New avian paramyxoviruses type I strains identified in Africa provide new outcomes for phylogeny reconstruction and genotype classification Renata Servan de Almeida, Saliha Hammoumi, Patricia Gil, François-Xavier Briand, Sophie Molia, Nicolas Gaidet, Julien Cappelle, Véronique Chevalier, Gilles Balança, Abdallah Traore, et al. To cite this version: Renata Servan de Almeida, Saliha Hammoumi, Patricia Gil, François-Xavier Briand, Sophie Molia, et al.. New avian paramyxoviruses type I strains identified in Africa provide new outcomes for phy- logeny reconstruction and genotype classification. PLoS ONE, Public Library of Science, 2013, 8(10), 10.1371/journal.pone.0076413. hal-02648713 HAL Id: hal-02648713 https://hal.inrae.fr/hal-02648713 Submitted on 29 May 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. New Avian Paramyxoviruses Type I Strains Identified in Africa Provide New Outcomes for Phylogeny Reconstruction and Genotype Classification Renata Servan de Almeida1,2*., Saliha Hammoumi1,2., Patricia Gil1,2, Franc¸ois-Xavier Briand3, Sophie Molia4, Nicolas Gaidet4, Julien Cappelle4,Ve´ronique Chevalier4, Gilles Balanc¸a4, Abdallah Traore´ 5, Colette Grillet1,2, Olivier Fridolin Maminiaina6, Samia Guendouz1,2, Marthin Dakouo5, Kassim Samake´ 5, Ould El Mamy Bezeid7, Abbas Diarra5, Hassen Chaka8, Flavie Goutard4, Peter Thompson9, Dominique Martinez1,2,Ve´ronique Jestin3, Emmanuel Albina2,10 1 CIRAD, UMR CMAEE, Montpellier, France, 2 INRA, UMR1309 CMAEE, Montpellier, France, 3 Anses-Ploufragan-Plouzane´, VIPAC, French Reference Laboratory for Avian Influenza and Newcastle Disease, Ploufragan, France, 4 CIRAD, UPR AGIRS, Montpellier, France, 5 Laboratoire Central Ve´te´rinaire, Bamako, Mali, 6 FOFIFA-DRZV, Antananarivo, Madagascar, 7 Centre National d’Elevage et de Recherche Ve´te´rinaires (CNERV), Nouakchott, Mauritania, 8 National Animal Health Diagnostic and Investigation Center (NAHDIC), Sebeta, Ethiopia, 9 Faculty of Veterinary Science, University of Pretoria, Pretoria, South Africa, 10 CIRAD, UMR CMAEE, Petit-Bourg, Guadeloupe, France Abstract Newcastle disease (ND) is one of the most lethal diseases of poultry worldwide. It is caused by an avian paramyxovirus 1 that has high genomic diversity. In the framework of an international surveillance program launched in 2007, several thousand samples from domestic and wild birds in Africa were collected and analyzed. ND viruses (NDV) were detected and isolated in apparently healthy fowls and wild birds. However, two thirds of the isolates collected in this study were classified as virulent strains of NDV based on the molecular analysis of the fusion protein and experimental in vivo challenges with two representative isolates. Phylogenetic analysis based on the F and HN genes showed that isolates recovered from poultry in Mali and Ethiopia form new groups, herein proposed as genotypes XIV and sub-genotype VIf with reference to the new nomenclature described by Diel’s group. In Madagascar, the circulation of NDV strains of genotype XI, originally reported elsewhere, is also confirmed. Full genome sequencing of five African isolates was generated and an extensive phylogeny reconstruction was carried out based on the nucleotide sequences. The evolutionary distances between groups and the specific amino acid signatures of each cluster allowed us to refine the genotype nomenclature. Citation: de Almeida RS, Hammoumi S, Gil P, Briand F-X, Molia S, et al. (2013) New Avian Paramyxoviruses Type I Strains Identified in Africa Provide New Outcomes for Phylogeny Reconstruction and Genotype Classification. PLoS ONE 8(10): e76413. doi:10.1371/journal.pone.0076413 Editor: Chiyu Zhang, Institut Pasteur of Shanghai, Chinese Academy of Sciences, China Received July 19, 2011; Accepted August 28, 2013; Published October 18, 2013 Copyright: ß 2013 de Almeida et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This study was mainly funded by the French Ministry of Foreign Affairs (MAE) via the Fonds de Solidarite´ Prioritaire project [GRIPAVI 2006-26] and partly by the EU network of excellence project [EPIZONE (016236, 01/06/2006–31/05/2011)]. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. * E-mail: [email protected] . These authors contributed equally to this work. Introduction (mesogenic), and nonpathogenic (lentogenic) strains based on pathogenicity in chickens [5]. Although V, HN, NP, P and L Newcastle disease (ND) is one of the most severe infectious proteins play a role in virulence [6,7,8,9], the most important diseases of birds, particularly poultry, and has been the cause of molecular determinant of virulence appears linked to the amino major economic losses worldwide [1]. It is one of the 14 avian acid motif present at the protease cleavage site of the F0 precursor diseases notifiable to the World Organization for Animal Health of the fusion protein [10]. In virulent isolates, this motif is (Office International des Epizooties, OIE) [2]. The cause of ND, constituted of basic amino acids, and rapid typing of this region by Newcastle disease virus (NDV) or avian paramyxovirus type 1 RT-PCR and sequencing is a good indicator of the NDV (APMV-1), belongs to the Avulavirus genus, Paramyxoviridae family, pathotype. However, other viral factors affect the virulence of and has a negative-sense single-stranded RNA genome of about isolates, so pathogenicity should be confirmed by in vivo tests, 15.2 kilobases. The genome encodes eight proteins, nucleocapsid including the intracerebral pathogenicity index (ICPI) in 1-day-old (NP), phosphoprotein (P), matrix (M), fusion (F), hemagglutinin- chickens, the mean death time (MDT) of specific-pathogen-free neuraminidase (HN), a large RNA-directed RNA polymerase (L), hen’s embryos after inoculation, and the intravenous pathogenicity and two additional nonstructural proteins, V and W, generated by index (IVPI) in 6-week-old chickens [2]. RNA editing during P gene transcription [3,4]. NDV can be NDV strains are divided into two clades (class I and class II) categorized into highly pathogenic (velogenic), intermediate according to the genome size and the sequence of the F and L PLOS ONE | www.plosone.org 1 October 2013 | Volume 8 | Issue 10 | e76413 New Outcomes for APMV-1 Phylogeny Reconstruction Table 1. Primers used for complete sequencing of the F and HN genes. Nucleotide position PCR product Primer Sequence 59-39 Directiona on AY741404 Gene targetb size Reference MFS1 GACCGCTGACCACGAGGTTA F 4306 M 766 [30] F3AS TGCATCTTCCCAACTGCCAC R 5072 F c F+4952 GCAGCCGCAGCTCTAATAC F 4952 F 747 c MFS3 GGCAATAACTGAGCCTTTGAG R 5699 F c F+886 AATAATATGCGTGCCACCTA F 5429 F 1040 c HN49rev GCGCCATGTRTTCTTTGC R 6469 HN c P6A ATCAGATGAGAGCCACTACA F 6177 F 1120 [31] HN886rev ACTCCTGGGTAATTTGCCAC R 7297 HN c 3HNOV GTCTTGCAGTGTGAGTGCAAC F 7119 HN 1271 [30] P7B TCTGCCCTTTCAGGACCGGA R 8390 L [31] aF, forward; R, reverse. bM, F, HN, and L matrix, fusion protein, hemagglutinin-neuraminidase, and polymerase genes, respectively. cprimers designed on conserved sequences based on the alignment of the complete sequences of 219 F genes and 74 HN genes published in GenBank. doi:10.1371/journal.pone.0076413.t001 genes [4]. Restriction enzyme site mapping of the F protein gene available were included in an extensive phylogeny reconstruction and phylogenetic analysis of the partial nucleotide sequence of the based on various methods. It is shown that the ‘‘genotype’’ F gene have been used to classify NDV of class II [11,12]. nomenclature is better adapted to the resulting genetic discrim- However, there is no consensus on NDV classification and ination of NDV isolates. In addition, 10 sub-genotypes are defined. taxonomy, since some authors use the classification of the group of According to these results and previous publications, a rooted Lomniczi and Ballagi-Pordany [11,12] based on ‘‘genotypes’’ classification with 14 distinct genotypes is now proposed. whereas others use the ‘‘lineage’’ classification of Aldous et al [1]. Both cover distinct isolate clusters but are based on the same Materials and Methods genomic information. According to the evolutionary distances, Miller et al [13] showed inconsistencies between the two Ethics Statement nomenclatures (for example lineage 3 is not monophyletic and All animal experiments (ICPI tests) were conducted according to contains genotypes III, IV, V, and VIII: detailed discrepancies internationally approved OIE standards, under authorizations set between the two nomenclatures can be found in Table S1). Calling forth by the director of the veterinary services of Coˆtes d’Armor on for objective criteria to unify the NDV nomenclature, those behalf of the prefect of Coˆtes d’Armor (Nu22–18) and by