealed that both the positive and negative efTects of GCs appear to be mediated by the type41 receptor, as suggested by effects of various steroid-specific agonisa and antagonists (Michelsohn and Anderson. 1992). The positive and negative effects of GCs on SA progenitors to develop into chromaffin cells are exerted sequentially: the inhibition of neuronal differentiation precedes the induction of

PNMT expression (Michelsohn and Anderson, 1992). In the absence of GC. many SA progenitors commit to neuronal differentiation and lose the competence to express PNMT

(Michelsohn and Anderson, 1992). This observation indicates a dependence of the differentiation of chromaffin cells on the suppression of the neuronal differentiation.

These findings together reveal a deliberate control of the chromaffin pathway of the SA progenitor, and suggest an ernbryonic rnechanism in which only the SA progenitors that migrate to the adrenal gland, which produces GCs, will be prevented fiorn undergoing neuronal differentiation and thereby aliow for the expression of chromaffin phenotypes. How do environmental factors contribute to the development of the SA progenitor

to a sympathetic neuron? As mentioned above, the SA progenitor can initiate neuronal

differentiation when GCs are absent, indicating the neuronal pathway as a default state of

the SA progenitor. However, the survival and development of the differentiating

syrnpathetic neurons are dependent on a signal. NGF (Anderson and Axel, 1986).

Although NGF plays an important role in the development of sympathetic neurons.

surprisingly, SA progeniton isolated from E14.5 rat ernbryos are initiaily unresponsive to

this factor (Anderson and Axel, 1986; Birren and Anderson, 1990). Further studies on

the immortalized SA progeniton (named MAH cells) showed that the lack of NGF

response is correlated with the lack of expression of the NGF receptors, including p75.

the low-affhity NGF receptor (LNGFR) (Birren and Anderson. 1990). and trkA. the

high- affinity NGF receptor (Anderson, 1993). Therefore, the mechanism that activates

the expression of NGF receptors may account for the transition of the SA progenitor from

the NGF unresponsive to responsive state. While searching for such mechanisms, Birren and Anderson (1990) found that bFGF can induce neurite outgrowth as well as proliferation of MAH and chromaffin cells. But, unlike NGF, bFGF does not suppon the survival of the postmitotic sympathetic neurons. As bFGF appears to cause a NGF dependence of chromaffin cells when it induces neurite outgrowth on these cells (Stemple et al., 1988), it is likely that bFGF also induces die NGF response of the SA progenitor cells. Consistently, in the presence of both bFGF and NGF, some MAH cells can differentiate and survive to the stage of postmitotic syrnpathetic neurons. Furthemore, bFGF induces the expression of p75 mRNA and protein in MAH cells (Anderson et ai..

1993). Subsequent studies using the proliferating neumblasts immuno-isolaied from the embryonic sympathetic ganglia suggested a new scheme: neurotrophin-3 (NT-3)induces

the expression of TrkA in the neural precurson, followed by the induction of the

expression of p75 by NGF (Verdi and Anderson, 1994). Taken together. these

observations suggest that neuronal development of neural crest cells (e-g- SA progenitors)

involve signaling cascades, in which NT-3 and possibly bFGF act to promote the proliferation and initial neuronal differentiation of the progenitor (Henderson, 1W6), while a second factor (e-g. NGF) in turn maintains the subsequent maturation and survival of the neuron.

In addition to NGF, other factors are also found to have trophic effects on PNS neurons. These factors make up the neurotrophic family, which includes NGF,

Neurotrophin-3 (NT-3), Neurotrophin415 (NT-4/5), and Brain-derived neurotrophic

Factor (BDNF). The effect of different neurotrophins is mediated by the activation of one of the Trk family of receptor tyrosine kinases, with TrkA being specific for NGF. TrkB for NT415 and BDNF, and TrkC preferred for NT-3 (Lindsay, 1996). In accord with differentiai patterns of the distribution of Trk receptors in penpheral ganglia. the neurotrophins show both distinct and overlapping expression in developing PNS. Various studies have established that neurotrophins play critical roles as classicai targeted-derived sunrival factors of neurons (Lindsay, 1996). However, much broader effects of neurotrophins have been suggested, including paracrine and autocrine actions on neuroblast proliferation and differentiation (Lindsay, 1996; Davies and Wright, 1996;

Lewin, 1996). Recent studies indicate that members of the TGF-P superfamily play important roles in the fate determination of neural crest cells. For example, bone rnorphogenetic protein 2 (BMP2) cm induce neuml crest stem cells to express MASHI. a neural determination gene (see below) and to difierentiate into sympathetic-like neurons. TGF- pl, on the other hand, exclusively promotes smooth muscle differentiation (Shah et ai..

19%).

Although extracellular signals play crucial roles during PNS development as discussed above, intrinsic mechanisms must be involved in this process as well. The outcome of the neuronal differentiation is probably the result of the interaction of the extracellular signai and the cell-intrinsic developmental program. As for O ther sy stems. transcription factors must also play key roles in fate determination during PNS development. Several transcription factors have recently been suggested to be involved in the determination of the autonomic lineages in developing PNS. AMASH-I was the first transcriptional regulatory gene show to be crucial during PNS development. iUASH- I is a murine homologue of the Drosophila achaefe-scute (Johnson et al. 1990) and belongs to the basic helix-loop-helix (bHLH) family. The MyoD subfamily of bHLH genes have been show to act together in regdatory cascades to speciQ muscle ce11 fate (Weintraub et al., 1991), and members of the Drosophila achaete-scute complex (AS-C) bHLH gene farnily act in concert to direct ectodermal cells into the ce11 lineage speciaiized to form ail classes of extemal sense organs (Campuzano and Modolell, 1992). hUSH-I is expressed in the brain, spinal cord and developing PNS. The expression of MSH-I in PNS is restricted in the precursors of the autonornic lineages, including, sympathetic. parasympathetic and enteric neurons. The MSH-I mRNA is detected early during

neural crest development, in the neural crest cells when they arrive at sites of peripheral

neurogenesis (Lo et al., 199 1 ; Guillemot and Joyner, 1993). In addition, the expression

of MSH-1 is seen before the expression of diffierentiated markers such as tyrosine

hydroxylase (TH) in the sympathetic ganglia and is downregulated shortly der their

appearance (Lo et al., 1991). Therefore, MSH-2 represents one of the fist markers

expressed afier the segregation of the autonomic and sensory neural lineages and may

play a role in determination of the cell fate for the autonomic Iineage. Subsequent work

has identified U4SH-I homologues and their expression in amphibians (Ferreiro et al.,

1Wî), fish (Allende and Weinberg, 1994), avians (Jasoni et ai., 1994), and hurnan (Bal1

et al., 1993).

The function of MASH-I has been directly assessed by gene targeting experirnents

(Guillemot et al., 1993). MW-I mutants mice die shortly derbirth, from dificulties

in feeding and breathing. The central nervous system (CNS) of the mutant mouse

displays a significant loss of sensory neurons from the olfactory epithelium. Most

strikingly, in the PNS, virtually all mature sympathetic and parasympathetic neurons are eliminated in MSH-Z homozygous mice (Guillemot et al., 1993). This neuronal deficit

is not due to a failure of migration of the neural crest cells to localize to sites of autonomic gangliogenesis, since neural crest cells are observed condensing adjacent to the dorsal aorta in MSH-I mutant mice, as determined by the expression of c-ret. a receptor tyrosine kinase expressed in the neural crest cells (Pachnis et al.. 1993;

Guillemot et al., 1993; Lo et al., 1994). In addition, cells expressing the early glial marker f-spondin can also be detected in the condensing neural crest ce11 aggregates, suggesting that AUSH-1 is not required for the initiation of gliogenesis in autonomic ganglia Further analyses also reveal that one particular set of entenc neurons is missing in MASH-I mutant rnice (Blaugrund et al., 1996). These data together suggest that

MSH-I is required for the differentiation of the neural crest cells into the autonomic neurons. Recent studies have identined other bHLH transcription factors as potentid vertebrate neuronal determination genes (Sommer et ai., 1996). These include NeiroD and Neurogenin. Overexpression of these genes causes ectodermal cells to adopt the neural fate and thereby induces ectopic neurogenesis in Xenopus embryos (Ma et al..

1996).

As the expression and function of MASH-I cover the sympathetic, parasympathetic, and enteric lineages, other regulatory genes must be involved in distinguishing the phenotypes of neurons in these three lineages. Phox 2. a mammalian paired homeodomain protein (Valarche et al., 1993), appears to be on such transcription factor. Phox2 is expressed in precursor cells in both the CNS and PNS that are destined to give rise to either adrenergic or noradrenergic neurons. In the PNS, Phox.? mRNA is detected in sympathetic ganglia, and certain enteric, parasympathetic, and sensory ganglia

(Valarche et al., 1993). It is striking that Phox2 expression is associated with an adrenergic or noradrenergic neuronal phenotype. This coincidence raises the possibility that this regulatory gene is involved in the specification of the neurotransmitter phenotype. Consistent with this idea, Phox2 appears to regulate the expression of dopamine-P-hydroxylase (DBH) (Tissier-Seta et al., 1993). Another group of genes that have been showed to be expressed in the developing

PNS are members of the GATA zinc-hger transcription factors (Yamamoto et ai.. 1990;

Zon et al., 1990). In the developing PNS, GATA-2 and GATA-3 are expressed in

sympathetic but not in enteric ganglia (Groves et al. 1994). Expression is dso observed

in the trigeminal (V), and facial-acoustic (VIIMII) ganglia (George et al.. 1994). The

expression patterns of GATA-2 and GATA-3 in the PNS correlate far less with the

neurotransmitter phenotype than that of Phox2.

13. Regulation of the function of homeobox genes during development

13.1 The role of homeobox genes in development

Homeobox genes consist of a large farnily found in many studied eukaryotic

organisms, including the yeast, plants, flies and vertebrates. They encode the homeodomain

DNA-binding transcription factors that play important roles in a variety of developmental processes such as ce11 differentiation and embryonic patterning. The developmental

fiction of homeobox genes has been reviewed before (Tang 1994).

1.3.2. Regulation of the functions of homeobox genes

1.3.2. 1. Regulation of developmental expression of homeobox genes.

The function of homeobox genes is highiy regulated during embryogenesis. One of the fundamental mechanisms involved is to regulate gene expression and to set up the spatial and temporal expression pattern during development. Numerous studies have been carried out aimed at dissecting the regulatory elements of a variety of homeobox genes by transgenic approaches and/or transfection experiments in cdtured cells. The picture that emerges is extremely complex. It appears that every homeobox gene analyzed is controlled by multiple regdatory elements, which are located in the promoter region downstream of the coding region, or within the introns. Many transcription factors controlling the regdation of various homeobox genes have been identified from these studies. Therefore, one cm imagine that setting up the developmental expression pattern of the homeobox gene

(and probably any other genes) requires a sophisticated regulatory architecture to organize the coorperative firnctions of multiple transcription factors in a spatial and temporal manner.

While little is known about the molecular basis for the developmental expression pattern of any homeobox gene, several interesting regulatory phenornena have been discovered.

Environmental signals may be involved in the regdation of homeobox gene expression directly. The regulatoiy effects of retinoic acid (RA) on homeobox gene expression have been best documented in this regard. RA plays vital roles during rnarnmalian development, and exogenous administration of RA during embryogenesis cm cause a variety of developmental abnormalities (Soprano and Soprano. 1995). It has been suggested that RA functions as a rnorphogen in various embryonic tissues such as the developing limb bud In vivo administration of RA during vertebrate embryogenesis cm induce homeotic transformations of the vertebral column (Kessel, 1992). Significantly, these iransformations of body segments are coincident with the shifl of Hox gene expression domains (Kessel and Gms, 1992), which putatively determine segmental identity. This observation indicates that RA regulates the expression of Hox genes directly or indirectly.

The effects of RA on transcnptiod regdation is exerted by the RA receptor (RAR) and the retinoid X receptor o(R),which are aiso transcription factors (Chambon, 1996).

Subsequent studies support the view that RARs and RXRs can directiy control the expression of Hox genes. For example, RA-responsive elements (RARES), which consist of

the binding motifs of RA receptodretinoid X receptor heterodimer, have ben identified in

the 5' as well as 3' regions of HoxBl gene (Oguraand Evans, 1995%b). In addition, there

is a binding site for retinoid-inducible protein, a cofactor of the RA receptor and retinoid X

receptor, at the 3' region. These motifs and proteins strongly and cooperatively activate the

transcription of HoxBl in a cell-specific and retinoid-dependent marner (Ougur and Evans.

1995% b). nie hction of RARES of HmBI in vivo is supported by studies using

transgenic mice. For example, RA exposure causes anterior shifi of the Lad expression

domain generated by the neural enhancer of HuxBI, but point mutations in the 3' RARE

can abolish this response and prevent the establishment of the neural expression of HoxBZ

in trangenic mice (Mashall et al. 1996). These results suggest that the 3' RARES is required

for the response of HoxBI to RA and is essentid for establishing the developmentd expression pattern of this gene. The regdation of Hox genes by RA during development is aiso suggested by midies on mutant mice with targeted mutations in RARs. For instance. the targeted mutation of RARy leads to homeotic transformation of the vertebrae. a phenotype fiequently caused by Hox gene mutations. The homeotic transformation observed in R4R;ynuIl mutants has been suggested to result from the loss-of-fûnction of

Hox genes (Lohnes et al. 1993).

RA regdation of transcription has also ken observed in many other homeobox genes within or outside of the Hox complex (e. g. Sheen et al., 1994). In addition to RA. the expression of homeobox genes may also be directly innuenced by other environmental sigds. For instance, McCormick et ai. (1990) suggested that the expression of the pituitary-specinc homeobox gene GHFl is moddated by the environmentai cues that

change the intracellular level of cyclic AMP and thereby the activity of CAMP response

element binding protein (CREB), a ubiquitous transactivator that binds to the GHFl

promoter. Furthemore, Mead et al. (1996) reported that the Xenopus homeobox gene

Mk l is an immediate-early gene responding to BMP-4 signalling during early

embryogenesis. These observations are hgmental but provide connections between the

environmental cues and developrnentd programming.

Another strücing observation is cross-regdation among members of the homeobox

gene family. Many Hox and non-Hox homeobox genes are found to be regulated positively

or negatively by other homeobox genes. For example, transient expression of Hox AS.

under control of an inducible promoter, in F9 embryonic carcinoma cells results in transient

and simultaneous expression of other upstrearn and dowmtrearn genes of the same Hm

cluster as well as genes nom other clusters (Lobe, 1995). Consistent with this finding, the consensus binding site with a TAAT core for homeodomain proteins has been found in rnany regulatory elements of Hox genes studied so far, suggesting a complex regulatory circuit among homeobox genes. On the other hand, the transcription of Hox genes can also be negatively regulated by other Hox proteins. For instance, the human HOX D9 promoter can be downregulated by HOX D8 protein (Zappavigna et al., 1994). However. HOX D8 is not an intrinsic transcription repressor and can activate transcription fiom other target genes.

As described above, Hox genes are organized into clusters on chromosomal loci. and the order of Hox genes in the cluster corresponds to the order of their expression domains dong the A-P axis of the developing embryo. Strkhgly, Hox genes are sequentially expressed in the cluster during development, from 3' to 5' within the cluster. The mechanism underlying this Hox expression phenornena is not clear. The cross-regdation of Hox genes. at least in part, likely contributes to setting up their spatiaily and temporaily ordered expression pattern. Non-Hox genes cm also regdate the expression of Hox genes. Subramanian et al

(1995) described the homeotic transformation of vertebrates caused by the targeted mutation of Cdxl. Interestingly, these abnormaiities are concomitant with the posterior shifi of Hox gene expression domains (e. g. Hox A7) in the somite mesoderm. In addition, the Cdxl-binding site is present in the Hox gene control regions, and Cdx-1 cmactivate the

Hox A7 transcription in cultured cells. These data suggest a direct regdation of the Hox gene expression by a non-tiox homeobox gene. Observations have aiso been made that non-Hox genes modulate the expression of other non-ffox genes. For example. the

Busophila caudal homeobox gene product activates the transcription offuhi trrrazu @) during embryogenesis (Demlf et al., 1989), by binding to the TITATG motifs located in the regulatory eiement offiz.

Homeobox genes can also be auto-regulated, and autoactivation of transcription has been observed in many homeobox genes. For instance, the HOX D9 protein can activate transcription fiom its own promoter (Zappavigna et al., 1994). The autoregulation of homeobox genes may be required for suçtaining the expression &er the initial activation.

Interestingly, the nechanism underlying the autoregulation appears to be evolutionally conserve& as show by the autoregdatory enhancer of the homeotic gene Defurmed (Dfd).

In &osophifa, the Dfd autoregdatory enhancer support the expression of Dfd in the postenor head segment in the embryo. Strikingly, this element also directs the expression of a LacZ reporter gene in the hindbrain region in transgenic mouse embryos

(Awgulewitsch and Jacobs, 1992). Furthemore, the expression domain of LacZ lies within the common anterior expression domain of the mouse Dfd cognate Hox genes in the

hindbrain. Taken together, the examples briefly discussed above illusirate a complex

regdatory network among homeobox genes. This network appears to be required for the

setting up of the developmental expression patterns of horneobox genes to exert iheir proper

roles in embryonic pattening.

1. 3. 2. 2. Regulation of the biological funetion of homeobox genes by mRNA

localization and translation.

Specific localization of mRNA is required for the normal developmental îùnction of

some homeobox genes, as most clearly shown by Drosophiiu bicoid (bcd) gene. bcd is a

matemally transcribed gene and encodes a homeodomain protein that can activate the

expression of several zygotic segmentation genes in a concentration-dependent rnanner (St.

JOhnston and Nusslein-Volhard, 1992; Driever and Nusslein-Volhard, 198 8; Struhi, et al,,

1989). The differential expression of these zygotic genes dong the anterior-posterior axis

of the fertilized egg is determined by the Bcd protein gradient fiom anterior to posterior that

specifies the pattern of the head and thorax mever, 1993). The Bcd morphogen gradient,

on the other hand is achieved by the diffusion of the protein translated fi-om bcd mRNA

specificaily localized at the antenor pole of the fertilized egg (St. Johnston. 1995). The

localization of bcd rnRNA to the anterior pole of the embryo involves a number of

intermediate steps (Berleth et al., 1988; St. Johnston et al., 1989). The cis-acting sequences

required for the localization occupy a large portion of the 3' untranslated region (3' UTR) of

each bcd transcript (Macdonald and Seuhl, 1988; Macdonald et al., 1993). Multiple tram- acting factors may bind to the cis-acting elements, which may be responsible fior the specific step in the localizition pathway (Macdonald et al., 1993). One of these factors is

Staufen (Stau) protein, which is required for the 1st step of the localization pathway -

targeting the bcd mRNA to the anterior pole (St. Johnston et al., 1989). Stau associates

with the 3'UTR of bcd mRNA and fom a particle that moves in a microtubule-dependent

manner (Ferrandon et al., 1 994).

The fùnction of some homeobox genes can also be controlled at the translational

level, as shown by Drosophila caudal (cad). Shortly afler the Bcd gradient forms. the Cad homeoprotein accumulates in a posterior-to-anterior gradient, opposing the gradient of Bcd

(Mlodzik and Gehring, 1987). While the Bcd gradient is required for the antenor patterning of the embryo, the Cad gradient is necessary for abdomen formation by activating the expression of zygotic genes. Uniike the Bcd gradient that arises from the anterior pole localization of bcd mRNA, the Cad gradient arises from the uniformiy distributed cad mRNA. Therefore, the translation of cod mRNA at the anterior part must be suppressed.

Genetic experiments suggested that bcd is necessary for setting up the Cad gradient, because the Cad gradient is abolished in embryos lacking functional Bcd. Instead of a gradient, the bcd mutant embryo has uniformly high concentration of Cad (Mlodzik and

Gehring, 1987; Macdonald and Struhl, 1986; Rivera-Pomar et al., 1995). Recently. it has been shown that Bcd can repress the translation tiom cad mRNA (Dubnau and Sbuhl,

1996; Rivera-Pomar et al., 1996). The homeodomain of Bcd binds to regdatory sequences in the 3 ' UTR of cad mRNA. Binding these sequences by Bcd blocks translation initiation on cod mRNA. Thus, the complementary Bcd and Cad gradients are formed, with less Cad being translated wherever there is more Bcd. 1.3.2.3. RegpIation of the biologieal activity of homeodomain proteins.

The fûnction of horneobox genes can also be modulated at the protein level. This

has been best illustrated by the modulation of the DNA binding activity of homeodomain

proteins by protein-protein interactions. It has been well established that homeodomain

proteins are DNA binding transcription factors (McGinnis and Knimlauf. 1992). Many of

them have been shown to be transactivators (McGinnis and Knimlauf, 1992). while several

homeodomain proteins have ken found to act as transcription repressors (e.g. Biggin and

Tjian, 1989). Similar to other DNA binding transcription factors, the homeodomain proteins also appear to exert their regdatory activity by interacting with the general transcription machinery (e.g Zhang et al., 1996). Therefore, homeobox genes are believed to control the developmental process by regulating the expression of other downstream genes. Numerous in vitro -dies showed that most of the homeoproteins bind to the same or similar DNA motif containing a TUTcore (McGinnis and Krumlauf, 1992). These observations of DNA binding specificity are obviously contradictory to the unique developmental function of individual homeobox genes. How do homeodomain protein achieve their high DNA binding specificity required for theu specific functions in vivo?

The emerging picture suggests that protein-protein interactions play a vital role in enhancing the DNA binding specificity of some homeoproteins. The yeast homeodomain protein MATa2 provides the best characterized exarnple of this type of mechanism

(Johnson, 1993). MATd is a mating-type control gene of S. cerevisiae. In diploids, the a2 protein associates with another homeodomain protein MATal and forms a heterodimer.

The two homeoproteins bind to a similar DNA motif. When associated with a 1. the a2 specificaiiy binds to 'hsg' operaton of haploid specific genes and suppresses their expression. ln haploid ceils of the a mating-type, however, the a2 foma homodimer and interacts with the MCMl protein. In this case, a2 specincally binds to a different DNA sequence, the 'asg' operator of a-specifîc genes and represses their expression. It is known that contacts between these cofactors (a1 and MCM1) and DNA, as well as the specific protein-protein interaction between the cofactors and a2, enhance the specificity required to target the correct sets of genes Nt vivo. The target specificity of these complexes derives fiorn the spacing of the homeodomain contact sites in the regulatory sequences of the target genes, while the sequences of the contact sites themselves are very similar. In the al -a2 heterodimer, the homeodomains are constrained to recognize a motif with contact sites spaced by 12bp, and in a2 homodimer-MCM1 cornplex a different space between the homeodomain contact sites is required (Smith and Johnson, 1992).

A similar type of modulation of DNA binding activity has also been observed for the Drosophila homeodomain proteins, as show by Exd and U'bx. Genetic analyses showed the extradenticle (ex4 gene can mode the hction of HOM-C genes. rnost ciearly

Ubx (Peifer and Wieschaus, 1990). For example, exd mutations alter Ubx functions even when the expression of (Ibx is still normal. Further evidence exists that exd regulates some of the sarne genes diat are under HOM-C control (Chan et., 1994: Rauskolb and Wieschaus,

1994). These observations indicate that exd acts in parallel to HOM-C genes (e. g. Ubx).

Molecular cloning of exd demonstrated that it encodes a homeodornain protein. This protein is highly conserved throughout evolution (Kamps et al., 1990; Nourse et al., 1990;

Monica et al., 199 1; Flegel et al., 1993). In vertebrates, these exd homologues are called pbx genes. Interestingiy, the Exd homeodomain shows hi& homology to ùiat of the yeast

MATal(Rauskolb et al., 1993; Flegei et ai., 1993), suggesting that Exd may aiso act as a

cofactor of Ubx and thus modify its DNA binding activity. Consistent with this ide% direct

interaction between Exd and Ubx has been demonstrated (Chan et al., 1994; Johnson et al.,

1995), and cooperative DNA binding between Exd and Llbx has been shown using in vivo

(Chan et al., 1994; Johnson et al., 1995) and artificial (Van Dijk et al., 1994) DNA binding

sequences of Ubx. For example, genetic analyses identified an enhancer element of the dpp

gene that is directly activated by Ubx in a smaU region of the visceml mesoderm in

Drosophila embryos (Capovilla et al., 1994; Manak et al., 1994; Sun et al., 1995).

Expression mediated by this enhancer also requires exd (Chan et al., 1994; Rauskolb and

Wieschaus, 1994). Anp, whose expression overlaps with that of dpp, does not activate this enhancer in vivo, although there are several AntpRfbx-type bhding sites in this enhancer element (Capovilla et al., 1994; Sun et al., 1995). Using subhgments of this enhancer,

Chan et al (1 994) demonstrated that Exd and Ubx bind to DNA cooperatively. On the other hand Antp fails to bind to the enhancer element cooperatively with Exd. Significantly. the amino acids present in the Ubx homeodomain that are required for the interaction between

Exd and Ubx and their cooperative DNA binding are absent in the Antp homeodomain

(Johnson et aI., 1995).

The UbxExd interaction provides another clear example as to how the functional specificity of homeodomain proteins in development can be moduiated by protein-protein interactions. In addition to the enhanced specificity, another direct result of these interactions could be the synergistic effect on transcription activation or repression as indicated by a recent study (Lichtsteiner and Tjian, 1995). Cooperative DNA bindinp has also been observeci for the vertebrate Pbx aud Hox proteins (Popper1 et al.. 1995; Chang et

al., 1995). Therefore, the interaction between Exd/Pbx and HOM-C/Hox proteins may

represent an evolutionarily conserveci mechanisrn dedicated to increasing the bctionai

specificity of homeobox genes during development.

Modulation of the developmental function of a vertebrate homeodomain protein by

protein-protein interactions has ben documented recentiy. Aguinick et al (1996) identified

a protein, Ldbl, that associates with the LIM homeodomain protein Lhw 1 (Lim i ). Ldb 1

does not belong to the horneodomain or any other known protein f-. When injected

into Xenopus embryos, the RNA of the Xenopus homologue of Liml. Xliml, displayed little or weak induction of the secondary axis with associated nedand muscle diflerentiation

(Taira et ai., 1994; Agulnick et ai., 1996), whereas Ldbl alone showed no effect on embryo development (Aguintck et al., 19%). However, CO-injectionof Ldbl and .Khi rnRNAs synergistically induced secondary axes. Therefore, it was suggested that the binding of

Ldb 1 to Mimi activated the Miml function in vivo (Agulnick et al.. 1996). However. it is not clear if the binding of Ldbl affects the DNA binding andlor transcriptional activities of

Xlim 1 protein.

1.4. HOXll and TLr homeobox genes.

HOXl l was identified as an oncogene of a T-ce11 acute lymphoblastic leukaemia (T-

ALL) at the breakpoints of chromosome 10 of the chromosornal translocation t( 10; 14) and t(7; 10) @ube et al., 199 1; Hatano et ai., 199 1; Kennedy et al., 1991 ; Lu et al., 1991 ). Afier a t(10;14) or t(10;7) translocation in T-cell acute lymphoblastic leukaemia, HOXll becomes fused to a specific Tcell receptor (TCR)locus on chromosomes 14 or 7 and is upregulated in T-ceus. However, the coding sequence of this gene is not affiected by the

translocations. Reverse transcription-polymerase chah reaction (RT-PCR) assay detected

low level expression in normal human T-cells (Lu et al., 1992). Thus, it was proposed that

the deregdated expression of HOXll upon translocation into the TCR locus may play a

role in leukaemogenesis. This hypothesis is consistent with a subsequent observation that

the forced expression of HOXl l in bone marrow cells can imrnortalize the cells and that in

vitro HOXI1 tramformed bone mmow ceus have the capability of forming tumors after

transplantation into nude mice (Hawley et ai., 1997). The HOXI I homeodomain protein

has been shown to function as a transcription activator (Dear et al., 1993).

Three mouse related genes of human HOXI 1 have been cloned and named Th-I,

IZx-2 and IZr-3 (T-ce11- leukaemia homeobox- gene) (Raju et al., 1993; Dear et al., 1993).

according to new des for vertebrate homeobox gene nomenclature (Scott, 1992). nX-1

and HOXl1 share identical homeodomain and C-terminal regions, while TLX-2 and ïXX-3

have horneodornains closely reIated to that of HOXI l(Dear et al., 1993). Therefore. it has

been suggested that HOXI1 and TLr genes comprise a distinct subfamily of homeobox

genes (Dear et al., 1993). The memben of this subfamily al1 contain a threonine residue at

position 47 of the horneodomain, a position contributhg to DNA contact. In rnost other homeodomain proteins, however, isoleucine or valine is most comrnonly found in this position (laughon, 199 1).

During mouse embryogenesis, TLc-1 shows a complicated pattern of temporal and spatial expression (Raju et al., 1993). 7k-I expression first becomes detectable by RNA in situ hybridization at E 8.5 in the first branchial arch. This expression progresses to encompass al1 the branchial arches as well as the region of the presurnptive pharynx at later stages. Later in development, the TLr-I expression domain extends Urto some structures

contributed by the arches including the tongue, mandible and extemal ear. At day 10.5,

several components of the nervous system are also marked by 7k-l expression including

the trigeminal ganglion, faciaoaccoustic gaugiion, glossopharyngeal ganglion, spinal cord

and the curvature of the pons-medulla By embryonic day 12.5, Tur-l expression can also

be detected in two of the digestive glands, salivary glands and spleen. Thus. the embryonic

expression of 1Zx-l is not restricted to a specific gemiinal layer, organ or tissue type. Gene targeting experiments have demonstrated that TLx-I is essential for the formation of spleen

(Roberts et al., 1994; Dear et ai., 1995).

1.5. Objectives of this study.

While the fûnction of Tlx-l is defined to a certain extent, the role of other Tlx genes during mouse development has not been determined. This study has been carried out to characterize the function of 77x-2 during mouse embryogenesis and the molecular activities of the TLX-2 protein. Specifically, the author attempts to address the following issues: (i) the fiction of 27x2 during mouse gastdation; (ii) the function of 77x-2 in

PNS development; (iii) the regulation of TLX-2 function. These problems are addressed by a combinatorid strategy of developmental and molecular approaches. References

Agulnick, A. D., Taria, M., Breen, J. J., Tanaka, T., Dawid, 1. B. and Westphal, K. (1996). Interactions of the LM-domain binding factor Ldbl with LIM homeodomain proteins. Nature 384,270-272.

Albano, R. M., Godsave, S. F., Huylebroeck, D., Van Nimmen, K., Isaacs, H. V. Slack, J. M. and Smith, J. C. (1990). A mesodenn-inducing factor produced by WEHI-3 murine myelomonocytic leukemia cells is activin A. Development 1 10,435-43

Allende, M. L. and Weinberg, E. S. (1994). The expression pattern of 2 Zebrafish achaete-sme homolog (ASH) genes is altered in the embryonic brain of the cyclops mutant. Dev. Biol. 166,509-530.

Amaya, E., Musci, T. J. and Kirschner, M. W. (1991). Expression of a dominant negative mutant of the FGF receptor disrupts mesodem formation in Xenopus embryos. Ce11 66,257-70

Amaya, E., Stein, P. A., Musci, T. J. and Kirschner, M. W. (1993). FGF signalling in the early specification of mesodem in Xenopus. Development 1 18,477-87.

Anderson, D. J. (1993). Cell fate determination in the peripheral nervous si ystem: the sympathoadrenal progenitor. J. Neurobiol. 24, 185- 198.

Anderson, D. J. and Axei, R. (1985). molecular probes for the development and plasticity of neural crest derivatives. Ce11 42,649-662.

Anderson, D. J. and Axel, R. (1986). Bipotential neuroendocrine precursor whose choice of ce11 fate is determined by NGF and glucocorticoids. Cell47, 1079- 1090.

Anderson. D. J., Carnahan, J., Michelsohn, A. and Patterson, P. H. (199 1). Antibody markers identifi a common progenitor to sympathetic neurons and chromafEin cells in vivo, and reveal the timing of commitment to neuronal differentiation in the sympathoadrenal lineage. I. Neurosci. 1 1,3507-35 19. hg,S-L. and Rossant, 1. (1994). ENF-3P is essentid for node and notochord formation in mouse development. Cell 78,561-574.

Artinger, K., Fraser, S. and Branner-Fraser, M. (1995?) Dorsal and ventral ce11 types in the closing neural tube can aise fi-om common progenitors. Dev. Biol.

Asashima, M., Nakano, H., Uchiyarna. H., Sugino, H., NakamuraJ., Eto. Y., Ejima. D., Nishimatsu, S., Ueno, N. and Kinoshita, K. (1991). Presence of activin (erythroid differentiation factor) in unfertilized eggs and blastulae of Xenopus laevis. Proc. Natl. Acad- Sci. USA 88,65 1 1-4

Awgulewitsch, A. and Jacobs, D. (1992). Defonned autoregdatory element fiom Drosophila fùnctions in a consenmi manner in transgenic mice. Nature 358,3414

Bail, D. W., Azzoli, C. G., Baylin, S. B., Chi, D., Dou. S., Donis-Keller. H., Cumarcaswamy, A., Borges, M. and Nelikin K. D. (1993). Identification of a human achaere-sczire homolog highly expressed in neuroendocrine tumor. Proc. Nati. Acad. Asci. USA 90,5648-5652.

Basler, K., Edlund, T., Jessell, T. M. and Yamada, T. (1 993). Control of ce11 pattern in the neural tube: regdation of ce11 differentiation by dorsalin-1, a novel TGF beta fmily member. Ce11 73,687-702.

Bastian, H. and Gruss, P. (1990). A murine even-skipped homologue Evx-1 is expressed during early embryogenesis and nemgenesis in a biphasic manner. EMBO J. 9. 1839- 1852.

Beato, M.(1989). Gene regulationby steroid hormones. Cell, 56,335-344.

Beddington, R. S. P. (1981). An autoradiographic analysis of the potency of embryonic ectoderm in the 8th day postimplantation mouse embryo. J. Embryol. Exp. Morph. 64. 87- 104.

Beddington, R. S. P. (1982). An autoradiographic andysis of tissue potency in different regions of the embryonic ectoderm during gastrulation in the mouse. J. Embryol. Exp. Morph. 69,265-385.

Beddington, R. S. P. (1983). Histogenetic and neoplastic potential of different regions of the embryonic cylinder. J. Embryol. Exp. Morph. 75, 189-204.

Beddington, R. S. P. (1987). Isolation, cultured and manipulation of postimplantation mouse embryos. In: Mammalian Development. A practical approach. Monk, M. ed. IRL Press, Oxford, pp. 43-70.

Beddington, R. S. P. , Morgemstem, J., Land, H. and Hogan, A. (1990). An in situ transgenic enzyme marker for the rnidgestation mouse embryo and the visualization of inner ce11 mass clones during early organogenesis. Development 106,37-46.

Beddington, R. S. P., Rashbas, P. and Wilson, V. (1992). Brachyury - a gene affecting mouse gastrulation and early organogenesis. Development ( 1992 suppl.), 1 57-165.

Bellairs, R. (1986). The primitive streak. Anat. Embryol. 174, 1-14. Berleth, T., Buni, M., Thorna, G., Bopp, D., Richstein, S., Frigerio, G., NolI. M. and Nusslein-Volhard, C. (1988). The role of lochtion of bicuid RNA in organinng the anterior pattern of the DrosophiIa embryo. EMBO J. 7, 1749-56.

Biggin MD. and Tjian R., 1989. A purified Drosophiia homeodomain protein represses transcription in vitro. Ce11 58:433-40.

Birren, S. J. and Anderson, D. J. (1990). A v-rnyc-immortalized sympathoadrenal progenitor ce11 Line in which neuronal differentiation is initiated by FGF but not NGF. Neuron 4, 189-20 1.

Birren, S. J., Lo, L. and Anderson, D. 1. (1993). Sympathetic neuroblasts undergo a developmental switch in trophic dependence. Development. 119,597-6 10.

Blaugrund, E., Pham, T. D., Tennyson, V. M., Lo, L., Sommer, L.. Anderson. D. J. and Gershon, M. D. (1996). Distinct subpopulations of enteric neuronal progenitos defined by the of development, sympathoadrenal lineage markers and Mash-1-dependence. Development 122,309-320.

Blum, M., Gaunt, S. J., Cho, K. W. Y., Steinbeisser, H., Blumberg, B., Bittner, D. and De Robertis, E. M. (1992). Gastnilation in the mouse: the role of the homeobox gene goosecoid. Cell69, 1097- 1 106.

Bohn, M. C., Goldstein, M. and Black, 1. (198 1). Role of glucocorticoids in expression of the adrenergic phenotype in rat embryonic adrenal gland. Dev. Biol. 82, 1- 10.

Bronner-Fraser, M- ( 1995). Origin of the avian neural crest. Stem Cells 13,64-646.

Bronner-Fraser, M. and Fraser, S. E. (1988). Cell lineage analysis reveals muitipotency of some avian neural crest cells. Nature 3 35, 16 1- 163.

Bronner-Fraser, M. and Fraser, S. E. (1989). Developmental potential of avian trunk neural crest cells in situ. Neuron 3,755-766.

Bubnau, J. and SW, G. (1996). RNA recognition and translation regulation by a homeodomain protein. Nature 379,694699.

Burglin, T. R. and Ruvkun, G. (1992). New motif in PBX genes. Nat. Genet. 1.3 19-20,

Campuzano, S. and Modolell, J. (1992). Patterning of the Drusophila nervous system: The achaete-scute cornplex. Trends Genet, 8,202-208.

Capovilla, M., Brandt, M. and Botas, J. (1994). Direct regulation of decapentaplegic by Ultrabithorax and its role in Drosophila midgut morphogenesis. Cell76.46 1-475. Chambon, P. (1996). A decade of molecular biology of retinoic acid recepton. FASEB J. 10,940-54.

Chan, S-K., JafTe, L., Capovilla, M., Botas, J. and Mann, R S. (1994). The DNA binding specificity of Ultrabithorax is modulateci by cooperative interactions with extradenticle. another homeoprotein. Cell78,603-6 15.

Chang, C.-P,. Shen, W.-F., Rozenfe1d, S., Lawrence, H. J., Largman, C. and Cleary, M. (1995) Pbx proteins display hexapeptidedependent cooperative DNA binding with a subset of Hox proteins. Genes Dev. 9,663674.

Cho, K. W. Y., Blurnberg, B., Steinbeisser, H. and De Robertis, E. M. (1991). Molecular nature of Spemann's organizer: the role of Xenopus homeobox gene Goosecoid. Ce11 67. 11 11-1 120.

Cooke, J. and Wong, A. (1990). Growth factor related-proteins that are inducers in early amphibian development may mediate sirnilar steps in amniotes (bird) embryogenesis. Development 1 1 1, 197-2 12.

Copp, A. 1. (1995). Death before death: dues fiom gene knockouts and mutation. Trends Genet. 11,87-93.

D'Ammico-Martel, A. and Noden, D. M. (1983). Contributions of placodal and neural crest cells to avian cranial peripheral ganglia. Am. J. Anat. 166.445468.

Dale, L., Howes, G., Price, B. M. and Smith J. C. (1992). Bone morphogenetic protein 4: a ventralizing factor in early Xenopus development. Development 1 15,573-85

Davies, A. M. and Wight, E. M. (1 996). Neurotrophin autocrine loops. Curr. Biol. 5. 723- 6.

De Robertis, E. M., Blum, M., Niehrs, C. and Steinbeisser, H. (1992). Goosecoid and the organizer. Developrnent (1992 Suppl.), 167-171.

Dear TN., Sanchez-Garcia I., and Rabbitts TH., 1991. The HOXll gene encodes a DNA- binding nuclear transcription factor belonging to a distinct family of homeobox genes. Proc. Natl. Acad. Sci. USA 90943 1-5.

Dear, T. N., Colledge, W. H., Carlton, M. B., Lavenir, I., Larson. T., Smith, A. J., Warren, A. J., Evans, M. J., Sofioniew, M. V. and Rabbitts, T. H. (1 995). The Hoxll gene is essential for ce11 survbal during spleen development. Development 122,2909- 15.

Dearolf, C. R., Topol, J. and Parkes, C. S. (i989). The caudal gene product is a direct activator ofjkshi tamtranscription during Drosophila embryogenesis. Nature 341,340-3. Deng, C-X., Wynshaw-Boris, A., Shen, M. M., Daugherty, C., Omitz, D. M. and Leder. P. (1994). Murine FCFR-I is required for early postimplantation growth and axial organization. Genes Dev. 8,3045-3057.

Detwiler, S. R. (1934). An experimental study of the spinal nerve segmentation in Ambystoma with reference to the plurisegmentai contribution to the brachial plexus. J. Exp. Zool.67,395-441.

Detwiler, S. R. (1937). Observations upon the migration of the neural crest cells, and upon the development of the spinal ganglia and vertebral arches in Arnblysroma. Am. J. Anat. 61,63-94.

Dickinson, M., Selleck, M., McMahon A., et al. (1995). Dorsalization of the spinal cord: non-neural ectodem induces Wnt- 1 expression. Development 12 1,2099-2 106.

Doupe, A. J., Landis, S. C. and Paterson, P. H. (1985a). Enviromental influences in the development of neural crest denvatives: Glucocorticoids, growth factors and chromafin ce11 plasticity . J. Neurosci. 5,2 1 19-2 142.

Doupe, A. J., Patterson, P. H. and Landis, S. C. (1985b). Srnall intensely fluorescent (SIF) cells in culture: role of glucocorticoids and growth factors in their development an phenotypic interversions with other neural crest denvatives. J. Neurosci. 5.2 143-2 160.

Dressler GR. and Gruss P., 1989. Antenor boundaries of Hox gene expression in mesoderm-denved structures correlate with the linear gene order dong the chromosome. Diff. 41:193-201.

Driever, W and Nusslein-Volhard, C. (1 988)- Cell54,83-93.

Driever, W. (1993). Materna1 control of anterior development. In: The development of Drosophila melanogaster, Bate, M. and Martinetz-Arias, A., eds. (Cold Spring Harbor Laboratory Press), pp. 30 1-324.

Dube ID., Kamel-Reid S., Yuan CC., Lu M.. Wu X., Corpus G., Raimondi SC., Crist WM., Carroll M., Minowada J. et al., 1991. A novel human homeobox gene lies at the chromosome 10 breakpoint in lymphoid neoplasias with chrornosomal translocation t(10: 14). Blood 78:2996-3003.

Dush, M. K. and Mariin, G. R. (1992). Analysis of rnouse Evx genes: Evx-1 displays graded expression in the primitive streak. Dev. Bi01 . 15 1,273-28 7.

Echelard, Y., Epstein, D. J., St-Jacques, B., et al., (1993). Sonic hedgehog, a member of a family of putative signahg molecules, is implicated in the regdation of CNS polarity. Ce11 75, 1417-1430. Fassler, R. and Meyer, M. (1995) Consequences of lack of Pl integrin gene expression in mice. Genes Dev. 9, 1896-1908.

Federoff, H. J., Grabczyk, E. and Fishman, M. C. (1988) Duai regulation of GAP43 gene expression by nerve growth factor and glucocorticoidç. J. Biol. Chem. 263. 19290-1 9295.

Ferrandon, D., Elphick, L., Nusslein-Volhard, C. and St Johnton, D. (1994). Staufén protein associates with the 3'UTR of bicoid mRNA to form particles that move in a microtubule- dependent manner. Cell79, 1221-32.

Ferreiro, B., Skoglund, P., Bailey, A., Dorsky, R. and Harris, W. (1992). USHI. a Xenoptcr homolog of achaete-scute: a proneural gene in antenor regions of the vertebrate CNS. Mech. Dev. 40,25-36.

Flegel, W. A., Singson, A. W., Margolis, J. S., Bang, A. G., Posakony, J. W. and Mm.C. (1993). Dpbx, a new homeobox gene closely to the human proto-ncogene pbxl molecular structure and developmentale expression. Mech. Dev. 4 1, 155- 161.

Fraser, S. E. and Bronner-Fraser, M. (1991). Migrating neural crest cells in the trunk of the avian embryo are multipotent. Development 1 12,910-9 13.

Frohman, M. A., Boyle, M. and Martin, G. (1990). Isolation of the mouse Hox-2.9 gene: analysis of the embryonic expression suggests that positional information dong the anterior-postenor axis is specified by mesodem. Development 1 10,589-607.

Gaunt, S. J. (1987). Homeobox gene Hox 1.5 expression in mouse embryos: earliest detection by 1 situ hybndization is during gastdation. Development 10 1.5 1-60.

Gaunt, S. J. (1988). Mouse homeobox gene transcripts occupy different but ovedapping domains in embryonic gem layers and organs: a cornparison of Hox-3. I and Hox-1.5. Development 103- 135- 144.

Gaunt, S. J., Miller, J. R., Powell, D. I. and Duboule, D. (1986). Homeobox gene expression in mouse embryos varies with position by the primitive streak stage. Nature 324,662-664.

George, E. L., Georges-Labousse, E. N., Patel-King, R. S., Rayburn, H. and Hynes. R. O. (1993) Defects in mesodem, neural tube and vascular development in mouse embryos lacking fibronectin. Development 11 9, 1079- 109 1.

Goodman, H. M. (1990). Identification of a functional glucocorticoids response element in the phenylethanolamine N-methyltransferase promoter using hision gene introduced into chromaffin cells in primary culture. J. Neurosci. 10, 520-530. Goulding M. D., Lurnsden, A. and Gniss, P. (1993). Signals fkom the notochord and floor plate regdate the region-specific expression of two Pax genes in the developing spinal cord. Development 1 17, 100 1- 10 16.

Gra, J. M., Thies, R. S., Song, J. J., Celeste, A. J. and Melton, D. A. (1994). Studies with a Xenopus BMP receptor suggest that ventral rnesoderm-inducing signals ovemde dorsal signals in vivo. Ce11 79, 169-79.

Green, J. B., Howes, G., Symes, K., Cooke, J. and Smith, J. C. (1990). The biological eEects of XTC-MF: quantitative cornparison with Xenopus bFGF. Development 108, 173-83.

Groves, A. K., George, K. M., Tisser-Seta, I-P., Engel, J. D., Brunet, J-F. and Anedrson, D. J. (1995). Differential regdation of transcription factor gene expression and phenotypic markes in developing sympathetic neurons. Development 12 1.887-90 1.

Guilemot, F., Lo, L-C., Johnson, J. E., Auerbach, A., Anderson, D. J. and Joyner, A. L. ( 1993). Mammalian achaete-smte homolog- 1 is required for the early development of ofactory and autonomic neurons. Cell 75,463-476.

Guillemot, F. and Joyner. A. L. (1993). Dynamic expression of the murine Achaete-scute homologue Mash-l in the developing nervous system. Mech. Dev. 42, 1 7 1- 185.

Haegel, H., Lame, L., Ohsugi, M., Fedorov, L., Herrenknecht, K. and Kemelr. R. (1995) Lack of p-catenin affects mouse development at gastnilation. Development 12 1. 3 529- 3537.

Hashimoto, K. and Nakatsuji, N. ( 1989). Formation of the primitive streak and mesoderm cells in rnouse-embryos-detailed scanning electron microscopicaI study. Dev. Growth Differ. 3 1, 209-2 18.

Hatano M., Roberts CW., Minden M., Crist W., and Korsmeyer SJ., 199 1. Deregdation of a homeobox gene, HOXIl, by the t(10:14) in T ce11 leukemia. Science 253 :79-82.

Haub, 0. and Goldfarb, M. (1991). Expression of the fibroblast growth factor4 gene in the mouse embryo. Development 1 12,397-406.

Hawley, R. G., Fong, A. Z., Reis, M. D., Zhang, N., Lu, M. and Hawley, T. S. (1997). Transforming Function of the HOXl lTTCL3 homeobox gene. Cancer Research 57, 337- 45.

Hebert, J. M., Boyle, M. and Martin, G. (1991). rnRNA localization studies suggest that murine FGF-5 plays a role in gastnilation. Development 1 12,407-4 15. Hemmati-Brivanlou, A. and Melton D. A. (1992). A tnincated activin receptor inhibits mesoderm induction and formation of axial structures in Xenopus embryos. Nature 359,609- 14.

Hendenon, C. E. ( 1996). Role of neurotrophic factors in neural in neural development. Curr. Opin. Neurobiol. 6,64-70.

Hendeaon, C. E. (1 996). Role of neurotrophic factors in neuronal development. Curr. Opin. Neurobiol. 6,64-70.

Herrmann, B. G. (1991). Expression pattern of the Brachyury gene in whole-mount T""/TW'mutant embryos. Development 11 3,9 13 -9 1 7.

Hemnann, B. G. (1992). Action of the Brachyury gene in mouse embryogenesis. In Postimplantation Development in the mouse. Ciba Found. Symp. 165. 78-86.

Hogan, B., Beddington, R., Costantini, F. and Lacy, E. (1 994) Manipulation of the mouse embryo (second edition). Cold Spring Harbor Laboratory Press.

Isaacs, H.V., Tannahill, D. and Slack, L M. (1992). Expression of a novel FGF in the Xenopus embryo. A new candidate inducing factor for mesoderm Formation and anteroposterior specification. Development 1 14.7 11 -20.

Ilic, D., Fumta, Y., Kanazawa, S., Takeda, N., Sobue, K. et al., (1995) Reduced ce11 motility and enhanced focal adhesion contact formation in ce11 from FAK-deficient mice. Nature 377, 539-544.

Jasoni, C. L., WaLker. M. B., Morris, M. D. and Reh, T. A. (1994). A chicken achaete- scute homolog (CASH- 1) is expressed in a tempordly and spatiaily discrete manner in the developing nervous system. Development 120, 769-783.

Jiang, W., Uht, R. and Bohn, M. C. (1989). Regulation of phenylethanolarnine N- methyltransferase (PNMT) rnRNA in the rat adrenal medulla by cortico-sterone. Int. J. Dev. Neurosci. 7, 5 13-520.

Johnson, A. (1993). A combinatonal regdatory circuit in budding yeast. In transcriptional Regulation, ed. Yamamoto and McKnight. pp. 975- 1006. Cold Spring Harbor Press.

Johnson, E. B., Birren, S. J. and Anderson, D. J. (1990). Two rat homologues of Drosophila achaete-scute specifically expressed in neuronal precursors. Nature 346, 858- 861. Johnson, F. B., Parker, E. and Krasnow, M (1995). Extradenticle protein is selective cofactor for the Drosophila horneotics: Role of the homeodomain and YPWM arnino acid motif in the interaction. Proc. Natl. Ad.Sci. 92,739-743.

Jones, C. M., Lyons, K. M., Lapan, P. M., Wright, C. V. and Hogan, B. L. (1992). DVR- 4 @one morphogenetic protein4) as a postenor-ventralizing factor in Xenopus mesodenn induction. Development 1 15,63947.

Kalcheim, C. ( 1989) Basic fibroblast growth factor stimulates survivd of nonneuronal celIs developing fiom tnink neural crest cells. Dev. Biol. 134, 1-1 0.

Kalcheim, C. and Le Douarin, N. M. (1986) Requirement of a neural tube signai for the differentiation of neural crest cells into dorsal root ganglia. Dev. Biol. 1 16.45 1-466.

Kalcheirn, C., Barde, Y. A., Thoenen, H., Le Douarin, N. M. (1987) In vivo effect of brain-derived neurotrophic factor on the survival of developing dorsal roo t ganglion cells. EMBO. J. 6,2871-2873.

Kamps, M. P., Murre, C., Sun, X-H. and Baltimore, D. (1990). A new homeobox gene contributes the DNA binding domain of the t(1; 19) translocation protein in pre-B NI. Ce11 60,547-555.

Kennedy MA., Gonzaiez-Sarmiento R., Kees UR., Lampert F., and Dear N.. 1991. HOXl 1, a homeobox-containing T-ce11 oncogene on human chromosome IOq24. Proc. Natl. Acad. Sci. USA 88:8900-4.

Kessel M. and Gniss P., 1991. Homeotic transformations of murine vertebrae and concomitant alteration of Hox codes induced by retinoic acid. Cell67:89-104.

Kessel M., 1992. Respecification of vertebral identities by retinoic acid. Development 1 15 :487-5O 1.

belman, D. and Kirschner, M. (1987). Synergistic induction of mesoderm by FGF and TGF-beta and the identification of an mRNA coding for FGF in the early Xenopus embryo. Ce115 1,869-77.

Kimelman, D., Abraham, J. A., Haaparanta, T., Palisi, T. M. and Kirschner. M. W. (1988). The presence of fibroblast growth factor in the fiog egg: its role as a natural mesodenn inducer. Science 242, 1053-6.

Kispert, A. and Hemnann, B. G. (1993). The Brachyury gene encodes a novel DNA binding protein [published emturn appears in EMBO J 1993 Dec; 12(12):4898-91. EMBO Journal 12,32 1 1-20. Koster, M., Plessow, S., Clement, J. H., Lorenz, A., Tiedemann, H. and Knochel. W. (1991). Bone morphogenetic protein 4 (BMP-4), a member of the TGF-beta family. in early embryos of Xenopus laevis: analysis of mesoderm inducing activity. Mech. Dev. 33, 191-9.

Kuhl, M., Finnemann, S., Binder, 0. and Wedlich, D. (1996) Dominant negative expression of a cytoplasmically deleted mutant of XBRT-cadherin disturbs mesodenn migration during gastdation in Xenopus laevis. Mech. Dev. 54,7 1-82.

Landis, S. C. and Pattenon, P. H. (1981). Neural crest ceil Iineages. Trends Neurosci. 4, 172-175.

Laughon A., 199 1. DNA binding specificity of homeodomains. B iochemistry. 30: I 1 3 57- 67.

Lawson, K. A. and Pedersen, R. A. (1992). Colonal analysis of ce11 fate during gastnilation and early neundation in the mouse. In: Post-implantation Development in the Mouse. Wiley, Chichester (Ciba Foundation Symposium 165) pp. 3-26.

Lawson, K. A., Meness, J. J. and Pedersen, R. A. (1991). Clonai analysis of epiblast fate during germ layer formation in the mouse. Development 1 13. 89 1-99 1.

Le Douarin, N. M. (1982). The Neural Crea. Cambridge Univ. Press, Cambridge.

Le Douarin, N. M. and Dupin, E. (1993) Ce11 lineage analysis in neural crest ontogeny. J. Neurobiol, 24, 146- 161.

Lee, C. H. and Gumbiner, B. M. (1995) Disruption of gastrulation movements in Xenopus by a dominant-negative mutant for C-cadherin. Dev. Biol. 17 1.363-3 73.

Leonarà, D. G. B., Ziff, E. B. and Greene, L. A. (1987). Identification and charaterization of mRNAs regulated by nerve growth factor in PC 12 cells. Mol. cell. Biol. 7. 3 156-3 157.

Lewin, G. R. (1996). Neurotrophins and the specification of neuronal phenotype. Phil. Trans. Royl. Soci. London - Series B: Biol. Sci. 35 1,405-1 1.

Liem, K. F. Jr., Tred, G., Roelink, H. and Jessell, T. M. (1995). Dorsal differentiation of neural plate cells induced by BMP-rnediated signals fiom epidermal ectoderm. Cell 82,969-79.

Lindsay, R. M. (1996). Role of neurotrophins and trk receptors in the development and maintenance of sensory neurons: an overview. Phil. Trans. Royl. Soci. London - Senes B: Biol. Sci. 35 1,365-73. Lo, L-C., Johnson, J. E., Wuenscheil, C. W., Saito, T. and Anderson, D. J. (1991). Mammalian achaete-scute homolog 1 is transiently expressed by spatially-restricted subsets of early neuroepithelial and neural crest cells. Genes Dev. 5, 1524- 1537.

Lo, L., Guilemot, F., kyner, A. L. and Anderson, D. J. (1994). MASH-1:a marker and a mutation for mammalian neural crest development. Perspect. Dev. Neurol. 2, 19 1-20 1.

Lobe, C. G. (1995). Activation of Hox gene expression by Hoxa-5. DNA & Ce11 Biology 14,8f 7-23.

Lohnes, D., Kastner, P., Diench, A., Mark, M., LeMeur, M. and Chambon, P. (1993) Function of retinoic acid receptor y in the mouse. Ce11 73,643-658.

Lu M., Gong ZY., Shen WF., and Ho AD., 1991. The tcl-3 proto-oncogene altered by chromosomal translocation in T-ce11 leukemia codes for a homeobox protein. EMBO J. 1O:29O5- 1O.

Lu M., Zhang N., and Ho AD., 1992. Genomic organization of the putative human homeobox proto-oncogene HOX-11 (TCL-3) and its endogenous expression in T cells. Oncogene 7: 1325-30.

Lyons, K., Graycar, J. L., Lee, A., Hashmi, S., Lindquist, P. B., Chen, E. Y. Hogan, B.L. and Derynck, R. (1989). Vgr-1, a mammalian gene related to Xenopus Vg- 1, is a member of the transforming growth factor beta gene superfarnily. Proc. Natl. Acad. Sci. USA 86. 4554-8.

Ma, Q., Kintner, C. and Anderson, D. J. (1996). Identification of vertebnte neuronal detedation gene. Ce11 87,4342.

Macdonald, P. M. and SM,G. (1986). A molecular gradient in early Drosophih embryos and its role in speciQing the body pattern. Nature 324,672475-

Macdonald, P. M., Kerr, K., Smith, L L. and Leask A. (1993). RNA regdatory element B le 1 directs the early steps of bicoid messenger-RNA localization. Development 1 1 8. 123 3- 43.

Macdonald. P. M. and Sa,G. (1988). Cis-acting sequences responsible for anterior localization of bicoid mRNA in Drosophila embryos. Nature 336,595-98.

Maeno, M., Ong, R. C., Suniki, A., Ueno, N. and Kung, H. F. (1994). A tmcated bone rnorphogenetic protein 4 receptor alters the fate of ventral mesoderm to dorsal mesoderm: roles of animal pole tissue in the development of ventral mesoderm. Proc. Natl. Acad. Sci. USA 91, 10260-4, Manak, J., Mathies, L. and Scott, M. P. (1994). Regdation of a decapentaplegic rnidgut enhancer by homeotic proteins. Development 120.3605-36 19.

Marshall, H., Momson, A., Studer, M., Poperl, H. and Knimlauf, R. (1996) Retinoids and Hox genes. FASEB J. 10,969-978.

McCormick, A., Brady, H., Theiil. L. E. and Karin, M. (1990). Regulation of the pituitary- specific homeobox gene GHFl by cell-autonomous and environmental cues. Nature 345. 829-32.

McGinnis W. and Knunlauf R., 1992. Homeobox genes and axial patteming. Ce11 68:283-302.

McMahon, A.P. and Moon, R. T. (1989). Ectopic expression of the protosncogene int- 1 in Xenopus embryos leads to duplication of the embryonic axis. Cell 58, 1075-84.

Mead, P. E., Brivanlou, 1. H., Kelley, C. M. and Zon, L. 1. (1996). BMP4responsive regdation of dorsal-ventrai patteming by the homeobox protein Mix. 1. Nature 3 82, 3 5 7- 60.

Meyer, B. 1. and Gruss, P. (1993). Mouse Cdx-l expression during gastnilation. Deveiopment 1 17, 19 1-203.

Michelsohn, A. and Anderson, D. J. (1 992). Changes in competence determine the timing of two sequential glucocorticoids effects on sympathoadrenal progenitors. Neuron 8. 589- 604.

Mishina, Y., Suzuki, A., Ueno, N. and Behringer, R. R. (1 995). Bmpr encodes a type 1 bone morphogenetic protein receptor that is essential for gastnilation during mouse embryogenesis. Genes Dev. 9,3027-3037.

Mitrani, E. and Shimoni, Y. (1990). Induction by soluble factors of organized axial structures in chick epiblast. Science 247, 1092- 1094.

Mitrani, E. Ziv, T., Thomsen, G., Shimoni, Y., Melton, D. A. and Bril, A. (1990b). Activin cm induce the formation of axial structures and is expressed in the hypoblast of the chick. Ce11 63,495-501.

Mitrani, E., Gruenbaum, Y., Shohat, H. and Ziv, T. (1990a). Fibroblast-growth factor during mesoderrn induction in the early chick. Development 109,3 8 7-3 93.

Mlodzik, M. and Gehring, W. J. (1987). Expression of the caudal gene in the gem line of Drosophila: formation of an RNA and protein gradient during early embryogenesis. Ce11 48,465- 478. Monica, K., Galili, N., Nourse, J., Saltmao, D. and Cleary, M. L. (199 1). PBX2 and PB=, new homeobox genes with extensive homology to the human proto-oncogene PBXI. Mol. Cell. Biol. 11,6 149-61 75.

Moury, J. D. and Jacobson, A. G. (1989). Neural fold formation at newly created boundaries between neural plate and epidermis in the axolotl. Dev. Biol. 133,44-57.

Murphy, P. and Hill, R E. (1991). Expression of the mouse labial-like homeobox- containing genes Hox-2.9 and Hox-1.6 during the segmentation of the hind brain. Development 11 1,61-74.

Nakatsuji, N. (1986). Presumptive mesodemal cells fiom Xenopus Iaevis gastrula attach to and migrate on substrats coated with fibronectin or lamine. J. Ce11 Sci. 86. 109- 11 8.

New, H. V., Howes, G. and Smith, J. C. (1991). Inductive interactions during early embryonic development. Curr. Opin. Genet. Dev. 1, 196-203.

Nieto, A. M., Sargent, M. G., Wilkinson, D. G. and Cooke, J. (1994). Control of ce11 behavior during vertebrate development by Slug, a zinc finger gene. Science 264,835-9.

Nieto, M. A., Bennett, M.F., Sargent, M. G. and Wihson, D. G. (1992). Cloning and developmental expression of Sna, a murine homologue of the Drosophila Snail gene. Development 1 16,227-237.

Nieuwkoop, P. D. (1973). The organization center of the amphibian embryo: its origin. spatial organization, and morphogenetic action. Advances in Morphogenesis 10, 1-39.

Niswander, L. and Martin, G. F. (1992). Fgf4 expression during gastrulation. myogenesis, lirnd and tooth development. Development 1 14, 755-768.

Nourse J., Mellentin JD., Galili N., Wilkinson J., Stanbridge E., Smith SD.. and Cleary ML., 1990. Chromosomal translocation t(1; 19) results in synthesis of a homeobox fusion mRNA that codes for a potential chirneric transcription factor. Ce11 60535-45.

Ogawa, M., Ishikawa, T. and Irimajiri, A. (1984). Adenal chromafin cells from functional c holinergic synapses in culture. Nature 3 07,66-68.

Ogura, T. and Evans, R. M. (1995). Evidence for two distinct retinoic acid response pathways for HOXBl gene regulation. Proc. Natl. Acad. Sci. USA 92,392-6.

Oum T. and Evans, R. M. (1995). A retinoic acid-triggered cascade of HOXBl gene activation. Proc. Natl. Acad. Sci. USA 92,387-92.

Pachnis, V., Mankoo, B. and Costantini, F. (1993). Expression of the c-rer proto- oncogene during mouse embryogenesis. Development 119, 1005- 101 7. Padgett, R. W., St. Johnston, R. D. and Gelbart, W. M. (1987). A transcript fiom a Drosophila pattern gene predicts a protein homologous to the transfomllng growth factor- beta family. Nature 325,8 1-4.

Peifer, MM.and Wieschaus, E. (1994). Mutations in the Drosophila gene extradenticle affect the way specific homeodomain proteins regdate segmentai identity. Genes Dev. 4. 1209- 1223.

Poelmann, R. E. (1980). Differential mitosis and degeneration patterns in relation to the alterations in the shape of the embryonic ectoderm of early post-implantation mouse ernbryos. J. Embryoi. Exp. Morph. 55,33-51.

Popperl, H. et ai. (1995). Segmentai expression of Hoxb-l is controlled by a highly conserved autoregdatory loop dependent upon exd/Pbx. Ce11 8 1. (in press).

Power, M. A. and Tam, P. P. L. (1993). Omet of gastnilation, rnorphogenesis and sornitogenesis in mouse embryos displaying compensatory growth. Anat. Embryol. 187. 493-504.

Radice, G. L., Rayburn, H., Matsunami, H., Knudsen, K. A., Takeichi, M. and Hynes, R. 0. (1 997) Developmental defects in mouse embryos lacking N-cadherin. Dev. Biol. 1 8 1, 64-78.

Raju K., Tang S., Dube ID., Kamel-Reid S., Bryce DM., and Breitrnan ML.. 1993. Characterization and developrnental expression of TLr-1, the murine homolog of HOXI I. Mechanisms of Development 445 1-64.

Rauskolb, C. and Wieschaus, E. (1994). Coordinate regdation of downstrearn genes by extradenticle and the homeotic selector protek. EMBO J. 13,356 1-3 569.

Rauskolb, C., Peifer, M. and Wieschaus, E. (1993). extradenticle, a regulator of homeotic gene activity, is a homolog of the homeobox-containhg human proto-oncogene pbxl. Ce11 74, 1-20,

Revel, J. P. and Solurish, M. ( 1978). Ultrastructure of primary mesenchyme in chick and rat embryos. SEM 2,1041-1046.

Rivera-Pomar, R., Lu, X., Penimon, N., Taubert, H. and Jackle, H. (1995). Activation of postenor gap gene expression in the Drosophila blastoderm. Nature 376,253-256.

Rivera-Pomar, R, Niessing, D., Schmidt-Ott, U., Gehring, W. J. and Jackle, H. (1996). RNA binding and translational suppression by bicoid. Nature 379,746-749. Roberts, C. W., Shutter, J. R. and Korsrneyer, S. J. (1994). Hoxl 1 controls the genesis of the spleen. Nature 368, 747-9.

RoeIi.uk, H., Augsburger, A., Heemskerk, J., et al., (1994). Floor plate and motor neuron induction by vhh- 1, a vertebrate homolog of hedgehog expressed by the notochord. Ce11 76,76 1-775.

Rollhauser-ter-Horst, 1. ( 1979). Artificial neural crest formation in in amphi bia. Ana. Embryol. 157, 1 13-120.

Ruberte, E., Dolle, P., Chambon, P. and Momss-Kay, G. (1991). Retinoic acid recepton and cellular retinoid binding proteins II. Their differential pattern of transcription during early morphogenesis in mouse embryos. Development 11 1,45-60.

Rupp, R., Hollenberg, S., Zhuang, Y. and Lassar, A. (1991). The myoD gene family: nodal point during specification of the muscle cell lineage. Science 25 1,761-766.

Scherson, T., Serbedjia, G., Fraser, S., et al., (1 993). Regulative capacity of cranial neural tube to fom neural crest. Development 1 18, 1049- 1O6 1.

Seidl, K. and Unsicker, K. (1989). The determination of the adrenal medullary ce11 fate during embryogenesis. Dev. Biol. 136,48 1-490.

Selleck, M. A. J. and Bro~er-Fraser,M. (1995). Origins of the avian neural crest: the ro le of neural plate-epidermal interactions. Development 12 1,526-53 8.

Shah, N. M., Groves, A. K. and Anderson, D. J. (1996). Alternative neural crest ce11 fates are instructively promoted by TGF-beta superfamily members. Ce11 85, 33 1-43.

Shen, R., Chen, Y., Huang, L., Vitale, E. and Solursh, M. (1994). Charactenzation of the human USX-I prornoter and an enhancer responsible for retinoic acid induction. Cell. Mol. Biol. Res. 40,297-3 12.

Shirneld SM. and Sharpe PT., 1992. Cell-surface changes induced by ectopic expression of the murine homeobox gene Hox-3.3. Biochimica Et Biolphysica Acta. 1 l36:253-8.

Shiurba, R. A., Jing, N., Sakakura, T. and Godsave SF. (1991). Nuclear translocation of fibroblast growth factor during Xenopus mesoderm induction. Development 1 13,487-93.

Sieber-Blum, M. and Cohen, A. M. (1980). Clonal analysis of quail neural crest cells: they are pluripotent and differentiation in vitro in the absence of non-crest cells. Dev. Biol. 80,96-106. Smith, D. L. and Johnson, A. D. (1992). A molecular mechanisrn for combinatorid control in yeast: MCMI protein sets the spacing and orientation of the hoemodomains of an a2 dimer. CeU 68,283-302.

Smith, J. C. (1989). Mesodem induction and mesoderm-induchg factors in early amphibian development. Deveiopment 105,665-77

Smith, J. C., Price, B. M., Van Nimmen, K. and Huylebroeck , D. (1990). Identification of a potent Xenopus mesodem-inducing factor as a homologue of activin A. Nature 345. 729-3 1.

Smith, W. C. and Harland, R M. (1992). Expression cloning of noggin. a new dorsalking factor locdized to the Spemann organizer in Xenopus embryos. Ce11 70. 829- 40.

Smith, W.C. and Hariand, R. M. (1991). Injected Xwnî-8 RNA acts early in Xenopus embryos to promote formation of a vegetal dorsalizing center. Ce11 67. 753-65.

Smith, W. C., Knecht, A. K., Wu, M. and Harland, R. M. (1993). Secreted noggin protein rnirnics the Spemann organizer in dorsalizing Xenopus mesoderm. Nature 36 1,547-9.

Snell, G. D. and Stevens, L. C. (1966). Early embryology. In: Biology of the laboratory mouse. Green, E. L., ed. McGraw-Hill, New York, pp. 205-245.

Snow, M. H. L. (1977). Gastruiation in the mouse: growth and regionalisation of the epiblast. J. Embryol. Exp. Morph. 42,293-303.

Snow, M. H. L. (1981). Autonomous development of parts isolated fiom prirnitive- streak-stage mouse embryo. Is development clonal? J. Embryol. Exp. Morph. 65 (suppl). 269-287.

Snow, M. H. L. and Bennett, D. (1978). Gastdation in the mouse: Assessrnent of ce11 populations in the epiblast of t'%"'' embryos. J. Embryol. Exp. Morph. 57.39-52.

Snow, M. H. L. and Tarn, P. P. L. (1979). 1s compensatory growth a complicating factor in mouse teratology? Nature 279.557-559.

Sokol, S., Wong, G. G. and Melton, D. A. (1990). A mouse macrophage factor induces head structures and organizes a body axis in Xenopus. Science 249,56 1-4.

Sokol, S., Christian, J. L., Moon, R. T. and Melton, D. A. (1991). Injected Wnt RNA induces a complete body axis in Xenopus embryos. Cell67,741-52. Solurish, M. and Revel, J. P. (1978). A scanning electron microscope study of ce11 shape and ce11 appendapes in the primitive streak region of the rat and chick embryo. Differentiation 1 1, 185-1 90.

Sommer, L., Ma, Q. and Anderson, D. J. (1996). neurogenim, a novel family of atonal- related bHLH transcription factors, are putative mammalian neuronal determination genes that reveal progenitor ce11 heterogeneity in the developing CNS and PNS. Mol. Cell. Neurosci. 8,22 1-41.

Soprano, D. R. and Soprano, K. J. (1995). Retinoids as teratogens. AM. Rev. Nutrition. 15.1 11-32.

Spyropoulos, D. D. and Capecchi, M. R. (1 994). Targeted disruption of the eïen-skipped gene, evxl, causes early postimplantation lethality of the mouse conceptus. Genes Dev. 8, 1949-6 1.

St Johnston, D. (1995). The intracellular localization of messenger RNA. CeIl 8 1. 16 1- 170.

St Johnston, D. and Nusslein-Volhard, C. (1992). The Ongin of pattern and polarity in the Drosophila embryo. Ce11 20 1-2 19.

Stemple, D. L. and Anderson, D. J. (1992). Isolation of a stem ce11 for neurons and glia derived fiom marnmalian neural crest. Ce11 71,973-985.

Stemple, D. L., Mahanthappa, N. K. and Anderson, D. J. (1988). Basic FGF induces neuronal differentiation, ce11 division, and NGF dependence in chromaffin cells: a sequence of events in sympathetic development Neuron, 1, 5 17-525.

Stephens, L. E., Sutherland, A. E., Klimanskaya, 1. V., Andrieu, A.. Meneses. J., Pedenon, R. A. and DAMSKY, C. H. (1995) Deletion of pl integrins in mice results in inner cell mass failure and pen-implantation lethality. Genes Dev. 9, 1883- 18%.

Stem, C. and Ingham, P. (1 992). Gastrulation. The Company of Biologists Limited. Cambridge.

Stnrhl, G.,Struhi, K. and Macdonald, P. M. (1 989). CeIl 57, lX9-Iî63.

Subramanian, V., Meyer, B. 1. and Gruss, P. (1995). Dimption of the murine homeobox gene Cdxl affects axial skeletal identities by altering the mesodermal expression domains of Hox genes. Cell83,641-53.

Sun, B., Hursh, D. A., Jackson, D. and Beachy, P. A. (1995). Ultrabithorax protein is necessary but not sufficient for full activation of decapentaplegic expression in the viseral mesoderm. EMBO J. 14,520-535. Sundin, O.H., Busse, H. G., Rogers, M. B., Gudas, L. I. and Eichele, G. (1990). Region- specific expression in early chick and mouse embryos of Ghox-lob and Hox M. vertebrate homeobox containing genes related to Drosophila Labial. Development 108, 47-58.

Suzuki, A., T'hies, R. S., Yamaji, N., Song, L J., Womey, J. M., Murakami. K. and Ueno, N. ( 1994). A tnincated bone morphogenetic protein receptor affects dorsal-ventral patternhg in the early Xenopus embryo. Proc. Natl. Acad. Sci. USA 9 1, 10255-9.

Taira, M., Otani, H., Saint-Jeannet, &P. and Dawid, 1. B. (1 994). Role of the LIM class homeodomain protein Xiim-1 in neural and muscle induction by the Spemann organizer in Xenopus. Nature 372,677-679.

Takada, S.. Stark, k. l., Shea, M. J., et ai., (1994). Wnt-3a regulates somite and tailbud formation in the mouse embryo. Genes Dev. 8, 174-1 89.

Takeichi, M. (1988). The cadherïnes: Celi-ce11 adhesion molecules controllhg animal morphogenesis. Development 102,639-655.

Tarn, P. P. L. (1984). The histogenetic capacity of tissues in the caudal end of the embryonic axis of the mouse. J. Embryol. Exp. Morph. 82,253-266.

Tarn, P. P. L. (1 988). The post-implantation development of Mitomycin C-treated mouse blastocysts. Teratology 37,305-2 12.

Tarn, P. P. L. and Beddington, R. S. P. (1992). Establishment and organization of germ layen in the gastrulating mouse embryo. In: Postimplantation Development in the Mouse. Wiley, Chichester (Ciba Foundation Symposium 165), pp. 27-49.

Tarn, P. P. L. and Meier, S. (1982). The establishment of a somitomeric pattern in the mesoderm of the gastnilation mouse embryo. Am. J. Anat. 164.209-225.

Tarn, P. P. L. and Tan, S. S. (1992). The somitogenetic potential of cells in the primitive streak and the tail bud of the organogenesis-stage mouse embryo. Development 1 15. 703- 71 5.

Tarn, P. P. L., Williams, E. A. and Chan, W. Y. (1993). Gastnilation in the mouse embryo: ultrastructural and molecdar aspects of germ layer morphogenesis.

Tarn, P. P.L and Beddington, R. S. P. (1987). The formation of mesodemal tissue in the mouse embryo during gastnilation and early organogenesis. Development 99, 109- 1 26.

Tang, S. J. (1994) Studies on the DNA-binding activity of the HOX 11 homeodomain protein. M. Sc. Thesis, University of Toronto. Thomsen, G., Woolf, T., Whitman, M., Sokol, S., Vaughan, J., Vale, W. and Melton, D. A. (1990). Activins are expressed early in Xenopus embryogenesis and can induce axial rnesoderm and anterior structures. Ce11 63,485-93.

Tisser-Seta, J-P., Hirsch, M-R, Vdarche, I., Brunet, J-F. and Goridis, C. (1993). A possible like between ce11 adhesion receptoa, homeodomain proteins and neuronal identity. C. R. Acad. Sci. (III) 3 16, 1306- 13 15.

Unsicker, K., Dnsch, B., Otten, J., and Thonen, H. (1978). Nerve growth factor-induced fiber outgrowih nom isolated rat adrenal chromaffin cells: impairment by glucocorticoids. Proc. Natl. Acad. Sci. USA 75,3498-3502.

Vdarche, I., Tisser-Sate, J-P., HUsch, M-R., Marthe& S., Goridis, C. and Brunet. J-F. (1 993). the mouse homeodomain protein Phox2 regulates Ncam promo ter activity in concert with cux/CDP and is a putative determinant of neurotransmitter phenotype. Development 1 19,88 1-896. van Dijk, M. and Murre, C. (1994). extradenticle raises the DNA binding specificity of homeotic selector gene products. Ce11 78,617624.

Van Straaten, H. W. M., Heddhg, E. J. L, M., Wiertz-Hossels, F. T. et al., (1988). Effects of the notochord on the differentiation of a floor plate area in the neural tube of the chick embryo. Anat. Embryol. 177,3 17-324.

Verdi, J. M. and Anderson, D. J. (1994). Neurotrophins regulate sequentiai changes in neurotrophin receptor expression by sympathetic neuroblasts. Neuron 13. 1359-72.

Weeks, D. L. and Melton, D. A. (1987). A matemal mRNA localized to the vegetal hernisphere in Xenopus eggs codes for a growth factor related to TGF-beta. Ce11 5 1. 86 1 -

Weinstein, D. C., Aitaba, E. S., Chen, W. S., HodIess, P., Prezoiso, V. R., Jessel, T. M. and Darnell, J. E. Jr. (1994). The winged helix transcription factor HNF-3P is required for notochord development in the moue embryo. Ce11 78,575-588.

Weintniub, H., Davis, R., Tapsccott, T., Thayer, M., Krause, M., Benezra, R., B LackwelI, T. K., Turner, D.,

Wilkinson DG., Bhatt S., Cook M., Boncinelli E., and Knunlauf R., 1989. Segmentai expression of Hox-2 homeobox-containing genes in the developing mouse hindbrain. Nature 34 1 :405-9. Wilkinson, D.G., Peters, G., Dickson, C. and McMahon, A. P. (1988). Expression of the FGF-related proto-oncogene int-2 during gastdation and nedation in the mouse. EMBO J. 7,691-695.

Wilson, V., Manson, L., Skarnes, W. C. and Beddington, R. S. (1995). The T gene is necessary for normal mesodemal morphogenetic ce11 movement during gastnilation. Development 12 1: 877-86.

WUmier, G., Blessing, M., Labosky, P. A. and Hogan, B. L. M. (1995). Bone morphogenetic protein-4 is required for mesoderm formation and patteming in the mouse. Genes Dev. 9,2 105-2 116.

Yamada, G., Mansouri, A., Torres, M., Stuart, E. T., Blum, M., SchuItz, M., De Robertis, E. M. and Gruss P. (1995). Targeted mutation of the murine goosecoid gene results in craniofacial defects and neonatd death. Development 12 1,291 7-22.

Yamada, T., Placzek, M., Tanaka, H., et al., (1991). Control of ce11 pattern in the developing nervous system: polarizing activity of the floor plate and notochord. Ce11 64, 635-647.

Yamaguchi, T. P., Harpal, K., Henkemeyer, M. and Rossant, I. (1994). fgfr-2 is required for embryonic growth and mesodermal patternhg during mouse gastnilation. Genes Dev. 8,3032-3044.

Yamamoto, K., Ko, L. J., Leonard, M. W., Beug, H.,Orkin S. H. and Engel, J. D. (1990) Activity and tissue-specific expression of the transcription factor NF-El multigene family. Genes Dev. 4, 1650-1662.

Zappavigna, V., Sartori, D. and Mavilio, F. (1994). Specification of Hox protein function depends on DNA-protein and protein-protein interactions, both rnediated by the homeo domain. Genes Dev. 8,73244.

Zhang, H., Catron, K. M. and Abate-Shen, C. (1996). A role for the Msx-l homeodomain in transcriptional regdation: residues in the N-terminal ami mediate TATA binding protein interaction and transcriptional repression. Proc. Natl. Acad. Sci. USA 93, 1764-9.

Zon, L. I., Tsai, S-F., Burgess, S., Matsuidaira, P., Bms, G. A. P. and Orkin. S. H. (1990). The major human erythroid DNA-binding protein (GF- 1): primary sequence and Iocalization of the gene to the X chromosome. Pro. Natl. Acad. Sci. USA 87,668-672. Chapter 2

Regulation of mammalian mesoderm development by a BMP/Tùr-2 signalling pathway

Work in this chapter forms the basis for the manuscript: Shao Jm Tang, Pamela A. Hoodless, Zhan Lu, Martin L. Breitman, Roderick R. McInnes, Jefney L. Wrana and Manuel Buchwald (1997). A BMP/TIx-2 signailhg pathway in mammalian rnesoderm development. (manuscript submitted).

The work that I perfomed in this chapter was cloning of TLx-2 gene, characterization of 77.x-2 expression in the early mouse embryo, creation of the TLr-2 targeted mutation in ES cells and in transgenic moue lines, determination of genotypes of mice and embryos, phenotypic analysis of the mutant embryos by histology, detemination of the mesoderm defects in Tuc-2 mutant embryos using molecular marken, BMP2 induction of Tuc-2 expression in the early moue embryo cultured in vitro, cloning of TLx-2 promoter, and construction of pTk-Lux report plasrnid. P. Hoodless and J. Wrana performed transfection assays with pTlx-Lux to detennine the response of the Tlx-2 prornoter to BMP2. 2. Lu provided help in collecting some of the early mouse embryos used for phenotypic analyses. 2.1. Abstract Mesoderm formation and patternhg during gastdation are fundamental for establishing the basic body plan of the mammalian embryo. Signaiiing cascades initiated by TGF-P-related factors are crucial for this developmental process. A homeobox gene, named Tlx-2, that regulates mesoderm formation in moue ernbryos is identified in this study. IZr-2 is expressed in the ectoderm and the primitive streak at E7.0 and in the posterior streak at E7.5. Exogenous BMP-2 cm induce ïk-2 expression in the ectoderm of in vitro cultured E6.5 embryos. h addition, a 1.6 kb promoter mentof 7k-2 can respond to BMP-2, activated BMP-type 1 receptors and Smadl in P 19 cells. These data strongly suggest that Tlx-2 is direct dowfl~treamtarget gene of the BMPZ4 signalling pathway. A targeted mutation of Tlr-2 is created in the mouse, which leads to embryonic lethality during E7.00E7.5. The homozygous embryos are defective in mesodem formation, with primitive streak and ectodermal maffomations. These results demonstrate an essential role of 22-2 in primitive streak organization and mesodemal formation, and suggest that Tlr-2 executes specific roles of BMP signalling during mesoderm development. Taken together, these findings suggest a BMP/Tlx-3 signalling pathway involved in the molecular control of mamrnalian mesodenn formation. 2.2. Introduction Mesoderm formation is a key developmental process in early marnmalian embryogenesis (Hogan et al., 1994). During gastnilation, active proliferation and rearrangement of epiblast cells leads to the formation of a primitive streak in the postenor midine, where prospective mesodemal cells delaminate fiom the ectoderm and ingress

into the embryo to form a mesoderm layer (Hogan et al., 1994; Tam et al., 1993). The processes of generation, patteming, proliferation and differentiation of mesodemai cells in the primitive streak are believed to be highiy coordinated by an uncharacterized molecular cascade initiated by mesodem inducing signals. In vertebrates, multiple growth factors, including membes of the fibroblast growth factor (FGF), Wnt, and transfomiing-growth factor+ (TGF-P) families. are involved in regulating mesoderm induction (Smith, 1993; Smith, 1 995). Among the strongest candidates for mesoderm inducing signals are memben of the TGF-P superfarnily, such as Vgl, activins, the Nodal-related factor Xnrl-3 and bone morphogenetic protein 4 (BMP-4) (Smith, 1995). Injection of their RNA cm affect the pattern of mesodemai differentiation in Xenopus embryos (Smith, 1995). Furthemore. overexpression of dominant negative recepton for these factors blocks mesoderm formation and axial patternhg (Smith, 1995). In marnmals, gene targeting expenments have demonstrated that disruption of BMP-4 and its receptor Bmpr (ALK3) leads to defects in moue mesoderm formation (Winnier et al., 1995; Mishina et al.. 1995). A mutation mediated by a viral insertion in mouse Nodal affects primitive streak formation and mesoderm patterning (Codon et al., 1994). Despite the compelling evidence of the central role of TGF-f3-related factors in vertebrate mesoderm formation, little is known. however, as to how these signals execute their function in this developmental process. Transcription responses to TGF-prelated signais in the early Xenopus embryo are necessary to pattern mesoderm. Previous studies have identified several irnrnediate early genes, including homeobox genes such as Mix.1, Mk.2, Xvent-2, and Xom, that respond to TGF-P related factors (Mead et al., 1996; Huang et al., 1995; Chen et al.. 1996; Onichtchouk et al., 1996; Ladher et al., 1996). The putative role of these genes in mediating the function of TGF-P signahg has been inferred from the abnormal mesoderm patteming induced by overexpression of the protein product. but the requirement of these genes during normal mesoderm development rernauis to be determined. In the case of mamrndian development, littie is known about the genes that respond to known TGF-B related mesodem inducing signals although a nurnber of genes, including several transcription factors such as Brachyury and HNF-3P, have been shown to be required for specific aspects of mesoderm formation (Wilson et ai.. 1995; Ang and Rossant, 1994). Homeobox genes are members of a large family of genes that regulate various developmental processes, incfuding embryonic patteming, tissue specification and ce11 differentiation (Knimlauf, 1994). Several horneobox genes are expressed in the primitive streak region of the mouse embryo, but their functions in mesoderm patterning are largely unknown (Tm et al., 1993). We show here that the 27x-2 homeobox gene, a mouse gene related to the human T-ceIl leukemia oncogene HOXI I (Kennedy et al., 199 1 ; Hatano et al., 1991 ; Dubé et al., 199 1; Lu et al., 199 1), is expressed in the primitive streak in E7.0 embryos as well as in the posterior primitive streak at E7.5. We aiso demonstrate that exogenous BMP-2 can induce ectopic expression of 77x2 in the epiblast of E6.5 embryos cultured in vitro, and that the ïïx-2 prornoter can respond to BMP- in P 19 cells. in a BMP type4 receptor and Smadl dependent manner. In addition, a targeted mutation of Tlx-2 causes prominent defects in the primitive streak with markedly reduced mesoderm formation. Together, these results indicate that Tlx-2 functions downstream of a BMP signalling pathway and is essential for mouse mesoderm development. These findings defme a BMP/Tlx-2 signalling pathway required for mesoderm formation in marnmalian embryos. 2.3. Materiais and Methods

Screening of genomic and cDNA iibraries The homeobox fragment of HOXI2 was used as a probe to scrcen a mouse 129fsvj genornic Iibrary. To clone the TLx-2 cDNA, the sequence of the f~ exon was isolated from the genomic clone and used as the probe to screen an E1O.O mouse embryonic cDNA Iibrary (Novagen).

Mole rnount RNA in situ

Whole mount in situ hybridization was performed as described (Wilkinson. 1992). Two antisense DIG-riboprobes, derived fiom different regions of the 77x4 cDN.4, were generated for the hybridization. Both probes yielded the same expression pattern, whereas the corresponding sense probes did not produce specific signals.

Construction of the Th2 targeting vector A BamHI fragment (426) containing the fist exon was isolated from the genomic clone, and cloned into pGEM7 to create pGEM7-T1x-2/4.7 used for the vector construction. A Stul-NcoI fragment (1.0 kb) spanning from an upstream StuI site to a NcoI site located at the initiation codon was used as the 5' homologous am, and was fused with the LacZ coding sequence in &me, by clonhg into the NcoVSpeI (blunted) sites of a LacZ-pBSKS (+) plasrnid. A fiagrnent containing the 5' arm and Lac2 was then released by Noti (blunted) and Sa11 digestions and cloned into SacII (b1unted)BaioI sites of the pGN plasrnid (Le Mouellic et al., 1992) to replace the Lad sequence in pGN, creating pGN-TIx-2(5')-Lad. A NotI @lunted)/NsiI hgrnent (2.6 kb) derived from pGEM7-T1x-214.7, extending fiom a Ndsite downstream of the first exon into the NsiI site in the polylinker, was used as the 3' homologous arm &er cioning into the BamHI (blunted)/NsiI sites in pGN-Tlx-Z(5')-LacZ. The vector was linearized by NsiI digestion. Electroporation and selection of ES cells R1 ES cells were used to introduce the targeted mutation. ES cells were handled, transfected and selected according to established methods (Joyner, 1993). The targeted cell lines were first identified by Southern blot, with BamHI digestion of genomic DNA and the 5' extemal probe (Fig. 3), and then confimied by Neo and Lac2 extemal probes (data not show). Of 124 G418 resistant colonies screened, 8 were found to have a correctly targeted allele, an overall fiequency of approximately 1 in 15.

Generation of chimeras, hetero-, and homozygous progeny containing the Tb2 targeted ailele The ES cells fiom three targeted clones were used to generate chirneric mice by aggregating with CD- I modae (Joyner, 1993). The resulting chimeras were bred to CD- 1 females and offspring with black coat colour were tested by Southern analysis for the presence of the targeted allele. Chimeras fiom two ce11 lines tmnsrnitted the mutation thmugh the germline. Heterozygous offspring were interbred to generate homozygous progeny. Genotypes were detemiined by either Southern blot or PCR as indicated in the figure legends.

Genotyping by Southern blot and PCR Adult mice and embryos after E9.5 were genotyped by Southem blot analysis. Early stage embryos were genotyped by PCR with DNA extracted fkom cultured ectoplacental cones. Three primers were used in each reaction (Fig. la): a.

S'TCACCTTCCCCTGGATGGAC 3'; b. S'CCACGTCGGATTGAACAGAG3'; c. S'ATCGCCTTCTTGACGAGTTC3'. The PCR products were resolved on a 1.5% agarose gel. The sizes of the amplified f'ragments are: a+b=l73bp; b+c=325bp (Fig. 2c). Construction of the pTlx-Lux reporter plasmid

An 1.6 kb promoter sequence was isolated by BamHIMcoI digestion (NcoI was blunted with Mung Bean Nuclease) from a Th-2 genomic clone and cloned into the

BglII/HindIII sites (HindIII was blunted with Klenow fragment) of the pGL2-Basic plasmid (Promega) to constmct the pTlx-Lux reporter plasmid. The 1.6 kb prornoter fragment extends upstream fiom the ktATG codon of TLx-2, which was destroyed by

Mung Bean Nuclease.

Transcriptional response assays Pl 9 cells were cultured in a-MEM containhg 7.5% calf senim and 2.5% fetal caif sem. Cells were tninsiently transfected with the reporter plasrnid (pTlx-Lux) and the indicated constmcts using the calcium phosphate-DNA precipitation method as described previously (MaciasSilva et al. 1996). To induce the reporter consmict. cells were incubated ovemight with BMP2 at the indicated concenaations. Luciferase activity was measured using the luciferase assay system (Promega) in a Berthold Lumat LB 9501 luminometer. Transfection efficiency was nomdized by CO-transfectionwith CMV-p- galactosidase which was measured using an ONPG colorimetric assay.

2.4.1. Identification and early expression of Th-2 The 2-2gene was cloned by screening a rnouse genomic library with a probe denved from the homeobox region of HOXI1 (Dubé et al., 1991). The corresponding cDNA was then isolated from an E10.0 mouse embryonic cDNA library. Northem analysis indicated that the 77x-2 mRNA was approximately 1.6 kb (data not shown). The deduced amino acid sequence encoded by 27x02 was identical to that of an incornpiete

Figure 2-1. The expression pattern of TLU-2 in the eariy mouse embryo. a Lateral view of an E6.5 embryo. No specifïc stauung is observed in the embryo. b. Lateral view of an E7.0 embryo. Note the expression in the posterior region corresponding to the primitive streak (arrow). Weak staining was aiso observed in the antenor ectoderm after longer colour development (data not shown). c. Dorsal-lateral view of an E7.5 embryo. Note the expression in the proximal-posterior end of the embryo corresponding to the posterior primitive streak (arrow) and in the two strips of cells extending anteriorly, correspondhg to the lateral part of the prospective neural ectoderm (arrowheads). d. Dorsal view of an E8.5 embryo. Note the 7k-2 expression in the posterior end and the primitive streak region (arrow), as well as in the node (arrowhead). e, f. Cross sections of an E7.5 embryo, at the levels of the arrow (e) and line (f) indicated in c. Note the expression in the posterior streak (arrow in e) and in the prospective neural ectoderm except the midline region (arrows in t). The arrowheads in e and f indicate the head folds. cDNA clone (HoxllLi)reported previously (Dear et al., 1993), suggesting that they represent the product of the same gene. To understand the function of Tb-2 in development, we first determined its

expression pattern in mouse embryos by whole mount in situ hy bridization andy sis

(Wilkinson, 1992). Expression was first detected in the primitive streak of E7.0 embryos (Fig. Ib). At E7.5, the expression was seen in the posterior primitive streak and at a position consistent with the edges of the presumptive neural ectoderm extending

anteriorly (Fig. lc). Histological analysis of E7.5 embryos after in situ hybridization revealed that the expression of 77x-2 was localized in the ectoderrn and mesoderm at the posterior end of the primitive streak (Fig. le). However, in the region immediately

anterior to th, expression was only observed in the primitive streak ectoderm with the

exception of the midline, but was not detected in the mesoderm (Fig. ln. In more anterior regions, TL'-2 expression was observed at the edges of the neural ectoderm in the posterior half of the embryo (Fig. Ic; data not shown). In E8.5 embryos. the most

prominent expression was in the posterior end of the embryo as well as in the region

flanking the primitive streak (Fig. Id). Relatively low expression was also detected in the node of the E8.5 embryo (Fig. Id). By E9.0, expression of Th-2 could not be detected at the postenor end of the embryo. TLx-2 expression der E9.0 was restricted to the developing PNS (data not shown).

2.4.2. Activation of Tb2expression by BMP signalüng

The expression of TLr-2 in the primitive streak suggests a potential role for this gene in mesoderm formation and patterning. Previous studies have demonstrated that CMP-4 is expressed in the postenor primitive streak of E65E7.5 mouse embryos (Winnier et al.. 1995), and that BMP signalling is required for mesoderm development (Winnier et al.. 1995; Mishina et al., 1995). We therefore decided to examine if Tlx-2 expression is regulated by BMP signalling in the moue embryo. To this end, we detemiined whether O 0.2 1 2 10 20 -;.- C BMP Concentration (nM) aO

Smadl Smadl(A458) Figure 2-2. Activation of TLr-2 expression by BMP-2. The activation of 7ïx-2 expression is detemiined both in embryos cultured in vitro (a and b) and in P 19 cells (c- e). a An E6.5 wild type embryo cultured in the absence of BMP-2 followed by in situ hybrihtion with n*-2. b. An E6.5 embryo cultured in the presence of BMP-2 for three hours followed by Ni situ hybridization with TLr-2. Note the TLr-2 expression in the epiblast surrounding the proarnniotic cavity. c. BMP2 cm activate the 7lx-2 promoter in a dose dependent manner. Pl9 cells were transientiy transfected with pTlx-Lux and incubated with the indicated concentrations of BMP? or activin. The promoter does not respond to activin indicating a BMP-specific response of the Tlx-2 promoter. d. Induction of 77x-2 is mediated through the BMP2 type 1 recepton. Pl 9 cells were transiently transfected with prix-Lux, a kinase-deficient type II receptor [ActRIIB(KR)] and constitutively active type 1 BMP receptors (ALK3* or ALK6*) as indicated. Relative luciferase activity is shown following nomalization with P-gal. ActRIIB(KR) blocks the BMP2 dependent induction of the TLr-2 promoter while ALU* and ALK6* results in sti-ong activation. e. Smad 1 enhances BMP2-dependent induction of the T1x2 promoter. Pl9 cells were transfected with pTlx-Lux and either Smadl or a phosphorylation site deletion of Smadl (~458)and incubated in the presence or absence of InM BMP7. Relative luciferase activity is plotted following nomalization with p-gal. Smadl increases the responsiveness of this promoter to BMP2 and this increase is dependent on phosphorylation of the C-terminal serine residues. Table1 : BMP2 inducti on of TIx-2 expression in In Vitro cultured E6.5 embryos

hbryos with TIx-2 expression/ Tota I embryos(%) Experiment s - BMP2 + BMP2

1 O! 6 (O) 2 O/ 5 (O) 3 O/ 6 (O) Tot al 01 17 (O) exogenous BMP couid induce the expression of Th-2. Embryos at E6.5, just prior to the

stage when n-2expression is initiated in vivo, were explanted and cultured in vitro in the presence or absence of BMPZ, which is highly related to BMP4 and is capable of interacting with the sarne receptors and activating dowll~treamcomponents of BMP

signailing pathway (Hogan, 1996). TLx-2 expression in the cultured embryos was examined by whole mount in situ hybridization. Consistent with the observations described above, TLr-2 was not expressed in control embryos cultured in the absence of BMP2 (Fig. 2a). However, treatment of embryos with 10 nM BMP2 for 3 hours resulted in the induction of TLxt expression throughout the epiblast layer in approximately 60% of treated embryos (Fig. 2b; Table 1). The rapid induction of 77'-2 expression strongly suggests that this gene is an immediate early target for BMP signalling. To characterize more fully the induction of Th2 expression by BMP signalling pathways, we isolated a 1.6 kb fiagrnent upstream from the first ATG codon of the T2.d and cloned it upstream of a luciferase reporter gene, to create pT1x-Lux. To test the activity of this promoter, we utilized Pl9 cells. which are derived fiom a mouse embryonic carcinoma and can be induced to di fferentiate into derivat ives of the three germ layers in response to BMPs and activins (Hoodless and Hemmati-Brivanlou. 1997). Transient transfection of pTlx-Lux into Pl9 cells resulted in low basal levels of transcription of the reporter gene (Fig. 2c). However, treatment of the cells with varying doses of BMP2 resulted in a 3-4-fold induction of the 7k-2 promoter, reaching maximal levels at 2 nM BMP2 (Fig. 2c). Treatment of the ceils with activin had no effect on induction of this promoter (Fig. 2c), suggesting that the induction was specific to BMPs. BMP2 signals through multiple heteromenc complexes of type 1 and type II sedthr kinase receptors (Hogan, 1996). To identie the signalling recepton that potentially mediate BMP2-dependent induction of pT1x-Lux, we first tested whether a kinase deficient version of ActRIIB [ActRII(KR)] could inhibit BMP signailing. Consistent with previous studies in Xenopus (Hemmati-Brivanlou and Thomsen, 1999, expression of this dominant negative type II receptor suppressed BMPZ-dependent induction of the 72-2 promoter (Fig. 2d). Furthemore, expression of constitutively activated forms of the BMP type 1 receptors ALK3 or ALK6 resulted in strong activation of this promoter (Fig. 2d). Induction of the TLx-2 promoter by constitutively active type 1 receptors even in the presence of the dominant negative type II receptor (Fig. 2d) together with the rapid induction observed in vivo (Fig. 2b) niggests that activation of TLr-2 is not secondas. to autocrine signalling, but is a consequence of direct activation of the BMP signalling pathways. TO further characterize the downstream components in this BMP signalhg pathway we assessed whether the MAD-related protein Smadl couid increase BMP2- dependent induction of the ?Zr2 promoter. Smadl is the mammalian homologue of

Drosophilu Mad, and was previously shown to function in BMP signalling pathways in vertebrates (Hoodless et al., 1996; Graff et al., 1996; Thomsen, 1996). For these studies we utilized suboptimal doses of ligand and tested whether coexpression of Smadl could increase sensitivity of the cells to BMPZ. Under these conditions, treatment of control cells with InM BMP2 resulted in a 2-fold induction of the 7?k2 promoter (Fig. Ze). However, cotransfection with Smadl increased BMP-responsiveness of this promoter to almost 5-fold over the controls (Fig. Ze). Cotransfection with Smadl alone led to an increase in basal transcription fiom the reporter (Fig. 2e), consistent with previous obsewations that overexpression of Smad proteins can initiate TGFB signalling (Graff et al., 1996). Previous studies in TGF-P and BMP signalling have shown that the C- terminal SSXS motif of Mad-related proteins is the target for receptor-mediated phosphorylation of the protein (Macias-Silva et al., 1996; Kretzchmar et al., 1997). To test whether this Smadl -mediated signalling required receptor-mediated phosphorylation of the protein, we constructed SmadI(A458), in which the C-terminal SSXS motif is deleted fiom the protein. Cotransfection of this conrrnict resulted in an abrogation of the Smadl-dependent increase in TLx-2 activation by BMP2 (Fig. 2e). These data strongly suggest that receptor mediated phosphorylation of Smadl is required for BMP2- dependent induction of the 7k-2 promoter. Collectively, our results demonstrate that the TIx-2 gene is a target of BMP2/4 signding pathways during early mouse development.

2.43. The TLx-2 targeted mutation causes early embryonic lethaiity Previous studies have demonstrated an essential role of BMP signailing in early mouse development (Winnier et al., 1995; Mishina et al., 1995). The identification of

Ex-2 as a direct target gene of BMP signalling provides an opportunity to dissect the complex downstrearn functions of the signalhg of BMPs. By analyzing the function of TLr-2, one may be able to define the specific function of BMP signalling that is carried out by this target gene duruig development. To directly assess the role of 7'21-2 . we created a mutation at the Tlx-2 locus by gene targeting (Joyner. 1993). The targeted mutation was intmduced by replacing most of the fmt exon, starting fiom the initiation codon, with a Lac2 sequence and a Neor expression cassette (Fig. 3a). From two transfections of R1 ES cells, eight ce11 lines with the expected targeted mutation were identified (Fig. 3b; data not shown). Germiine transmission of the mutation was obtained fiom chimeric mice derived from two independent-targeted ce11 lines (Table 2).

In F2 offspnng derived fiom the two ce11 lines, no homozygous mice were identified, indicating that the mutation was lethai during embryogenesis (Table 2). The heterozygotes, on the other hand, appeared to be normal. To determine when the homozygous embryos died, ernbryos at different stages were analyzed (Fig 3c: Table 3). At E6.5, we obsenred no obvious morphological differences between mutant and wild type embryos (data not shown). However, at E7.0 mutant embryos were observed that were delayed in development, with ectodermal layers that were less distinct than normal litter mates (Fig. 4a). Some homozygous embryos at this stage were not morphologicdly distinguishable from their wild type litter mates (Fig. 4a). At E7.5, homozygous embryos were arrested in development and often appeared as spherical structures (Fig. 4b). In 1 Targeting vector LacZ Neo 1I 5' probe 3. 3' b // ,-; I // TIx-2 targeted allele B S Neo 8 Figure 2-3 The targeted mutation of TLr-2. a Diagram of the Tlx-2 wild type locus, the targeting strategy, and the TLr-2 targeted locus. The diagram is not drawn to scaie. Arrowheads indicate the PCR primer5 used for genotyping. Primers a and b are designed to ampl@ a 173 bp hgrnent from the wild type locus, while c and b are expected to ampli@ a fragment of 325 bp From the targeted locus. B: BamHI: S: StuI; Nc: NcoI; No: Noti. b. Identification of the Iirx-2 targeted ES ce11 lines by Southem analysis. The ES ce11 DNA was digested with BamHI and probed with the 5' probe indicated in a. Further analyses were performed with the Neo probe to cobthe targeted mutation (data not shown). W = wild type; T = targeted alleles. c. Genotyping of E7.0 embryos by PCR.

DNA made from the in vitro cultured ectoplacental cone was analyzed by PCR with primen a, b, and c in the same reaction. Table 2: Genotyp es of of fs pring from TIx-2 hete rozygo te mating s Number (%) ES clone

206 426 Tot al

Figure 2-4. Phenotypes of whole mount mutant embryos. a* E7.0 embryo litter mates.

Some homozygotes are developmentaiiy arrested at this stage, with a smaller sue and unclear ectoderm layer (far right). Other homozygotes are rnorphologicaily normal at this stage (second fiom far right). b. E7.5 embryos. The homozygous embryos collected at this stage are severely retarded, many of hem displayhg a bail-like structure (middle one). c. E8.5 embryos. Small pieces of mutant embryos are occasionally collected. d. E9.0 embryos. Only empty yolk sacs are occasionally found at this stage. Genotypes were determined by PCR on DNA prepared fiom ectoplacentai cones (a) or fkom the embryos after photography (b, c, d). pp -- - -- Table 3: Genotyp es of embryos from TIx-2 hete rozygote rnating s Number (%) Stage Normal embryos Abnormal embryos

+/ + +/ - 4 - +/ + +/ - -/ -

11 (29) 18 (47) 5 (13) 10 (24) 25 (60) O (0) 7(33) 12(57) O(0) 6 (38) 10 (62) O (0) 2(15) 11 (85) O(0) 4 (44) 5 (56) O (0) 3 (33) 6 (67) O (O) 4 (36) 7 (64) O (O) addition, some empty decidua were observed. At E8.5, the mutant embryos were only found as spherical structures or small pieces of embryonic tissues (Fig. 4c). Empty yolk sacs were occasiondy found for mutant embryos at E9.0 (Fig. 4d), and no mutant

embryos were ever obsewed after E9.S. Together, these data demonstrate that the 77x4 targeted mutation causes an early embryonic lethality during E7.0-E7.5. Since the mutant embryos denved kom both ce11 lines showed the same phenotype, we focused on one mouse line (206) for fk-ther analyses.

24.4. Phenotypic effects of the TLr-2 mutation in the primitive streak, mesoderm and ectoderm of the homozygous embryo Since the earliest Tuc-2 expression was observed in the primitive streak of E7.0 embryos (Fig. Ib), we examined histologically the formation of the primitive streak and mesoderm in E7.0 and E7.5 wild type and mutant embryos. Normal E7.0 embryos displayed a well organized primitive streak with abundant mesodermal cells evident between the ectoderm and endoderm layers (Fig. Sa). In less affected E7.0 mutant

embryos (Fig. Sc), the size and overail structure appeared to be normal. however. an undulating non-uniform streak region with little mesoderm was seen (Fig. 5c. 5d).

Unlike the streak ectoderm in the normal embryos (Fig. 5% Sb). which was a single columnar ce11 layer, the streak ectoderm in these mutants was disorganized. with cells piled in a multi-ce11 layer (Fig. 5c, 5d). Occasionally, a few mesoderm-like cells could be

detected immediately undemeath the deformed primitive streak ectoderm at the posterior end (Fig. 5d). In addition, the postenor arnniotic fold was less developed in these mutants (Fig. 5c; 5d). In more severely afTected E7.0 mutants (Fig. Se. 50, the embryos appeared to be smailer, no distinct primitive streak was observed. and few, if any, mesodermal cells were seen. Disorganized ectoderm with regions of multi-ce11 Iayers was seen in these mutants (Fig. 50. At E7.5, normal embryos formed a fully expanded mesoderm layer that covered the basal surface of the whole embryonic ectoderm (Fig.

Figure 2-5. Histological anaiysis of the mutant embryos. a. A sagittal section of an E7.0 wild type embryo through the primitive streak region. Note the mesoderm layer between the ectoderm and endoderm at the primitive streak region (boxed). Arrowhead Uidicates the transverse fold. b. High magnification of the boxed region in a. c. A sagittal section of a mutant E7.0 embryo through the assumed primitive streak. Arrowhead indicates the transverse fold. Note the lack of a mesoderm layer in the presumptive primitive streak region (boxed). d. High magnification of the boxed region in b. In the streak of nonnal embryos (a, b), there are abundant mesoderm cells, and the ectoderm is a single columnar cell layer. By con- in the mutant embryo streak (c, d), a mesoderm layer is missing, although a few mesoderm-like cells are present (arrowhead in d), and, instead of a single ce11 layer, the ectoderm at this region is a kinked multi-ce11 layer. e, f. sagittal sections of more severely affected E7.0 embryos. Recognizable primitive streaks and mesoderm layers are not found in these embryos afier examining senal sections (e, f; data not show). The ectoderm layer of these embryos is profoundly disorganized (e, 0. g, h. Sagittal sections of E7.5 wild type (g) and mutant (h) embryos. h represents a typical mutant embryo at this stage. The embryonic ectoderm forms a closed circle with a curled streak producing some mesoderm cells that appear to spread into the extraembryo~c region instead. The extraembryonic endoderm is prominently dedwith folds, as indicated by arrowheads. This type of mutant presumably corresponds to the sphencd embryo presented in Fig. 3b. Genotypes were detennined by PCR on DNA prepared fiom the embryonic region of the sections. Scde bars: 200 Fm in a, c, e and f; 55 pm in b and d; 500 pm in g; 330 pm in h. Abbreviations: al, allantois; am, amnion; ec, ectoderm; en, endoderm; epc, ectoplacentai cone; me, mesodenn. 5g). In less atlected E7.5 mutant embryo that had not degenerated (Fig. 5h), the size of the embryo was srnalier and the ernbryonic ectoderm curled into a closed spheroid. The primitive streak of these mutant was kinked, but some mesodemal cells were observed at the primitive streak region (Fig. 5h). However, the mesodermal cells stayed at the posterior region and spread hto the extraembryonic cavity. In the distal and anterior regions, a mesoderm layer was not observed undemeath the ectodenn (Fig. 5h). In addition, rdedextraembryonic endoderm with deep folds was observed in these mutant embryos. More severely affected mutants at E7.5 were undergoing degeneration (data not shown). An allantois-like structure was not seen in any E7.5 mutant ernbryo analyzed (Fig. jh, and data not shown). Together, these results reveal a deformed primitive streak with defects in mesoderm formation in the E7.0 and E7.5 mutant embryo.

To Mercharacterize the defects in primitive streak and mesoderm formation in mutant embryos, we examined Brachyury expression in E7.0, E7.5, and E8.5 mutant embryos. At E7.0, Brachyury expression marked the primitive streak in normal embryos (Wilkinson et al., 1990), whereas in homozygous mutant embryos the expression domain was largely restricted to the postenor end (Fig. 6a). In addition, the size of this expression domain was markedly reduced compared with that of normal litter mates (Fig.

6a). In normal E7.5 ernbryos. Brachywy was expressed in the fully extended primitive streak. In contrast, the expression domain in mutant embryos at E7.5 remained resaicted to the posterior end and was reduced in size (Fig. 6b). In mutants with spherical morphology at E7.5, the main expression domain was restricted to one side of the embryo (Fig. 6b), resembling the pattern of mesodermal cells revealed by histological analyses in E7.5 mutants with similar morphoiogy (Fig. 5h). In wild type embryos at E8.5. Brachyury was expressed in the notochord and the postenor end. The mesodermal cells marked by Brachyury expression in E8.5 mutants remained at one side of the embryonic spheroid (Fig. 6c),and, unlike their normal litter mates, no notochord-like structure could

Figure 2-6. In situ analyses using the molecular markers for the primitive streak and mesoderm. a, b, c. Brachyq expression in E7.0-E8.5 embryos. In E7.0 (a) and

E7.5 @) embryos, Brachyury expression marks the primitive streak in normal embryos (arrows), but in IZr-2 mutant embryos the expression is restricted to the posterior end (arrowheads). In E7.5 mutant embryos with spherical morphology (represented by the lower mutant in b), the expression is rnainly restricted to the presurnptive mesoderm in the proximal side of the embryo (arrowhead), resembling the curled primitive streak revealed by histological analyses (Fig. 4h). In E8.5 embryos (c), T is expressed in the posterior end (white arrow) and in the notochord (arrowhead) of nomal ernbryos. whiIe in the mutants the expression @lack arrow) resembles that of E7.5 ball-like mutant embryos (b), and the notochord-like expression domain is not observed. d. Em-I expression in E7.0 embryos. Evx-l is normally expressed in the posterior primitive streak (arrow). Note that this expression pattern is largely retained in the mutant embx-yo (arrow head) . be detected (Fig. 6c). Taken together, these data demonstrate that mutant embryos are defective in generating mesodemal cells. We also determined the expression of Evx-1, a gene expressed in ectoderm as well

as in mesoderm of the primitive streak region in E7.0 embryos (Dush and Martin, 1992). As show in Fig. 6d, Evx-l was expressed in the posterior primitive sîreak in both normal and mutant embryos. To fürther assess the development of the streak ectoderm.

we examined the expression of Sm-1, an early nedation rnarker specifically expressed in the ectodem that overlies the primitive streak at E7.5 (Schubert et al.. 1995).

Preliminary results indicated that Sa-2 was expressed in the ectoderm at the posterior end (data not shown). The expression of Brachyury as well as Evx-I indicated that gastdation and primitive streak formation in the mutant embryos was initiated. though an extended streak was never observed.

2.5. Discussion 2.5.1. Tlx-2 is a direct target gene for BMP signalling Members of the TGFB superfarnily play a central role in vertebrate gastrulation

(Hoodless and Wrana, 1997), but how these signals regdate this developmental process is not yet clear. Understanding the underlying molecular mechanism requires the identification of downstream targets of the signalling. We have shown that BMP

signalling can rapidly activate expression of 77x-2 in mouse embryos. Consistent with the view that BMP signals are transduced by the BMP type 1 receptors (Hogan 1996). constitutively active form of these receptors, ALU* or ALK6*, can activate the 77x4 promoter in Pl9 cells. We observed an additional effect of BMP2 on the Th2 promoter activity in presence of ALU* (Fig. 2-2d). This may be caused by the activation of the endogenous type I receptors by BMPZ. In addition, tmnsfection of wild type Smadl, an intracellular transducer of the BMP signalling (Hoodless and Wrana 1997), can enhance the TLx-2 response to BMP2. These results together strongly suggest that TZx-2 is a downstram target of BMP signalling. TLr-2 is expressed in a position coincident with BMP4 in the posterior primitive streak and in the postenor ventral rnesoderm (Fig. 1; Wieret al., 1995), Mplicating BMP4 as an endogenous reguiator of TLr-2 expression during gasaulation. However, this suggestion does not preclude that other BMPs may regdate 7lx-2 in other tissues at different developrnentai stages. In fact, BMPî. BMP4. BMP7 and GDF5 can al1 signal through BMP type 1 and type II receptors. aithough BMP7 and GDF5 can also bind to the activin type 1 (ActRI) and ActRiI receptors (Mehler et al. 1997)- Furthemore, intracellular transducers such as Srnadl is often used by multiple BMPs (Mehler et al. 1997). These observations indicate extensive interactions or cross-tdking among the signalling invoked by different BMP or BMP- related factors. Therefore, TLr-2 is likely regulated by multiple BMPs during development. Consistent with this idea, in addition to the primitive streak. 77x2 is also expressed in other tissues where BMPs have been implicated in ce11 or tissue specification. These 77i-2 expression domains include the neural fold and the sympathetic ganglia (Chapter 3). It has been suggested BMPs are involved in specification of the dorsal phenotype of the neural plate including the formation of the neural crest in the neural fold (Liem et al. 1995). BMPZ and BMP4 are expressed in the dorsal neural fold (Hogan 1996; Liem et ai. 1995; Winner et al. 1995). and can induce the differentiation of the neural crest fiom the in vi~ocultured neural plate (Liem et al. 1995). Therefore, the expression of TLx-2 in the neural folds may be activated by these BMPs. Similady, BMP4 and BMP7 expressed in the dorsal aorta and potentially involved in the specification of sympathetic neurons (Reissmann et al. 1995; Shah et al. 1996) may contribute to the activation the expression of 77x-2 in the sympathetic ganglia. Activation of the Z7x-2 promoter by BMP signaihg is modulated by BMP receptors and Smad 1 (Fig. 2). Srnad proteins undergo ligand-dependent phosphory iation and nuclear accumulation in response to TGFP signalling (Hoodless et al., 1996; GrafT et al., 1996; Liu et al., 1996). In addition, Smadl has been suggested as a BMP-regulated transcriptional activator (Liu et al., 1996). A transcriptional regdatory role of Smad2 protein in activin signalling has also been suggested (Chen et al., 1996). Thus the 77x-2 promoter may be a direct target for Smadl. In support of this idea, transfection of Smad 1 alone upreguiates the 77x-2 promoter activity, in addition to potentiating BMP-induced activation (Fig. 2e). Ladher et al (1996) have recentiy identified a Xenopts homeobox gene, Xom. as an immediate early gene responsive to BMP4 signailhg and overexpression of Xom results in abnormal mesodexm formation. uiterestingly, like Tuc-2. Xom belongs to the HOXll subfamily (Ladher et al., 1996). These fmdings suggest the existence of an evolutionarily conserveci BMPmx-2 (Xom) signalling pathway that is essential for vertebrate mesoderm development.

2.5.2. Th-2 functions as a mediator of BMP signalling in primitive streak and mesoderm development Disruption of the TZx-2 gene provides insights about the specific role of the BMPTnx-2 pathway in mammalian mesoderm formation and helps to dissect the complex biological functions of BMP signalling cascades. The mutation of Th-7 leads to defects in ectodermal organization and the development of primitive streak and mesoderm. Since 77x-2 expression is not detected at the onset of gastrulation. and mesodermal cells with brachywy expression are generated at the posterior end in mutant embryos, 7ik-2 is not required for the initiation of gastnilation. This suggestion is consistent with the presence of extraembryonic mesodermal cells (Fig. 5h) and the anterior mesoderm as indicated by the expression of HNF-3P in E7.5 mutants (data not show), which are normally generated during the early stage of gastnilation (Tarn et al.,

1993). However, as suggested by the impaired mesoderm formation at later stages. 77x-2 is required in maintaining mesoderm formation. In 77x-2 mutants, since primitive streak formation is severely disturbed, the reduction of mesoderm may directly results fiom a failure in the primitive streak fuaction. The abnormal morphology of the primitive streak ectoderrn suggests that TLx-2 regulates the migration and differentiation of cells through the primitive streak. Aitematively, since ce11 proliferation has been implicated in

initiation and maintenance of gastdation (Tarn et ai., 1993; Mishina et al., 1999, 77x-2 may be required for ce11 proliferation in the primitive streak ectoderm, and mutation of Tlx-2 may disturb ce11 proliferation and block formation of a functiond primitive streak. Previous studies have demonstrated a hdamental role of BMP signalling in the

development of the primitive streak and mesodem in the moue. Similar to 77x2 mutant embryos, the most severely afEected BMP-I mutants that arrest at the egg cylinder stage display defects in mesoderm and primitive streak development (Winnier et al.. 1995). In addititon, a smail amount of extraernbryonic mesoderm is observed in both mutants. The

phenotypic similarities caused by the two mutations supports the view that Tlx-2 and BMP.I function in the sarne developmentd pathway during mesoderm formation. However, some BMPl mutants develop beyond gastnilation. Since al1 7Z.r-2 mutants arrest at primitive streak stages, this suggests that in these BMP4 mutants the T'Y-2 expression must be partially maintained and activation of the expression of TLr-2 may be attributed to matemal BMP4 secreted from decidual cells (Jones et al., 1991) or others related factors. For example, BMPZ rnay partly compensate the absence of BMP4 signals because both ligands can bind to the same receptor (Hogan, 1996). However, BMP2 expression is not detected until E7.5 in the mesodemal cells of the proamniotic canal and in the extraembryonic mesoderm lining the chorion and arnnion and later in the presurnptive precardiac mesodem. BMP2 mutation does not affect primitive streak formation though defects are observed in amnion and heart development (Zhang and Bradley, 1996), indicating BMPZ signals are not the main regulator of Tlx-2 during gastrulation. The BMP-related factor Nodal is expressed throughout the epiblast at the egg cylinder stage and becomes restncted to the primitive streak at gastrulation (Zhou et al., 1993; Codon et al., 1994). Sirnilar to TLr-2 mutants, homozygotes of the Nodal mutation are defective in the formation of the primitive streak and most mesoderm (Codon et al., 1994). The expression and phenotypic coincidence between ïLr-2 and Nudd together with the homology between Nodal and BMPs suggest that Nodal, in addition to BMP4 is a strong candidate as a regulatory signal of TLx-2 during gastnilation. BMP signalling is transduced through the heteromeric complex between type 1 and type II transmembrane serine-threonine kinase receptors (Hogan. 1996). A type 1 receptor, ALK3, is expressed in the epiblast and mesoderm during gastnilation. and an ALK3 mutation inhibits primitive sîreak and rnesoderm formation (Mishina et al.. 1995). The phenotypic overlap of the T1x-2 and ALK3 mutants in primitive streak and mesoderm development Mer suggests that 7k-2 mediates the biologicd fimction of BMP signalling transduced by ALIO in this developmental process. In support of this view. signalling initiated by the constitutively active ALKj can activate the TZx-2 promoter (Fig. 2d). Furthemore, consistent with the suggestion that ALK3 mutation blocks gastnilation by downregulating epiblast ce11 proliferation (Mishina et al., 1995). the ability of TLX-2 to promote mitogenesis is indirectly suggested by its ability to suppress neuronal differentiation of PC 12 cells (Tang et al., unpublished result). In contrast to TLy- 2 mutants, which produce a small amount of mesoderm, ALK3 mutation Ieads to a complete block in mesoderm formation (Mishina et al., 1995). This phenotypic difference indicates that 77.x-2 only carries out a subset of the Functions of ALK3- transduced BMP signalling cascades during gastnilation. Tken together, the phenotypic effects of 77x-2, BMP4 and ALK3 mutations and the identification of 77~-2as a downstream target gene of BMP signallùig suggest that TLr-2 mediates a specific role of BMP signalling in maintaining the function of the pnmitve streak for production of mesoderm after the onset of gastruiation. In summary, we have identified a downstream target gene. ï7x-2. of BMP signalling during mouse gastnilation, and shown that Tlx-2 is essential for the development of primitive streak and mesoderm. These results define a BMP/Tlx-2 signalling pathway that regulates marnmalian mesoderm development, and provide a molecular mechanism for TGFP-related factors to execute theù roles in mesoderm induction, 2.6. References hg, S. L. and Rossant, J. (1994) HNF3beta is essential for node and notochord formation in mouse development. Ce11 78,56 1-74.

Chen, X., Rubock, M. J. and Whitman, M. (1996). A transcriptional partner for MAD proteins in TGF-beta signaliing. Nature 383,69 1-6.

Codon, F. L., Lyoms, K. M., Takaesu, N., Barth, K. S., Kispert, A., Hermann. B. and Robertson, E. B. (1994) A primary requirement for nodal in the formation and maintenance of the primitive streak in the mouse. Development 120, 19 19-28,

Dear, T. N., Sanchez-Garcia, 1. And Rabbitts, T. H. (1993). The HOXI 1 gene encodes a DNA-binding nuclear transcription factor belonguig to a distinct family of homeobox gene. Proc. Nati. Acad. Sci. USA 90,443 1-4435.

Dubé, 1. D., Kamel-Reid, S., Yuan, C. C., Lu, M., Wu, X., Corpus, G., Raimondi, S. C.. Crist, W. M., Carroll, A. J., Minowada, J., et al. (1991) A novel hurnan homeobox gene lies at the chromosome 10 breakpoint in lymphoid neoplasias with chromosomal translocation t(10; 14). Blood 78,2996-3003.

Dush, M. K. and Martin, G. R. (1992) Analysis of mouse Evx genes: Evx-1 displays graded expression in the primitive streak. Dev. Biol. 15 1,273-87.

Graff, J. M., Bansal, A. and Melton, D. A. (1996). Xenopus Mad proteins transduce distinct subsets of signals for the TGF beta superfamily. Ce11 85,479-87.

Hatano, M., Roberts, C. W., Minden. M.. Crist, W. M. and Korsmeyer. S. J. (1991) Deregulation of a homeobox gene HOXI1, by the t (10r14) in T cell leukemia. Science 253,79-82.

Hemmati-Brivaniou, A. and Melton, D.A. (1992). A tnincated activin receptor inhibits mesoderm induction and formation of axial structures in Xenopur embryos. Nature 359. 609-614.

Hemmati-Brivanlou, A. and Thornsen, G. H. (1995). Ventral mesodemal patterning in Xenopus embryos: expression patterns and activities of BMP-3 and BMP-4. Dev. Genet. 17-78-89.

Hemmati-Brivanlou, A. and Thomsen, G.H. (1995). Ventral mesodemal patterning in Xenopus embryos: Expression patterns and activities of BMP-2 and BMP-4. Dev. Genetics 17, 78-89. Hogan, B. L. M. (1996) Bone morphogenetic proteins: multifunctiond regdators of vertebrate development Genes Dev. 10, 1580-94.

Hogan, B., Beddington, R., Costanthi, F. and Lacy, E. (1 994). Manipulating the mouse embryo: a practicai manual. 2nd edition. Cold Spring Harbor Laboratory Press.

Hoodless, P. A. and Hemmati-Brivanlou, A. (1997). Inhibitory control of neural differentiation in mammalian cell. Developmenk Genes and Evolution 207. 19-28.

Hoodless, P. A. and Wrana, J. L. (1997). The rnechanism and function of signalling by the TGFb superfamily. In Current Topics in Micobiology and Immunology. A. J. Pawson (ed) Springer-Verlag, München. In press.

Hoodless, P. A., Haerry, T., Abdallah, S., Stapleton, M., O'Connor, M. B., Attisano. L. Wrana, J. L. (1996) MADRI, a MAD-related protein that functions in BMP2 signaling pathways. Ce11 85,489-500.

Huang, H. C., Murtaugh, L. C., Vize, P. D. and Whitman, M. (1995). Identification of a potential regulator of early transcriptional responses to mesoderm inducers in the frog embryo. EMBO J. 14,5965-73.

Joyner, A. L. (1993). Gene Targeting: a practical approach (IRL Press. Odord).

Kennedy, M. A., Gonzalez-Sarmiento, R., Kees, U. R., Lampert., F., Dear, T. N., Boehm. T. and Rabbits, T. H. (1991) HOXl1, a homeobox-containing T-ce11 oncogene on human chromosome 10q24. Proc. Natl. Acad. Sci. USA 88,8900-4.

Kretzschmar, M., Liu, F., Hata, A., Doody, J., and Massagué, J. (1997). The TGF-J3 family mediator Smadl is phosphorylated directly and activated functionaily by the BMP receptor base. Genes Dev. 11,984-995.

Ladher, R., Mohun, T. J., Smith, J. C. and Snape, A. M. (1996) Xom: a Xenopus homeobox gene that mediates the early effects of BMP-4. Development 122.2385-94.

Le Mouellic, H., Lallemand, Y. and Brûlet, P. (1992). Homeosis in the mouse induced by a nul1 mutation in the Hox-3.1 gene. Cell69,25 1-264.

Liem, K. F. Jr., Tremmi, G., Roeldc, H. and Jessell, T. M. (1995). Dorsal differentiation of neural plate cells induced by BMP-mediated signals from epidermal ectoderm. Ce11 82,969-79.

Liu, F., Hata, A., Baker, J.C., Doody, J., Carcarno, J., Harland, R. M. and Massague, J. (1996) A human Mad protein acting as a BMP-regulated transcriptionai activator. Nature 3 8 1,620-23 Lu, M., Gong, Z.. Y., Shen, W. F. and Ho, A. D. (1 99 1) The tel-3 proto-oncogene altered by chromosomal translocation in T-ceIl leukemia codes for a homeobox protein. EmO J. 10,2905-10.

Macias-Silva, M., Abdollah, S., HoodIess, PA., Pirone, R., Attisano, L., and Wrana, J.L. (1996). MADR.2 is a substrate of the TGFB receptor and its phosphorylation is required for nuclear accumulation and signalling. Ce11 87, 12 15-1224.

Mead, P. E., Brivadou, 1. H., Kelley, C. M. and Zon, L. 1. (1996) BMP-4-responsive regulation of dorsal-ventral patteming by the homeo box protein Mix. 1. Nature 382.3 5 7- 60.

Mehler, M. F., Mabie, P. C., Zhang, D. and Kessler, J. H. (1997) Bone morphogenetic proteins in the nervous system. Trends Neurosci. 20,309-3 17.

Mishina, Y., Suzuki, A., Ueno, N. and Behringer, R. R. (1995) Bmpr encodes a type 1 bone morphogenetic protein receptor that is essential for gastnilatioo during mouse embryogenesis. Genes Dev. 9,3027-37.

Onichtchouk, D., Gawantka, V., Dosch, R., Delius, R., Hirschfeld, K., Blumenstock, C. and Niehrs, C. (1996) The Xvent-2 homeobox gene is part of the BMP-4 signalling pathway controllhg dorsalventral patteming of Xenopus mesodem. Development 122, 3045-53.

Reissmann, E., Ernsberger, U., Francis-West, P. H., Rueger, D.. Brickell, P. M. and Rohrer, H. (1996) Involvement of bone morphogenetic protein-4 and bone morphogenetic protein-7 in the differentiation of the adrenergic phenotype in developing sympathetic neurons. Development 122,2027-2088.

Schubert, F. R., Fainsod, A. Gmebaum, Y. and Gws, P. (1995) Expression of the novel murine homeobox gene Sm-l in the developing nervous system. Mech. Dev. 51.99-1 14.

Shah, N. M., Groves, A, K. and Anderson, D. 1. (1996). Alternative neural crest ce11 fates are instructively promoted by TGFbeta superfarnily members. Ce11 85.33 1-43.

Smith, J. C. (1993) Mesodexm-inducing factors in early vertebrate development. EMBO J. 12,4463-70.

Smith, I. C . (1 995) Mesoderm-inducing factors and mesodemal pattemhg. Cm. Opin. Ce11 Biol. 7,856-6 1.

Tarn, P. P., Williams, E. A. and Chan, W. Y. (1993) Gastxulation in the mouse embryo: ultrastructural and molecular aspects of germ layer morphogenesis. Microscopy Research and Technique, 26,30 1-28. Thomsen, G. H. (1996). Xenopus mother against decapentaplegic is an embryonic ventralking agent that acts downstream of BMP-U4 receptor. Development 1222359-66.

Weinstein, D. C., Ruiz 1 Altaba, A., Chen, W. S., Hoodess, P., Prezioso, V. R., Jessell, T. M. and Darnell, J. E., Jr. (1994) The winged-helix transcription factor HNF-3 beta is required for notochord development in the mouse ernbryo. Ce11 78, 575-88.

Wilkinson, D. G. (1 992). Whole mount in situ hybridization of vertebrate embryos. In: In Situ Hybridization: a practical approach. ed. Wilkinson, D. G. (IEU Press. Odord).

Wilkinson, D. G. Bhatt, S. and Hemnann, B. G. (1990) Expression pattern of the moue T gene and its role in mesoderm formation, Nature 343,657-9.

Wilson, V., Manson, L. Skames, W. C. and Beddington, R. S. (1995) The T gene is necessary for normal mesodemal morphogenetic ce11 movements during gastmlation. Development 12 1,877-86.

Winnier, G., Blessing, M.. Labosky, P. L. and Hogan, L. M. (1995) Bone morphogenetic protein-4 is required for mesoderm formation and patternhg in the mouse. Genes Dev. 9. 2105-21 16.

Zhang, H. and Bradley, A. (1996) Mice defficient for BMP2 are nonviable and have defects in amnion~chononand cardiac development. Development 122,2977-86. Chapter 3

TLX-2: a homeodomain transcription repressor

that is expressed in the deveioping PNS and functions as a negative

regulator of neuronal differentiation

Work in this chapter forms the bais for the manuscript:

Shao Jun Tang, Ting-Chung Suen, Roderick R. McInnes, and Manuel Buchwald (1997). TLX-2: a homeodomain transcription repressor that is expressed in the developing PNS and functions as a negative regulator of neuronal differentiation. (Manuscript).

The work I performed in this chapter was the analysis of the developmental expression of 77x2, preparation of the Northem blot, transfections and determination of the effect of TLx-2 overexpression on neurite outgrowth of PC 12 cells, construction of plaçmids for ûansfection and

CAT assays. Ting-Chung Suen performed CAT assays. 3.1. Abstract

The mamrnalian periphed nervous system (PNS) is mainly derived fiom the neural crest.

Transcription factors play important roles in segregation and Merentiation of neural crest cells during PNS development. This paper describes the function of the homeobox gene 7k-2 in murine neural crest and PNS development. During mouse embryogenesis, a-2 is specificaily expressed in the prospective neural plate ridge and developing PNS. In the neural plate ridge, TZr-7 expression displays progressive restriction in a posterior-to-antenor direction, coinciding with the progressive segregation of the neural crest. In the developing PNS, TLc-2 expression marks al1 neural crestaerived gangiia as they forrn but is downregulated later. Overexpression of Zr-2 in PC

12 cells causes inhibition of neuronal differentiation induced by nerve growth factor (NGF).

Furthemore, we demonstrate that nX-2 fiinctions as a transcription repressor. These findings suggest that TLX-2 represses expression of neuronal genes and thereby prevents premature neuronal differentiation during the early phase of ganglion formation. 3.2. Introduction

During mammalian PNS development, nelaal crest ceils migrate out tiom the dorsal neural tube, condense at the site of prospective peripheral ganglia, proliferate and finally differentiate into postmitotic neurons and neuroglia (Le Douarin, 1986; Bromer-Fraser, 1992; Anderson. 1994).

Both extracellular signds nich as neurotrophins, and intracellular regdatory molecules such as transcription factors play vital roles in this process (Le Douarin et al., 1994; Bronner-Fraser, 1995:

Anderson, 1994). Neurotmphic factors, including NGF, brain-derived neurotrophic factor (BDNF). neurotrophin-3 (NT-3),and neurotrophin-415 ('NT49 are essentid for survivai and differentiation of neurons (Le Douarin et al, 1994). Recent studies have suggested a role of NGF in proliferation of ganglion cells (Geffen and Goldstein, 1996; Goldstein et al., 1997). On the other hand, transcription factors, as most clearly show by members of the basic helix-loop-helix (bHLH) family, are crucial for fate determination of neural crest cells during PNS development. For example, MSH-I is required for formation of autonomic neural cells (Guillemot et al. 1993). while iVeuroD and Neurogenin are exclusively expressed in the sensory lineage within the PNS and. when overexpressed, can transform ectodermal cells to neural cells in Xenopus (Lee et al., 1995;

Ma et al., 1996). Studies on the neuron restrictive silencer factor (NRSF), a zinc-finger DNA binding transcription repressor that is expressed in neural precursors but not in differentiated neurons, suggested that transcription repression may also serve as an important mechanism in regulating neural development (Schoenherr and Anderson, 1995).

Homeobox genes encode a large family of transcription factors involved in various aspects of development (McGinnes and Krumlauf, 1992). The mouse 2-2 (HoxllLI)homeobox gene is 1O6

related to the human T-ceIl oncogene HOXll (Dube et al., 1991; Kennedy et al., 199 1; Hatano et

al., 1991; Lu et al., 1991; Raju et al., 1993; Dear et al., 1993). We have demoostrated that TLx-2 is

required for gastruiation of mouse embryos (Tang et al., 1997). The present study is to characterize

the fkction of TLx-2 during neural crest and PNS development Tlx-2 is specifically expressed in

the prospective neural plate ridge and in the developing PNS. Omet and evolution of 2-2 expression in the neural plate ridge and the peripheral ganglia are coincident with initiation and progression of the neural crest and PNS development These observations suggest that TLr-2 not only is a specific rnolecular marker for the development of neural crest and PNS. but is also an important regulator for these developmental processes. We demonstrate that overexpression of TLr-

2 inhibits NGF-induced neurite outgrowth of PC 12 celis, ~ggestingTLx-2 is a negative regdator of neuronal differentiation. In addition, we show that TLX-2 is a transcription repressor. Our results suggest that ïïx-2 reguiates neuronai differentiation by suppressing expression of neuronal genes. We propose that during PNS development TLr-2 represses possible premature differentiation of neural precursors in newly formed ganglia where TLc-2 is highly expressed. Such a mechanism is probably important during the early phase of PNS development to ensure the production of enough neural precursors before onset of neuronai differentiation.

3.3. Materials and Methods

Molemount RNA in situ.

Mouse embryos were staged by counting the appearance of a mating plug as 0.5 day.

Embryos were collected, ked, and pre-treated according to described procedure (Wilkison, 1992). 1O7

Two antisense DIG-riboprobes, derived hm the 5' coding sequence and fiom the 3' coding sequence, were generated for the hybridization. Both probes yielded the same expression pattern? whereas the corresponding sense probes did not produce hybridization signais. Whole mount in situ hybridization was performed as described (Wilkison, 1992).

Northern Anaiysis.

Total RNA from PC 12 cells was isolated using Trizol (GIBCO-BRL) according to manufacturer's instruction. Ten pg of total RNA was loaded on a 1% formaiin-agarose gel in

MOPS gel bder [20 mM MOPS (3-(N-morpholino) propanesulfonic acid) , 8 mM sodium acetate,

ImM EDTA]. The RNA was transferred to Hybond-W membrane in 0.05M NaOH. using a vacuum transfer apparatus (Bio-Rad). The transferred membrane was rinsed in ZxS SC.

Hybridization was carried out in Rapid-hyb buffer (Amershan) ovemight at 65°C. Mer hybridization, the membrane was washed for 2xlOmin at room temperature in 2xSSCM).2% SDS. followed by 2x30 min washes at 65°C in 0.2xSSC/0.2% SDS.

Neuronal differentiation of PC 12 ceiis induced by NGF.

PC 12 cells were maintained in RPMI1640 medium contauiing 10% home senun (Sigma) and 5% fetal bovine senim. Approximately 5x10' cells were piated on 60 mm dishes on the day before transfection. The cells were trausfected using calcium phosphate method (Chen and

Okayama, 1987). On the next day the ceils were rinsed with PBS and cultured in medium 1O8

containing 10 nghl NGF (2.5S, Sigma). The medium was changed on a daily basis until the date

of Lac2 staining.

Construction of the TLr-2 expression vector.

The TLr-2 cDNA hgment containing the full length of open reading he(ORF) was cloned into pcDNAl (invitrogene), where the expression of Tlr-2 cDNA was controlled by the

CMV promoter. 'The DNA used for transfection was purified by ultracentrifugation in a CsCl gradient.

Calcium phosphate mediated ceU transfection.

C2C 12 cells were grown in DMEM supplemented with 10% fetal bovine serum on 100 mm tissue culture dishes (Falcon) in a humidified incubator (370C. 5% CO2). Transfection was perfonned by a calcium phosphate method (Chen and Okayama. 1987; Suen and Hung 1991).

Briefiy, confluent C2C 12 cells were split at a 1:8 ratio a day before tramfection. DNA was added to 0.5rnl of filter-sterilized 0.25M CaC12. 0.5d of 2X BBS (50mM BES p.N-bis-(2- hydroxyethy1)-2-aminoethanesulfonic acid], 280m.M NaCl, 1.5rnM NazHP04) was then added dropwise to the DNA solution. The mixture was left at room temperature for 25 minutes and then added to the cells, which were incubated at 370C for 16-20 hours, washed three times with PBS, and cultured in eesh medium for another 20 hours before harvest.

Three pg of C.4T construct was used for each transfection, with the addition of various quantities of negative control vector @cDNAl) or effector plasmid @cDNAI-Tix-2). Two pg of 1O9

pRSVIacZ (Edlund et ai., 1985) was included in each transféction for monitoring transfection

efficiency. pcDNAl was used to normalize the total amount of DNA (10 pg) used for each

transfection.

P-galactosidase and CAT (chloramphenicol -acetyltninsferase) - assays

Transfected cells from one 60mm dish were harvested, centrifuge4 and washed twice with

PBS. Cells were resuspended in 120~1of 025M Tris (pH8.0) and subjected to 4 keze (dry

ice/ethanol bath), thaw (370C waterbath) and vortex cycles. CeIl debns was removed by spinning

in a microcentrifuge. Thirty pl of the supernatant was used to perform P-gal assays using O-

Nitrophenyl-P-D-galactopyranoside (ONPG) as a substrate (Norton and Cofi.1985: Suen and

Hung, 1990). Results tiom the P-gai assay were used to nonnalize the amount of ce11 extract used

in each CAT assay (Goman et al., 1983; and modified as in Suen and Hung, 1990). The CAT reaction mixture was extracted with 300d of ethyl acetate, dried in a Speed-Vac. re-dissolved in

8p1 of ethyl acetate, and loaded ont0 a thin-layer chromatography (TLC)sheet. The chromatogram was nui in a TLC tank containhg an organic solvent of 955 chloroform:methanol. and was stopped when the solvent front reached at least half the length of the TLC sheet. Afier air drying, the TLC sheet was exposed to Kodak XAR-5 film at room temperature. The spots corresponding to the positions of the ['4~]chloramphenicoland the acetylated products were cut from the TLC sheet and counted in a scintillation counter

3.4. Results

111

Fig. 3-1. Progressive restriction of TLc-2 expression in the prospective neural plate border of

the mouse embryo. A. Ieft: Dorsal-laterai view of a E7.5 embryo. Expression is detected in two

strips of ectodem (arrowheads), the prospective neural plate borders containhg the future neural

crest, and the posterior mesoderm connecting with the forrning allantois. Right: Postenor vîew of

a E7.75 embryo. The "V"expression domain demarcates the prospective neural plate border. Six

horizontal lines (a to e) indicate the proximate positions of the sections presented in Fig. 1B. B.

Series cross sections were collected fiom the E7.75 embryo as illustrated in Fig. IA (nght). a A

cross section through the posterior tip of the primitive streak. A strong signai is detected in the

streak (arrow). b. A section antenor to a The expression covers the entire fomllng neural

epitheliurn except the rnidline. c. A section anterior to b through the posterior half of the primitive

streak. Expression is restricted to the lateral haIf of the neural ectoderm, but not in the medial part

of the neural epitheiium and streak. d. A section through the midde level of the streak anterior to c.

Expression is restncted to lateral edge of the ne& ectoderm. e. A section through the antenor

primitive streak where the neural plate and the neural fold form. Expression is restricted to the

neural fold (arrowhead). Detectable signal is also seen in the cells under the fold (empty anow). f.

More anteriorly to e, the neural plate is thicker and the neural folds become more evident. In

addition to strong expression in the fold expression in cells undemeath the neural fold becomes

more manifest (empty arrow). The asyrnmetric localization of the expression on both sides in

sections d, e, and f and the separation of the neural plate and the underlying mesodenn are due to manipulations during sectioning. Abbreviations: HF, head fold; PS, primitive streak; NE, neuroepithelim; NF, neural fold; NP, neural plate; PE, prospective epidermis. Magnifications: 360x

for a, b, c, d, e, and f 3.4.1. Tuic-2 expression in the prospective neural plate ridge of mouse embryos

Zk-2 is first expressed in the primitive streak of E7.0 embryos (Tang et al., 1997). At E7.5-

E7.75, the expression forms a V-shaped pattern in posterior half of the embryo (Fig. 1A). To

determine the tissue and ce11 types where %-2 is expressed, transverse sections from E7.75

embryos after in situ hybridization were examked (Fig. 1B). At the posterior end. expression was

observed in the primitive streak, which included ectodermal and primitive mesodemal cells (Fig.

1B-a). However, in a region just anterior to the posterior end, the expression was exclusively

detected in the primitive streak ectoderm except midline, and the expression was not seen in the

mesoderm layer (Fig. 1B-b). This expression pattern is similar in E7.5 embryos (Tang et al.. 1997).

At the level of mid-streak, expression was observed in lateral part of the neural ectoderm (Fig. 1B-

c, 1B-ci). In more antenor regions, where the neural fold was evident, Tlx-2 expression was seen at

edges of the neural epithelium in the fonning neural fol& (Fig. 1B-e, 1B-f). Expression in these

regions was also detected in cells undemeath the neural fold (Figs. 1B-e, I B-f), with a monger

signal in the more anterior section (Fig. IB-f). These data demonstrate progressive restriction of

TLx-2 expression to the neural plate ndgeheural fold fkom posterior to antenor in the embryo at

definitive streak stage. The dynarnic change of TLr-2 expression patterns dong the lateral neural

plate appears to cohcide with the postulated progressive segregation of the prospective neural crest

(Selleck and Bronner-Fraser, 1995).

3.4.2. Tb2 expression in the developing PNS

The expression of Tlx-2 in neural plate ridgeheural folds disappeared when the nedtube closed, and in E8.5 embryos the expression was only observed in the posterior end and in the node

Fig. 3-2. Spatial and temporal expression of the TLr-2 gene in the developing PM. a Dorsal view of a E8.5 embryo with the yok sac tom oE High level expression is restricted to the posterior end of primitive streak (arrow) and cells flanking the primitive streak. A clear signal is aiso detected in the node (arrowhead). b. Lateral view of a E9.0 embryo. Expression is detected in cranial ce11 clusters, which condense to fom the cranial gangiia (empty arrows). Expression in the posterior end of the embryo is not detectable at this stage. c. Dorsal view of a E9.25 embryo.

Expression of TLr-2 is specificdy restricted to the fomiing manial sensory ganglia most prominently in the weil condensed ûigerninal (V) and facial 0ganglia, but also clearly detectable in the srnall clusters of cells fodgthe superior (IX) ganglion. d. Lateral view of a

E9.5 embryo. in addition to the cranid ganglia, expression be- to be detected in the dorsal mot and sympathetic chah gangiia, with the strongest signal in the well-fomed anterior DRG and decreased signal in the posterior condensing DRG. e. Lateral view of a El 0.5 embryo. Expression is observed in the segmentally arrayed sympathetic ganglia in the anterior ûunk and condensing sympathetic chah in the posterior tmnk (arrowhead). E Dorsal view of a E10.5 embryo. g. Laterd view of a El 1.5 embryo. Evident signal is also detected in the root of the accessory nerve

(arrowhead). Note that expression is observed in the trigeminal Or) ganglion but not in other cranial ganglia. h. Laterai view of a E 13.5 embryo. Expression persists in the posterior DRG (white arrowhead). Note that intensity of signals in DRG decreases antenorly. Expression is also detected in the forebrain (white arrow), mouth region (black arrow) and limbs (arrowhead). Ab breviations:

DRG, dorsal mot gangliodganglia; flb, forelirnb bud; ht (H), heart; nt, neural tube, ot, otic vesicle;

SG, sympathetic gangiiodganglia. 115

(Fig. 2a), which was completely absent by E9.0 (Fig. 2b). TLr-2 expression after E9.0 was specificdy seen in the developing PNS (Fig. 2b-2h). At E9.0, the expression was detected in patches of scattered cek at sites of the prospective craniai ganglia (Fig. 2b). At E9.25, the expression was observed in well-condensed daiganglia (Figs. 2c). At E9.5, in addition to the cranial ganglia, expression started to be detected in dord root ganglia (DRG) at antenor hdf of the aunk (Fig. 2d). At E10.5, the expression pattern of Tlx-2 extended into DRG in the postenor trunk

(Fig. te, 2f). The expression in peripherai sensory ganglia was confirmed by histological analyses of the embryo (Fig. 3). Evolution of the Kk-2 expression pattern descnbed above is coincident with the sequential formation of peripheral sensory gangiia in an anterior-to-posterior order at these stages of embryogenesis. At El 1.5, expression was sustained in the DRG, but appeared to be downregdated in cranial ganglia, most evidentiy in VTIth, IXth and Xth ganglia (Fig. 2g). At

E 13.5, strong expression of TLx-2 was observed oniy in posterior DRG that had recently formed, but the expression was downreguiated in cranid ganglia and anterior DRG (Fig. 2h). At this stage

7Z.x-2 expression was dso detected in the forebrain, the mouth region and limb buds (Fig. Zh).

These data indicate that TLr-2 expression in the PNS is activated in the newly-fomed ganglion, but is downreguiated when the ganglion is well developed. in cranial ganglia Zr-2 expression was detected in ail components contributed by the neural crest, including trigeminal (V), facial

(VII), glossopharyngeal (IX) and vagus (X) (Fig. 2b-2E Le Douarin, 1986), but was not observed in the acoustic ganglion (WI) (Fig. 2c-2f; Fig. 3b), which is entirely derived fiom the ectodermai placode (Le Douarin, 1986). These data indicate a restriction of Tlx-2 expression to the neural crest-derived PNS ganglia

117

Fig. 3-3. HiPtological analysis of TLr-2 erpression in the PNS. a A cross section of an E 1OS embryo through the trigeminai (V) gangüon. b. A cross section of an E 1OS embryo thorough the otic vesicles (ot). Note that the expression of TZr-2 is observed in the facial (VI0 but not in the acoustic (Vm, arrowhead) ganglia c. A cross section of an E10.5 embryo through ganglion K. d.

A section of an E10.5 embryo through ganglion X. e. A posterior section of an ElO.5 embryo showing expression in DRG. f. A cross section of an E 10.5 embryo showing expression in DRG and sympathetic gangiia (SG). g. A cross section of an E11.5 embryo through the fore limb bud

(flb), showing presumptive parasympathetic ganglia (PSG) in heart region. h. A cross section of an

El 1.5 embryo, showing expression in the enteric gangLa (EG). Abbreviations: da dorsal aorta; fg,

DRG, dorsal root ganglion; fore gut; IV,the Nth vesicle; nt, neural tube; rp, Rathke's pocket; tv. telencephaion vesicle. Il8

In autonomie PNS, TLr-2 expression was first observeci in the condensing sympathetic chah

in the anterior trunk at E9.5 (Fig, 2d). At E10.5, expression was seen in the segrnentally anayed

antenor sympathetic thas weli as in the condensing posterior sympathetic chah (Fig. 2e; 20.

The expression in sympathetic gangiia was confinneci in sections, at a position dorsal-laterai to the

dorsai aorta (Fig. 3f; 3g). Therefore, as in the sensory ganglia, evolution of the 7Z.expression

pattern in sympathetic system is coincident with the sequential formation of the sympathetic

ganglia in an anterior-to-posterior order. Expression of TLc-2 was also detected in both

parasympathetic and enteric ganglia of E 1 1.5 embryos (fig. 3g; 3h). Collectively, these results

demonstrate that 7k-2 is expressed in ail the PNS ganglia derived from the neural crest, and

progression of its expression is coincident with the formation of PNS.

3.43. NGF-regulated expression of Tur-2 in PC 12 ceUs

As the targeted mutation of TLr-2 causes early embryonic lethality before the PNS is formed

(Tang,S. J. et al., 1997), the role of îZr-2 in PNS development cannot be determined from the

targeted mutants. To circumvent this problem, we used PC 12 cells as an in vina system to assess the role of Tlx-2 in neural merentiation (Teng and Greene, 1994). We fvst determined the expression of ir2x-2 in PC12 cells by Northem anaiysis and detected a relatively low level of expression before NGF treatment (Fig. 4a). However, a clear upregulation of ïk-2 expression was observed 12 hours after NGF induction (Fig. 4a). interestingly, 48 hou afler NGF- stimulation,

TLx-2 expression was downregulated (Fig. 4a). This NGF-regulated expression profile of nx-2 in

PC 12 cells appears to be coincident with the suggested sequential processes of proliferation and differentiation following NGF-induction (Greene and Tischler, 1982). Consistent with this notion, NGF induction (hours) O 3 12 24 48

transfection of pcDNA-Tlx-2 4 !cg) 120

Fig. 3-4. TLc-2 is a neuronal differentiation suppressor in PC 12 celIs.

A. NGF-regulated expression of Tfr-2 in PC 12 ceils revealed by Northem analysis. A low level of irlx-2 expression in untreated PC 12 celis (far left lane). The expression is upreguiated after 12 hours of NGF treatment, but is downregdated after 48 hours of treatment. B. Suppression of neurite outgrowth of PC 12 cells with 7k-2 transfection. Percentage of transfected cells (as reveaied by Lac2 staining) with neurites longer than one ce11 body der 4 days of NGF treatment is presented in this figure. 121

as described above, during PNS development TLc-2 expression is activated during the early phase of

gangliogenesis, when the ganglia presumptively undergo ceil proliferation, but is downregulated in

weU-formed seflsoly ganglia which presumptively undergo active neuronal differentiation.

3.43. Overexpression of TLr-2 in PC 12 cek suppresses neuronal dinerentiation induced by

NGF

To assess the physiological role of 7Zr-2 dtrring neural development, we examined the effect

of Zr-2 overexpression on NGF-induced neuronal differentiation PC 12 cells were transfected

with 7k-2 expression and RSV-Lad constnicts. Cells were treated with NGF for 4 days and then

stained for P-glactosidase to identie transfected cells. Transfected cells were scored according to

the relative lengths of theû neurites to the ce11 body. Mock transfection was performed using the

empty pcDNA-1 vector. The resdts showed that transfection of the ïLr-2 expression plasmid

suppressed neurite outgrowdi, as demonstrated by the decreased proportion of cells bearing neurites

longer than one ce11 body (Fig. 4b). The degree of suppression was TLr-2 dose-dependent (Fig. 4b).

This result suggests TLc-2 is a negative regulator of neuronal differentiation. This notion is

consistent with the NGF-regulated expression of TLr-2 in PC 12 cells and its developmental

expression in the PNS.

3.45. TLX-2 is a transcription repressor

Homeodomain proteins are believed to be involved in the control of ce11 differentiation and other developmental processes by regulating the expression of their dowmtream target genes 132

(McGinnes and Knmilauf, 1992). To obtain insights into the mechanism of TLx-2 mediated

suppression of neural differentiation, we characterimi the tramcription regdatory activity of TLX-

2 by cotransfection assays in GC,, tells. In initial experiments, we observed that TLX-2 repressed

CAT gene expression controlled by the TK promoter (Luckow and Schw 1987) in a dose-

dependent manner (Fig. Sa). To Mercharacterize the transcription repression of T'LX-2. we

examined the activity of TLX-2 on other promoters. As shown in Fig. 5b, nX-2 suppressed CAT

expression fiom dl tested promoters, including TK, SV40 and HIV promoters. These resuits

demonstrate that TLX-2 can repress gene expression through diverse promoters. The transcription

repression activity of TLX-2 was also observed in other ce11 lines. including CHO and NIH3T3

cells (data not shown).

The fact that TLX-2 can repress transcription £iom diverse promoters without its binding

motifs indicates that TLX-2 may hction in a DNA-binding independent manner, as suggested for

PBXl and MSXl homeodomain transcription repressors (Catron et al.. 1995; Lu and Karnps,

1996). However, this notion does not preclude the possibility that the transcription repression activity of TLX-2 can be modulated by DNA binding. We then determined whether the transcription suppression activity of TLX-2 is affected by the presence of its putative DNA binding motif in the promoter. To this end, we constnicted a reporter plasmid 6xTAATTG-TK-CAT, in which a motif of six tandem repeats of the TAATTG horneodomain consensus binding site on which HOXI 1 cari bind @ex et al., 1993) were placed immediately upstream of the TK promoter

(Luckow and Schug 1987). Because HOXll and TLX-2 share 86.7% identity in their homeodomains Wear et al., 1993), we reasoned that TLX-2 would also be able to bind to this consensus buiding site. Cotransfection with the TLX-2 expression vector resulted in 4-5 fold relative repression (folds)

- - 1 ., & I 'A - 124

Fig. 3- 5. TLX-2 is a transcription repressor.

a TLX-2 represses transcription nom the TK promoter in a dose-dependent manner. Various

arnounts of pcDNA-Tlx-2 CO-tdectedwith the TK-CAT plasmid, in which the CAT reporter

gene is controiied by a TIC promoter, and the relative CAT activity determined by cornparhg with

mock aansfections without pcDNA-Tlx-2. b. TLX-2 represses transcription fkom diverse

promoters. In addition to the TK promoter, TLX-2 can also repress transcription from SV40 and

HIV promoters. c. a 6-mer of the homeodomain consensus DNA binding motif TAATTG enhances the TLX-2 trdption repression on IX promoter. Six TAATTG tandem repeats are created upstream in TK promoter of TK-CAT plasrnid. The transcription repression of TLX-2 on

TK-CAT or 6xTMTïG-TK-CAT is deterrnined by the ratio of CAT activities detected in cells transfected without and with pcDNA-Tlx-2. d. TLX-2 antagonizes the trans-activation acûvity of

Spl. Similar resuits were obtained fiom multiple experiments for data shown in c and d. 125

suppression of CAT activity fiom 6xTAATTG-TK-CAT, while a similar cotransfection ody

caused approxhate 2 folds of repression hmTK-CAT (Fig. Sc). This resuit indicates that the

homeodomain consensus DNA-binding motif created in the promoter cm enhance transcription

suppression mediated by TU(-2.

To get insights into the mechanism of TLX-2mediated transcription repression. we tested

whether nX-2 is able to antagonize the transactivation activity of transcription activators. As

shown in Fig. 54 TLX-2 antagonized the trans-activation activity of Sp1 . Preliminary results

indicated that TLX-2 dso counteracted the transcription activation mediated by TAT (data not

shown). Collectively, these resdts demonstrate that TLX-2 is a repressor of transcription.

3.5. Discussion

Fate mapphg snidies have suggested that neural crest cells are denved from the prospective neural plate ridge (Resenquist, 198 1; Rollhauser, 1979; Selleck and Bromer-Fraser. 1995).

However, Little is known about the molecular basis for segregation of neural crest cells. TIx-2 expression is observed in the posterior prospective neural plate ridge of E7.5E7.75 mouse embryos, and displays a progressively restricted expression fiom the posterior to the anteriot of the neural plate ridge as follows: neural ectoderm @osterior)+lateral neural ectoderm (mid-streak level)+neura.I fold (anterior çtreak level) (Fig. 1). This pattern of ïb-2 expression rnarkedly resembles the postulated progressive segregation process of neural crest cells (Selleck and Bronner-

Fraser, 1995). Moreover, late expression of Tk-2 is restricted to the developing PNS that is derived 126

from the neurai crest (Fig. 2; Fig. 3). These results suggest that TLr-2 may play a role for

segregation of the neural crest.

BMP signalhg has been suggested to play a crucial role in induction of the neural crest

from the nedplate ridge and neural fold (Liem et al., 1995). BMPl and BMP-7 are expressed in

the neural plate ridge, the neural fold, and the ectodermal epiderxnis, and recombinant BMP-4 can

induce differentiation of neural crest ceiis fkom the explanted nedplate (Liem et al.. 1995).

Cohcidently, our recent studies have demonstrated that BMP-2 can activate TLx-2 expression in the

epiblast of E6.5 embryos, and that the TLr-2 promoter responds to BMP-2 signalIing in a BMP type

1 receptor and Smadl (MADRI) dependent marner. We have proposed a BMPmlx-2 signalling pathway in mammalian mesoderm development (Tang et al., 1997). During the induction of the neurai crest, 7k-2 may also act downstream in BMP signalhg to initiate segregation of neural crest cells.

Tlx-2 is expressed in al1 PNS components derived nom neurai crest cells, and therefore is a prominent marker and a potential important regulator for PNS development. We showed that overexpression of Tlx-2 represses neuronal differentiation of PC 12 cells induced by NGF (Fig. 4b).

Although an indirect effect of IE-2 cannot be excluded at this stage, a simple explanation is that

TLX-2 acts as a negative regulator of neuronal differentiation. In support of this ide* Zr-2 expression is activated during the early phase of peripheral ganglion formation, when neural precursors are presurned to be proliferating, but is downregulated in well formed sensory ganglia where neural precursor cells are thought to be undergoing neuronal differentiation. Furthemore. in

PC 12 cells treated with NGF, TLr-2 is upreguiated during the early phase of induction and is downregulated afterward, consistent with the two sequential processes that have been suggested to 127 foiiowing NGF induction in PC 12 cek: the cell first proMerates for a few ce11 cycles and then undergoes neuronai diffixentiation (Greene and Tischler, 1982). This coincidence is consistent with the view that TLr-2 ptays a negative role in regdahg the neuronal differentiation evoked by

NGF. Based on these results, we propose that during PNS development TLX-2 represses premature neuronal differentiation in the newly formed ganglia and thus maintallis neural precursor cells in the proliferating state. Such a mechanism of stage-specific suppression of neuronal differentiation may be required for ensuring that the correct number of neural precursor cells are generated before the onset of neuronal differentiation. However, to prove this model. a direct effect of TLX-2 on neuronal dflerentiation has to be demonstrated. It would be important to examine the effect of TLx-2 overexpression on the expression of neuronal genes such as neurofilament. tyrosine hydroxylase (TH) and SCG10. Interestingly, there are multiple consensus binding sites of HO,YI I

(Dear et al. 1993; Tang and Breitman 1995) in the promoter region of SCG 1O (Mori et al. 19W), suggesting a possibility that SCGl O may be a downstream target of TLx-2.

T'LX-2 can repress transcription fiom different promoters (Fig. 3-5b). and the putative DNA binding motif of TLX-2 increases its transcription repression activity. indicating that this transcription regdatory activity can be enhanced by its DNA binding. These results suggest TL.X-2 may act through a direct repression mechanism (Hanna-Rose and Hansen 1996). In this scenario.

TLX-2may interact with the general hanscription factors and therefore interfere with the formation or activity of the transcription rnachinery. For example, the EVE homeodomain protein can repress transcription through its interaction with the TATA-box binding protein (TBP)(Um et al. 1995).

The fact that KX-2 cm antagonize the activity of Spl and TAT tramactivators suggest TLX-2 may also regdate transcription by a quenching mechanism (Hama-Rose and Hansen 1996). In this 128 conte* 'TLX-2 may directly interact with these tramcription activators, or with a CO-activator specific to the activator, or even with a basal transcription factor respoosive to the activator. and thus suppresses the function of the activator. It should be pointed out that these two potentid mechanisms used by TLX-2 are not rnuhially excluded. For example. the Krüppel (Kr) transcription repressor has been demonstrated to regdate transcription through either direct repression, by interaction with the TFIIEy (Sam et al. 1995), or quenching, by interaction wiîh Sp 1

(Licht et al. 1993). Recent studies have shown that Kr carries distinct repression domains with different functional specificity (Hama-Rose et al. 1997).

A number of homeodornain proteins have been suggested to repress transcription (Lu and

Kamps, 1996; Zhang et al., 1996; Catron et al., 1995). MSXl and PBXl homeodomain proteins can represses transcription in a DNA-binding independent manner (Lu and Kamps. 1996: Catron et al., 1995). Similar to TL,X-2, PBXl can repress the transcription activation induced by Spl (Lu and Kamps, 1996).

Ln surnmary, we demonstrate that nX-2 is a transcription repressor and a negative regulator of neuronal differentiation that is specificaiiy expressed in the developing mouse PNS.

These results collectively suggest a molecular mechanism that regulates neural development in mammalian PNS: TLX-2 prevents premaiure neuronal differentiation and maintains the proliferating state of neural precursors in newly fonned ganglia by repressing the expression of neuronal genes. Such a mechanism is theoreticaILy important to assure the proper number of neural precursor cells is generated before the onset of neuronal differentiation. 3.6. References

Anderson, D. J. (!994) Stem cells and tranwiption factors in the development of the mammaiian neural crest. FASEB J. 8,707-713.

Bronner-Fraser, M. (1992) Ce11 lineage segregation in the vertebrate neural crest. in Deterrninants of Neuronal Identity, M. Shankland, E. R. Macagno, Eds. (Academic Press. inc. San Diego), pp3 59-3 89.

Catron, K. M., Zhang, H., Marshall, S. C., Inostrom, J. A., Wilson, J. M. and Abate, C. (1995). Transcriptional repression by Msx-1 does not require homeodomain DNA-binding sites. Mol. Ceil. Biol. 15, 861 -871.

Chen, C., and H. Okayama 1987. High-efficiency transformation of rnamrnalian cells by plasmid DNA. Mol. Cell. Biol. 7:2745-2752,

Dear, T. N., Sanchez-Garcia, 1. and Rabbitts, T. H. (1993). The HOXlI gene encodes a DNA- binding nuclear transcription factor belonging to a distinct family of homeobox genes. Proc. Natl. Acad. Sci. USA 90,443 1-4435.

Dubé 1. D., Kamel-Reid, D., Yuan, C. C., Lu, M., Wu, X., Corpus, G., Raimond S. C.. Crist, W. M., Carroll, A. J., Minowada, J. & Baker J. (1991) A novel homeobox gene lies at the chromosome 10 breakpoint in Lymphoid neoplasias with chromosomaf translocation t(10; 14). Blood 78. 2996- 3003.

Edlund, T., M.D. Walker, P.J. Barr, and W.J. Rutter. 1985. Cell-specific expression of the rat insulin gene: evidence for role of two distinct 5' flanking elements. Science 230:9 12-9 16.

GeEen, R and Goldstein, R. S. (1996). Rescue of DRG that are programmed to degenerate in normal development: evidence that NGF can increase proliferation of neuroectodermally derived cells in vivo. Dev. Biol. I 78,s 1-62.

Goldstein, R. S., Avivi, C. and GeEen, R (1997). In vivo NGF treatment increases proliferation in the primary sympathetic ganglia of chick embryos. Dev. Biol. 18 1, 1 16-1 20.

Goman, C.M., L.F. Moffat, and B.H. Howard. 1983. Recombinant genomes which express chloramphenicol acetyl-tramferase in mammalian ceils. Mol. Cell. Biol. 2: 1 044-1 05 1.

Green, L. A. and Tischler, A. S. (1982). PC 12 pheochromocytoma cultures in neurobiologicai research. Adv. cell. Neurobiol. 3, 373-4 14. Guillemot, F., Lo, L-C., Johnson, J. E., Auerbach, A., Anderson, D. J. & Joyner, A. L. (1993) Mammalian achaete-scute homolog-l is required for the early development of olfactory and autonomie neurons. Ce11 75,463-476.

Hanna-Rose. W., Licht, J. D. and Hansen, U. (1997) Two evolutionarily conserved repression domains in the Drosophila Knippel protein differ in activator specifïcity. Mol. Cell. Biol. 17, 4820-4829.

Hanna-Rose, W. and Hansen, U. (1996) Active repression mechanisms of eukaryotic transcription repressos. Trends Genet. 12,229-234.

Hatano, M., Roberts, C. W. M., Minden, M., Crisr, W. M. & Korsrneyers, S. J. (199 1) Deregulation of a homeobox gene Hoxll, by the t(l O; 14) in T cell leukaemia Science 253,79-82.

Kennedy, M. A., Gonzalez-Sarmiento, R., Kees, U. R., Lampert, F., Dear. N.. Boehm. T. & Rabbitts, T. H. (1 991) Hoxll, a homeoboxcontaining T-ce11 oncogene on human chromosome 10q24. Proc. Natl. Acad. Sci. USA 88,8900-8904.

Le Douarin, N. M. (1986) Cell line segregation during peripherai nervous system ontogeny. Science 23 1, 1515- 1522.

Le Douarin, N. M., Dupin, E & Ziller, C (1994) Genetic and epigenetic control in ne& crest development. Curr. Opin. Gent. Dev. 4,685-695.

Lee, J.E., Hollenberg, S.M., Snider, L., Turner, D., Lipnick, N., and Weintraub, H. (1995) Conversion of Xenopus ectoderm into neurons by NeuroD, a basic helix-loop-helix protein. Science 268,836-844.

Licht, J. D., Ro, M., English, M. A., Grossel, M. and Hansen, U. (1993) Selective repression of transcriptional activators at a distance by the Drosophila KruppeI protein. Proc. Nad. Acad. Sci. USA 90,11361-1 1365.

Liem Jr, K. F., Tremml, G., Roelhk, H. and Jessel, T. M. (1995) Dorsal differentiation of neural plate cells induced by BMP-mediated signals fiom epidermal ectoderm. Ce11 82,969-979.

Lu, M., Gong, Z. Y., Shen, W. F., and Ho, D. A. (1991) The tel-3 proto-oncogene altered by chrornosomal translocation in T-cell leukaemia codes for a homeobox protein. EMBO J. 10,2905- 2910.

Lu, Q. and Karnps, M. P. (1996). Selective repression of transcriptional activators by pbxl does not require the homeodomain. Proc. Natl. Acad. Sci. USA 93,470-474. Luckow, B., and G. Schutz. 1987. CAT constructions with multiple unique restriction sites for the fùnctional dysisof eukaryotic promoters and regdatory elements. Nucleic Acid Res. 15:5490.

Ma, Q., Kintner, C. and Anderson, D. J. (1996). Identification of neurogenin, a vertebrate neuronal detennination gene. Ceii 87,4342-

McGinnis, W. and Knimlauf, R (1992) Homeobox genes and axial patterning. Ce11 68,283-302.

Mon, N., Schoenherr, C., Vandenbergh, D. J. and Anderson, D. J. (1 992) aA cornmon silencer element in the SCG 1O and type II Na+ charnel genes binds a factor present in nonneuronal cells but not in neuronal cells. Neuron 9,4554.

Raju, K., Tang, S., Dubé, 1. D., Kamel-Reid, S., Bryce, D. M. and Breitman, M. L. (1993) Characterization and developmental expression of 224, the murine homolog of HOXI 1. Mech. Dev. 44,s 1-64.

Resenquist, G. C. (1981) Epiblast origin and early migration of neural crest cells in the chicken embryo. Dev. Biol. 87,201-2 1 1.

Rollhauser-ter-Horst, J. (1979) Artificial neural crest formation in arnphibian. Anat Embryol. 157, 113-120.

Sauer, F., Fondell, J. D., Ohkuma, Y., Roeder, R. G. and Jackle, H. (1995) Control of transcription by Kruppel through interactions with TFIIB and TFIIF beta. Nature 375, 162- 164.

Schoenhen; C. J. and Anderson, D. J. (1995). The neuronorestrictive silencer factor (NRSF): a coordinate repressor of multiple neuron-specific genes. Science 267, 1360- 1363.

Selleck, M. A. J. & Bronner-Fraser, M. (1995) Origins of the avian neural crest: the role of neural plate-epidermal interactions. Development 12 1,525-53 8.

Suen, T.-C., and M.-C, Hung. 1990. Multiple cis- and iram-acting elements involved in the regulatioon of Neu oncogene. Mol. Cell. Biol. 10: 6306-63 15.

Suen, T.-C., and M.-C. Hung. 1991. c-myc reverses neu-induced transformed morphology by transcriptional repression. Mol. Cell. Biol. 1 1: 624-632.

Tang, S. J. and Breitman, M. L. (1995) The optimal binding sequence of the Hoxll protein contains a predicted recognition core motif. Nucleic Acid Research 23, 1928- 193 5.

Tang, S. J., Hoodess, P. A., Lu, Z., Breitman, M. L., Mcuines, R. R., Wma, J. L. and Buchwald, M (1 997). A BMPm-2 signalling pathway in mammalian mesoderm development (manuscript). Teng, K. K. and Greene, L. A. (1994) Cultured PC12 cells: a mode1 for neuronal bction and differentiation. in Celi Biology. A laboratory handbook ed Celis, J. E. Academic Press, New York.

Um, M., Li, C. and Manley, J. L. (1 995) The transcription repressor even-skipped interacts directly with TATA-binding protein. Mol. Cell. Biol. 15,5007-5016.

Wilkinson, D. G. (1992) Whole mount in situ hybridization of vertebrate embryos. in In Situ Hybridization, Ed. Willcinson D. G. (Mord University Press, New York). pp75-83.

Zhang, H., Catron, K. M. and Abate-Shen, C. (1996). A roie for the Msx-1 homeodomain in transcriptional regulatiun: residues in the N-terminal am mediate TATA binding protein interaction and transcriptional repression. Proc. Nad. Acad. Sci. USA 93, 1764-1 769. Chapter 4

Modulation of neural development by the interaction of TLX-2 homeodomain

and 14-34 signalling proteins

Work in this chapter forms the basis for the manuscript:

Shao Jun Tang, Ting-Chung Suen, Roderick R. McInnes, and Manuel Buchwald (1997).

Modulation of neural development by the interaction of TLX-2 homeodomain and 14-3-3 signalling proteuis. (Manuscript submitted).

Work descnbed in this chapter was almost entirely done by me. Ting-Chung Suen provided help in initial transfection expenments of PC 12 cells. 4.1. Abstract

Homeodomain proteins are important regdaton for various developmental processes.

The fiulctions of these proteins are increasingly recognized to be modulated by polypeptide cofactors. Here we report that 143-3 q is a cofactor of nX-2, a homeodomain protein required for mouse embryogenesis. The 14-3-3 family of signalling proteins participate in the regulation of many processes, including the ce11 cycle and apoptosis. We found that nX-2 and 14-3-3 q associate both in vitro and in vivo, that they have overlapping spatial and temporal patterns of developmental expression in the mouse peripheral nervous system (PNS). and that the expression of 14-3-3 q shik the predominant locdization of TLX-2 in COS cells from the cytoplasm to the nucleus. Both Tlx-2 and 14-3-3 7 are expressed in PC 12 cells. Increased expression of either gene by cDNA transfection inhibited the initiation but not the extension of NGF-induced neunte growth fiom PC 12 cells, and CO-transfectionof both cDNAs synergisticaliy repressed neurite outgrowth. These results define 14-3-3 proteins as a new class of cofacton for homeodomain proteins, and indicate that the function of TLX-2 in neural differentiation is reguiated directly by signalhg mediated by 14-3-3 q. 135 4.2. Introduction

Homeobox genes consist of an evolutionaily conserved superfamily that play important

roles in various aspects of development (Knimlauf, 1994; Lawrence and Monta, 1994). As

homeodomain proteins are DNA binding transcription factors, it is believed that homeobox genes

control the developmental process by regulating the expression of the downstream targeted genes

(Knimlauf, 1994). The function of homeobox genes during development is tightly regulated.

For instance, the spatial and temporal expression of homeobox genes specified by the genetic

program is crucial for embryonic patternhg and tissue specification (blauf. 1994). In

addition, evidence exists that the activity and specificity of homeodomain proteins in

transcription regulation are also highly regulated (Lichtsteiner and Tjian, 1995: Chan et al.. 1 994).

One suggested mechanism underlying the regulation of the activity of homeodomain proteins is

through protein-protein interactions (e.g. Chan et al., 1994; Xue et al., 1993: White. 1994: Zhu et ai., 1996; Agulnick et al., 1996; Kawabe et al., 1997; Guichet et al., 1997: Yu et al.. 1997).

77'-2 gene is a moue related gene of the human oncogene HOXll ( Chapter 1). The ectopic activation of HOXll in T cells by chromosomal translocations results in malignant transformation. The murine homolog of HOXI I, TLx-2, is required for spleen formation (Chapter

1). The previous studies have shown that 77x-2 is expressed in the primitive streak and in the developing PNS during moue embryogenesis (Chapter 2 & Chapter 3). Targeted disruption of

Tlx-2 reveals an essential role of Tlx-2 in mesoderm formation during mouse gastruiation

(Chapter 2). In addition, 77x-2 may also play an important role during PNS development

(Chapter 3). TLX-2 protein is a transcription repressor in cutured cells (Chapter 3). To gain insight into the regdation of the ïlX-2 function, 1 set up experiments to identi@ proteins 136 associating with TLX-2 in vivo. This Chapter describes an Ni vitro and in vivo interaction

between TLX-2 and the mouse 14-3-3 q pmteins. The biological relevance of this interaction

has been demonstrated at multiple levels. 14-3-3 proteins have been shown to function as cell

signalhg mediaton by interacting with various protein kinases (Fanti et al.. 1994: Irie et al..

1994; Freed et al., 1994; Reuther et at., 1994; Fu et al., 1994; Pallas et al.. 1994: Braselmann and

McCormick, 1995; Li et al., 1995; MelIer et al., 1996; Aitken, 1995). A suggested role for 14-3-

3 proteins is to mediate interactions between different signalling proteins as scaEolds

(Braselmann and McCormick, 1995; Liu et al., 1995; Xiao et al., 1995). The finding of the

interaction between TLX-2 and 14-3-3 proteins suggest that the 14-3-3 q may mediate an

interaction between the TLX-2 and a signalling kinase and the function of the TLX-2 homeodomain protein is thus modulated by ce11 signalling events mediated by the kinase.

4.3. Materials and Methods

Plasmid constnicts

pEXlox(+)-Tlx-2: a TIx-2 cDNA plasmid derived from hEXlox-Tlx-2 after Cre-mediated excision (Novagen). The TIx-2 cDNA fragment was flanked by EcoRI and HindIII sites. with the

5' end closed to EcoRI. pGEM7-Tix-2: The EcoRI-HindIII (the HindIII end was blunted by

Klenow) fiagrnent from pEXlox(+)-Th-2 was cloned into the EcoRI/Smai site of pGEM7. pBSKS(-)-Tlx-2/SacIIA: the 284 bp SacII £kagrnent from the IZx-2 genornic clone was cloned into the SacII site of pBSKS(-), oriented with the 5' end next to the T3 promoter. pGST2TK-Tlx-

2: the NcoI-HindIII Th-2 fiagrnent was released fiom pGEM7-Tix-2, blunted by Klenow, and cloned into the SmaI site of pGEX2TK in hme with GST. pGST2TK-Tix-2C68: the Tlx-2 137 hgrnent in pBSKS(-)-Tix-ZSacIIA was reieased by Sac1 and BamHI digestion (the SacII end was blunted by T4 DNA polymerase) and cloned into the SrnaVBamHI sites of pGEX2X. pcDNA-Tlx-2: the EcoRVHincüII ment fkom pEXlox(+)-Tlx-2 (HindIII was blunted) was cloned into EcoRVNsiI (NsiI was blunted) sites of pcDNA- 1. pFLAG-Tlx-2: NcoI/BamHI hgment from pGEM7-TIx-2 was cloned into the CIaVBamHI sites of pFLAG-CMV3 (NcoI and

ClaI were blunted). pEXlox(+)-14-3-3 q: a mouse 14-3-3 q cDNA plasmid denved fiom

XEXlox- 14-3-3 q after Cre-mediated excision. pGEM7- 14-3-3 q : The EcoRINsiI fngrnent of

14-3-3 q hmpEXlox(+)- 14-3-3 q was cloned into the EcoRUNsiI sites of pGEM7. pcDNA 1-

14-3-3 q: the EcoRUNsiI hgment of 14-3-3 q fiom pEXlox(+)-14-34 q was cloned into

EcoRVNsiI sites of pcDNA- 1. pGST2TK-14-3-3 q: the pEXlox(+)- 14-3-3 q EcoRIMnd fiagrnent was blunted with Klenow followed by self-ligation. The EcoRI site was restored by the self-ligation. The EcoRI-NsiI fiagrnent (EcoRI was blunted by Klenow) was cloned into the

BamHI/PstI sites (BamHI was blunted by Klenow) of pBTM 1 16 to construct pBMT 1 16- 14-3-3-

3 q. The SmaUBglII fiagrnent from pBMT116- 14-3-3 q was released. blunted by Klenow. and cloned into the SrnaI site of pGEX2TK in fhne with GST. pFLAG-CMVZ-14-3-3 q: the

NniVBgiII hgrnent of 14-3-3 q fiom pGEM7-14-3-3 q was cloned into HindIII (blunted by

Klenow)/BglIl sites of pFLAG-CMV2 vector.

Screening of the cDNA expression library

This method was modified fÏom Skolnik et al (1 991) and Blanar & Rutter (1992). The

GST-TLX-UC68 fusion protein was expressed in bacteria, purified using Glutathione Sepharose

4B according to the manufacturer's instructions, and verified by SDS-PAGE. Fifty ng of the 138 purified fusion protein was phosphoryiated by heart muscle kinase in 35 pl of reaction buffer

(20mM Tris-HCI [7.5], 1mM dithiothreitol [D'T'Tl, 1OOmM NaCI, 12mM MgCl]. 5 ml of [y-

"P]ATP [6000 ci/mmol, Du Pont NEG-0024) for 30 min at 30°C. The labelling reaction was

passed through a Sephadex (3-25 column (equilibrated in PBS containing 0.1% BSA) to separate the fusion protein fiom the free isotope. The specific activity of the probe was usually at the range of 5-8x10' CPM/pg. A mouse E 10.0 embryonic cDNA expression library (Novagen) was plated according to the manufacturer's instructions at a density of 4-5 X 10' plaques per 150 mm agarose plate. Mer three hours, nitroceIlulose membranes (Arnersham) pre-soaked in I mM

IPTG were placed on the plates and the incubation was continued ovemight. The membranes were lifted, rinsed in PBS with 0.05 % Triton X-100 and blocked in prehybndization solution

(20mM HEPS[pH 7.5],5rnM MgCII, ImM KC1) containing 5% blocking reagent (Bio-Rad) for 2 hours at4C. After prehybndization, the membranes were transferred into hybridization solution

(prehybndization solution plus probe at a concentration of 4x10; CPM/ml). and incubated at

4°C overnight with gentle shaking. The membranes were then washed for 3 times for jmin in

PBS containing 0.2 % Triton X-100 at room temperature with gentle shaking. The membranes were air-dried and exposed to X-ray film ovemight at -80°C.

In viiro protein binding assay, CO-immunoprecipitation,and Western blot analysis

For in vitro binding assays, 1 pmol of GST or GST fusion proteins bound on Glutathione

Sepharose 4B beads was incubated with the in vitro transiated TLX-2 or 14-34 q labeled with

! 'S-methionine (Amersham) at 4°C for 2 hows. The beads were washed three times wi th 0.1 %

Triton-XI00 in PBS. The protein bound on the beads was eluted with 1 x Laemmli loading 139 buf5er (50mM Tris, pH 6.8; 2%SDS; 10% glycerol; lOOmM DTT; 0.05% Bromophenol blue),

and separated on 4-20 % SDS-PAGE gradient gels (Novex) in Tris-glycine bufTer (25mM Tris,

250mM glycine, 0.1% SDS). After drying, the gel was exposed to X-ray film ovemight at room

temperature. For CO-immunoprecipitati011~,COS-7 cells grown on a 100 mm plate in DMEM

were transfected with expression vecton encoding FLAG-14-3-3 q and nX-2 using calcium

phosphate, and were harvested 30 hours later. Cells were washed once in PBS. resuspended in

500 pl of TNM baer [20mM Tris-HCl (PH 7.4), 1SOmM NaCI, 5m.M MgCI,, 0.1% NP-401

containhg complete proteinase inhibitor cocktail (Boehringer Mannheim), and sonicated 3 X 1Os

on ice. The ceil lysate was centrihiged at 14,000 rpm for 10 min at 4°C. The supematant was

precleared by incubating with 20 pl of protein A conjugated agarose beads (50% slurry) for

30mln at 4°C. Co-IP was performed by incubating the supematant with 1 pg of ami-FLAG M2

antibody (Eastman Kodak) conjugated on agarose beads for 2 hours at 4:C The beads were

washed 4 times with 1 ml of TNM buffer, resuspended in 40 pl of Laemmli loading buffer and boiled for 2 min. For Western blot analysis, 10 pl of the CO-IP product was separated by SDS-

PAGE and transferred to nitrocellulose membranes overnight (4"C, 30V) in transfer buffer

(25rnM Tris-HCI pH 8.3; 150mM glycine; 20% rnethanol). After transfer. the membrane was rinsed in PBS then blocked in PBS containing 0.1% Tween-20 and 5% non-fat milk (Bio-rad) for

1 hour at room temperature, washed three times (1 x 15 min, 2 x 5 min) with wash buffer (0.1%

Tween-20 in PBS), and then incubated with the anti-TLX-2 polyclonal antibody for 1 hour at room temperature. After three washes (1 x 15 min, 2 x 5 min), the membrane was incubated with peroxidase-labeied anti-rabbit antibody (Arnersham) for 30 min at room temperature followed by five washes (1 x 15 min, 4x5 min). Detection was performed with enhanced chernical 140 luminescence (ECL) Western blottuig detection reagents (Amersharn) accordhg to the

manufacturer's instructions. The TLX-2 rabbit anti-sera was raised against the synthetic peptide

AEDNKVASVSGL correspondhg to the C-terminus of TLX-2 protein (produced by the

National Centers of Excellence, Vancouver, Canada). The specificity of this anti-sera was tested

with GST-TLX-2 and in vitro translated TLX-2 protein (data not shown).

Indirect immunofluorescence staining

COS-7 cells cultured in Pemanox charnber slides (Nunc) were transientiy transfected

with either FLAG-Tlx-2 or FLAG- 14-3-3 q alone or with both pcDNA- 14-3-3 q and pcDNA-

Tlx-2. Cells were washed once with PBS, futed for 10 min with 4% paraformaldehyde in PBS

followed by three washes with PBS. Fixed cells were then permeablized with cold (-20°C) methanol for 2 min followed by four washes with PBS, blocked in 10% goat serum for 1 hour at room temperature, and then incubated overnight at 4°C in 10% goat serum containhg 20 pglml of anti-FLAG M2 monoclonal antibody. Cells were washed four times with PBS then incubated for 2 hours at room temperature with FITC-conjugated donkey anti-mouse IgG antibody

(Jackson ImmunoResearch Laboratories) in 10% goat sem, foliowed by three subsequent washes. For nuclear staining, cells were incubated in DAPI (1 mghl in PBS) for 5 min and washed three times in PBS.

Whole mount RNA in situ hybridization

Whole mount in situ hybridization was perfonned as described by Wilkison (1992). For generating the Tlx-2 antisense ribo-probe, pGEM7-Tlx-USacIIA was linearized with Notl and 141 transcribed with the T7 polymerase. For generating the 14-3-3 q antisense nbo-probe,

pEXox(+)- 143-3-3 q was linearized with BglII and transcribed with Sp6 polymerase.

Northern blot analysis

Ten pg of total RNA were nin on a 1% agarose gel containing 2.2M fomaldehyde. RNA

transfer to Hybond-N' membrane was performed using a vacuum blotter (Bio-rad) for 2 hours

with 0.05M NaOH as a transfer buffer. The membrane was rinsed twice in 2 X SSC.

prehybridized for 2 hours at 68°C in Rapid-hyb bufFer (Amersham) containing 50 rng/ml of

denatured sheared salmon sperm DNA, and hybridized overnight by adding the probe into the

prehybridization buffer. Two washes were performed in 2 X SSC, 0.2% SDS at room

temperature followed by two washes in 0.2 X SSC. 0.2% SDS at 68°C.

PC 12 cell tninsfection and the neuronal dmerentiation assay

PC 12 cells were cutured in RPMI 1640 with IO% horse senun and 5% fetal bovine serum on collagen coated 60 mm plates and transfected with appropriate expression vectors plus RSV-

Lac2 using either calcium phosphate or the LipofectAMME reagent (Gibco-BRL). Three pg of

Tlx-2 ador 14-3-3q expression vector and 1 pg RSV-LacZ were used in transfections as indicated in Table 1. Empty pcDNA 1 vector was used to make up the total arnount of DNA to 7 pg for mock and single vector transfections. NGF (2.5S, Sigma) was added to a final concentration of 10 ng/ml 20 hours after transfection. After 3 or 6 days of NGF induction, the cells were stained for Lac2 expression. Cells were rinsed in 0.1M phosphate buffer (pH 7.3, fixed in fixing solution (0.2% glutaraldehyde, 5mM EGTA, 2mM MgCl! in O. IM phosphate 142 buffer) for 5 min, washed three hesin wash bmer (2mM MgCl!, 0.0 1% deoxycholate. 0.02%

Nonidet-P40 in 0.1 M phosphate buffer), and stained ovemight at 37°C in X-gai staining solution

(1 mg/d X-gai, 0.005mM potassium ferrocyanide, 0.OO5mM potassium ferricyanide in wash

buffer). The ceils were stored in wash beer at 4°C. The stained cells were scored according to

their relative length compared to the ce11 body.

4-4, Resuits

4.4.1. Interaction cloning of the mouse 14-3-3 q gene

The TLc-2 gene is specifically expressed in the developing mouse PNS afier 9.0 days

postcoitum of ernbryogenesis (Chapter 3). To isolate proteins that interacts with and regulates

TLX-2 during PNS ontogenesis, a GST-TLX-2 fusion protein containing the C-terminal 68 residues of TLX-2 was "P-labeled by heart muscle kinase and used to screen a mouse cDNA expression library derived from mouse embryos 10.0 days postcoihm (Novagene) (Blanar and

Rutter, 1992; Skolnik et al., 1991). A positive clone was isolated after four rounds of purification fiom 2.5~10'plaques screened. Sequence analysis revealed that this clone contained a fragment of 1668 bp (Fig. 4-l), which was similar to the size of its mRNA as detennined by

Northern blot analysis (Fig. 4-Sa). A data base search revealed that the deduced amino acid sequence is identical to the rat 14-3-3 q (Watanabe et al., 1991), indicating the cloned cDNA was the mouse 14-3-3 r;l. -nrrrrarrr,Pm3!m2G--ca3axmG---- M GDRE QLL OCPO=T1333S------QRA RLAE QAE RYD DMAS AMK AVT ELNE PLS NED

------RNLL SVA YKN VVGA RRS SWR VISS IEQ KTM ADGN A!mm&2AGrlGmuA~~~~CAGlTIOLAA-~~ EKK LEK VKAY REK IEK ELET VCN DVL ALLD KFL ---C;PiOaP43IG------C;PiOaP43IG------IKN CNDF QYE SKV FYLK MKG DYY RYLA EVA SGE AIV;AAFAACA-m----?DCZYXXnPC-m KKNS VVE ASE AAYK EAF Ers KEHM QPT HP1 RLGL ~~~~~~1TZZ?a(33=AAACAA03CrZC~~ ALN FSV FYYE IQN APE QACL LAK QAF DDAI AEL ~~m~~~-CAPDCICPD=-~~ DTL NEDS YKD STL IMQL LRD NLT LWTS DQQ DEE ccmssvG------AGEG N cmummfr------m 144 Fig. 4-1. Mouse 14-33 q cDNA Nucleotide and deduced amino acid sequence of the mouse Transfection pFLAG-CMV2 --+ pcDNAl -TIx-2 ++ pFLAG-CMVP-14-3-3 eta ++-

ant i-TLX-2 + TLX-2

Blotting:

anti-FLAG + FLAG-14-3-3 ETA 146 Fig. 4-2. In V'oand In Vito interaction of TLX-2 and 14-3-3 q proteios. a In vim translation products of TLX-2 and 14-3-3 q. The deduced molecular weights of TLX-2and 14-

3-3 q are 30.3 kD and 28.2 kD, respectively. nX-2 and 14-3-3 q proteins are indicated by arrows. b. In vitro binding assays. GST or GST fusion proteins bound on Glutathione Sepharose

4B beads were incubated with the in vitro translated and "s-methionine labeled TLX-2 or 14-3-3 q. "s-labeled protein retained on beads afler washes was analyzed by SDS-PAGE. The combination of proteins in each lane is as follows: Lane 1, GST + "S -nX-2: Lane 2. GST+ ":s

- 14-3-3 q; Lane 3, GST-14-3-3 q + "S -TLX-2; Lane 4, GST-TLX-2 + ''s- 14-3-3 q; Lane 5,

GST-14-3-3 q + "S - 14-3-3 q . Lanes 1 and 2 serve as negative controts, and show bat neither nX-2 nor 14-3-3 q binds to GST. Lane 5 is a positive control. showing the expected dimerization of 14-3-3 proteins as demonstrated previously (Jones et al.. 1995). Lanes 3 and 4 demonstrate the interaction between nX-2 and 14-3-3 q. c. Co-immunoprecipitation. Ce11 extracts were made fiom COS-7 cells transiently msfected with expression vectors indicated above individual lanes. The extracts were then immunoprecipitated with anti-FLAG M2 antibody, followed by detection of precipitates with anti-TLX-2 (upper panet) or anti-FLAG antibodies (bottom panel), by Western blot analysis. As shown in the rniddle lane. where TIx-2 and 14-3-3 q are CO-transfected, TLX-2 is CO-precipitatedwith 14-3-3 q. TTdX-2 protein is observed as a doublet (indicated by arrow). FLAG-TLX-2 was also detected as a doublet with the anti-FLAG antibody on Western blot of the cefl extract prepared fiom COS-7 cells transiently transfected with pFLAG-Th-2 (data not shown). 147 4.4.2. Interaction of the TLX-2 and 14-3-3 q proteins Ur vitro and in vivo

The results of the cloning described above suggested an interaction between the C- terminus of TLX-2 and the 14-3-3 q protein. To confirm the interaction between the Ml-length proteins, in vitro interaction assays were performed using GST-TLX-2 and GST-14-3-3 q fusion proteins and Nt vitro translated TLX-2 and 14-3-3 q. The results showed that the S-Iabeled

TLX-2 and 14-3-3 q bound to GST-14-3-3 q and GST-TLX-2, respectively, but not to GST (Fig.

4-2a; 4-2b). Consistent with the previous observation on the dimerization of 14-3-3 proteins

(Jones et al., 1995), an intermolecular interaction was also detected for the 14-3-3 q protein (Fig.

4-2b).

To determine if the association between TLX-2 and 14-34 q proteins occurs in marnmalian cells, CO-immunoprecipitation was performed on extracts fiom COS-7 cells transiently CO-transfectedwith expression vectors encoding FLAG epitope-tagged 14-34 q and wild type TLX-2. Precipitation was performed by using the antibody against the FLAG-epitope followed by Western blot analysis with antibodies against 'T'LX-2. As shown in Figure 4-2C. the

TLX-2 protein cm be CO-precipitatedwith 14-3-3 q, indicating that these two proteins can interact in mammalian cells. TLX-2 at least exists in two isofonns, which may be resulted fiom post-translational modifications, as indicated by the presence of multiple bands (Fig. 4-2C).

4.43. The enhancement of TLX-2 nuclear locaiization by 14-33 q

To identiSr the subcellular coinpartment in which TLX-2 and 14-3-3 q interact we fim detemiined the cellular localization of TLX-2 and 14-3-3 q in COS-7 cells transfected with an expression vecton encoding FLAG epitope-tagged T'LX-2 (FLAG-TLX-2) or FLAG- 14-3-3 q . DAPl anti-FLAG DAPl anti-FLAG 149 Fig. 4-3. Enhancement of the nuclear accamuIation of TLX-2 by CO-transfectionof 14-3-3

q. A. 14-3-3 q dependent nuclear accumulation of TLX-2 in COS-7 cells. COS-7 cells were

transfected with pFLAG-Th-2 (a,c) or pFL AG-Tlx-2 plus pcDNA- 14-3 -3 q (b,d). The cellular

localization of TLX-2 was detemiined by immunofluorescence using the anti-FLAG M2

antibody and an FITC-conjugated secondary antibody. DAPI staining was used to visualize

nuclei, as show below each correspondhg FITC micrograph (c,d). When pFLAG-Tlx-2 was transfected alone, the FITC fluorescent signal was distributed in both the nucleus and the cytoplasm (a). However, CO-trmsfection with pcDNA- 14-3-3 q resulted in predominantly nuclear staining (b). B. The cellular localization of 14-3-3 q was not affected by TLX-2. COS-7 cells were transfected with pFLAG-14-3-3 q alone (e, g) or pFLAG-14-3-3 q together with pcDNA-Tlx-2 (f, h). Cells transfected with either pFLAG- 14-3-3 q done or pFLAG- 14-3-3 q and pcDNA-Tlx-2 displayed cytoplasmic and membrane FITC-staining (e. f). Arrows in c. d. g, and h identified nuclei of the FITC-positive cells in a, b, e, and f, respectively. C. Quantifation of cells with nuclear and cytoplasmic staining or with only nuclear staining as illustrated in (A).

The data summarïzed are fiom three independent experiments for FLAG-Tlx-2 transfection (448

FITC-positive cells were scored in 174 randomly picked microscopic fields). and fiom four experiments for CO-transfectionof FLAG-Tlx-2 and 14-3-3 q (572 FITC-positive cells were scored in 267 randomly picked microscopic fields). The enhancement of the nuclear localization of TLX-2 by 14-3-3 q is statistically significant, as demonstrated by the test of the mean difference (0.005 c p < 0.01). 150 AAer st-g with anti-FLAG primary and Buorescein isothiocyanate (F1TC)-conjugated secondary antibodies, two patterns of fluorescent signals were observed in the ce11 population transfceted with FLAG-TLX-2: exclusive nuclear staining was seen in 36% of the FITC-positive cells, while the remaining 64% cells had both distict cytoplasmic and nuclear signals (Fig. 44A- a; 4-3A-c; 4-3C). When COS-7 cells were tranfected with an expression vector coding for

FLAG-14-3-3 q, the fluorescent signal was observed primarily in the cytoplasm and on the ce11 membrane (Fig. 4-3B-e; 4-3B-g). These results demonstrate a CO-localizationof nX-2 and 14-

3-3 q in cytoplasm. To determine if the interaction of T'LX-2 and 14-3-3 q affect the cellular localization of TLX-2, we examined the pattern of fluorescent signals in COS-7 cells CO- transfected with FLAG-TLX-2 and 14-3-3 q. We observed that the majority of the FLAG-TLX-

2 positive cells (86%) had an exclusively nuclear signai, while the remaining fraction (14%) had signals in both cytoplasm and nucleus (Fig. 4-3A-b; 4-3A-d; 4-3C). These results demonstrate that the CO-expression of 14-3-3 q significantly enhances the nuclear localization of TLX-2

(0.005 < p < 0.01). However, CO-expressionof T'LX-2 did not significantly alter the cellular distribution of 14-3-3 q (Fig. 4-3B-f; 4-3B-h).

4.4.4. The overlapped expression patterns of 14-3-3 7 and Tb2in the developing PNS

To assess the biological significance of the interaction between TLX-2 and 14-34 q during development, whole mount Ni situ hybridization analysis was performed to compare the expression patterns of these two genes during embryogenesis. As shown in Fig. 4-4. TIx--2 and

11-3-3 q shared extensively overlapping expression domains in the developing PNS, including both sensory and autonomie systems (Fig. 4-4, data not shown). Compared with that of Tlx-2, 14-3-3 eta 152 Fig. 4-4. Overlapphg expression of 14-3-3 q and Tuc-2 in the developing mouse PNS.

E 10.5 and El 1.5 mouse embryos were subjected to whole mount in situ hybridization analysis to determine the expression of 14-3-3 q (a, b) and 7E-2 (c, d). The expression of both genes was observed in the cranial ganglia (black arrows), dorsal mot ganglia (DRG, arrowheads). As its rat counterpart (Watanabe et ai., 1991), preliminary resuits suggest the mouse 14-3-3 q is also expressed in the sympathetic ganglia (data not shown), where 7k-2 is highly expressed (white arrows in c; data not shown). Abbreviations: b, branchial arches; lb, Iimb buds. 153 the expression pattern of 14-3-3 q was much broder. in addition to the developing PNS, 14-3-3

q expression was also detected in other tissues and organs, including branchial arches and Iïmb

buds (Fig. 4-4). These results demonstrate the CO-expressionof Tlc-2 and 14-3-3 q in the developing PNS and suggest a functionai interaction between these two proteins during PNS development.

4.4.5. Co-expression of TWand 14-3-3 7 in PC 12 ce&

PC 12 cells are derived fkom the transformed adrenal chromaffin cells that originate. as do most components of the PNS, tiom the neural crest These cells can differentiate into sympathetic-like neurons der NGF induction (Teng and Green. 1994). PC 12 cells were therefore used to assess the potential functional interaction between TLX-2 and 14-3-3 q.

Firstly, the expression of TLx-2 and 14-3-3 7 in PC 12 cells was detemiined by Northern blot analysis. As shown in Fig. 44% both genes are expressed in this ceil line before and after NGF induction. Taken together with the CO-expressionof these genes in the developing PNS. this result suggests that the interaction of TLX-2 and 14-3-3 q may play a role in the neural differentiation of PC 12 cells.

4.4.6. Synergistic suppression of the neurite growth of PC 12 cells by TLX-2 and 14-3-3 q

The previous studies showed an inhibitory effect of the Tlx-2 overexpression on NGF- induced neurite growth of PC 12 cells (Chapter 3). 1 therefore examined the effect of 14-3-3 q on this activity of T1x-2 by transfection assays. PC 12 cells were fust transfected with the Table 1: Cornparison ofneurite growth of PC 13, cells transfected with Tlx-2, 14-3-3 q, or Tbc-2 + 14-3-3 q (%kSD) 3 days of NGF induction 6 days of NGF induction relative Tlx-3 + Tlx-2 + length of pcDNA- 1 Tlx-2 4-q 14-3-3 q pcDNA- l Tlx-2 14-3-3 14-3-3 neurites O 36.8k0.6 59.Jk1.5 59.6k4.6 90.6I1.8 23.6k0.6 65.7S.O 62.2k2.3 93.20.5 <1 44.1kO.l 30.321.7 34.1-2 SSf1.3 26.7f0.9 21.3k1.6 21.7k1.6 5.3k0.8 1-2 I4.9k0.9 8.3202 5.0f 1.3 0.6f0.2 27.9k1.4 9.2kl.O 10.232 I.2k0.3 >2 4.3k0.4 2.1k0.1 1.6f0.4 0.4k0.0 21.72 1.5 3.5k1.0 6.1k0.6 0.5fr0.0 total cells 465 437 43 8 504 444 403 473 422 notes: a. relative length of neurites: 0, without neurites; cl, neurites shorter than one celt body; 1-2, neurites longer than one but shorter than nvo cell bodies; >2, neurites longer than two ceII bodies. b. RSV-Lac2 ptasmid was included in each transfection, and the tnnsfected cells were identified by Lac2 staining. pcDNA- I transfection was included as a control. relative suppression (folds)

- - Id 1, - J. - - JI = Jt = Ji = JI = 156 Fig. 4-5. Synergistic suppression of neurite growth of PC 12 ce& by TLX-2 and 14-3-3 q.

a. Co-expression of TLx-2 and 14-3-3 7 in PC 12 cells. The expression of TLr-2 and 14-3-3 7 in

PC 12 cells was determined by Northem blot analysis. p-actin was used as a control for the

amount of RNA loaded on individual lanes. b. Synergîstic suppression of neurite growth of PC

12 cells by co-tmnsfection of TLx-2 and 14-3-3 4 PC 12 cells were transfected with pcDNA-Tlx-

2 or pcDNA-14-3-3 q alone or co-transfected with both as well as with RSV-LacZ, followed by

induction with 10 ng/d NGF for 3 or 6 days. The empty pcDNA-1 plasmid was used in mock

transfections. The transfected cells, identified by Lac2 staùllng, were scored according to the

length of their processes (Table4-1). The relative folds were defined as the ratio between the percentages of cells with neurites longer than 1 cell body in mock transfection and various expression vector transfections (Table 4- 1). 157 expression vectors of Zk-2 and 14-3-3 7 together with RSV-LacZ, as indicated in Table 4-1.

After three or six days of NGF induction, the transfected cells were identified by LacZ staining and scored according to the relative length of their neurïtes. Consistent with prevïous observations, transfection of TLr-2 led to suppression of the NGF-induced neurite outgrowth

(Tanle 4-1). Moreover, transfection of 11-3-3 7 alone also caused a substantiai suppression of the NGF-induced neurite growth (Table 4-1). Importantly, when both TLr-2 and 14-3-3 q~ were

CO-transfectedinto PC 12 cells, a synergistic suppression of the growth of nemites was observed

(Fig. 4-5b). This result suggests a hctional interation between TLX-2 and 14-3-3 q proteins during the neuronal differentiation of PC 12 cells. The physiological relevance of this observation is supported by the co-expression of TLr-2 and IC3-3 q in PC 12 cells.

Finally, the specific stage of neurite growth at which TLX-2 and 14-34 q block was determined. In mock transfections, the percentage of transfected cells without processes was considerably lower after six days of induction than after three days (Table 4-1). indicating that active neurite outgrowth was occurring in this group of transfected cells. In contrast. the percentage of cells without processes in cells ~sfectedby either77x-2 or 14-3-3 q alone or CO- transfected with both vectors did not decrease as the induction proceeded, suggesting that these transfected cells did not undergo an active differentiation. On the other hand, the percentage of cells with processes longer than one ce11 body in both mock and experimental transfections increased hmday three to six, while the percentage of cells with neurites shorter than one cell body decreased substantially. This indicates diat the growth of existing processes continued in cells transfected with Tlr-2 and 11-3-3 q, although it is difficult to determine if the rate of growth of pre-existing neurites is the same as that in mock transfected cells (Table 4-1). 158 Together, these data suggest a role for both 2%-2 and 14-3-3 7 in blocking the initiation of neurite outgrowth.

4.5. Discussion

An in vitro and Ni vivo interaction between the TLX-2 homeodomain and 14-3-3 q proteins has been demomtrated in this study. The biological significance of this interaction is established at several levels: 14-3-3 q uicreases the nuclear localization of TW(-2, Th-2 and 14-3-3 q are

CO-expressedin the developing PNS and in PC 12 cells, and TLX-2 and 14-3-3 q cooperatively suppress neurite outgrowth of PC 12 cells induced by NGF. Recent studies have suggested that

14-3-3 proteins cm bind to a RXXSXP motif (serine is phosphorylated) in various signalling proteins (Muslin et al., 1996). However, this motif is not present in the amino acid sequence of

TLX-2, indicahg that a different binding mechanism or motif mediates its interaction with 14-3-

3 q. Notably, the interaction between PGIb-a and 14-3-3 proteins is also not rnediated by a

RXXSXP motif (Du et ai., 1996).

Arnong a number of potentid hctions in various biological processes such as ce11 cycle and apoptosis (Ford et al., 1994: Conklin et al., 1995; Zha et al., 1996), 14-34 proteins have been show to play important roles in regulating ce11 signalling (Fantl et al.. 1994: Irie et al.,

1994; Freed et ai., 1994; Reuther et al., 1994; Fu et al., 1994; Pallas et al., 1994; Braselmann and

McCormick, 1995; Li et al., 1995; Meller et al., 1996; Aitken, 1995). For example, Fantle et al.

(1995) found that 14-3-3 proteins can stimulate endogenous Raf activity and promote the Raf- dependent maturation when introduced into Xenopus oocytes. Furthexmore, overexpression of

14-3-3 in yeast S. cerevisiae activates the mammdian Raf expressing in this strain (Freed et al. 159 1994), while the activation of Raf by overexpression of Ras is prevented by deletion of BMHI, which encodes a yeast 14-3-3 homolog (Irie et al. 1994). These results suggest a positive role of

14-3-3 proteins in regdahg the activation of Raf in the Ras signalhg pathway. The biological requirement for 14-3-3 proteins in Ras/MAPK signalling pathway has recently been demonstrated in yeast and Drosophila. In yeast, the RaslMAPK signalling is essential for pseudohyphal growth and pheromone-induced mating. Roberts et al. (1997) reported that double mutations in Bmhl and Bmh2 disrupt the pseudohyphal growth pathway but not the mating response, indicating that Bmhl and Bmh;! play a specific role in the RaslMAPK signalling cascade. In Drosophiiu, the Ras/MAPK pathway is required for specification of the R7 photoreceptor. Kockel et al. (1997) showed recently that Ioss-of-function of 14-3-3 5 results in disruption of R7 photoreceptor formation, while gain-of-function mutation in 14-Me suppresses the phenotype caused by Ras mutation (Chang and Rubin 1997). In another snidy.

Rommel et al. (1997) reported a single base pair substitution in Raf results in increased activity of Raf which in ~LUII causes the formation extranurnery R7 photoreceptors. Interestingly, this mutation prevents the association of 14-3-3 with the mutant Raf. The authors thus argued that the increased activity of Raf may result fiom the selective loss of 14-3-3 binding. These data colIectively demonstrate a biologicai function of 14-3-3 proteins in RaslMAPK signalling cascades.

14-3-3 proteins may integrate different signailing pathways by interacting with various signalling molecules. In fact, 14-3-3 proteins cm form homo- and hetero-dimer (Jones et al.

1995) in which the amino-terminai helices of the two subunits contact one another (Xiao et al.

1995; Liu et al. 1995). Studies have suggested that such dimeric molecules rnay function as 160 adaptors or scaffolds to mediate interaction between different proteins. For instance. it has been

shown that 14-3-3 proteins mediate the interaction between Raf and Bcr proteins (Braselmann

and McCormick 1995). In this scenario, our finding of the association between TLX-2 and 14-3-

3 q suggests that the 14-3-3 protein may bridge an interaction of ïLX-2 and another as yet uncharacterized protein. Given that 1 4-3-3 proteins are associated with numerous signalling kinases, it is likely that -LX-2 may interact with one or more of those kinases. and therefore the function of TLX-2 is regulated directiy by ce11 signalling. Since phosphorylation and dephosphorylation serve as a major mechanism regulating the nuclear localization of transcription factors (Vandromme et al. 1996), the obsewed enhancement of T'LX-2 nuclear localization by 14-3-3 q may be attributed to a potentiai 14-3-3 q-mediated interaction between

TLX-2 and a signailing kinase which modulates the phosphorylation state of TLX-2. Taken together, we propose the following mode1 for the regdation of TLX-2 function by 14-3-3 proteins. 14-3-3 proteins mediate an interaction between TLX-2 and specific signalling kinases

(e.g. RAF-1). Activation of certain signailing pathways by extracelluIar signals (e.g. NGF) results in phosphorylation of TLX-2 by the associated kinase. As a consequence. the phosphorylated TLX-2 is transferred to the nucleus to exert its function in transcription regdation.

Tlx-2 and 11-3-3 7 are CO-expressedin the developing PNS, and cooperatively suppress the neurite outgrowth induced by NGF when co-transfected into PC 12 cells. These results suggest a functional interaction between the two genes. As discussed previously (Chapter 3). Th2may act as a negative regulator of neuronal differentiation and is likely required for maintaining the proliferating state of neural precursor cells. The fmding of nX-U14-3-3 q interaction suggests 161 this activity of TLX-2 is subjected to regdation by 14-3-3 proteins and in tum likely to the ceil signalling mediated by 14-3-3 proteins. During PNS development, a process highiy regdated by environmentai signals, this interaction may provide a mechanism that connects the extracellular signals and intnicellular transducers that execute their functions in neural proliferation and differentiation, 162 4.6. References

Agulmck, A. D., Taria, M., Breen, J. J., Tanaka, T., Bawid, 1. B. and Westphal, H. (1996). Interactions of the LIMdomain binding factor Ldbl with LMhomeodomain proteins. Nature 384,

Aitken, A. (1995) 14-3-3 proteins on the MAP. Trends Biochem. Sci. 20,957.

Blanar M. A. and Rutter, W. (1992) Interaction cloning: identification of a helix-loop-helix zipper protein that interacts with c-Fos. Science 256, 10 14- 18.

Braselmann, S. and McConnick, F. (1995) Bcr and Raf form a complex in vivo via 14-3-3 proteins. EMBO Journal 14,4839-48.

Chan, S. K., Jaffe, L., Capovilla, M., Botas, J. and Mann, R. S. (1994) The DNA binding specificity of Ultrabithorax is modulated by cooperative interactions with extradenticle, another homeodomain protein. Ce11 78,603-1 5.

Chang, H. C. and Rubin, G. M. (1997) 14-3-3 E positively regulates RASOmediated signailing in Drosophiia. Genes Dev. 1 1, 1 132- 1 139.

Chen, C. and Okayama, H. (1987) Hi&-eEciency transformation of mammalian cells by plasrnid DNA. Mol. Cell. Biol. 7,2745-52

Conklin, D. S., Galaktionov, K. and Beach, D. (1995) 14-3-3 proteins associate with cdc25 phosphatases. Proc. Natl. Acad. Sci. USA 92,7892-6.

Du, X., Fox, J. E. and Pei, S. (1996) Identification of a binding sequence for the 14-34 protein within the cytoplasmic dornain of the adhesion receptor, platelet glycoprotein Ib alpha. J. Biol. Chem. 271,7362-7.

Fanti, W. J., Muslin, A. J., Kikuchi, A., Martin, J. A., Gross, R. W. and Wi Activation of Raf- 1 by 14-3-3 proteins. Nature 37 1,61 2-4.

Ford, J. C., al-Khodairy, F., Fotou, E., Sheldrick, K. S., Griffith, D. I. and 14-3-3 protein homologs required for the DNA darnage checkpoint in fission yeast. Science 265, 533-5.

Freed, E., Symons, M., Macdonald, S. G.. McCormick, F. and Ruggieri, R. (1994) Binding of 14-3-3 proteins to the protein kinase Raf and effects on its activation. Science 265. 17 13-6. 163 Fu, H., Xia. K., Pallas, D. C., Cui, C., Conroy, K., Narsimfian, R. P., Mamon, H., Collier, R. J. and Roberts, T. M. (1994) Interaction of the protein kinase Raf-1 with 14-3-3 proteins. Science 266, 126-9.

Guichet, A., Copeland, 1. W. R., Erdelyi, M. et al. (1 997) The nuclear receptor homologue Ftz- F 1 and the horneodomain protein Ftz are rnutually dependent cofactors. Nature 385,548-552.

Irie, K., Gotoh, Y., Yashar, B. M., Errede, B., Nishida, E. and Matsumoto. K. (1994) Stimulatory effects of yeast and mamrnalian 14-3-3 proteins on the Raf protein kinase. Science 265. 17 16-9.

Jones, D. H., Ley, S. and Aitken, A. (1995) lsoforxns of 14-3-3 protein can form homo- and heterodimer in vivo and in vitro: implications for firnctions as adapter pmteins. FEBS Letters 368,55-8.

Kawabe, T., Muslin, A. and Korsmeyer, S. 1. (1997) HOX11 interacts with protein phosphatases PP2A and PP1 and dismpts a G2/M cell-cycle checkpoint. Nature 385,45448.

Kockel, L., Vorbmggen, G., Jackle, H., Mlodzik, M. and Bohrnann, D. (1997) Requirement for Drosophila 14-3-3 5 in RAFF-dependent photoreceptor development. Genes Dev. 1 1. 1 140- 1 147.

Knimlauf, R. (1 994) Hox genes in vertebrate development. Ce11 78, 19 1-20 1.

Lawrence, P. A. and Morata, G. (1994). Homeobox genes: their function in Drosophila segmentation and pattern formation. Cell78, 18 1-9.

Li, S., Janosch, P., Tanji, M., Rosenfeld, G. C., Waymire, J. C., Mischak, H.. Kolch, W.. and Sedivy, J. M. (1995) Regulation of Rd-1 kinase activity by the 14-3-3 farnily of proteins. EMBO J. 14, 685-96.

Lichtsteiner, S. and Tjian, R (1995). Synergistic activation of transcription by UNC-86 and MEC3 in Caenorhabditis eiegans embryo extracts. EMBO J. 14,39374.

Liu, D., Bienkowska, J., Petosa C., Collier, R. J., Fu, H. and Liddington. R. (1995) Crystal structure of the zeta isoform of the 14-3-3 protein. Nature 376, 191-4.

Meller, N., Liu, Y. C., Collins, T. L., Bonnefoy-Berard, N., Baier, G., Isakov. N. and Altman, A. (1996) Direct interaction between proteh kinase C theta (PKC theta) and 14-3-3 tau in T cells: 14-3-3 overexpression results in inhibition of PKC theta translocation and function. Mol. CeIl. Biol. 16, 5782-9 1.

Muslin, A. J., Tanner, J. W., Allen, P. M. and Shaw, A. S. (1996) Interaction of 14-3-3 with signaling proteins is mediated by the recognition of phosphoserine. Ce11 84, 889-97. Pallas. D. C., Fu, H., Haehnel, L. C., Weller, W., Collier, R. J. and Roderts, T. M. (1994) Association of polyomavinis midde tumor antigen with 14-3-3protek. Science 265,535-7.

Reuther, G. W., Fu, H., Cripe, L. D., Collier, R. j. and Penderpast, A. M. (1994) Association of the protein kinases cBcr and Bcr-Ab1 with proteins of the 14-3-3family. Science 266, 129-33.

Roberts, R. L., Mosch, H-U. and Fi& G. R. (1997) 14-3-3 proteins are essential for RAS/MAPK cascade signalling during pseudohyphal development in S. cerevisiae. Ce11 89, 1055-1065.

Rommel, C., Radziwill, G., Moelling, K. and Hafen, E. (1997) Negative regulation of RAF activity by binding of 14-3-3to the amino terminus of EWF in vivo. Mech. Dev. 64.95-104.

Skolnik, E. Y., Margolis, B., Moharnmadi, M., Lowenstein, E., Fischer, R., Drepps, A., Ullrich. A. and Schlessinger, J. (1991) Cloning of PI3 kinase - associated p85 utilizing a novel method for for expression/cloning of targeted proteins for receptor tyrosine kinase. Cell 65. 83-90.

Tang , S. J., Hoodless, P., LU, Z., Breitman, M., McInnes, R. R., Wrana, J. and Buchwald, M. (1997) Regulation of mammaiian mesoderm development by a BMP/Tlx-2 signalling pathway. (manuscript)

Teng, K. K. and Greene, L. A. (1994) Cultured PC 12 cells: a mode1 for neuronal function and differentiation. in Cell Biology. A laboratory handbook ed. Celis, J. E. Academic Press. New York.

Vandromme, M., Gauthier-Rouviere, C., Lamb, N. and Femandez, A. (1996) Regulation of transcription factor localization: fme-tuning of gene expression. Trends Biochem. Sci. 2 1.59-64.

Vincenz, C. and Dixit, V. M. (1996) 14-3-3 proteins associate with A20 in an isoform-specific rnanner and hinction both as chaperone and adapter molecules. J. Biol. Chem. 271.2002944.

Watanabe, M., Isobe, T., Okuyama, T., Ichimura, T., Kuwano, R., Takanashi, Y. and Kondo. H. (1991). Molecular cloning of cDNA to rat 14-3-3 eta chah polypeptide and the neuronal expression of the mRNA in the central nervous system. Brain Res. Mol. Brain Res. 10. 15-158.

White, R. (1994) Homeodomain proteins: homeotic genes seek partners. Curr. Biol. 4.48-50.

Wilkinson, D. G. (1992) Whole mount in situ hybridization of vertebrate embryos. in In Situ Hybridization, ed Wilkinson, D.G. IRL Press, pp75-83.

Xiao, B., Smerdon, S. J., Jones, D. H., Dodson, G. G., Soneji, Y., Aitken. A. and Gamblin, S. J. (1995) Structure of a 14-3-3 protein and implications for coordination of multiple signalling pathways. Nature 3 76, 188-9 1. Xue, D., Tu, Y. and Chaifie, M. (1993) Cooperative interaction between the Caenohabditis elegans homeoproteins UNC-86and MEC-3. Science 261,1324-8.

Yu, Y., Li, W., Yussa, M., Han, W., Perrimon, N. and Pick, L. (1997) The nuclear hormone receptor Ftz-F 1 is a cofactor for Dnophila homeodomain protein Ftz. Nature 358.552-555.

Zha, J., Harada, H., Yang, E., Jockel. J. and Konmeyer, S. .J. (1996) Serine phosphorylation of death agonist BAD in response to sUrviva.1 factor results in binding to 14-3-3 not BCL-X,. Ce11 87,6 19-28.

Zhu, A. and Kuziora, M. (1997) Homeodomain interaction with the B subunit of the generai transcription factor TFIIE. J. Biol. Chem. 27 1,20993-20996. Chapter 5

Conclusions and future perspectives s detailed in the previous sections, the aim of this thesis was to understand the function of a mouse HOXII-related gene, TLr-2, fkom severai aspects. In this chapter, the conclusions reached fiom each project will be briefly summarized in the context of the most closely related previous studies (Chapterl). The questions that have been raised by these studies but remain to be merdefmed will then be discussed. Finally. potential approaches to address these questions are proposed.

5.1. The function of TLr-2 in mouse gastrulation

5.1.1. A summary of the Tb2function during mouse mesoderm development: the phenotypes of TLr-2 mutant embryos

The basic body plan of mammalian embryos is laid down during gastrulation. a process involving extensive ce11 movement, germ layer formation, and embryonic patterning (Hogan et al., 1994; Tarn and Beddington, 1992). During this developmentd process, a transient structure called primitive streak is formed at the posterior midline of the epiblast, as the result of epiblast ce11 allocation and proliferation. The primitive srreak plays important roles in mesoderm formation, by recruiting and distributing the prospective mesodemal cells from the epiblast (Tarn et al.. 1993). However. the molecular basis of the primitive streak organization and mesoderm formation remainç unknown (section 1. 1.). Understanding the molecular mechanism of mesoderm development in mammalian embryos depends, in part, on identiming the regulatory genes involved in this process and charactenzing their functions in vivo. This has been a difEcult problem to solve until recently, as more regulatory genes of mouse mesoderm development have been identified, and their functions begun to be understocd through tbe

use of gene targeting experiments (Copp, 1995).

In this study, TLr-2, an important regdatory gene for the formation of mouse

primitive streak and mesoderm, has been identified (Chapter 2). The 27x-2 homeobox

gene is expressed in the primitive streak of mouse embryos. A targeted mutation of Tlx-2

causes an early embryonic lethality, with the mutant embryos dispiaying defects in

primitive streak organization and mesoderm formation. Formation of the primitive streak

is initiated in the mutant ernbryo but is disorganized and does not extend (Chapter 2).

The prospective mesodenn cells derived fiom the deformed streak in mutant embryos are reduced and appear to remain at the posterior end. Therefore, the function of 77x2 is required for the organization of the primitive streak and the development of rnesoderm.

However, at this stage, the cellular and molecular defects that are caused by the TIx-7 mutation and are directly responsible for the phenotypes seen in the mutant embryos are not known. These questions set the direction for the next phase of research to understand the TIx-2 function in mouse mesoderm development.

5. 1. 2 The cellular basis of the mesoderm and streak phenotypes in the mutant embryos

Three possible mechanisms can be proposed to explain the cellular defect in the primitive streak of TLr-2 mutant embryos. As studies carried out in other labs have suggested that the proliferation of the epiblast cells is required for the formation of primitive streak and mesoderm (section 1. 1.2.; Mashina ey al., 1995), the TLr-2 mutation may downregulate ce11 proliferation in the primitive streak region. Consistent with this notion, 7b-2 is highly expressed in the primitive streak (Chapter 2), where the cells are

known to undergo active proliferation. At least two approaches are feasible to test this

idea One is to examine the expression of ce11 proliferation markers, e.g. PCNA

(proliferating ce11 nuclear antigen), at the primitive streak region of the mutant embryo by

immunocytochemistry. If nx-2 is required for cell proliferation, the expression of PCNA

is expected to be downregulated as compared with wild type embryos. Another approach

is to in vivo label the proliferating cells by BrdU and determine. by

immunocytochemistry, the percentage of BrdU positive cells at the primitive region of

the Tur-2 mutant embryos and their wild type litter mates. Fewer BrdU positive cells

should be seen in the mutants than in the wild type if Tlx-2 is required for cell

proliferation.

The second possibility is that the Tur-2 mutation results in apoptosis and thus

gastnilation is arrested. Consistent with this idea, the targeted mutation of 77x4. a mouse

counterpart of TLx-2, blocks the formation of spleen by causing apoptosis in spleen

precursor cells @eu et al., 1995). To test this idea, one approach is to perform a TUNEL

assay on the mutant embryonic section to label the apoptotic cells containing fragmented

DNA. If the TLr-2 mutation causes apoptosis, the mutant embryos are expected to have

higher proportion of positive cells labeled by TUNEL assay compared with that of wild

type embryos.

The third possibility is that the TZx-2 mutation causes defects in ce11 movement or differentiation in the streak, and thus the mutant embryos can not organize a functional primitive streak to produce mesodem cells (Chapter 1). A potential approach to address this possibility is to use Lac2 labeled TLx-2 homozygous ES cells to create chimenc embryos, and examine the behavior or distribution of the homozygous cells in the chimeric streak embryos and compare with that of the Lac2 labeled wild type ES cells.

As the TLX-2 transcription factor may control the expression of multiple genes that are directly involved in different aspects of streak and mesoderm formation, the above possibilities are not necessarily exclusive to each other.

5. 1. 3. The molecular basis for the mesoderm and streak phenotypes in mutant embryos

The specific molecular defect îhat directly Ieads to the phenotypes observed in the

TL*-2 mutant streak embryos is not known. MoIecdar insights could be obtained by identifjhg the downstream target genes of TLT-2 that are directly involved in mouse streak and mesoderm development. However, direct cloning of the downstream target genes of any mamrnalian homeodomain protein or transcription factor is still a challenging task, although techniques are being developed. Since more and more genes required for certain aspects of mouse gastnilation are being characterized (Chapter 1). an alternative strategy to identify the TLr-2 target genes is the "candidate gene" approach. assuming that the downstream targets should share sirnilarities in the expression pattern and the phenotypic effect of their mutation with that of TIx-2. So far, genes encoding ce11 adhesion molecules, signal molecules, transcription factors have been show to be required for mesoderm development (Chapter 1; Copp, 1995). Transfection assays can be performed to examine the response of the promoter of the candidate target gene to TLX-2 in cultured cells. Further confirmation of their status as the target genes of 7Zx-2, however, is required fiom in vivo experiments. For example, one could use transgenic approaches to test if the mis-expression of TLx-2 in the embryo cm cause ectopic activation or suppression of the expression of candidate target genes.

5.2. The fanetion of Tk-2 dunng mouse PNS development

5.2.1. The role of Th2 in neural crest and PNS development

Neural crest is the main source of PNS ontogenesis (Le Douarin. 1982).

According to the fate mapping studies carried out in arnphibian and chicken embryos, neural crest cells are denved fiom the junction between the prospective neural plate and epidermis. As development proceeds, these cells locate at and then migrate out fiom the dorsal part of the neural tube. Mer migration, neural crest cells can differentiate into many different cells types, including the sensory and autonomic components of PNS

(section 1. 1. 2.). Severai important issues regarding the developrnent of neural crest and

PNS remain to be addressed including the mechanisms that allow the prospective neural crest cells to segregate from the fates of neural ectoderm and epidermis, and that lead to the migration of neural crest cells to their fuial destinations and subsequent differentiation into peripherd neural cells.

An important function of Tlx-2 in neural crest and PNS development is indicated by its high and specific expression in developing PNS (Chapter 3). A role for 77x-2 in the early segregation of neural crest is suggested by its expression in the lateral part of the neurai ectoderm as well as in the neural fold. In the developing PNS, expression starts at the early phase of PNS ontogenesis, when the ganglia are condensing fiom the migrating neural crest cells. This expression suggests a role for Th-2 in PNS fate deterrnination and/or proliferation of the penpheral ganglion neural cells. As the 77x2 targeted mutation causes early embryonic lethaiity before PNS ontogenesis begins, the in vivo

function of TLx-2 in PNS development remains undefined. However, overexpression of

n*-2 suppresses the neurite outgrowth of PC 12 cells induced by NGF. This result

suggests that the expression of Tur-2 during PNS development may play a role in

maintainhg the proliferating state of the neural precunor cells, and thus preventing the

premature neuronal differentiation of neural precursor cells in ganglia This potential

function may be important during the early phase of PNS development. This study also

showed that TLX-2 is a transcription repressor, which suggests that nx-2 may suppress

the neuronal differentiation by repressing the expression of specific neuronal genes.

5.2.2. The possible role of Tb2in segregation of the prospective neural crest cells

The molecuiar basis for the initial segregation of neural crest in the ectoderm is

largely unknown (Chapter 1). The expression of Tlx-2 in the neural ectoderm of streak

embryos coincides with the region where the neurai crest segregates (Chapter 3). The

progressive restriction of the ï7x-2 expression dong the postenor-anterior ais of the junction between neurai plate and epidermis dso coincides with the postulated

progressive segregation of the neural crest. In addition. Tlx-2 expression fier E9.0 is

restricted to the developing PNS that is derived nom the neural crest. These observations suggest a potential role of TLr-2 in neurai crest segregation. An attractive approach to test the function of Tuc-2 in the segregation of the neural crest is to generate ectopic TIx-2 expression in the neural ectoderm in embryos at primitive streak stage and then examine the effect of this abnormal expression on the patteming of neural crest cells. For example, one can generate a transgenic mouse line in which the expression of Tlx-2 cDNA is driven by the Sa-l promoter that cm direct expression to the posterior neural

ectodem (Schubert et al., 1995). If TLr-2 plays a positive role in determining neural crest

fate, ectopic expression of TLr-2 rnay induce neural crest-like characteristics at the ectopic

region in the neural groove or neural tube as revealed by neural crest markea such as

Slug. On the other hand, as the ectopic 77.x-2 expression may force the neural plate to

adopt a neural crest fate and thus interfere with its intrinsic fate, one may expect defects

in the neural tube developing later.

5.2.3. TMfunction in PNS development: in vbo approaches

As the TLr-2 mutant embryos die before the development of the PNS, the in vivo

function of ïïx-2 during PNS ontogenesis has to be addressed through other approaches.

One important question to be addressed is if Tlx-2 is required for the fate determination of

PNS neural precursors. To address this question, one cm examine if TLr-2 homozygous

cells can contribute to the PNS ganglia in chimeric embryos. Briefly, one could first

create the TLr-2 homozygous cells from the heterozygous ce11 lines. using high G418 selection. The homozygous cells can then be aggregated with the morula-stage embryos of Rosa 26, that is labeled by the LacZ reporter gene. The aggregated embryos are then transferred into the foster mother to raise the chimeric embryos. Chimeric embryos after

E9.0 are collected for Lac2 staining to detemiine the contribution of the unstained TZx-2 homozygous cells to the PNS ganglia. As control, wild type ES cells are also used in parallel experirnents to generate the chimeric embryos. If 77x-2 is required for the neural crest cells to follow a PNS developmental fate, one would expect that the contribution of the hornozygous cells to the ganglia would be significantly reduced, compared with wild

type ES cells.

To circumvent the problem of early embryonic Iethality of the 77x-2 mutants, one

can create a conditional knock-out of TLr-2 in the developing PNS by using the CreLoxp system. Since the transgenic mouse line with Cre expression specific to the PNS has not been reported, one wouid first have to create such a mouse line. The expression pattern of

Tlx-2 in the developing PNS indicates that the TLr-2 promoter (and its PNS enhancers) should be useful for driving Cre expression in the developing PNS. A Th-2 transgenic line would be targeted so that the first exon or another part of the gene is flanked by the

Loxp motifs. The two transgenic mouse Iines are then crossed so that the region flanked by the Loxp motifs is deleted specifically in the PNS where Cre is expressed. The mice or embryos hornozygous for the targeted loci and carying the Cre transgene are analyzed for the resulting phenotypes in the PNS.

5. 2. 4. Th-2 is an ideal moleculsr marker for the study of PNS development: a

LacZ transgenic mouse

The expression of Tur-2 in the developing PNS is most remarkable in the sense that it specifically demarcates al1 PNS components derived fiom the neural crest. A long- term goal has been to generate a transgenic mouse line in which the developing PNS is labeled by LacZ reporter gene to facilitate the studies of PNS neural crest ce11 migration, fate detennination and neural differentiation. For this initiative, the Tlx-2 promoter would be ideal to drive the expression of the Lac2 transgene. Such a transgenic mouse line would be helpful for studying the function of genes required for PNS development, in addition to examining the embryonic and cellular aspects of PNS ontogenesis. For

instance, if a targeted mutation of a gene involved in PNS development is created. one

cm cross this knockout line with the Tix-2nacZ mouse and the mutant embryos at

different stages are collected for LacZ staining. This should greatly facilitate the analysis

of the phenotypic effects of this specific mutation on PNS developrnent.

5.2.5. The human homologue of Tliu-2: a potential disease gene?

An important finding of developmentai biology in the Iast decade is the conserved

function of homologous genes in different species. Given the fact that the mouse 77x2 is

expressed highly and specifically in the developing mouse PNS, one wodd wonder if its

human counterpart is not similarly expressed. Aithough the targeted mutation of 7l.r-2

causes early embryonic lethality, a partial loss-of-function mutation or deregulation of

TLx-2 expression in human may result in a genetic disorder. Since human HOXIl is a T ce11 leukemia oncogene, it should also be intriguing to see if Tlx-2 can act as an oncogene. To this end, one could first clone the human 77x-2 by using the mouse Th-as a probe. Once the gene is isolated, its Iocalization can be defined by conventional methods to see if it coincides with the locus of any disease genes. Then. one can decide if it is necessary to Merpursue the mutation screening.

5.3. Regulation of Tb2function by BMP signals

5.3.1. The BMP/Tix-2 pathway in mammaüan mesoderm development: implications

One of the exciting findings fiom this study is the BMP/Tlx-2 pathway implicated in mesoderm development (Chapter 2). This resuit has shed insights into the molecular mechanisms which determine how mesoderm inductive signais control mesoderrn

formation in mammalian embryos (Chapter 1; Chapter 2). The results obtained in this

study indicate that at Ieast one way in which mesoderm inductive signds direct

mammaiian mesoderm formation and patterning is to regulate the expression of

homeobox genes, a class of regdatory genes that are well known to play roles in

embryonic patterning and other aspects of development. Coincident with this suggestion, several Xenopur homeobox genes have recently been found to Function irnrnediately downstream in the mesoderm inductive signaling pathways (Chapter 2). A BMPlTlx-2 pathway may therefore represent a cornmon molecular mechanism of mesoderm developrnent in vertebrates.

Multiple mesoderm inductive signals are involved in vertebrate rnesoderm formation and patîeming (Chapten 1 & 2), and different inducing signals rnay play roles in distinct aspects of mesoderm development. Thus, a particular inductive signal possibly evoke unique signaling cascades that program specific aspects of mesoderm development. It would be intriguing to examine if different mesoderm inductive signals regulate the expression of specific transcription factors, or regulate the expression of the same gene in a distinct fashion. In this context, one can examine if the expression of TZx-

2 is also regulated by the other signals that are required for the mesoderm development such as Nodal. On the other hanci, one can also examine if known mesoderm inductive signds (e. g. BMP4, Activin) can regulate the expression of other transcription factors that are required for mouse mesoderm development (e. g. Brachywy). By carrying out such experirnents, one would eventually work out a complete picture of the different signalling pathways underlying mesoderm development. 5.3.2. A possible BMP/Th-2 pathway in PNS and neural crest development

Ln addition to mesoderm development, the BMP/Tix-2 pathway may also function

elsewhere during embryogenesis, given the fact tbat TLr-2 is expressed in several other

tissues where the BMP signals have been suggested to play roles in patternhg and/or fate

detennination, inciuding the lateral neural plate, neural folds. and neural crest cells

(Chapter 3). One of the most interesthg sites to be examined is the sympathetic ganglia.

2-2 is expressed in sympathetic ganglia, and BMF-2 is expressed in the dorsal aorta

adjacent to syrnpathetic ganglia Recent work has shown that BMP-2 can function as an

instructive signal for fate determination of syrnpathetic neural precursor cells (Shah et al..

1996). One hypothesis would be that Tuc-2 also plays a role in sympathetic neural differentiation by functioning downstream of BMP-2 signding. To test this idea one could fint examine the regulation of 7Zx-2 expression by BMP-2 in PC 12 cells. where

T[x-2 is expressed (Chapter 3). As PC 12 cells can be induced to differentiate into sympathetic-like neurons by BMP 24 signaling (Iwasaki et al., 1996). one could next interfere with Th-2 function by loss of function approaches such as antisense techniques and examine how this affects the neuronal differentiation induced by BMP-2. Similar experiments can also be done on neural crest stem cells.

Another developmental process that potentially requires a functionai BMPmx-2 pathway is the segregation of the prospective neural crest. BMP4 and BMP7 are expressrd in the ectodemal epidermis and cm induce neural crest differentiation of the explanted neural plate (Liem et al., 1995). Therefore, it has been suggested that a BMP- like signal is involved in the initiation of neural crest segregation during development.

As 7ïx-2 is expressed at the edge of the neural ectoderm and in the neural fold and is potentiaily invoived in the initial segregation of the neural crest (Chapter 3), the

BMPfllx-2 pathway may aiso hction during the segregation of the neural crest. To test this idea, one can first examine if BMP4BMP7 cm induce Th-2 expression in the explanted neural plate before the neural crest ceH is induced. As BMP2 induces 77x2 expression in the ectodem of E6.5 embryos (Chapter 21, it is likely that BMP4/BMP7 can dso induce Tlx-2 expression in the neural plate. One can then test if blocking the function of 1TZx-2 in the explanted neural plate (e.g. by antisense an approach) can suppress the induction of the neural crest cells by BMP4BMP7.

5. 3. 3. Identif~cationof the transcription factor mediating the Tk-2 response to

BMP signals

Little is known about how the BMP signals regulate the expression of other genes.

Until recently few genes, and their promoters, that function immediately downstream of the signaling pathways have been characterized. One recent advance in the BMP signaling field is the identification of transcription factors, including MAD in Drusuphila and MAD related proteins in mammals, that are directly controlled by BMP signaling through phosphorylation (Chapter 2). After being phosphorylated by the activated BMP receptors, these proteins are enriched in the nucleus and presumably affect the expression of the immediate downstrearn genes. At this point, it is not known whether the

MAD/MADR proteins cm function on their own since DNA binding activity has not been proven. A potential scheme proposed on the basis of recent work on Activin (a

BMP related molecule belonging to the TGF-P superfamily) signalling is that the function of MAD/MADR proteins on transcriptio~~regulation is mediated, through protein-protein interaction, by other DNA-binding hanscription factors, such as the winged-helix protein (Chen et al., 1996)- Therefore, the TLx-2 promoter wouid be helpful in defdg the mechanisms involved in BMP induced transcriptional regulation. One approach is to fkt identi@ the minimal element in the TLr-2 promoter that can respond to

BMP signals (see Chapter 2). This element can next be used for two kinds of experiments. The first is to examine if the MADR proteins can bind to this element directly, and if so, whether this DNA binding activity is required for transcription activation in transfection assays. In addition, this minimai element can be used for one- hybrid experiments to directly isolate the transcription factor responsible for BMP mediated transcription activation. The requirement of this factor for BMP signaling can be Mercobed in transfection assays.

5.4. Reguiation of the TLX-2 function by 14-3-3 proteins

5. 4. 1. Interaction between TLX-2 and 14-3-3 proteins: a new perspective for regulation of homeodomain proteins

The functions of homeodomain proteins are believed to be tightly controlled during development (Chapter 4). The underlying mechanisrns, however, are largely undefined. One possible rnechanism is protein-protein interaction. For example, the association between different homeodomain proteins has been shown to increase the affinity and specificity of their DNA binding (White, 1994). The results presented in

Chapter 4 revealed a novel perspective for the regulation of the function of homeodomain protein, by showing the interaction between the TLX-2 homeodomain and 14-34 ce11

signaling proteins, and demonstrates that the subcelluiar localization and the biotogical

fuoction in neuronal differentiation of TLX-2 are modulated by 14-3-3 q (Chapter 4).

However, it is not known how 14-3-3 q modulates the function of TLX-2 at the molecular level. The 14-3-3 proteinRaf4 may mediate an interaction between TLX- and a

ce11 signaling kinase such as (see below). 14-3-3 proteins have been recently

shown to associate with various signalhg kinases and the dimeric 14-3-3 can function as

a scafTold to mediate the interaction between difierent proteins (Chapter 4). Therefore.

the interaction of TLX-2 and 14-3-3 q implies that the function of the nX-2

homeodomah protein could be directly regulated by ce11 signaling that is crucial for

developmental processes.

5.4.2 Interaction between homeodomain and 14-33 proteins: a general theme?

As both TLX-2 and 14-3-3 ETA belong to the evolutionarily conserved protein

families (Chapter 4), the interaction between these two proteins may indicate a common

theme of interaction between members of these two protein families. To test this idea,

one could examine if TL,X-2 aiso interacts with other members of the 14-3-3 family, or

14-3-3 ETA also interacts with other homeodomain proteins. Considering that 14-3 -3 proteins cm form both homo- and heterodimer, the interaction between members of the homeodomain family and members of the 14-3-3 farnily may fom a regulatory network that functions in different aspects of development.

5.4.3. 1s TLX-2coupled to specific ce11 signaling pathways by 14-3-3 proteins? As 14-3-3 are proteins that bind to various cell signaling kinases and have been suggested to fhction as scafTolds that mediate the interactions between different proteins

(Chapter 4), the finding that TLX-2 is associated with 14-3-3 ETA irmnediately suggests a possibility that 14-3-3 ETA couples TLX-2 to certain ce11 signaling pathways by mediating an interaction between T'LX-2 and signaling kinases. This suggestion implies that the function of homeodomain proteins may be directly controlled by extracellular signals during development. To test this idea, one could first examine if mX-2. 14-3-3, and kinases such as Raf-1, which cm interact with 14-3-3 proteins and is a convergent kinase for several ce11 signaling pathways, cmfonn a complex in vitro and if they cmbe

CO-precipitated fkom cell lysates by CO-immunoprecipitation. If they are in the same complex, the issues to be examined are whether this kinase cm phosphorylate TLX-2 and how 14-3-3 ETA modulates this reaction. One can use NI vitro kinase assays to address these issues. The activated kinase (e-g. Raf-1) can be immuno-purified from appropriate cultured cells and used for a kinase assay on the TLX-2 substrate in the presence or absence of 14-3-3 ETA. To confimi this observation, CO-transfection followed by

Western analysis of TLX-2 can be used to examine how the presumed phosphorylated form of TLX-2 is affected by the Raf-l kinase. The functionai significance of the potential Raf- 1/14-3-3mX-2 interaction can be exarnined in the NGF signaling pathway in PC 12 cells, where al1 of these genes are known to be expressed (Chapter 3). by their effect on proliferation and differentiation. 5.5. References

Chen, X., Rubock, M. J. and Whitman, M. (1996). A transcriptional partner for MAD proteins in TGF-beta signalling. Nature 383,69 1-6.

Copp, A. J. (1995). Death before death: clues fkom gene knockouts and mutation. Trends Genet. 11,87-93.

Dear, T. N., Colledge, W. H., Carlton, M. B., Lavenir, L. Larson, T.. Smith. A. J., Warren, A. J., Evans, M. J., Sofroniew, M. V. and Rabbitts, T. H. (1995). The Hoxll gene is essentiai for ce11 suntival during spleen development. Development 122.2909- 15.

Hogan, B., Beddington, R., Costanthi, F. and Lacy, E. (1994). Manipulating the mouse embryo: a practical manual. 2nd edition. Cold Spring Harbor Laboratory Press.

Iwasaki, S., Hattori, A., Sato, M., Tsujimoto, M. and Kohno, M. (1996). Characterization of the bone morphogenetic protein-2 as a neurobophic factor. Induction of neuronal differentiation of PC12 cells in the absence of rnitogen-activated protein kinase activation. J. Biol. Chem. 271, 17360-5.

Le Douarin, N. M. (1 982). The Neural Crest. Cambridge Univ. Press, Cambridge.

Liem, K. F. Jr., Tremmi, G., Roelink, H. and Jessell, T. M. (1995). Donal differentiation of neural plate cells induced by BMP-rnediated signals fiom epidermal ectodenn. Ce11 82,969-79.

Mishina, Y., Suzuki, A., Ueno, N. and Behringer, R. R. (1995) Bmpr encodes a type 1 bone morphogenetic protein receptor that is essential for gastnilation during mouse embryogenesis. Genes Dev. 9,3027-37.

Schubert, F. R., Fainsod, A. Gruebaurn, Y. and Gniss, P. (1995) Expression of the novel murine homeobox gene Sm- l in the developing nervous system. Mech. Dev. 5 1.99- 1 14.

Shah, N. M., Groves, A. K. and Anderson, D. 1. (1996). Alternative neural crest ce11 fates are instructively promoted by TGFbeta superfamily members. Ce11 85,331-43.

Tarn, P. P. L. and Beddington, R. S. P. (1992). Establishment and organization of germ layers in the gastruiating mouse embryo. In: Postimplantation Development in the Mouse. Wiley, Chichester (Ciba Foundation Symposium 165), pp. 27-49.

Tarn, P. P., Williams, E. A. and Chan, W. Y. (1993) Gastrulation in the mouse embryo: ultrastructural and molecdar aspects of germ layer morphogenesis. Microscopy Research and Technique, 26,30 1-28. White, R. (1994). Homeodomain proteins: homeotic genes seek partnen. Cm. Biol. 4, 48-50. IMAGE EVALUATION TEST TARGET (QA-3)

APPLIED IMAGE. lnc =- 1653 East Main Street --.- - Rochester. NY 14609 USA -==-- Phone: 7161482-0300 ---- F% 7161208-5989