DOCSLIB.ORG

Differentiating Mesoderm and Muscle Cell Lineages During Drosophila Embryogenesis BRENDA LILLY, SAMUEL GALEWSKY, ANTHONY B

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Differentiating Mesoderm and Muscle Cell Lineages During Drosophila Embryogenesis BRENDA LILLY, SAMUEL GALEWSKY, ANTHONY B Proc. Nati. Acad. Sci. USA Vol. 91, pp. 5662-5666, June 1994 Developmental Biology D-MEF2: A MADS box transcription factor expressed in differentiating mesoderm and muscle cell lineages during Drosophila embryogenesis BRENDA LILLY, SAMUEL GALEWSKY, ANTHONY B. FIRULLI, ROBERT A. SCHULZ, AND ERIC N. OLSON* Department of Biochemistry and Molecular Biology, Box 117, The University of Texas M. D. Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, TX 77030 Communicated by Thomas P. Maniatis, January 21, 1994 ABSTRACT The myocyte enhancer factor (MEF) 2 family cle-specific genes (13). The recent cloning of MEF2 has oftranscription factors has been Implicated In the regultion of revealed that it belongs to the MADS (MCM1, Agamous, musle tansription in vertebrates. We have cloned a protein Deficiens, and serum-response factor) family oftranscription fromDrosophia, termed D-MEF2, that shares extensive amino factors. Four MEF2 genes, designated MEF2A, -B, -C, and acid homology with the MADS (MCM1, Agamous, Defdcens, -D, have been cloned from vertebrates (10, 14-19). The and serum-response factor) d of the vertebrate MEF2 proteins encoded by these genes are highly homologous proteins. D-mef2 gene expression Is first detected dring within the 55-amino-acid MADS domain at their amino Drosophila embryogenesis within mesodermal precursor cells termini and within an adjacent MEF2-specific region of 27 prior to spcation of the somatic and visceral muscle lin- residues, but they diverge outside of these regions. eages. Expression of D-mef2 Is dependent on the mesodermal We have cloned aDrosophila homologue ofMEF2, termed determinants twist and snail but independent ofthe homeobox- D-MEF2,t which, to our knowledge, is the first MADS containng gene dtnman, which is required for visceral muscle protein to be identified in Drosophila. During Drosophila and heart development. D-mef2 express precedes that ofthe embryogenesis, D-meJ2 is expressed first in the committed MyoD homoogue, nautilus, and, in contrast to nautilu, mesoderm and subsequently in the somatic and visceral D-wmeJ2 appears to be expressed ii all somatic and visceral muscle lineages. Its temporal and spatial patterns of expres- muscle ceil precursors. Its temporal and spatial expression sion suggest thatD-meJ2 functions at an early step in agenetic pattern suggest that D-meJ2 may play an important role in cascade leading to the specification of myogenic lineages in commitment of mesoderm to myogenic lineages. the Drosophila embryo. AND METHODS The formation of skeletal muscle during embryogenesis in- MATERIALS volves the commitment of mesodermal progenitors to the Drosophila Stocks. Stocks carrying the sna"'f"' and twi'> myogenic lineage followed by the expression of muscle mutant alleles were obtained from the Bloomington stock structural genes. The muscle-specific basic-helix-loop-helix center. The tinEc4O mutant allele was generously provided by proteins, MyoD, myogenin, myf5, and MRF4, have been R. Bodmer (University of Michigan) (5). The tinman strain shown to regulate muscle development (reviewed in ref. 1), contained a marked TM3 balancer chromosome (TM3-Pw+- but little is known of the mechanisms that control these lacZ), which permitted the identification of homozygous regulators during the earliest steps of myogenic lineage tinman mutant embryos by their lack of lacZ expression. specification. D-mef2 cDNA Isolation. A Drosophila 3- to 12-hr embry- In Drosophila, the mesoderm-specific regulatory genes onic cDNA library in AgtlO (kindly provided by Tom Korn- twist and snail are responsible for the formation ofmesoderm berg, University of California, San Francisco) was screened at the beginning ofgastrulation (reviewed in ref. 2). Later, the at low stringency (17) with a mouse MEF2A probe containing mesoderm separates into the somatic muscle lineage, which the MADS/MEF2 domain (J. Martin and E.N.O., unpub- gives rise to skeletal muscle, and the visceral muscle lineage, lished results). which gives rise to muscles ofthe gut and heart. Because the In Situ Hybridization to Whole-Mount Embryos. In situ separation of these two muscle lineages occurs after the hybridization of a digoxigenin-labeled D-mef2 DNA to wild- expression of twist and snail, but well before the expression type and mutant embryos was as described (20). of the MyoD homologue nautilus in somatic muscle cells (3, In Vitro Transcription and Translation and Gel Mobility 4), it is likely that one or more regulatory genes act in this Shift Assays. In vitro transcription and translation were intervening period to specify the somatic and visceral muscle carried out using the TNT rabbit reticulocyte lysate in vitro lineages. One such gene appears to be the homeobox- translation system (Promega) according to manufacturer's containing gene tinman, which is first expressed in the instructions. A D-mef2 cDNA, encompassing the complete uncommitted mesoderm and subsequently becomes re- open reading frame (nucleotides +535 to +2295), was cloned stricted to visceral mesoderm and heart (5, 6). into the P-CITE vector (Novagene). Gel mobility shift assays Members of the myocyte enhancer factor (MEF) 2 family were performed as described (17) using an oligonucleotide of regulatory factors have been implicated in the control of encompassing the muscle creatine kinase (MCK) MEF2 site myogenin and MyoD gene expression in vertebrates and are (13) as probe. Competitor oligonucleotides were added at therefore potential candidates for early regulators of the 100-fold molar excess to the labeled probe. Sequences of skeletal muscle lineage (7-12). MEF2 was originally defined as a muscle-specific DNA-binding activity that recognizes a Abbreviations: MEF, myocyte enhancer factor; MADS, MCM1, conserved A+T-rich element associated with numerous mus- Agamous, Deficiens, and serum-response factor; MCK, muscle crcsatine kinase; CAT, chloramphenicol acetyltransferase; tk, thy- midine kinase. The publication costs ofthis article were defrayed in part by page charge *To whom reprint requests should be addressed. payment. This article must therefore be hereby marked "advertisement" tThe D-meJ2 cDNA sequence reported in this paper has been in accordance with 18 U.S.C. §1734 solely to indicate this fact. deposited in the GenBank data base (accession no. U03292). 5662 Downloaded by guest on September 28, 2021 Developmental Biology: Lilly et al. Proc. Natl. Acad. Sci. USA 91 (1994) 5663 oligonucleotides were as follows: MCK MEF2, GATCGC- A TCTAAAAATAACCCTGTCG; mutant 6, GATCGC- .. ... TCTAAACATAACCCTGTCG. Transfections. Transient transfections of S2 cells were carried out using a calcium phosphate precipitation method. : Chloramphenicol acetyltransferase (CAT) activity was mea- tt + ' 7 sured as described (13). The constructs used were 4xMEF2- ,., tkCAT, which contains four copies of the MCK MEF2 site _ _ upstream of the kinase (tk) to \ ....... ..... thymidine promoter linked CAT, and the parental vector tkCAT, which lacks the MEF2 sites. The D-meJ2 expression vector contained nucleotides + 1 to + 1939 of the cDNA under control of the Moloney sarcoma virus (MSV) promoter in the vector EMSV. FIG. 2. D-MEF2 binds to and activates transcription RESULTS through the MEF2 site. (A) An Isolation of cDNA Clones Encoding D-MEF2. To search for oligonucleotide corresponding potential Drosophila MEF2 homologues, a Drosophila 3- to to the MEF2 site from the mouse 12-hr embryonic cDNA library was screened under conditions MCK enhancer was used as a of reduced stringency with a portion of a mouse MEF2A probe in a gel mobility shift as- cDNA encompassing the MADS box and MEF2 domain. The say with in vitro-translated longest positive clone was 1900 bp in length and encoded an D-MEF2. Unprogrammed lysate a was included in a parallel lane. A open reading frame that began with an ATG codon immedi- 100-fold excess of unlabeled ately preceding a region with striking homology to the MADS MEF2 or mutant MEF2 oligonu- and MEF2 domains of the mammalian MEF2 proteins. Thus, M.EF2 _ cleotide was used as competitor. we designated the protein encoded by this cDNA D-MEF2, for ;.->r.t'De (B) Schneider cells were tran- Drosophila myocyte-specific enhancer factor 2, and we des- siently transfected with 5 pg of ignated the gene encoding this protein D-mef2. The complete the 4xMEF2-tkCAT or tkCAT reporter genes and 5 or 10 ,g of open reading frame of D-MEF2, deduced from the composite 8- sequences of a c: 8 - the EMSV expression vector multiple overlapping cDNA clones, encodes with and without the D-mef2 515-amino-acid protein with a predicted Mr = 54,289 (pI = 8.2) > 6- cDNA insert. CAT activity was (Fig. 1A). The cDNA to a D-mef2 hybridizes single transcript 0 4- determined as described in the 5 of -3.5 kb in embryos and adults (data not shown). LL text. Values are expressed rela- Within the MADS domain, D-MEF2 differs from the four 2 - tive to the basal level of expres- mammalian MEF2 proteins at only 5-7 of 56 residues (Fig. O-1 sion of tkCAT, which was set at 1B). The MEF2 domain of D-MEF2 is also highly conserved 0 1. The results of duplicate trans- over the first 21 residues, but it diverges from the vertebrate D-MEF2, ug fections are shown. A ATCCCCCCCAAAAAAATTCAAATATCACCCATCACCCATCAACCCAATCCCCACCTCACCCTTCAACAACCGCAACTTCCCCCTGATCAACAACGCCTACCACCTCTCCCTCCTCTCCCAC M C R K K I Q I S R I T D R R N R Q V T F N K R K F C V X KK A Y Z L S V L C D 40 TGCCAr.ATCGCCCTr-ATCATCTTCTCGTCGMCAACAAGCTCTACCACTACGCCAGCACCr.ACATC"TCGCCTCCTGCTCAACTACACCGACTILCAACGMCCCCACGAGTCCCTCACC_ - --------_
Load more

Recommended publications
  • Functional Analysis of the Homeobox Gene Tur-2 During Mouse Embryogenesis
    Functional Analysis of The Homeobox Gene Tur-2 During Mouse Embryogenesis Shao Jun Tang A thesis submitted in conformity with the requirements for the Degree of Doctor of Philosophy Graduate Department of Molecular and Medical Genetics University of Toronto March, 1998 Copyright by Shao Jun Tang (1998) National Library Bibriothèque nationale du Canada Acquisitions and Acquisitions et Bibiiographic Services seMces bibliographiques 395 Wellington Street 395, rue Weifington OtbawaON K1AW OttawaON KYAON4 Canada Canada The author has granted a non- L'auteur a accordé une licence non exclusive licence alIowing the exclusive permettant à la National Library of Canada to Bibliothèque nationale du Canada de reproduce, loan, distri%uteor sell reproduire, prêter' distribuer ou copies of this thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la forme de microfiche/nlm, de reproduction sur papier ou sur format électronique. The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts fkom it Ni la thèse ni des extraits substantiels may be printed or otherwise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation. Functional Analysis of The Homeobox Gene TLr-2 During Mouse Embryogenesis Doctor of Philosophy (1998) Shao Jun Tang Graduate Department of Moiecular and Medicd Genetics University of Toronto Abstract This thesis describes the clonhg of the TLx-2 homeobox gene, the determination of its developmental expression, the characterization of its fiuiction in mouse mesodem and penpheral nervous system (PNS) developrnent, the regulation of nx-2 expression in the early mouse embryo by BMP signalling, and the modulation of the function of nX-2 protein by the 14-3-3 signalling protein during neural development.
    [Show full text]
  • The Mechanisms of Hedgehog Signal Transduction
    Markku Varjosalo The Mechanisms of Hedgehog Signal Transduction Publications of the National Public Health Institute A 12/2008 Department of Molecular Medicine National Public Health Institute and Institute of Biomedicine, University of Helsinki, Finland Helsinki, Finland 2008 Markku Varjosalo THE MECHANISMS OF HEDGEHOG SIGNAL TRANSDUCTION ACADEMIC DISSERTATION To be publicly discussed with the permission of the Faculty of Medicine, University of Helsinki, in Lecture Hall 2, Biomedicum Helsinki, on 2nd May 2008, at noon. National Public Health Institute, Helsinki, Finland and Institute of Biomedicine, University of Helsinki, Finland Helsinki 2008 Publications of the National Public Health Institute KTL A12 / 2008 Copyright National Public Health Institute Julkaisija-Utgivare-Publisher Kansanterveyslaitos (KTL) Mannerheimintie 166 00300 Helsinki Puh. vaihde (09) 474 41, telefax (09) 4744 8408 Folkhälsoinstitutet Mannerheimvägen 166 00300 Helsingfors Tel. växel (09) 474 41, telefax (09) 4744 8408 National Public Health Institute Mannerheimintie 166 FIN-00300 Helsinki, Finland Telephone +358 9 474 41, telefax +358 9 4744 8408 ISBN 978-951-740-805-9 ISSN 0359-3584 ISBN 978-951-740-806-6 (pdf) ISSN 1458-6290 (pdf) Kannen kuva - cover graphic: Yliopistopaino Helsinki 2008 Supervised by Academy Professor Jussi Taipale Genome-Scale Biology Program Institute of Biomedicine, University of Helsinki Department of Molecular Medicine National Public Health Institute (KTL) Helsinki, Finland Reviewed by Professor Tomi Mäkelä Genome-Scale Biology Program
    [Show full text]
  • Dynamics of Maternal Morphogen Gradients in Drosophila Stanislav Y Shvartsman1, Mathieu Coppey1 and Alexander M Berezhkovskii2
    COGEDE-512; NO OF PAGES 6 Available online at www.sciencedirect.com Dynamics of maternal morphogen gradients in Drosophila Stanislav Y Shvartsman1, Mathieu Coppey1 and Alexander M Berezhkovskii2 The first direct studies of morphogen gradients were done in ified genes [1]. Since most of these studies were done the end of 1980s, in the early Drosophila embryo, which is with fixed embryos, maternal gradients were viewed as patterned under the action of four maternally determined relatively static signals. Several recent studies report morphogens. Since the early studies of maternal morphogens quantitative measurements of the anterior, dorsoventral, were done with fixed embryos, they were viewed as relatively and terminal gradients and propose biophysical models static signals. Several recent studies analyze dynamics of the for their formation and interpretation. We review these anterior, dorsoventral, and terminal patterning signals. The studies and discuss how their conclusions affect our view results of these quantitative studies provide critical tests of of dynamics in one of the most extensively studied classical models and reveal new modes of morphogen patterning systems. regulation and readout in one of the most extensively studied patterning systems. Bicoid gradient: diffusion and reversible Addresses trapping of a stable protein? 1 Department of Chemical Engineering and Lewis-Sigler Institute for In the end of 1980s, studies of the distribution and Integrative Genomics, Princeton University, New Jersey, United States transcriptional effects of the Bicoid (Bcd) protein in 2 Mathematical and Statistical Computing Laboratory, Division of Computational Bioscience, Center for Information Technology, National the Drosophila embryo provided the first molecularly Institutes of Health, Bethesda, MD 20892, United States defined example of a morphogen gradient [2–4].
    [Show full text]
  • Dynamics of the Dorsal Morphogen Gradient
    Dynamics of the Dorsal morphogen gradient Jitendra S. Kanodiaa, Richa Rikhyb, Yoosik Kima, Viktor K. Lundc, Robert DeLottoc, Jennifer Lippincott-Schwartzb,1, and Stanislav Y. Shvartsmana,1 aDepartment of Chemical Engineering and Lewis-Sigler Institute for Integrative Genomics, Princeton University, Washington Road, Princeton, NJ 08544; bCell Biology and Metabolism Branch, NIH, Building 32, 18 Library Drive, Bethesda, MD 20892; and cDepartment of Molecular Biology, University of Copenhagen, Ole Maaløes Vej 5, DK-2200 Copenhagen, Denmark Contributed by Jennifer Lippincott-Schwartz, October 28, 2009 (sent for review September 6, 2009) The dorsoventral (DV) patterning of the Drosophila embryo depends several minutes (16). Nuclei change in volume and undergo five on the nuclear localization gradient of Dorsal (Dl), a protein related to synchronous divisions (15, 17). To explore how these processes the mammalian NF-␬B transcription factors. Current understanding of contribute to the formation of the Dl gradient, we formulated a how the Dl gradient works has been derived from studies of its mathematical model that accounts for the nuclear import and transcriptional interpretation, but the gradient itself has not been export of Dl, its interaction with Cact, and the dynamics of nuclear quantified. In particular, it is not known whether the Dl gradient is density and volumes in the syncytial blastoderm. Based on the stable or dynamic during the DV patterning of the embryo. To address computational analysis of this model and a number of our model- this question, we developed a mathematical model of the Dl gradient based experiments, we argue that the Dl gradient is dynamic and, and constrained its parameters by experimental data.
    [Show full text]
  • The Physical Mechanisms of Drosophila Gastrulation: Mesoderm and Endoderm Invagination
    | FLYBOOK DEVELOPMENT AND GROWTH The Physical Mechanisms of Drosophila Gastrulation: Mesoderm and Endoderm Invagination Adam C. Martin1 Department of Biology, Massachusetts Institute of Technology, Cambridge, Massachusetts 02142 ORCID ID: 0000-0001-8060-2607 (A.C.M.) ABSTRACT A critical juncture in early development is the partitioning of cells that will adopt different fates into three germ layers: the ectoderm, the mesoderm, and the endoderm. This step is achieved through the internalization of specified cells from the outermost surface layer, through a process called gastrulation. In Drosophila, gastrulation is achieved through cell shape changes (i.e., apical constriction) that change tissue curvature and lead to the folding of a surface epithelium. Folding of embryonic tissue results in mesoderm and endoderm invagination, not as individual cells, but as collective tissue units. The tractability of Drosophila as a model system is best exemplified by how much we know about Drosophila gastrulation, from the signals that pattern the embryo to the molecular components that generate force, and how these components are organized to promote cell and tissue shape changes. For mesoderm invagination, graded signaling by the morphogen, Spätzle, sets up a gradient in transcriptional activity that leads to the expression of a secreted ligand (Folded gastrulation) and a transmembrane protein (T48). Together with the GPCR Mist, which is expressed in the mesoderm, and the GPCR Smog, which is expressed uniformly, these signals activate heterotrimeric G-protein and small Rho-family G-protein signaling to promote apical contractility and changes in cell and tissue shape. A notable feature of this signaling pathway is its intricate organization in both space and time.
    [Show full text]
  • S41467-018-04754-Z.Pdf
    ARTICLE DOI: 10.1038/s41467-018-04754-z OPEN Guided morphogenesis through optogenetic activation of Rho signalling during early Drosophila embryogenesis Emiliano Izquierdo 1, Theresa Quinkler1 & Stefano De Renzis 1 During organismal development, cells undergo complex changes in shape whose causal relationship to individual morphogenetic processes remains unclear. The modular nature of 1234567890():,; such processes suggests that it should be possible to isolate individual modules, determine the minimum set of requirements sufficient to drive tissue remodeling, and re-construct morphogenesis. Here we use optogenetics to reconstitute epithelial folding in embryonic Drosophila tissues that otherwise would not undergo invagination. We show that precise spatial and temporal activation of Rho signaling is sufficient to trigger apical constriction and tissue folding. Induced furrows can occur at any position along the dorsal–ventral or anterior–posterior embryo axis in response to the spatial pattern and level of optogenetic activation. Thus, epithelial folding is a direct function of the spatio-temporal organization and strength of Rho signaling that on its own is sufficient to drive tissue internalization independently of any pre-determined condition or differentiation program associated with endogenous invagination processes. 1 EMBL Heidelberg, Meyerhofstrasse 1, 69117 Heidelberg, Germany. Correspondence and requests for materials should be addressed to S.D.R. (email: [email protected]) NATURE COMMUNICATIONS | (2018) 9:2366 | DOI: 10.1038/s41467-018-04754-z | www.nature.com/naturecommunications 1 ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/s41467-018-04754-z raditional genetic approaches have played a pivotal role in Results establishing the requirement of individual gene activities RhoGEF2 plasma membrane recruitment and tissue responses.
    [Show full text]
  • Conserved Signaling Mechanisms in Drosophila Heart Development
    DEVELOPMENTAL DYNAMICS 246:641–656, 2017 DOI: 10.1002/DVDY.24530 REVIEWS Conserved Signaling Mechanisms in Drosophila Heart Development a Shaad M. Ahmad 1,2* 1Department of Biology, Indiana State University, Terre Haute, Indiana 2The Center for Genomic Advocacy, Indiana State University, Terre Haute, Indiana Abstract: Signal transduction through multiple distinct pathways regulates and orchestrates the numerous biological pro- cesses comprising heart development. This review outlines the roles of the FGFR, EGFR, Wnt, BMP, Notch, Hedgehog, Slit/ Robo, and other signaling pathways during four sequential phases of Drosophila cardiogenesis—mesoderm migration, cardiac mesoderm establishment, differentiation of the cardiac mesoderm into distinct cardiac cell types, and morphogenesis of the heart and its lumen based on the proper positioning and cell shape changes of these differentiated cardiac cells—and illus- trates how these same cardiogenic roles are conserved in vertebrates. Mechanisms bringing about the regulation and combi- natorial integration of these diverse signaling pathways in Drosophila are also described. This synopsis of our present state of knowledge of conserved signaling pathways in Drosophila cardiogenesis and the means by which it was acquired should facili- tate our understanding of and investigations into related processes in vertebrates. Developmental Dynamics 246:641–656, 2017. VC 2017 Wiley Periodicals, Inc. Key words: heart development; Drosophila cardiogenesis; cardiac mesoderm specification; cardiac morphogenesis;
    [Show full text]
  • Embryonic Transcription and the Control of Developmental Pathways
    Copyright 0 1996 by the Genetics Society of America Embryonic Transcription and the Control of Developmental Pathways Eric Wieschaus Department of Molecular Biology, Princeton University, Princeton, New Jersey 08544 It appears that the initial steps up to the [sea urchin] selected to play unique, controlling roles in develop- blastula stage are independent of the quality of the nu- ment. In this admittedly extreme reformulation of BO- clear substance, even though it is essential that the nu- VERI’S observation, I will restrict consideration to those clear substance be of a kind capable of existing in the egg. The necessity for particular chromosomes becomes genes whose products must be supplied zygotically and apparent first with the formation of the primary mesen- to organisms that have minimized their transcriptional chyme and from then on shows up in all processes asfar requirements during embryogenesis. I will first present as development can be observed. With respect to reasons why such a division of labor makes teleological those characters in which we are able to recognize indi- sense and then examine the data from Drosophila to vidual variations, the nuclear substance and not the cyte plasmic cell substance imposes its specific character on determine the extent to which gene activityactually the developing trait. obeys these expectations. Then I will discuss the excep- . Earlier stages, for which according to our results, tions, i.e., certain wellcharacterized cases where partic- specific chromosomes are not necessary, demonstrate a ular Drosophila genes are supplied zygotically but do purely maternal character. I would like to ascribe to not seem to play controlling roles.
    [Show full text]
  • ERIC F. WIESCHAUS Investigator Howard Hughes Medical Institute
    ERIC F. WIESCHAUS Investigator Howard Hughes Medical Institute, Research Laboratories Professor, Department of Molecular Biology Princeton University, Princeton, NJ 08544 Telephone # (609) 258-5383 Fax # (609) 258-1547 [email protected] Date of Birth: June 8, 1947 EDUCATION University of Notre Dame, Indiana B.S. (Biology) 1969 Yale University Ph.D (Walter Gehring) 1974 University of Zurich, Switzerland Postdoctoral training (Rolf Nöthiger) 1975 ACADEMIC EMPLOYMENT 1975-1978 Postdoctoral Fellow, Zoologisches Institut der Universität Zurich, with Dr. Rolf Nöthiger. 1976 EMBO short-term fellowship to the laboratory of Mme. Gans, Laboratoire de Genetique Moleculaire, C.N.R.S., Gif-sur-Yvette, France. 1977 Visiting Researcher, laboratory of Peter Bryant, Center of Pathobiology, U. of CA, Irvine. 1978-1981 Group Leader, European Molecular Biology Laboratory, Heidelberg, West Germany. 1981-1983 Assistant Professor of Biology, Princeton University. 1983-1987 Associate Professor of Biology, Princeton University. 1987-Present Professor, Department of Molecular Biology, Princeton University. 1997-Present Investigator, Howard Hughes Medical Institute. 1997-Present Adjunct Professor of Biochemistry at the University of Medicine and Dentistry of New Jersey, Robert Wood Johnson Medical School. HONORS, AWARDS and PROFESSIONAL RECOGNITION 1969 Graduated Magna cum laude, University of Notre Dame, South Bend, Indiana 1974 John Spangler Niclaus Prize for the outstanding dissertation, Yale University 1989-1999 NIHHD Merit Award 1993 Appointed Squibb Professor
    [Show full text]
  • "Blastoderm Formation and Cellularisation in Drosophila
    Blastoderm Formation and Introductory article Cellularisation in Article Contents . Drosophila’s Unusual Syncytial Blastoderm Drosophila melanogaster . Fertilisation and Preblastoderm Cycles . Blastoderm Cycles Shaila Kotadia, University of California at Santa Cruz, Santa Cruz, California, USA Online posting date: 15th September 2010 Justin Crest, University of California at Santa Cruz, Santa Cruz, California, USA Uyen Tram, The Ohio State University, Columbus, Ohio, USA Blake Riggs, San Francisco State University, San Francisco, California, USA William Sullivan, University of California at Santa Cruz, Santa Cruz, California, USA Immediately following fertilisation in Drosophila and of some 6000 nuclei in a common cytoplasm (Foe and many other arthropods, the embryo undergoes a series of Alberts, 1983; Zalokar and Erk, 1976). At interphase of rapid syncytial nuclear divisions. These divisions are dri- nuclear cycle 14, these nuclei are packaged into individual ven by maternally supplied components and occur in the cells in a process known as cellularisation. This rapid devel- opment is achieved by several attributes of the early embryo. absence of zygotic transcription. Unlike typical cell div- First, the embryo is endowed with an abundance of mater- isions, these divisions alternate between S and M phases, nally supplied products, which allows it to bypass zygotic resulting in cell cycles that last only from 10 to 25 min. transcription during the first several divisions. Second, the After four rounds of division, the nuclei undergo axial nuclear division cycles alternate between M and S phases. expansion, a process that relies on microfilaments. Sub- Lastly, nuclear division is uncoupled from cytokinesis. Thus, sequently migration of the nuclei to the cortex relies on the initial division cycles proceed rapidly, ranging from 10 to microtubules.
    [Show full text]
  • Mechanics of Drosophila Embryogenesis and Heat-Shock-Induced Developmental Defects
    Mechanics of Drosophila embryogenesis and heat-shock-induced developmental defects By Sarah Michelle Crews Dissertation Submitted to the Faculty of the Graduate School of Vanderbilt University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY in Physics August, 2015 Nashville, Tennessee Approved: M. Shane Hutson, Ph.D. Kirill I. Bolotin, Ph.D. Jeffery M. Davidson, Ph.D. Richard F. Haglund, Ph.D. John P. Wikswo, Ph.D. To my family, your support made this possible. ii ACKNOWLEDGEMENTS There are so many people to acknowledge for helping me complete this dissertation. First, I would like to thank my family and friends who have supported me every step of the way. I could not have accomplished this without my husband Joe, who supported me through the long hours and late nights in the lab. Thank you to my parents, who have worked overtime as grandparents helping to watch my daughter Allison so I could concentrate on my work. I do not think I would be here if it had not been for the encouragement and support from my grandparents for my education. I would also like to thank my brothers, Andrew and Darren, for our continued sibling rivalry. Our competition helps drive me to be the best I can be. Thank you to my friend and sister-in-law, Susanne, for always being just a phone call away. I would also like to thank my office mate, Susan Kost, for letting me use her as a sounding board when I was stuck on a problem and for her encouragement and support.
    [Show full text]
  • Farrell Ofarrell Manuscript Preprint
    1 / 29 From egg to gastrula: How the Table of Contents 1. Introduction cell cycle is remodeled during 2. Early development in Drosophila the Drosophila mid-blastula 3. Transitions in embryonic regulation transition. 4. Why have a specialized, exceptionally rapid early cell cycle program? Jeffrey A. Farrell (1) and Patrick H. O’Farrell (2) 5. Achieving speed 5.1. Dependence only on maternal (1) Department of Molecular and Cellular contributions Biology Harvard University, Cambridge, MA 5.2. Lack of gap phases 02138 [email protected] 5.3. Rapid S phase (2) Department of Biophysics and 6. The consequences of speed Biochemistry, University of California, San 7. A mechanistic view of pre-MBT cell cycle Francisco 94158, [email protected] slowing Corresponding author: Patrick H. O’Farrell 7.1. DNA replication and the replication checkpoint time the pre-MBT cycles Running title: Slowing the cell cycle at the 7.2. Why does DNA replication slow MBT during the early cycles? 8. The dramatic lengthening of the cell Keywords: Drosophila, MBT, maternal zygotic cycle at the MBT transition, replication, G2, cell cycle 8.1. Cdc25 phosphatase activity determines the length of interphase 14 Abstract 8.2. Maternal Cdc25 is depleted via Many, if not most, embryos begin destruction of Cdc25/Twine protein development with extremely short cell 8.3. Inhibitory phosphorylation cycles that exhibit unusually rapid DNA collaborates with an inhibitor of Cdk1 replication and no gap phases. The 9. The transition is active and dependent commitment to the cell cycle in the early on transcription embryo appears to preclude many other 10.
    [Show full text]