DOCSLIB.ORG

Mutation Plt and EBI-1 Ligand Chemokine Genes in the Of

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mutation Plt and EBI-1 Ligand Chemokine Genes in the Of Gene Duplications at the Chemokine Locus on Mouse Chromosome 4: Multiple Strain-Specific Haplotypes and the Deletion of Secondary Lymphoid-Organ Chemokine and EBI-1 Ligand Chemokine Genes in the plt Mutation1 Hideki Nakano and Michael D. Gunn2 The murine paucity of lymph node T cell (plt) mutation leads to abnormalities in leukocyte migration and immune response. The causative defect is thought to be a loss of secondary lymphoid-organ chemokine (SLC) expression in lymphoid tissues. We now find that the plt defect is due to the loss of both SLC and EBI-1 ligand chemokine (ELC) expression in secondary lymphoid organs. In an examination of the plt locus, we find that commonly used inbred mouse strains demonstrate at least three different haplo- types. Polymorphism at this locus is due to duplications of at least four genes, three of them encoding chemokines. At least two cutaneous T cell-attracting chemokine (CTACK), three SLC, and four ELC genes or pseudogenes are present in some haplotypes. All haplotypes share a duplication that includes two SLC genes, which demonstrate different expression patterns, a single func- tional ELC gene, and an ELC pseudogene. The plt mutation represents a deletion that includes the SLC gene expressed in secondary lymphoid organs and the single functional ELC gene, leaving only an SLC gene that is expressed in lymphatic endo- thelium and an ELC pseudogene. This lack of CCR7 ligands in the secondary lymphoid organs of plt mice provides a basis for their severe abnormalities in leukocyte migration and immune response. The Journal of Immunology, 2001, 166: 361–369. t is now recognized that chemokines mediate the trafficking The plt mutation arose spontaneously in a colony of DDD/1 of leukocytes to and within lymphoid organs and thereby mice at the University of Tokyo (11). Because this mutation was I participate in the development of an immune response (1–3). not initially recognized, the true parental line was lost, but a con- Several chemokines are constitutively expressed in lymphoid or- genic strain, DDD/1-Mtv2, still exists (12). In a comparison of gans, and predictions have been made concerning their function DDD/1 and DDD/1-Mtv2 mice, it was found that DDD/1 mice based on their expression patterns and in vitro activities (4, 5). In display a marked paucity of T cells in peripheral LNs (13). Further a few cases these predictions have been confirmed through the use analysis revealed that this abnormality was due to the development of in vivo models (6–8). A prominent member of the constitutive of a recessive mutation (now designated plt) in the DDD/1 inbred chemokine family is secondary lymphoid-tissue chemokine line. DDD/1-plt mice demonstrate a 5- to 10-fold decrease in the (SLC),3 which is believed to mediate the migration of T cell and number of naive T cells present in peripheral LNs and a defect in dendritic cell (DC) subsets into lymphoid organs. Much of our naive T cell homing to secondary lymphoid organs (14, 15). The current understanding of SLC function originated from studies of plt locus was mapped to mouse chromosome 4 in a region of mice homozygous for the paucity of lymph node (LN) T cell ( plt) conserved synteny to human chromosome 9p13. Three human che- mutation (8–10). plt mice do not express SLC in secondary lym- mokine genes map to 9p13: SLC (CCL21), EBI-1 ligand chemo- phoid organs and demonstrate severe abnormalities in leukocyte kine (ELC; CCL19), and cutaneous T cell-attracting chemokine migration and immune response (8). However, significant ques- (CTACK; CCL27), although this was not known at the time plt tions remain concerning the validity of plt mice as a model of SLC mice were identified (16–18). dysfunction, because the molecular basis of the plt mutation has SLC was identified by several groups as a novel chemokine not been determined. present in the National Center for Biologic Information expressed sequence tag (EST) database (17, 19–21). Three characteristics of SLC suggested that it may be the chemokine responsible for me- Division of Cardiology, Department of Medicine, Duke University Medical Center, diating the entry of T cells into secondary lymphoid organs. First, Durham, NC 27710 it is expressed in the high endothelial venules (HEV) of LNs and Received for publication July 11, 2000. Accepted for publication October 6, 2000. Peyer’s patches and within T cell zones of LNs, spleen, and Pey- The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance er’s patches (22). SLC is also expressed in thymic medulla and in with 18 U.S.C. Section 1734 solely to indicate this fact. the lymphatic endothelium of multiple tissues (9, 19, 22). Second, 1 This work was supported by an Established Investigator Award (0040030N) from SLC is a highly efficacious chemoattractant for naive T cells (22, the American Heart Association and a training grant from the Cancer Research In- 23). Third, SLC stimulates the integrin-mediated adhesion of naive stitute (to H.N.). T cells to ICAM-1 and MadCAM-1 (24–26). The chemokine most 2 Address correspondence and reprint requests to Dr. Michael D. Gunn, Box 3547, Duke University Medical Center, Durham, NC 27710. E-mail address: michael. similar to SLC is ELC (16). SLC and ELC share the same receptor, [email protected] CCR7, and their genes are separated by Ͻ100 kb in humans (16, 3 Abbreviations used in this paper: SLC, secondary lymphoid-tissue chemokine; DC, 27, 28). ELC is expressed by DC and stromal cells within LNs and dendritic cell; BAC, bacterial artificial chromosome; CTACK, cutaneous T cell-at- spleen (29). Based on its expression pattern and activities, ELC is tracting chemokine; ELC, EBI-1 ligand chemokine; HEV, high endothelial venules; LN, lymph node; RFLP, restriction fragment length polymorphism; EST, expressed believed to act within lymphoid organs to mediate naive T cell-DC sequence tag; Cklc4, chemokine locus chromosome 4. interactions (1). The most recently identified chemokine on human Copyright © 2001 by The American Association of Immunologists 0022-1767/01/$02.00 362 VARIATIONS IN CHEMOKINE GENE NUMBER ON MOUSE CHROMOSOME 4 chromosome 9 is CTACK, which is expressed predominately in Southern blot analyses ϩ skin and is chemotactic for CLA memory T cells (30). DNA was prepared from murine tissue by standard procedures or was Once the probable function of SLC was recognized, its potential obtained from The Jackson Laboratory. For Southern blot analysis, 10 ␮g contribution to the plt mutation was examined. It was found that of genomic DNA or a normalized amount of P1 or BAC plasmid was the plt phenotype and the SLC gene map to the same genetic locus digested with restriction enzymes according to manufacturer’s instructions (Roche, Indianapolis, IN), separated on 1% agarose gels at 1 V/cm for on mouse chromosome 4. SLC mRNA is not expressed in the ϩ 10–18 h, and transferred to nylon membranes (Hybond-N , Amersham, secondary lymphoid organs of plt mice despite the fact that an Arlington Heights, IL) by alkaline blotting (33). Blots were hybridized intact SLC gene is present in plt DNA (8). The expression of ELC with 32P-labeled probe random primed from a BglII-NsiI fragment of mRNA is reduced in plt mice, but is clearly present. Subsequent Scya21a (probe A), a PvuII-XbaI fragment of Scya19 (probe B), a CTACK studies have demonstrated that rolling naive T cells do not attach EST, or an IL-11R␣ EST in dextran sulfate hybridization mixture over- night at 68°C. Blots were washed in 0.1ϫ SSC/0.1% SDS at 68°C before to HEV in the LNs or Peyer’s patches of plt mice (9, 10). In LN autoradiography. this defect can be partially reversed by the s.c. injection of SLC (9). plt mice also demonstrate abnormalities in DC localization and SLC expression studies migration (8). The number of DCs in the LN and splenic white For in situ hybridizations, paraffin sections (5 ␮m) from BALB/c and pulp of plt mice is markedly reduced, as is the number of DCs that BALB/c-plt mice were deparaffinized, fixed in 4% paraformaldehyde, and migrate to these areas after inflammatory stimuli. Similar defects treated with proteinase K. After washing in 0.5ϫ SSC, the sections were in DC migration are seen in mice after treatment with anti-SLC covered with hybridization solution, prehybridized for 1–3 h at 55°C, and 35 Abs (31). These studies strongly suggest that SLC is required for hybridized overnight with sense or antisense S-labeled riboprobe tran- scribed from the mouse SLC cDNA. After hybridization, sections were the migration of naive T cells and activated DC into the thymus- washed at high stringency, dehydrated, dipped in photographic emulsion dependent areas of secondary lymphoid organs. Support for this NTB2 (Eastman Kodak, Rochester, NY), stored at 4°C for 4 wk, developed, view has come from studies of CCR7-deficient mice, which dis- and counterstained with hematoxylin and eosin. For RT-PCR-restriction play a constellation of leukocyte trafficking abnormalities that are fragment length polymorphism (RFLP) analysis, total RNA was prepared similar, but not identical, to those seen in plt mice (7). from mouse LN and spleen using TRIzol reagent (Life Technologies, Gaithersburg, MD), reverse transcribed using a First Strand Synthesis kit To determine the basis of the plt phenotype, we initiated studies (Roche), and amplified with ELC-specific primers (AGGAGGACATCT to examine the DNA abnormality in plt mice. These studies were GAGCGATTCC and TGGTGAACACAACAGCAGGCAC). A portion of complicated by the finding that marked genetic heterogeneity ex- the RT-PCR product was digested with NcoI, and digested and undigested ists at this locus in wild-type mice.
Load more

Recommended publications
  • Functional Analysis of the Homeobox Gene Tur-2 During Mouse Embryogenesis
    Functional Analysis of The Homeobox Gene Tur-2 During Mouse Embryogenesis Shao Jun Tang A thesis submitted in conformity with the requirements for the Degree of Doctor of Philosophy Graduate Department of Molecular and Medical Genetics University of Toronto March, 1998 Copyright by Shao Jun Tang (1998) National Library Bibriothèque nationale du Canada Acquisitions and Acquisitions et Bibiiographic Services seMces bibliographiques 395 Wellington Street 395, rue Weifington OtbawaON K1AW OttawaON KYAON4 Canada Canada The author has granted a non- L'auteur a accordé une licence non exclusive licence alIowing the exclusive permettant à la National Library of Canada to Bibliothèque nationale du Canada de reproduce, loan, distri%uteor sell reproduire, prêter' distribuer ou copies of this thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la forme de microfiche/nlm, de reproduction sur papier ou sur format électronique. The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts fkom it Ni la thèse ni des extraits substantiels may be printed or otherwise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation. Functional Analysis of The Homeobox Gene TLr-2 During Mouse Embryogenesis Doctor of Philosophy (1998) Shao Jun Tang Graduate Department of Moiecular and Medicd Genetics University of Toronto Abstract This thesis describes the clonhg of the TLx-2 homeobox gene, the determination of its developmental expression, the characterization of its fiuiction in mouse mesodem and penpheral nervous system (PNS) developrnent, the regulation of nx-2 expression in the early mouse embryo by BMP signalling, and the modulation of the function of nX-2 protein by the 14-3-3 signalling protein during neural development.
    [Show full text]
  • The Transcriptional Activator PAX3–FKHR
    Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press The transcriptional activator PAX3–FKHR rescues the defects of Pax3 mutant mice but induces a myogenic gain-of-function phenotype with ligand-independent activation of Met signaling in vivo Frédéric Relaix,1 Mariarosa Polimeni,2 Didier Rocancourt,1 Carola Ponzetto,3 Beat W. Schäfer,4 and Margaret Buckingham1,5 1CNRS URA 2375, Department of Developmental Biology, Pasteur Institute, 75724 Paris Cedex 15, France; 2Department of Experimental Medicine, Section of Anatomy, University of Pavia, 27100 Pavia, Italy; 3Department of Anatomy, Pharmacology and Forensic Medicine, University of Turin, 10126 Turin, Italy; 4Division of Clinical Chemistry and Biochemistry, Department of Pediatrics, University of Zurich, CH-8032 Zurich, Switzerland Pax3 is a key transcription factor implicated in development and human disease. To dissect the role of Pax3 in myogenesis and establish whether it is a repressor or activator, we generated loss- and gain-of-function alleles by targeting an nLacZ reporter and a sequence encoding the oncogenic fusion protein PAX3–FKHR into the Pax3 locus. Rescue of the Pax3 mutant phenotypes by PAX3–FKHR suggests that Pax3 acts as a transcriptional activator during embryogenesis. This is confirmed by a Pax reporter mouse. However, mice expressing PAX3–FKHR display developmental defects, including ectopic delamination and inappropriate migration of muscle precursor cells. These events result from overexpression of c-met, leading to constitutive activation of Met signaling, despite the absence of the ligand SF/HGF. Haploinsufficiency of c-met rescues this phenotype, confirming the direct genetic link with Pax3. The gain-of-function phenotype is also characterized by overactivation of MyoD.
    [Show full text]
  • Genomic Targeting of Epigenetic Probes Using a Chemically Tailored Cas9 System
    Genomic targeting of epigenetic probes using a chemically tailored Cas9 system Glen P. Liszczaka, Zachary Z. Browna, Samuel H. Kima, Rob C. Oslunda, Yael Davida, and Tom W. Muira,1 aDepartment of Chemistry, Princeton University, Princeton, NJ 08544 Edited by James A. Wells, University of California, San Francisco, CA, and approved December 13, 2016 (received for review September 20, 2016) Recent advances in the field of programmable DNA-binding proteins Here, we report a method that combines the versatility of have led to the development of facile methods for genomic pharmacologic manipulation with the specificity of a genetically localization of genetically encodable entities. Despite the extensive programmable DNA-binding protein. Our strategy uses a utility of these tools, locus-specific delivery of synthetic molecules chemically tailored dCas9 to display a pharmacologic agent at a remains limited by a lack of adequate technologies. Here we combine genetic locus of interest in live mammalian cells (Fig. 1). This is trans the flexibility of chemical synthesis with the specificity of a pro- accomplished using split intein-mediated protein -splicing grammable DNA-binding protein by using protein trans-splicing to (PTS) to site-specifically link a recombinant dCas9:guide RNA ligate synthetic elements to a nuclease-deficient Cas9 (dCas9) (gRNA) complex to the synthetic cargo of choice (22). Indeed, in vitro and subsequently deliver the dCas9 cargo to live cells. we show that the remarkable specificity, efficiency, and speed of PTS allow the direct generation of desired dCas9 conjugates The versatility of this technology is demonstrated by delivering within the cell culture media, thereby facilitating a streamlined dCas9 fusions that include either the small-molecule bromodomain “one-pot” approach for genomic targeting of the reaction product.
    [Show full text]
  • Geometry, Epistasis, and Developmental Patterning
    Geometry, epistasis, and developmental patterning Francis Corson and Eric Dean Siggia1 Center for Studies in Physics and Biology, The Rockefeller University, New York, NY 10021 This contribution is part of the special series of Inaugural Articles by members of the National Academy of Sciences elected in 2009. Contributed by Eric Dean Siggia, February 6, 2012 (sent for review November 28, 2011) Developmental signaling networks are composed of dozens of (5) shows that even differentiation can be reversed. Yet they have components whose interactions are very difficult to quantify in provided a useful guide to experiments. an embryo. Geometric reasoning enumerates a discrete hierarchy These concepts admit a natural geometric representation, of phenotypic models with a few composite variables whose para- which can be formalized in the language of dynamical systems, meters may be defined by in vivo data. Vulval development in also called the geometric theory of differential equations (Fig. 1). ’ the nematode Caenorhabditis elegans is a classic model for the in- When the molecular details are not accessible, a system s effec- tegration of two signaling pathways; induction by EGF and lateral tive behavior may be represented in terms of a small number of signaling through Notch. Existing data for the relative probabilities aggregate variables, and qualitatively different behaviors enum- of the three possible terminal cell types in diverse genetic back- erated according to the geometrical structure of trajectories or grounds as well as timed ablation of the inductive signal favor topology. The fates that are accessible to a cell are associated with attractors—the valleys in Waddington’s “epigenetic landscape” one geometric model and suffice to fit most of its parameters.
    [Show full text]
  • Genetic Dissection of Developmental Pathways*§ †
    Genetic dissection of developmental pathways*§ † Linda S. Huang , Department of Biology, University of Massachusetts-Boston, Boston, MA 02125 USA Paul W. Sternberg, Howard Hughes Medical Institute and Division of Biology, California Institute of Technology, Pasadena, CA 91125 USA Table of Contents 1. Introduction ............................................................................................................................1 2. Epistasis analysis ..................................................................................................................... 2 3. Epistasis analysis of switch regulation pathways ............................................................................ 3 3.1. Double mutant construction ............................................................................................. 3 3.2. Interpretation of epistasis ................................................................................................ 5 3.3. The importance of using null alleles .................................................................................. 6 3.4. Use of dominant mutations .............................................................................................. 7 3.5. Complex pathways ........................................................................................................ 7 3.6. Genetic redundancy ....................................................................................................... 9 3.7. Limits of epistasis ......................................................................................................
    [Show full text]
  • Cytokine Engineering for Improved Ligand/Receptor Traff Ming Dynamics Douglas a Lauffenburger, Eric M Fallon and Jason M Haugh
    Review R257 Scratching the (cell) surface: cytokine engineering for improved ligand/receptor traff Ming dynamics Douglas A Lauffenburger, Eric M Fallon and Jason M Haugh Cytokines can be engineered for greater potency in stimulating Cytokine engineering cellular functions. An obvious test criterion for an improved Recombinant DNA methods offer the possibility of pro- cytokine is receptor-binding affinity, but this does not always ducing cytokines possessing properties superior to those correlate with improved biological response. By combining of the natural. wild-type proteins. In aitrr, as well as in U&XI protein-engineering techniques with studies of receptor applications beckon. Mammalian cell binreactors, for trafficking and signaling, it might be possible to identify the example, for production of pharmacological proteins or ligand receptor-binding properties that should be sought. expansion of differentiated cell populations, often require feeding with specific cytokines for the ximulation of cell Address: Division of Bioengineering & Environmental Health, Department of Chemical Engineering and Center for Biomedical proliferation or differentiation. or the prevention of apop- Engineering, Massachusetts Institute of Technology, Cambridge tosis [1,2]. Typically, periodic re-feeding is required, as a MA 02139, USA. result of metabolic degradation of the cytokines arising from the action of a combination of extracellular and intra- Correspondence: Douglas A Lauffenburger E-mail: [email protected] cellular proteases [3]. Creation of cytokinc
    [Show full text]
  • In Vivo and in Vitro Analysis of Dll1 and Pax6 Function in the Adult Mouse Pancreas
    TECHNISCHE UNIVERSITÄT MÜNCHEN Lehrstuhl für Experimentelle Genetik In vivo and in vitro analysis of Dll1 and Pax6 function in the adult mouse pancreas Davide Cavanna Vollständiger Abdruck der von der Fakultät Wissenschaftszentrum Weihenstephan für Ernährung, Landnutzung und Umwelt der Technischen Universität München zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaften genehmigten Dissertation. Vorsitzender: Univ.-Prof. Dr. D. Langosch Prüfer der Dissertation: 1. Univ.-Prof. Dr. M. Hrabé de Angelis 2. Univ.-Prof. A. Schnieke, Ph.D. Die Dissertation wurde am 03.07.2013 bei der Technischen Universität München eingereicht und durch die Fakultät Wissenschaftszentrum Weihenstephan für Ernährung, Landnutzung und Umwelt am 10.12.2013 angenommen. I. Table of contents I. TABLE OF CONTENTS .................................................................................................. I II. FIGURES AND TABLES ................................................................................................ V III. ABBREVIATIONS ................................................................................................. VIII IV. PUBLICATIONS, TALKS, AND POSTERS ................................................................... XI V. ACKNOWLEDGMENTS .............................................................................................. XII VI. AFFIRMATION ..................................................................................................... XIV 1. SUMMARY/ZUSAMMENFASSUNG ............................................................................
    [Show full text]
  • The Many Faces of Pleiotropy
    Opinion The many faces of pleiotropy Annalise B. Paaby and Matthew V. Rockman Department of Biology and Center for Genomics & Systems Biology, New York University, 12 Waverly Place, New York, NY 10003, USA Pleiotropy is the well-established phenomenon of a pleiotropy is a feature of the genotype–phenotype map single gene affecting multiple traits. It has long played that defines the genetic and evolutionary autonomy of a central role in theoretical, experimental, and clinical aspects of phenotype, independent of fitness. This is the research in genetics, development, molecular biology, mutational pleiotropy underlying the diverse manifesta- evolution, and medicine. In recent years, genomic tech- tions of syndromic diseases, the ontogenetic pleiotropy that niques have brought data to bear on fundamental ques- underlies classical questions about allometry and hetero- tions about the nature and extent of pleiotropy. chrony, and the molecular pleiotropy that underlies ques- However, these efforts are plagued by conceptual diffi- tions about relative importance of cis-regulatory versus culties derived from disparate meanings and interpreta- protein-coding variants. tions of pleiotropy. Here, we describe distinct uses of the In ‘selectional pleiotropy’, the question is about the pleiotropy concept and explain the pitfalls associated number of separate components of fitness a mutation with applying empirical data to them. We conclude that, affects. In some cases, the multiple fitness components for any question about the nature or extent of pleiotropy, are life-history traits of a single individual, which is at the appropriate answer is always ‘What do you mean?’. the heart of the antagonistic pleiotropy model for the evolution of aging [1].
    [Show full text]
  • The EGF Receptor Ligand Amphiregulin Controls Cell Division Via Foxm1
    Oncogene (2016) 35, 2075–2086 © 2016 Macmillan Publishers Limited All rights reserved 0950-9232/16 www.nature.com/onc ORIGINAL ARTICLE The EGF receptor ligand amphiregulin controls cell division via FoxM1 SW Stoll1, PE Stuart1, WR Swindell1, LC Tsoi2,BLi3, A Gandarillas4, S Lambert1, A Johnston1, RP Nair1 and JT Elder1,5 Epidermal growth factor receptor (EGFR) is central to epithelial cell physiology, and deregulated EGFR signaling has an important role in a variety of human carcinomas. Here we show that silencing of the EGF-related factor amphiregulin (AREG) markedly inhibits the expansion of human keratinocytes through mitotic failure and accumulation of cells with ⩾ 4n DNA content. RNA-sequencing- based transcriptome analysis revealed that tetracycline-mediated AREG silencing significantly altered the expression of 2331 genes, 623 of which were not normalized by treatment with EGF. Interestingly, genes irreversibly upregulated by suppression of AREG overlapped with genes involved in keratinocyte differentiation. Moreover, a significant proportion of the irreversibly downregulated genes featured upstream binding sites recognized by forkhead box protein M1 (FoxM1), a key transcription factor in the control of mitosis that is widely dysregulated in cancer. The downregulation of FoxM1 and its target genes preceded mitotic arrest. Constitutive expression of FoxM1 in AREG knockdown cells normalized cell proliferation, reduced the number of cells with ⩾ 4n DNA content and rescued expression of FoxM1 target genes. These results demonstrate that AREG controls G2/M progression and cytokinesis in keratinocytes via activation of a FoxM1-dependent transcriptional program, suggesting new avenues for treatment of epithelial cancer. Oncogene (2016) 35, 2075–2086; doi:10.1038/onc.2015.269; published online 3 August 2015 INTRODUCTION a variety of epithelial neoplasms and it may confer tumor cells 31–34 Epidermal homeostasis requires balance between keratinocyte with autonomous growth.
    [Show full text]
  • Measurement of Ligand-Receptor Interactions (Biomembrane Interactions/Adhesion/Biotin/Streptavidin) CHRISTIANE A
    Proc. Natl. Acad. Sci. USA Vol. 88, pp. 8169-8173, September 1991 Biochemistry Measurement of ligand-receptor interactions (biomembrane interactions/adhesion/biotin/streptavidin) CHRISTIANE A. HELM*t, WOLFGANG KNOLL*§, AND JACOB N. ISRAELACHVILI* *Department of Chemical and Nuclear Engineering, and Materials Department, University of California, Santa Barbara, CA 93106; and tMax-Planck-Institut for Polymerforschung, Postfach 3148, D-6500 Mainz, Federal Republic of Germany Communicated by Charles P. Bean, June 10, 1991 ABSTRACT One distinguishing feature of "life" is that deposition of a layer of L-a-dilauroylphosphatidylethanol- the physical forces between biological molecules and membrane amine (DLPE; Sigma) of area 0.55 nm2 per molecule (con- surfaces are often highly specific, in contrast to nonspecific taining 5% DPPE-biotin) (Molecular Probes), thereby expos- interactions such as van der Waals, hydrophobic, and electro- ing one biotin ligand group per 11 nm2. This deposition was static (Coulombic) forces. We have used the surface-forces- done at 30TC from a 1 mM NaCl solution at a pressure ofabout apparatus technique to study the specific "lock and key" or 38 mN/m. "ligand-receptor" interaction between two model biomem- An avidin surface was prepared from a biotin surface by brane surfaces in aqueous solution. The membranes were lipid adsorbing soluble streptavidin molecules (kindly provided by bilayers supported on mica surfaces; one carrying streptavidin Boehringer Mannheim) from an aqueous solution, thereby receptors, the other exposing biotin ligand groups. We found yielding a surface with the same density ofunsaturated avidin that, although no unusual or specific interaction occurs be- (receptor) sites as biotin (ligand) groups.
    [Show full text]
  • Hedgehog Signaling: Networking to Nurture a Promalignant Tumor Microenvironment
    Published OnlineFirst July 20, 2011; DOI: 10.1158/1541-7786.MCR-11-0175 Molecular Cancer Subject Review Research Hedgehog Signaling: Networking to Nurture a Promalignant Tumor Microenvironment Lillianne G. Harris, Rajeev S. Samant, and Lalita A. Shevde Abstract In addition to its role in embryonic development, the Hedgehog pathway has been shown to be an active participant in cancer development, progression, and metastasis. Although this pathway is activated by autocrine signaling by Hedgehog ligands, it can also initiate paracrine signaling with cells in the microenvironment. This creates a network of Hedgehog signaling that determines the malignant behavior of the tumor cells. As a result of paracrine signal transmission, the effects of Hedgehog signaling most profoundly influence the stromal cells that constitute the tumor microenvironment. The stromal cells in turn produce factors that nurture the tumor. Thus, such a resonating cross-talk can amplify Hedgehog signaling, resulting in molecular chatter that overall promotes tumor progression. Inhibitors of Hedgehog signaling have been the subject of intense research. Several of these inhibitors are currently being evaluated in clinical trials. Here, we review the role of the Hedgehog pathway in the signature characteristics of cancer cells that determine tumor development, progression, and metastasis. This review condenses the latest findings on the signaling pathways that are activated and/or regulated by molecules generated from Hedgehog signaling in cancer and cites promising clinical interventions. Finally, we discuss future directions for identifying the appropriate patients for therapy, developing reliable markers of efficacy of treatment, and combating resistance to Hedgehog pathway inhibitors. Mol Cancer Res; 9(9); 1165–74.
    [Show full text]
  • Inducible Short-Term and Stable Long-Term Cell Culture Systems Reveal That the PAX3-FKHR Fusion Oncoprotein Regulates CXCR4, PAX3, and PAX7 Expression
    Laboratory Investigation (2004) 84, 1060–1070 & 2004 USCAP, Inc All rights reserved 0023-6837/04 $30.00 www.laboratoryinvestigation.org Inducible short-term and stable long-term cell culture systems reveal that the PAX3-FKHR fusion oncoprotein regulates CXCR4, PAX3, and PAX7 expression Oana Tomescu1, Shujuan J Xia1, Donna Strezlecki1, Jeannette L Bennicelli1,*, Jill Ginsberg1,w, Bruce Pawel2 and Frederic G Barr1 1Department of Pathology and Laboratory Medicine, University of Pennsylvania School of Medicine, Philadelphia, PA, USA and 2Department of Pathology, Children’s Hospital of Philadelphia, Philadelphia, PA, USA In the pediatric cancer alveolar rhabdomyosarcoma (ARMS), the 2;13 chromosomal translocation juxtaposes the PAX3 and FKHR genes to generate a chimeric transcription factor. To explore molecular pathways altered by this oncoprotein, we generated an inducible form by fusing PAX3-FKHR to a modified estrogen receptor ligand-binding domain and expressed this construct in the RD embryonal rhabdomyosarcoma cell line. This inducible system permits short-term evaluation of downstream expression targets of PAX3-FKHR and complements a panel of stable long-term RD subclones constitutively expressing PAX3-FKHR. Using these two sets of resources, we investigated several candidate PAX3-FKHR target genes. First, we demonstrated in both short-term and long-term systems that PAX3-FKHR upregulates expression of the gene encoding the chemokine receptor CXCR4. In addition, we found that expression of wild-type PAX3 is upregulated, whereas expression of wild-type PAX7 is downregulated by PAX3-FKHR. In the presence of cycloheximide, CXCR4 and PAX3 are still inducible, supporting the hypothesis that these genes are direct transcriptional targets of PAX3- FKHR.
    [Show full text]