DOCSLIB.ORG

Alkaloid Profile of Endophytic Diaporthe Spp. from Cinchona Calisaya

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Alkaloid Profile of Endophytic Diaporthe Spp. from Cinchona Calisaya Alkaloid profile of endophytic Diaporthe spp. from....(N. Radiastuti, G. Rahayu, I. Okane, I. Hidayat, and S. Setiati A.) Alkaloid profile of endophytic Diaporthe spp. from Cinchona calisaya Profil alkaloid endofit Diaporthe spp. dari Cinchona calisaya Nani Radiastuti1, Gayuh Rahayu1*, Izumi Okane2, Iman Hidayat3, and Suminar Setiati Achmadi4 1Department of Biology, Faculty of Mathematics and Natural Sciences, Bogor Agricultural University (IPB), Indonesia. 2Faculty of Life and Environmental Sciences, University of Tsukuba, Japan. [email protected] 3Microbiology Division, Research Center for Biology, Indonesian Institute of Sciences (LIPI), Indonesia. [email protected] 4Department of Chemistry, Faculty of Mathematics and Natural Sciences, Bogor Agricultural University (IPB), Indonesia. [email protected] email: [email protected] Submit: 21April 2015; correction: 30 April 2015; accept: 26 May 2015 Abstract score, UPGMA analyses of alkaloid profile of these strains shows that these strains forms 23 Endophytic fungi have been known as clusters. Alkaloid profile clustering does not potential source of bioactive compound, similar support the phylogenetic grouping. This to their host. This study was conducted to indicates that the alkaloid profile is strain identify endophytic Diaporthe spp. isolated dependent. Some potential strains should be from Cinchona calisaya and to explore their further investigated for optimization of their potential in producing alkaloids, particularly quinine production. quinine. A total of 39 strains of Diaporthe spp. were identified using ITS1-5.8S-ITS2 and EF1- Keywords: Cinchona calisaya, Diaporthe spp., α gene. Seventeen strains have species name endophytes, quinine and they represent eight species of Diaporthe i.e. D. cynaroidis, D. endophytica, D. ganjae, D. gardeniae, D. litchicola, D. phaseolorum, D. Abstrak pseudomangiferae, and D. rhoina. The re- maining 22 strains represents 15 groups of Cendawan endofit merupakan salah satu unidentified Diaporthe sp. High performance sumber senyawa bioaktif yang potensial seperti liquid chromatography analyses of chloroform inangnya. Penelitian ini bertujuan untuk meng- extract of 21-days old static cultures of all fungi identifikasi Diaporthe spp. asal Cinchona cali- in potato dextrose broth showed that these saya dan menganalisis potensi produksi alka- strains produce totally 82 different alkaloids. loidnya, terutama kuinin. Sebanyak 39 strain Each strain producedabout 2-38 different Diaporthe spp. diidentifikasi menggunakan alkaloids. Sixteen out of 39 strains (41%), i.e. sekuen daerah ITS1-5.8S-ITS2 and gen EF1-α. one strain each of D. endophytica, D. gar- Tujuh belas strain termasuk ke dalam 8 spesies deniae, D. phaseolorum, and D. pseudo- Diaporthe yaitu D. cynaroidis, D. endophytica, mangiferae, 2 strains of D. litchicola, and 10 D. ganjae, D. gardeniae, D. litchicola, D. strains of unidentified Diaporthe were able to phaseolorum, D. pseudomangiferae, and D. produce quinine. The quinine concentration rhoina. Dua puluh dua strain lainnya mewakili ranges from 1.1 mg/l to 155.2 mg/l. By using 15 grup Diaporthe spp. Analisis High per- Jaccard’s similarity index 0.44 as the cutting formance liquid chromatography terhadap 81 Jurnal Penelitian Teh dan Kina, 18(1), 2015: 81-93 ekstrak kloroform dari kultur cendawan pada (Susilo, 2011). Starting 2003, the Quina agar kentang cair yang diinkubasi secara statik tree plantation area has decreased and selama 21 hari menunjukkan bahwa strain- strain tersebut menghasilkan 82 jenis alkaloid. consequently the tree populationhas also Puncak-puncak pada kromatogram pada waktu declined. In 2011, Quina plantation area retensi yang berbeda menunjukkan jenis alka- was only about 3.886 hectares in West Java, loid yang berbeda. Setiap strain dapat mempro- and the production met only 30-50% de- duksi 2-38 alkaloid yang berbeda. Sebanyak 16 dari 39 strain (41%), yaitu masing-masing satu mand of the industry (Susilo, 2011). This strain dari D. endophytica, D. gardeniae, D. shortage is overcome by importing bark phaseolorum dan D. pseudomangiferae,2 strain flakes. Although replanting program is D. litchicola, dan 10 strain Diaporthe spp. being undertaken, alternative sources for dapat menghasilkan kuinin. Konsentrasi kuinin berkisar antara 1,1 mg/ml sampai 155,2 mg/ml. quinine production have to be investigated. Berdasarkan batas nilai index kemiripan Among those alternatives is endophytic (Jaccard)= 0,44, analisis UPGMA profil alka- fungi obtained from Quina tree. loid strain-strain ini menunjukkan bahwa Endophytic fungi have been known to strain-strain ini terbagi dalam 23 kelompok. Kelompok berdasarkan profil alkaloid tidak produce bioactive compounds originally mendukung pengelompokan berdasarkan filo- from their host (Strobel et al., 1993, Zhao et genetik. Hal ini menunjukkan bahwa profil al., 2010). For example, taxol is naturally alkaloid tersebut bergantung pada strainnya. produced by Taxus brevifolia and now is Strain-strain potensial perlu dipelajari lebih lanjut dalam optimasi produksi kuininnya. produced by various endophytes from different medicinal plants (Gangadevi et al., Kata kunci: Cinchona calisaya, Diaporthe spp., endofit, kuinin 2008a, 2008b, Visalakchi & Muthumary, 2010). Endophytic fungi of Cinchona spp. have been reported by several researchers (Simanjuntak et al., 2002, Mumpuni et al., 2004, Winarno, 2006, Maehara et al., INTRODUCTION 2010). A single strain of a closely related Quina tree (Cinchona spp.) is widely Diaporthe phaseolorum, an endophytic known as a medicinal plant. The bark of fungi from C. ledgeriana (syn. of C. this tree has antimalarial compound namely calisaya), was reported to produce quinine quinine (Taylor, 1975). In addition to and its related substances (Maehara et al., antimalarial drug, quinine can be usedasraw 2012). Prior to this study, a number of material in pharmacy, as food colorant, and specimens of endophytic Diaporthe from C. beverage flavor (Santoso et al., 2004). calisaya Wedd. (syn. C. calisaya var. Therefore, some species of Cinchona spp. ledgeriana Howard) has been collected has been cultivated in several countries for (data unpublished). The collection was not quinine production. One of the commercial limited to those from bark and young stems clone for quinine production is C. calisaya but from all parts of the tree. Based on (syn. C. ledgeriana). phylogenetic study using Internal Trans- Quinine industry in Indonesia has cribed Spacer (ITS) region, the collection been established before Second World War, consisted of D. beckhausii, D. eucalyp- and Indonesiahad ever been recognized as torum, D. infecunda, D. hongkongensis, D. the world's largest supplier of quinine litchicola, D. phaseolorum, D. psoraleae, 82 Alkaloid profile of endophytic Diaporthe spp. from....(N. Radiastuti, G. Rahayu, I. Okane, I. Hidayat, and S. Setiati A.) D. pseudomangiferae, and some uniden- 70% ethanol for 20 s. The samples were tified species of Diaporthe (data unpub- rinsed three times in sterile distilled water, lished). Re-identification of these Diapor- and dried with sterile paper for at least 6 h. the using other marker such as EF1-α is still The sterile distilled water of the final rinse needed. Further, bioactive compoundsin was poured onto the agar medium as a those collected species has not been quality control of sterilization process. explored. Therefore, this study was aimed After drying, samples were cut into seg- to reconfirm the identity of endophytic Dia- ments approximately1 × 2 cm and placed porthe spp. isolated from leaf, petiole, twig, on the surface of Malt Extract Agar (MEA) bark, and fruit of C. calisaya and to analyze (Difco, USA) (4 segments/petri dish). All its potential for alkaloid production, parti- petri dishes were incubated at room con- cularly quinine. dition. Three replications were made for each sample. The growth of endophytic fungi mycelium were observed every day, for about 30 d. The growing colonies were MATERIALS AND METHODS purified using hyphal tip isolation method Sampling and fungal endophyte isolation to get a pure culture. The cultures were kept Flowers, leaves (with petioles), stems, in Bogor Agriculture University Culture barks, and roots of C. calisaya werecollec- Collection (IPBCC). Cultures having cha- ted from trees grown in quina plantation racteristics resembling morphotypes of managed by the Research Center for Tea Diaporthe were then selected for further and Quina, Gambung, West Java, Indonesia investigation. (29 September 2012). The plantation is lo- cated at 7°8'35.78"S, 107°30'59.55"E and Identification of the fungi 1.400 m asl. Five pieces of each healthy Identification was done by phyloge- organ were taken from 5 individual plants netic analyses on the bases of combined and placed in zipped plastic bags. The co- ITS1-5.8S-ITS2 and EF gene sequences. llecting bags were sealed and labelled with Genomic DNA from 7-d fungal mycelia the name of the host tree, collection site, grown in 5 ml of Potato Dextrose Broth date, and collector(s). All specimens were (PDB) (Difco, USA) were harvested using kept in ice boxes prior to isolation in the PhytopureTM DNA extraction kit (GE laboratory. Health care, UK) following the manufac- turer’s protocol. Isolation The primer pairs of ITS5 (forward)(5’ The fungal endophytes were isolated –TCCTCCGCTTATTGATATGC–3’) and using isolation protocol described by ITS4 (reverse) (5'–TCCGTAGGTGA- Mostert et al. (2001) with modification. ACCTGCGC–3') (White et al., 1990) were The
Load more

Recommended publications
  • Cinchona Amazonica Standl. (Rubiaceae) No Estado Do Acre, Brasil1 Cinchona Amazonica Standl
    Bol. Mus. Para. Emílio Goeldi. Ciências Naturais, Belém, v. 1, n. 1, p. 9-18, jan-abr. 2006 Cinchona amazonica Standl. (Rubiaceae) no estado do Acre, Brasil1 Cinchona amazonica Standl. (Rubiaceae) in the state of Acre, Brazil Percy Amilcar Zevallos Pollito I Mário Tomazello Filho II ResumoResumo: O presente estudo trata da dendrologia, distribuição geográfica e status de conservação de Cinchona amazonica Standl., plantas de interesse medicinal que ocorrem no estado do Acre, Brasil. A pesquisa consistiu em trabalhos de campo para a coleta de material botânico, levantamento e estudo das exsicatas disponíveis nos herbários nacionais e internacionais da América do Sul, revisão bibliográfica das espécies do gênero na literatura e nos sites especializados. Os resultados apresentam a descrição com a sua ilustração e mapeamento bem como determinação da sua situação populacional. Palavras-chavealavras-chave: Cinchona. Dendrologia. Ditribuição geográfica. Status de conservação. Acre. AbstractAbstract: The present research is about dendrology, geographic distribution and status of conservation of Cinchona amazonica Standl. with are plants with medical interest; they grow in the state of Acre, Brazil. The research consisted in: field work for the collection of botanical material, in the survey and study of the available exsiccates in the national and international herbariums of the South America. It has been done a bibliographical review of the species of this genera in literature and the specialized sites The results present the description of the species with their illustration and mapping, as well as determination of their population situation. Keywordseywords: Cinchona. Dendrology. Geographic distribution. Conservation status. Acre I Universidade Nacional Agraria La Molina. Faculdad de Ciencias Florestales.
    [Show full text]
  • Plants and Parts of Plants Used in Food Supplements: an Approach to Their
    370 ANN IST SUPER SANITÀ 2010 | VOL. 46, NO. 4: 370-388 DOI: 10.4415/ANN_10_04_05 ES I Plants and parts of plants used OLOG D in food supplements: an approach ETHO to their safety assessment M (a) (b) (b) (b) D Brunella Carratù , Elena Federici , Francesca R. Gallo , Andrea Geraci , N (a) (b) (b) (a) A Marco Guidotti , Giuseppina Multari , Giovanna Palazzino and Elisabetta Sanzini (a)Dipartimento di Sanità Pubblica Veterinaria e Sicurezza Alimentare; RCH (b) A Dipartimento del Farmaco, Istituto Superiore di Sanità, Rome, Italy ESE R Summary. In Italy most herbal products are sold as food supplements and are subject only to food law. A list of about 1200 plants authorised for use in food supplements has been compiled by the Italian Ministry of Health. In order to review and possibly improve the Ministry’s list an ad hoc working group of Istituto Superiore di Sanità was requested to provide a technical and scientific opinion on plant safety. The listed plants were evaluated on the basis of their use in food, therapeu- tic activity, human toxicity and in no-alimentary fields. Toxicity was also assessed and plant limita- tions to use in food supplements were defined. Key words: food supplements, botanicals, herbal products, safety assessment. Riassunto (Piante o parti di piante usate negli integratori alimentari: un approccio per la valutazione della loro sicurezza d’uso). In Italia i prodotti a base di piante utilizzati a scopo salutistico sono in- tegratori alimentari e pertanto devono essere commercializzati secondo le normative degli alimenti. Le piante che possono essere impiegate sono raccolte in una “lista di piante ammesse” stabilita dal Ministero della Salute.
    [Show full text]
  • God's Healing Leaves: the Colonial Quest for Medicinal Plants in The
    GOD’S HEALING LEAVES: THE COLONIAL QUEST FOR MEDICINAL PLANTS IN THE TORRID ZONE* ROBERT VOEKS and CHARLOTTE GREENE ABSTRACT. The colonial era witnessed a fevered quest for exotic medicinal plants by Eur- opean physicians and scientists. This essay explores the geographical principles that oriented the search towards the lands and peoples of the humid tropics. Believing that God had planted botanical cures for diseases in their places of origin, medicinal plant collectors concentrated their efforts in the pestilential equatorial latitudes. Although many subscribed to the ancient Doctrine of Signatures, colonial bioprospectors discov- ered early that indigenous and diasporic peoples represented storehouses of plant knowl- edge. Assuming that native knowhow constituted more instinct than intelligence, Europeans employed coercion, bribes, torture, and promises of freedom to extract their ethnomedical secrets. In the case of especially lucrative healing plants, imperial and colo- nial entities conspired to pilfer and naturalize endemic species in their distant colonies. In response to this legacy of inappropriate exploitation of native peoples and tropical plants during the colonial era, most present day bioprospectors follow established codes of ethnobotanical ethics. Keywords: Medicine, botany, tropical rainforest. In the late-twentieth century, the public’s attention was drawn to the world’s tropical rainforests, not just as exotic bestiaries and biodiversity hotspots, but as sources of miracle-cure drug plants. Popular magazines and books touted the pharmaceutical potential of rainforest vegetation, citing for example the case of quinine derived from South American cinchona trees, the historical remedy for malaria, and especially the 1970s discovery of vincristine from the Madagascar periwinkle (Catharanthus roseus), the highly-successful therapy for childhood leukemia.
    [Show full text]
  • Cinchona Pubescens Quinine Tree Rubiaceae
    Cinchona pubescens Quinine tree Rubiaceae Forest Starr, Kim Starr, and Lloyd Loope United States Geological Survey--Biological Resources Division Haleakala Field Station, Maui, Hawai'i January, 2003 OVERVIEW Cinchona pubescens, native from Andean South America north to Costa Rica, has been cultivated in various tropical regions of the world mainly for use in the production of quinine, a medicine used to treat malaria, which is obtained from the root and bark of the tree. In some places where C. pubescens is cultivated, such as Galapagos and Hawai'i, it is spreading from initial plantings, invading nearby forests, forming dense thickets, and crowding out native plants. In Hawai'i, Cinchona plantations were planted as early as 1868 on Maui with later plantings by state foresters on O'ahu, Maui, and Hawai'i in the first half of the 1900's (Wagner et al. 1999). C. pubescens was reported as naturalized in 1978 from the island of Hawai'i and in 1987 from Maui (Wagner et al. 1999). On Maui, C. pubescens is locally abundant in the Makawao Forest Reserve of East Maui in areas near original plantings and alien forestry plantations, along old roads, and in thick native mixed mesic to wet forests. Though seed production is heavy, this species does not seem to disperse very far from original plants. Though locally abundant, it is fairly far along in its invasion process, and the terrain is very difficult, including steep gulches and thick under-story vegetation, making control of this species difficult. While eradication of C. pubescens in the Makawao Forest Reserve would be difficult, controlling small populations in pockets of rich native vegetation may help contain the infestation and slow the degradation of the remaining native forests in the area.
    [Show full text]
  • Phytogeographic Basis Plant Breeding
    PHYTOGEOGRAPHIC BASIS of PLANT BREEDING 1. Local Varieties and Their Significance :— The -varieties of cultivated plants grown in the different regions of the Soviet Union until recently were varieties introduced from various localities and countries, and were inseparable from human migration and colonization. The list of cultivated plants reflects the history of our country in its recent past, it shows the effects of individual peasant farming. In the separate groups and varieties of plants one can trace the routes by which they were brought from Western Europe, the United States, Asia Minor, Mongolia, and Iran. In the pre-revolutionary period, the introduction of new varieties in our country was haphazard. Beginning with the eighteenth century, individual amateur growers and societies unsystemati- cally introduced new varieties from abroad. Sometimes these new varieties were quite valuable but because of the vastness of our country and the com- plete absence of any state-planned system of plant introduction, the imported varieties usually restricted themselves to very limited areas and disappeared. It may be considered that pedigree seed production, in the real meaning of the term, did not exist in our country before the October Revolution. We have just begun a planned distribution of varieties in accordance with the needs of our large-scale socialized and mechanized agricultural economy. Yet, there is no doubt that the varietal materials which were introduced in our country and cultivated for decades and centuries were subjected to natural selection, and also to deliberate or casual artificial selection, and that some local varieties evolved that were ecologically adapted. The proximity of the Soviet Union to the basic centers of origin of numer- ous cultivated plants facilitated the selection of exceptionally valuable forms.
    [Show full text]
  • Phylogeny of the Tribe Cinchoneae (Rubiaceae), Its Position in Cinchonoideae, and Description of a New Genus, Ciliosemina
    54 (1) • February 2005: 17–28 Andersson & Antonelli • Phylogeny of Cinchoneae MOLECULAR PHYLOGENETICS Phylogeny of the tribe Cinchoneae (Rubiaceae), its position in Cinchonoideae, and description of a new genus, Ciliosemina Lennart Andersson* & Alexandre Antonelli Botanical Institute, Göteborg University, P. O. Box 461, SE-405 30 Göteborg, Sweden. alexandre.antonelli@ botany.gu.se (author for correspondence) Relationships of and within the Rubiaceae tribe Cinchoneae were estimated based on DNA sequence variation in five loci: the ITS region, the matK and rbcL genes, the rps16 intron, and the trnL-F region including the trnL intron and the trnL-F intergenic spacer. Within Cinchonoideae s.s., the tribe Naucleeae is the sister group of a clade that comprises all other taxa. Cinchoneae and Isertieae s.s., are strongly supported as sister groups. The tribe Cinchoneae is strongly supported as monophyletic in a restricted sense, including the genera Cinchona, Cinchonopsis, Joosia, Ladenbergia, Remijia and Stilpnophyllum. There is strong support that these genera are monophyletic as presently conceived, except that one species mostly referred to Remijia is of uncer- tain phylogenetic affinity. To accommodate this species and a morphologically closely similar one, a new genus, Ciliosemina A. Antonelli, is proposed and two new combinations are made. KEYWORDS: Cinchona, Cinchoneae, Cinchonopsis, Joosia, Ladenbergia, Remijia, Stilpnophyllum, Rubiaceae; ITS, matK, rbcL, rps16 intron, trnL-F. oideae. Bremekamp (e.g., 1966) revised Schumann’s INTRODUCTION classification and redefined Cinchonoideae to comprise Traditionally (e.g., Candolle, 1830; Schumann, only genera without raphides, with imbricate or valvate 1891, 1897; Robbrecht, 1988), the tribe Cinchoneae has corolla aestivation and testa cells with coarsely pitted been circumscribed to include about 50 genera with basal walls.
    [Show full text]
  • Cinchona Or the Peruvian Bark
    HISTORY PLANTS AGAINST MALARIA PART 1: CINCHONA OR THE PERUVIAN BARK M.R. Lee, Emeritus Professor of Clinical Pharmacology and Therapeutics, University of Edinburgh One of the most compelling sagas in the history of were prepared to use their knowledge of the bark to aid medicine and therapeutics is the emergence of the their struggles for power within the Church! Peruvian bark (Cinchona) and also of the pharma- cologically active substance derived from it, quinine. Its An important ecclesiastical figure, Cardinal de Lugo, now discovery involved exploration, exploitation and secrecy, emerges to take the initiative in the history of Cinchona and it came, in the nineteenth century, to reflect the (Figure 1). De Lugo was born in Madrid in 1585 but struggles of the major European powers for domination, spent his early years in Seville where he later became a territory and profit. This short history shows how the Jesuit priest.4 In 1621 he was transferred to the Collegium use of Cinchona enabled the exploration of dangerous Romanum in Rome, then the leading educational malarial areas and in this way facilitated imperial institution of the Jesuits. He taught there with distinction expansion by the Western powers. from his arrival until 1643. Initially de Lugo probably obtained the Peruvian bark from Father Tafur S.J. and, impressed by his preliminary trials of its efficacy, he THE PERUVIAN; JESUIT’S OR CARDINAL’S BARK purchased large amounts of it at his own expense. Many physicians are familiar with the story of the Countess Sturmius, a contemporary, reported that de Lugo ‘gave it of Chinchón, wife of the Viceroy of Peru; it was claimed gratis to the fevered poor, on condition only, that they by Bado that she was cured of a certain ague by did not sell it and that they presented a physician’s Cinchona bark sometime in the late 1620s or early statement about the illness’.
    [Show full text]
  • Download This PDF File
    REINWARDTIA Published by Herbarium Bogoriense - LBN, Bogor Vol. 10, Part 2, pp. 245 - 264 (1985) HASSKARL'S CINCHONA BARKS 1. HISTORICAL REVIEW C. E. RIDSDALE Rijksherbarium, Leiden, Netherlands & L. A. ANDERSON. A. T. KEENE & J. I). PHILLIPSON Department of Pharmacognosy, The School of Pharmacy, University of London, U.K. ABSTRACT The preliminary results of alkaloid analyses of Hasskaii's cinchona bark collection, made in Peru in 1852/3' is given, and the identity and historical aspects of the material discussed in respect of the role the plants played in the Javanese plantations. ABSTRAK Hasil sementara analisis alkaloid koleksi pepagan kina Hasskarl yang dibuat di Peru tahun 1852/1853 disajikan. Identitas dan segi sejarah bahan tadi dibahas dalam kaitannya dengan peranan tanaman di perkebunan di pulau Jawa. INTRODUCTION The Dutch were the first to successfully organize Cinchona planta- tions, which were situated in Java. Materials for these plantations were obtained over a number of years by the import of plants or seeds from various sources either direct, e.g. by Hasskarl, Ledger, Karstens and Schuhkraft, or later indirect through exchange of materials from former British India. The basis of the first planting stocks of Cinchona in the former Dutch East Indies was derived from the plants and seeds collected by Hasskarl on his expedition to S. America in 1852/3. In addition a limited quantity of 'C. calisaya javanica' was propagated from plants produced from cuttings of the first Cinchona plant introduced into Java, which was obtained by De Vriese (De Vriese 1885) from Messers Thibant & Keteleer in Paris, an offspring from seed collected by Weddell.
    [Show full text]
  • Pharmacognosy of Cinchona
    www.ijcrt.org © 2020 IJCRT | Volume 8, Issue 12 December 2020 | ISSN: 2320-2882 Pharmacognosy of cinchona Vishal Prajapati, Pyiush Yadav, Ajeet Kumar Kannaujiya, Ravikant Vishwkarma, Akshay Pratap Yadav Department of pharmacy, Prasad Institute of Technology, Jaunpur (UP) , India ABSTRACT The near about 350,000 species of plants are found in the earth and these plants have the great medicinal value. The plant of Cinchona is also known as Jesuit’s bark, Peruvian bark and cinchona bark which is belong from the family of Rubiaceae. It produces the yellowish to green colored in short ruptur to outer surface and which is inner surface is yellow, brown, deep reddish to brown colored, different- 2 species inner surface of color is different.The cinchona bark are the consist of 30 types of alkaloids, which belong to quinoline groupbut mainly quinidine , quinine, cinchonina and cinchonidine are the play the vital role in medicinal field . Quinine are mainly used to treatment of malaria and other alkaloids are producing the various medicinal properties such as analgesic, antipyretic, protoplasmic, cardiac arrhythmia, dyspepsia ,gastric catarrh and cardiac depressant . KEYWORDS Introduction , Biological source, Geographical source, Botanical classification, Organoleptic property, Microscopic property, Cultivation and collection, Chemical consitituents, Pharmaceutical uses INTRODUCTION The cinchona is a larger shrub or small tree is domestic or born to South America. Cinchona bark is also known as Peruvian bark or Jesuit’s bark , it is famous his medicinal
    [Show full text]
  • Alkaloids – Secrets of Life
    ALKALOIDS – SECRETS OF LIFE ALKALOID CHEMISTRY, BIOLOGICAL SIGNIFICANCE, APPLICATIONS AND ECOLOGICAL ROLE This page intentionally left blank ALKALOIDS – SECRETS OF LIFE ALKALOID CHEMISTRY, BIOLOGICAL SIGNIFICANCE, APPLICATIONS AND ECOLOGICAL ROLE Tadeusz Aniszewski Associate Professor in Applied Botany Senior Lecturer Research and Teaching Laboratory of Applied Botany Faculty of Biosciences University of Joensuu Joensuu Finland Amsterdam • Boston • Heidelberg • London • New York • Oxford • Paris San Diego • San Francisco • Singapore • Sydney • Tokyo Elsevier Radarweg 29, PO Box 211, 1000 AE Amsterdam, The Netherlands The Boulevard, Langford Lane, Kidlington, Oxford OX5 1GB, UK First edition 2007 Copyright © 2007 Elsevier B.V. All rights reserved No part of this publication may be reproduced, stored in a retrieval system or transmitted in any form or by any means electronic, mechanical, photocopying, recording or otherwise without the prior written permission of the publisher Permissions may be sought directly from Elsevier’s Science & Technology Rights Department in Oxford, UK: phone (+44) (0) 1865 843830; fax (+44) (0) 1865 853333; email: [email protected]. Alternatively you can submit your request online by visiting the Elsevier web site at http://elsevier.com/locate/permissions, and selecting Obtaining permission to use Elsevier material Notice No responsibility is assumed by the publisher for any injury and/or damage to persons or property as a matter of products liability, negligence or otherwise, or from any use or operation
    [Show full text]
  • Medicinal Plants of Brazil Introduction
    www.asiabiotech.com Special Feature Dr Robin Mitra1, Associate Professor Brad Mitchell2, Professor Chris Gray3, Professor John Orbell4, Dr Tony Coulepis5 and Dr Morley Somasundaram Muralitharan6 Medicinal Plants of Brazil Introduction Brazil is the largest country in Latin America covering a territory of 8,514,876.599 km² that lies between central South America and the Atlantic Ocean. Brazil is named after the plant pau-brasil (Caesalpinia echinata L.), a member of the Caesalpiniaceae family which was used in the past to obtain a dye-stuff known as “brasiline” (Goncalves De Lima et al., 1961). Due to Brazil’s varied geographical environment ranging from the Amazonian rainforests to the dry semi-arid hinterland known to the Indians as the “Caatinga” (Anon1 1978), the country is botanically rich with 40 000–60 000 vegetal species (Jorge et al., 2004). The five major biomes of Brazil include the Amazon rain forests that cloak an area larger than western Europe, Cerrado brushlands the home of the Krahô Indians, the Mata Atlântica rain forest, the Pantanal wetlands and the Caatinga semi arid desert (Giorgetti et al., 2007). With the exception of the Amazon forests, there is a huge paucity of documented studies on the medicinal plants concerning other biomes such as the Mata Atlantica, the Pantanal, (Di Stasi et al., 2002) and especially the Caatinga and the Cerrado (Almeida et al., 2006). Historians believe that it was the richness of the flora and the highly prized wood from the forests of Brazil that had played a central role in enticing the early explorers to its shore (De Mello 1980).
    [Show full text]
  • Rubiaceae: Cinchona Calisaya)
    Phylogeny predicts the quantity of antimalarial alkaloids within the iconic yellow Cinchona bark (Rubiaceae: Cinchona calisaya) Maldonado Goyzueta, Carla Brenda; Barnes, Christopher James; Cornett, Claus; Holmfred, Else Skovgaard; Hansen, Steen Honoré; Persson, Claes; Antonelli, Alexandre; Rønsted, Nina Published in: Frontiers in Plant Science DOI: 10.3389/fpls.2017.00391 Publication date: 2017 Document version Publisher's PDF, also known as Version of record Document license: CC BY Citation for published version (APA): Maldonado Goyzueta, C. B., Barnes, C. J., Cornett, C., Holmfred, E. S., Hansen, S. H., Persson, C., ... Rønsted, N. (2017). Phylogeny predicts the quantity of antimalarial alkaloids within the iconic yellow Cinchona bark (Rubiaceae: Cinchona calisaya). Frontiers in Plant Science, 8, [391]. https://doi.org/10.3389/fpls.2017.00391 Download date: 08. Apr. 2020 ORIGINAL RESEARCH published: 22 March 2017 doi: 10.3389/fpls.2017.00391 Phylogeny Predicts the Quantity of Antimalarial Alkaloids within the Iconic Yellow Cinchona Bark (Rubiaceae: Cinchona calisaya) Carla Maldonado 1, 2 †, Christopher J. Barnes 1 †, Claus Cornett 3, Else Holmfred 3, Steen H. Hansen 3, Claes Persson 4, 5, Alexandre Antonelli 4, 6 and Nina Rønsted 1* 1 Natural History Museum of Denmark, University of Copenhagen, Copenhagen, Denmark, 2 Herbario Nacional de Bolivia, Universidad Mayor de San Andres, La Paz, Bolivia, 3 Analytical Biosciences, Department of Pharmacy, Faculty of Health and Medical Sciences, University of Copenhagen, Copenhagen, Denmark, 4 Department of Biological and Environmental Sciences, University of Gothenburg, Gothenburg, Sweden, 5 Gothenburg Global Biodiversity Centre, Gothenburg, Sweden, 6 Gothenburg Botanical Garden, Gothenburg, Sweden Edited by: Danièle Werck, Centre National de la Recherche Considerable inter- and intraspecific variation with respect to the quantity and Scientifique, France composition of plant natural products exists.
    [Show full text]