Proc. Nati. Acad. Sci. USA Vol. 91, pp. 5662-5666, June 1994 Developmental Biology D-MEF2: A MADS box transcription factor expressed in differentiating mesoderm and muscle cell lineages during Drosophila embryogenesis BRENDA LILLY, SAMUEL GALEWSKY, ANTHONY B. FIRULLI, ROBERT A. SCHULZ, AND ERIC N. OLSON* Department of Biochemistry and Molecular Biology, Box 117, The University of Texas M. D. Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, TX 77030 Communicated by Thomas P. Maniatis, January 21, 1994 ABSTRACT The myocyte enhancer factor (MEF) 2 family cle-specific genes (13). The recent cloning of MEF2 has oftranscription factors has been Implicated In the regultion of revealed that it belongs to the MADS (MCM1, Agamous, musle tansription in vertebrates. We have cloned a protein Deficiens, and serum-response factor) family oftranscription fromDrosophia, termed D-MEF2, that shares extensive amino factors. Four MEF2 genes, designated MEF2A, -B, -C, and acid homology with the MADS (MCM1, Agamous, Defdcens, -D, have been cloned from vertebrates (10, 14-19). The and serum-response factor) d of the vertebrate MEF2 proteins encoded by these genes are highly homologous proteins. D-mef2 gene expression Is first detected dring within the 55-amino-acid MADS domain at their amino Drosophila embryogenesis within mesodermal precursor cells termini and within an adjacent MEF2-specific region of 27 prior to spcation of the somatic and visceral muscle lin- residues, but they diverge outside of these regions. eages. Expression of D-mef2 Is dependent on the mesodermal We have cloned aDrosophila homologue ofMEF2, termed determinants twist and snail but independent ofthe homeobox- D-MEF2,t which, to our knowledge, is the first MADS containng gene dtnman, which is required for visceral muscle protein to be identified in Drosophila. During Drosophila and heart development. D-mef2 express precedes that ofthe embryogenesis, D-meJ2 is expressed first in the committed MyoD homoogue, nautilus, and, in contrast to nautilu, mesoderm and subsequently in the somatic and visceral D-wmeJ2 appears to be expressed ii all somatic and visceral muscle lineages. Its temporal and spatial patterns of expres- muscle ceil precursors. Its temporal and spatial expression sion suggest thatD-meJ2 functions at an early step in agenetic pattern suggest that D-meJ2 may play an important role in cascade leading to the specification of myogenic lineages in commitment of mesoderm to myogenic lineages. the Drosophila embryo. AND METHODS The formation of skeletal muscle during embryogenesis in- MATERIALS volves the commitment of mesodermal progenitors to the Drosophila Stocks. Stocks carrying the sna"'f"' and twi'> myogenic lineage followed by the expression of muscle mutant alleles were obtained from the Bloomington stock structural genes. The muscle-specific basic-helix-loop-helix center. The tinEc4O mutant allele was generously provided by proteins, MyoD, myogenin, myf5, and MRF4, have been R. Bodmer (University of Michigan) (5). The tinman strain shown to regulate muscle development (reviewed in ref. 1), contained a marked TM3 balancer chromosome (TM3-Pw+- but little is known of the mechanisms that control these lacZ), which permitted the identification of homozygous regulators during the earliest steps of myogenic lineage tinman mutant embryos by their lack of lacZ expression. specification. D-mef2 cDNA Isolation. A Drosophila 3- to 12-hr embry- In Drosophila, the mesoderm-specific regulatory genes onic cDNA library in AgtlO (kindly provided by Tom Korn- twist and snail are responsible for the formation ofmesoderm berg, University of California, San Francisco) was screened at the beginning ofgastrulation (reviewed in ref. 2). Later, the at low stringency (17) with a mouse MEF2A probe containing mesoderm separates into the somatic muscle lineage, which the MADS/MEF2 domain (J. Martin and E.N.O., unpub- gives rise to skeletal muscle, and the visceral muscle lineage, lished results). which gives rise to muscles ofthe gut and heart. Because the In Situ Hybridization to Whole-Mount Embryos. In situ separation of these two muscle lineages occurs after the hybridization of a digoxigenin-labeled D-mef2 DNA to wild- expression of twist and snail, but well before the expression type and mutant embryos was as described (20). of the MyoD homologue nautilus in somatic muscle cells (3, In Vitro Transcription and Translation and Gel Mobility 4), it is likely that one or more regulatory genes act in this Shift Assays. In vitro transcription and translation were intervening period to specify the somatic and visceral muscle carried out using the TNT rabbit reticulocyte lysate in vitro lineages. One such gene appears to be the homeobox- translation system (Promega) according to manufacturer's containing gene tinman, which is first expressed in the instructions. A D-mef2 cDNA, encompassing the complete uncommitted mesoderm and subsequently becomes re- open reading frame (nucleotides +535 to +2295), was cloned stricted to visceral mesoderm and heart (5, 6). into the P-CITE vector (Novagene). Gel mobility shift assays Members of the myocyte enhancer factor (MEF) 2 family were performed as described (17) using an oligonucleotide of regulatory factors have been implicated in the control of encompassing the muscle creatine kinase (MCK) MEF2 site myogenin and MyoD gene expression in vertebrates and are (13) as probe. Competitor oligonucleotides were added at therefore potential candidates for early regulators of the 100-fold molar excess to the labeled probe. Sequences of skeletal muscle lineage (7-12). MEF2 was originally defined as a muscle-specific DNA-binding activity that recognizes a Abbreviations: MEF, myocyte enhancer factor; MADS, MCM1, conserved A+T-rich element associated with numerous mus- Agamous, Deficiens, and serum-response factor; MCK, muscle crcsatine kinase; CAT, chloramphenicol acetyltransferase; tk, thy- midine kinase. The publication costs ofthis article were defrayed in part by page charge *To whom reprint requests should be addressed. payment. This article must therefore be hereby marked "advertisement" tThe D-meJ2 cDNA sequence reported in this paper has been in accordance with 18 U.S.C. §1734 solely to indicate this fact. deposited in the GenBank data base (accession no. U03292). 5662 Downloaded by guest on September 28, 2021 Developmental Biology: Lilly et al. Proc. Natl. Acad. Sci. USA 91 (1994) 5663 oligonucleotides were as follows: MCK MEF2, GATCGC- A TCTAAAAATAACCCTGTCG; mutant 6, GATCGC- .. ... TCTAAACATAACCCTGTCG. Transfections. Transient transfections of S2 cells were carried out using a calcium phosphate precipitation method. : Chloramphenicol acetyltransferase (CAT) activity was mea- tt + ' 7 sured as described (13). The constructs used were 4xMEF2- ,., tkCAT, which contains four copies of the MCK MEF2 site _ _ upstream of the kinase (tk) to \ ....... ..... thymidine promoter linked CAT, and the parental vector tkCAT, which lacks the MEF2 sites. The D-meJ2 expression vector contained nucleotides + 1 to + 1939 of the cDNA under control of the Moloney sarcoma virus (MSV) promoter in the vector EMSV. FIG. 2. D-MEF2 binds to and activates transcription RESULTS through the MEF2 site. (A) An Isolation of cDNA Clones Encoding D-MEF2. To search for oligonucleotide corresponding potential Drosophila MEF2 homologues, a Drosophila 3- to to the MEF2 site from the mouse 12-hr embryonic cDNA library was screened under conditions MCK enhancer was used as a of reduced stringency with a portion of a mouse MEF2A probe in a gel mobility shift as- cDNA encompassing the MADS box and MEF2 domain. The say with in vitro-translated longest positive clone was 1900 bp in length and encoded an D-MEF2. Unprogrammed lysate a was included in a parallel lane. A open reading frame that began with an ATG codon immedi- 100-fold excess of unlabeled ately preceding a region with striking homology to the MADS MEF2 or mutant MEF2 oligonu- and MEF2 domains of the mammalian MEF2 proteins. Thus, M.EF2 _ cleotide was used as competitor. we designated the protein encoded by this cDNA D-MEF2, for ;.->r.t'De (B) Schneider cells were tran- Drosophila myocyte-specific enhancer factor 2, and we des- siently transfected with 5 pg of ignated the gene encoding this protein D-mef2. The complete the 4xMEF2-tkCAT or tkCAT reporter genes and 5 or 10 ,g of open reading frame of D-MEF2, deduced from the composite 8- sequences of a c: 8 - the EMSV expression vector multiple overlapping cDNA clones, encodes with and without the D-mef2 515-amino-acid protein with a predicted Mr = 54,289 (pI = 8.2) > 6- cDNA insert. CAT activity was (Fig. 1A). The cDNA to a D-mef2 hybridizes single transcript 0 4- determined as described in the 5 of -3.5 kb in embryos and adults (data not shown). LL text. Values are expressed rela- Within the MADS domain, D-MEF2 differs from the four 2 - tive to the basal level of expres- mammalian MEF2 proteins at only 5-7 of 56 residues (Fig. O-1 sion of tkCAT, which was set at 1B). The MEF2 domain of D-MEF2 is also highly conserved 0 1. The results of duplicate trans- over the first 21 residues, but it diverges from the vertebrate D-MEF2, ug fections are shown. A ATCCCCCCCAAAAAAATTCAAATATCACCCATCACCCATCAACCCAATCCCCACCTCACCCTTCAACAACCGCAACTTCCCCCTGATCAACAACGCCTACCACCTCTCCCTCCTCTCCCAC M C R K K I Q I S R I T D R R N R Q V T F N K R K F C V X KK A Y Z L S V L C D 40 TGCCAr.ATCGCCCTr-ATCATCTTCTCGTCGMCAACAAGCTCTACCACTACGCCAGCACCr.ACATC"TCGCCTCCTGCTCAACTACACCGACTILCAACGMCCCCACGAGTCCCTCACC_ - --------_