Characterization of Rapid Nongenomic Cortisol Signalling in Rainbow Trout Liver

University of Calgary PRISM: University of Calgary's Digital Repository

Graduate Studies The Vault: Electronic Theses and Dissertations

2018-08-03 Characterization of Rapid Nongenomic Cortisol Signalling in Rainbow Trout Liver

Thraya, Marwa

Thraya, M. (2018). Characterization of Rapid Nongenomic Cortisol Signalling in Rainbow Trout Liver (Unpublished master's thesis). University of Calgary, Calgary, AB. doi:10.11575/PRISM/32790 http://hdl.handle.net/1880/107608 master thesis

University of Calgary graduate students retain copyright ownership and moral rights for their thesis. You may use this material in any way that is permitted by the Copyright Act or through licensing that has been assigned to the document. For uses that are not allowable under copyright legislation or licensing, you are required to seek permission. Downloaded from PRISM: https://prism.ucalgary.ca UNIVERSITY OF CALGARY

Characterization of Rapid Nongenomic Cortisol Signalling in Rainbow Trout Liver

Marwa Thraya

A THESIS

SUBMITTED TO THE FACULTY OF GRADUATE STUDIES

IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE

DEGREE OF MASTER OF SCIENCE

GRADUATE PROGRAM IN BIOLOGICAL SCIENCES

CALGARY, ALBERTA

AUGUST, 2018

Glucocorticoids are critical in the regulation of metabolic processes for stress adaptation. Cortisol, the primary glucocorticoid in fish, exerts physiological effects through genomic and nongenomic signalling pathways. The genomic response to cortisol is characterized by activation of the corticosteroid receptors, glucocorticoid receptor

(GR) and mineralocorticoid receptor (MR), whereas the nongenomic cortisol response involves rapid changes to downstream second-messenger signalling cascades independent of gene regulation. However, nongenomic glucocorticoid signalling remains poorly characterized in teleost models and even more so in the liver, despite the importance of this tissue in regulating both metabolic and physiological adjustments in the face of a stressor. Therefore, the primary objective of this thesis was to further elucidate mechanisms of rapid cortisol signalling in rainbow trout (Oncorhynchus mykiss) liver.

The hypothesis tested was that activation of secondary-signalling cascades would mediate rapid cortisol effects and glucocorticoid-membrane receptor(s) were involved in initiating this response. Indeed, stress and the attendant rise in cortisol rapidly modulated cAMP response element binding protein (CREB) phosphorylation, and reduced reactive oxygen species (ROS) generation and glutathione production in vivo. While corticosteroid receptors were identified on the plasma membrane, RU486 had no effect on CREB signalling or ROS generation in vitro, suggesting that these endpoints are GR- independent. Also, cortisol did not rapidly affect the transcript abundance of glucocorticoid-responsive genes associated with the corticosteroid receptors along with biomarkers for immune, growth, metabolic, and oxidative stress systems, suggesting a role for genomic activation in directly regulating the stress response. Furthermore, a

ii membrane-specific cortisol receptor(s) remains unidentified in any species. Altogether, the results presented here propose a role for rapid nongenomic glucocorticoid signalling in modulating the stress-mediated metabolic responses in fish liver, and this provides a novel approach in studying the role of glucocorticoids in mediating stress coping mechanisms.

iii Acknowledgements

This thesis would not have been made possible without the guidance and support of many people. First and foremost, I would like to sincerely thank my supervisor, Dr.

Mathilakath Vijayan, for allowing me to become a part of his lab and for his scientific expertise and ongoing support during my graduate studies. I am also very grateful to my committee members, Dr. Hamid Habibi and Dr. Carrie Shemanko, for their kindness and continued input/feedback while working in their laboratories and during our committee meetings. Also, a huge thank you goes out to my external examiner, Dr. Steve Wiseman, for his insight and helpful comments during my defense examination.

I would like to extend many thanks towards all past, present, and honorary

Vijayan “stressed” lab members, especially Erin Faught, Andrew Thompson, Chinmayee

Das, and Analisa Lazaro-Cote for their mentorship, patience, and for always answering my never-ending questions. Thank you to all other staff and students in the department who I had the pleasure of knowing throughout the course of my studies at the University of Calgary.

Finally, many thanks go out to my amazing parents, Ghassan and Nahda Thraya, and to my siblings who have loved, encouraged, and supported me on this life path.

iv Table of Contents

Abstract ...... ii Acknowledgements ...... iv Table of Contents ...... v List of Tables ...... vii List of Figures ...... viii List of Symbols, Abbreviations and Nomenclature ...... ix

CHAPTER ONE: GENERAL INTRODUCTION ...... 1 1.1 Introduction ...... 1 1.1.1 Teleost stress response ...... 1 1.1.2 Glucocorticoid signalling ...... 5 1.1.2.1 Genomic glucocorticoid pathway ...... 5 1.1.2.2 Nongenomic glucocorticoid pathway ...... 7 1.2 Experimental rationale and research objectives ...... 18 1.3 Acknowledgements ...... 19

CHAPTER TWO: RAPID EFFECTS OF CORTISOL ON SECONDARY- SIGNALLING PATHWAYS IN RAINBOW TROUT HEPATOCYTES ...... 20 2.1 Introduction ...... 20 2.2 Materials and Methods ...... 23 2.2.1 Experimental fish ...... 23 2.2.2 Hepatocyte primary culture and experimental treatment ...... 23 2.2.3 SDS-PAGE and immunodetection ...... 24 2.2.4 Statistical analysis ...... 25 2.3 Results ...... 26 2.3.1 Phosphorylation of PKA, PKC, and Akt substrates ...... 26 2.3.2 Phosphorylation of CREB, ERK1/2 MAPK, and mTOR target proteins ...... 26 2.3.3 Effect of RU486 and eplerenone on CREB and mTOR signalling ...... 27 2.4 Discussion ...... 34 2.5 Acknowledgements ...... 38

CHAPTER THREE: STRESS-INDUCED RAPID CORTISOL EFFECTS IN RAINBOW TROUT LIVER ...... 39 3.1 Introduction ...... 39 3.2 Materials and Methods ...... 41 3.2.1 Experimental Fish ...... 41 3.2.2 In vivo stress experiment ...... 42 3.2.3 Liver slices and experimental treatment ...... 42 3.2.4 Determination of ROS generation ...... 43 3.2.5 Determination of total GSH ...... 44 3.2.6 Hepatocyte primary culture for transcript abundance ...... 44 3.2.7 Total RNA extraction, cDNA synthesis and real-time (quantitative) PCR .....45 3.2.8 Statistical analysis ...... 46 3.3 Results ...... 50 3.3.1 ROS and total GSH generation in vivo ...... 50

v 3.3.2 ROS generation in vitro ...... 50 3.3.3 Rapid cortisol-mediated transcript abundance ...... 50 3.4 Discussion ...... 58 3.5 Acknowledgements ...... 62

CHAPTER FOUR: PUTATIVE CORTICOSTEROID RECEPTORS ON THE PLASMA MEMBRANE OF RAINBOW TROUT LIVER ...... 63 4.1 Introduction ...... 63 4.2 Materials and Methods ...... 65 4.2.1 Experimental fish ...... 65 4.2.2 Crude membrane isolation ...... 65 4.2.3 Sucrose gradients for the purification of plasma membranes ...... 66 4.2.4 Enzyme activities: LDH and 5’AMP nucleotidase ...... 67 4.2.5 Cortisol-agarose affinity chromatography ...... 67 4.2.6 SDS-PAGE, immunodetection and mass spectrometry ...... 68 4.2.7 Statistical analysis ...... 69 4.3 Results ...... 69 4.3.1 Hepatic membrane enrichment: 5’AMP nucleotidase and LDH ...... 69 4.3.2 Presence of corticosteroid receptors on hepatic membranes ...... 70 4.3.3 Novel corticosteroid receptors using cortisol-agarose affinity chromatography ...... 70 4.4 Discussion ...... 76 4.5 Acknowledgements ...... 79

CHAPTER FIVE: GENERAL CONCLUSIONS ...... 80 5.1 Summary of findings ...... 80 5.2 Future directions ...... 84

BIBLIOGRAPHY ...... 85

APPENDIX A: SUPPLEMENTARY MATERIAL TO CHAPTER THREE ...... 96 A.1. Materials and Methods ...... 96 A.1.1. Glucose measurement using liver slices in vitro ...... 96 A.1.2. Metabolomics ...... 96 A.1.3. Statistical analysis ...... 97 A.2. Results ...... 98

APPENDIX B: SUPPLEMENTARY MATERIAL TO CHAPTER FOUR ...... 100 B.1. Introduction ...... 100 B.2. Materials and Methods ...... 100 B.2.1. SDS-PAGE and immunodetection ...... 100 B.3. Results ...... 101

vi List of Tables

Table 1.1 Nongenomic cortisol signalling in fish ...... 16

Table 3.1 Gene-specific primers for select target genes ...... 47

Table 4.1 Mass spectrometry results for select hits of putative cortisol-bound proteins ...75

vii List of Figures

Fig. 1.1 Teleost stress axis ...... 4

Fig. 1.2 Proposed mechanisms of nongenomic cortisol actions in fish ...... 12

Fig. 2.1 Rapid regulation of PKA, PKC, and Akt substrate phosphorylation by cortisol ...... 28

Fig. 2.2 Rapid regulation of PKA, PKC, and Akt substrate phosphorylation by cortisol-BSA ...... 29

Fig. 2.3 Rapid regulation of CREB, ERK1/2, and mTOR phosphorylation by cortisol ... 30

Fig. 2.4 Rapid regulation of CREB, ERK1/2, and mTOR phosphorylation by cortisol- BSA ...... 31

Fig. 2.5 Rapid CREB and mTOR cortisol-mediated signalling ...... 32

Fig. 2.6 Rapid CREB and mTOR membrane-mediated signalling by cortisol-BSA ...... 33

Fig. 3.1 Stress-mediated ROS and GSH generation in vivo ...... 52

Fig. 3.2 ROS generation using liver slices in vitro ...... 53

Fig. 3.3 Rapid modulation of the expression of corticosteroid receptors by cortisol ...... 54

Fig. 3.4 Rapid modulation of the expression of immune-related genes by cortisol ...... 55

Fig. 3.5 Rapid modulation of the expression of growth-related genes by cortisol ...... 56

Fig. 3.6 Rapid modulation of the expression of CREB and NFE2L2 genes by cortisol . 57

Fig. 4.1 Enrichment of hepatic membranes ...... 71

Fig. 4.2 The presence of GR and MR are located on the plasma membrane of trout liver ...... 72

Fig. 4.3 Isolation of cortisol-bound proteins by affinity chromatography ...... 73

Fig. 4.4 Identity confirmation of cortisol-bound proteins by affinity chromatography .... 74

Fig. 5.1 Schematic diagram representing nongenomic cortisol action in teleost liver ..... 83

Fig. A.1 Glucose production is not rapidly altered by cortisol in vitro ...... 98

Fig. A.2 Cortisol does not rapidly affect whole liver metabolome ...... 99

Fig. B.1 Affinity chromatography purified cortisol proteins probed with ORAI-1 ...... 101

viii List of Symbols, Abbreviations and Nomenclature

Symbol Definition 11ß-HSD2 11 beta-hydroxysteroid dehydrogenase type 2 ACTH Adrenocorticotropic hormone AMP Adenosine monophosphate ANOVA Analysis of Variance BSA Bovine serum albumin Ca2+ Calcium ion cAMP Cyclic adenosine monophosphate CBG Corticosteroid binding globulin Cortisol-BSA Cortisol conjugated to bovine serum albumin CRAC Calcium release-activated channel CREB cAMP response element binding protein CRH Corticotropin releasing hormone DNA Deoxyribonucleic acid DOC Deoxycorticosterone EF1a Elongation factor 1 alpha ELISA Enzyme-linked immunosorbent assay ERK1/2 Extracellular signal-regulator protein kinase 1/2 GH Growth hormone GPCR G-protein coupled receptor GR Glucocorticoid receptor GRE Glucocorticoid response element GSH Glutathione HPA Hypothalamus-pituitary-adrenal HPI Hypothalamus-pituitary-interrenal HRP Horseradish peroxidase HSP70, 90 Heat shock protein 70, 90 IGF-1 Insulin-like growth factor 1 IκBα Inhibitor of NF-κB alpha Il-6 Interleukin 6 K+ Potassium ion Kd Dissociation equilibrium constant kDa Kilo Daltons LDH Lactate dehydrogenase Lck Lymphocyte-specific protein tyrosine kinase MAPK Mitogen-activated protein kinase MC2R Melanocortin 2 receptor mPRα Membrane progesterone receptor alpha MR Mineralocorticoid receptor mRNA Messenger ribonucleic acid mTOR Mammalian target of rapamycin Na+ Sodium ion NADPH Nicotinamide adenine dinucleotide phosphate

ix NF-κB Nuclear factor-kappa B NFE2L2 Nuclear factor (erythroid-derived 2)-like 2 ORAI-1 Ca2+ release-activated Ca2+ CRAC channel subunit p53 Tumor protein 53 PAGE Polyacrylamide gel electrophoresis PCA Principal component analysis PCR Polymerase chain reaction PEPCK Phosphoenolpyruvate carboxykinase pgc1α Peroxisome proliferator-activated receptor gamma coactivator 1 alpha PKA Protein kinase A PKB/Akt Protein kinase B PKC Protein kinase C POMC Proopiomelanocortin ROS Reactive oxygen species RU28318 MR antagonist RU486 Mifepristone; GR antagonist SDS Sodium dodecyl sulfate SEM Standard error of mean SOCS1-3 Suppressors of cytokine signalling 1, 2, and 3 StAR Steroidogenic acute regulatory protein STAT5 Signal transducer and regulator of transcription 5 TGF-ß Transforming growth factor-beta TNF Tumour necrosis factor

Chapter One: General Introduction

1.1 Introduction

1.1.1 Teleost stress response

Organisms exhibit a range of biochemical, molecular, physiological, and behavioural adaptations in response to real or perceived stressors (Mommsen et al., 1999;

Sapolsky et al., 2000). In all cases, the stress axis becomes critical in coping with stressors that pose a threat to homeostasis, a state of dynamic equilibrium (Mommsen et al., 1999; Wendelaar Bonga, 1997). Dysregulation of the stress axis may result in harmful effects associated with reproduction, immunity, metabolism, growth, and performance- related functions (Barton, 2002; Mommsen et al., 1999; Romero et al., 2009). The catecholamines and corticosteroid stress hormones are key mediators in the maintenance or restoration of physiological parameters necessary for regulating homeostasis

(Mommsen et al., 1999; Wendelaar Bonga, 1997).

The physiological stress response is highly conserved among vertebrates

(Mommsen et al., 1999; Sapolsky et al., 2000) and is divided into three main categories: primary, secondary, and tertiary responses (Fig. 1.1). The primary physiological response to stress involves both sympathetic activation and neuroendocrine release of hormones beginning in the brain (Mommsen et al., 1999; Wendelaar Bonga, 1997). The central nervous system initiates the fight-or-flight response and stimulates sympathetic nerve fibres to release the catecholamines, epinephrine and norepinephrine, from chromaffin cells in the head kidney surrounding the walls of the posterior cardinal vein (Mommsen et

al., 1999; Reid et al., 1992). Simultaneously, the hypothalamus-pituitary-interrenal (HPI) axis (analogous to the hypothalamus-pituitary-adrenal (HPA) axis found in mammals) is activated to coordinate the synthesis and release of cortisol, the primary corticosteroid in teleost blood circulation (Mommsen et al., 1999; Wendelaar Bonga, 1997; Fig. 1.1).

Briefly, the secretion of cortisol is initiated by the release of corticotropin-releasing hormone (CRH) in the hypothalamus to stimulate the production and secretion of the precursor, proopiomelanocortin (POMC), which is then cleaved to form adrenocorticotropic hormone (ACTH) from the anterior pituitary gland (Metz et al.,

2006; Mommsen et al., 1999; Wendelaar Bonga, 1997). Once in blood circulation, ACTH binds to melanocortin 2 receptors (MC2R) on interrenal (steroidogenic) cells in the head kidney (Wendelaar Bonga, 1997). This subsequently signals steroidogenic acute regulatory protein (StAR) to shuttle cholesterol from the outer to the inner mitochondrial membrane, the rate-limiting step for the biosynthesis of cortisol (Mommsen et al., 1999;

Stocco, 2000). A negative feedback mechanism controls the synthesis and release of cortisol at all levels of the HPI axis (Barton, 2002; Wendelaar Bonga, 1997).

Corticosteroid-binding globulins (CBG) are known to control the availability of free cortisol in the blood, but a CBG has not been found in fish (Mommsen et al., 1999).

Unlike the rapid secretion of catecholamines (seconds), cortisol synthesis produces a longer lag-time (minutes to hours) and therefore, is often used as a biomarker for stress measurements (Barton, 2002; Wendelaar Bonga, 1997). The release of stress hormones regulates the secondary response to stress which involves adjustments made to physiological parameters associated with the hydromineral balance, metabolism and energy repartitioning, and the cardiovascular, respiratory, and immune systems (Barton,

2002; Mommsen et al., 1999; Fig. 1.1). This, in turn, affects the tertiary response for stress adaptation which results in changes to the behaviour, performance, growth, and survival conditions at the whole-organism level (Barton, 2002; Olla et al., 1995).

Fig. 1.1 Teleost stress axis The primary response to stress involves the rapid release of catecholamines (epinephrine and norepinephrine) and the slower release of glucocorticoids (cortisol) via the HPI axis. The stress hormones regulate the secondary response, which mediates physiological adjustments such immune function, metabolism, and energy substrate mobilization for coping with a stressor. This ultimately affects behaviour and performance at the level of the whole organism (tertiary response). Abbreviations: CRH – corticotropic releasing hormone; ACTH – adrenocorticotropic hormone; HPI – hypothalamus-pituitary- interrenal.

1.1.2 Glucocorticoid signalling

Cortisol and related steroid hormones primarily exert wide-spread cellular effects on target tissues through the genomic pathway, which generally elicits delayed physiological effects (Borski, 2000; Mommsen et al., 1999). This signalling route involves activation of the intracellular corticosteroid receptors that regulate mRNA transcription and de novo protein synthesis (Bury et al., 2003; Faught and Vijayan, 2016;

Mommsen et al., 1999; Prunet et al., 2006; Stolte et al., 2006). Interestingly, growing evidence in more recent years has pointed towards rapid steroidal effects elicited by nongenomic mechanisms that occur independently of gene regulation (Borski, 2000;

Borski et al., 2002). The sections that follow provide a brief overview of the current literature surrounding glucocorticoid signalling with an emphasis on rapid nongenomic effects and their proposed mechanisms in teleost fishes. It is important to note that studies delineating the rapid actions of cortisol have mostly been conducted in mammalian species while very limited studies have been reported in teleost models (Table 1.1).

1.1.2.1 Genomic glucocorticoid pathway

The effects of cortisol elicited through the genomic pathway are mediated by activation of the glucocorticoid receptor (GR) and mineralocorticoid receptor (MR), which are ligand-activated transcription factors of the nuclear receptor superfamily

(Borski, 2000; Mommsen et al., 1999). Cortisol passively diffuses across the plasma membrane and binds to GR, the main mediator of genomic signalling, as part of a multiprotein complex containing heat shock proteins (HSP70 and 90) and immunophilins

(Bury et al., 2003; Faught and Vijayan, 2016; Nicolaides et al., 2010). Upon binding, GR

homodimerizes and the ligand-receptor complex translocates to the nucleus where it binds directly to glucocorticoid-response elements (GRE) in the promoter of target genes

(Mommsen et al., 1999) or indirectly through protein-protein interactions with other transcription factors, including nuclear factor-kappa B (NF-κB; De Bosscher et al., 2003).

Steroidal responses elicited through this pathway are delayed with effects manifesting within minutes to hours of cortisol release (Borski, 2000; Bury et al., 2003; Losel et al.,

2003; Mommsen et al., 1999).

Teleost GR and MR have been cloned, sequenced, and extensively reviewed

(Bury and Sturm, 2007; Mommsen et al., 1999; Prunet et al., 2006; Stolte et al., 2006;

Sturm et al., 2011). Most fish possess two isoforms of GR (GR1 and GR2; Bury et al.,

2003; Ducouret et al., 1995) apart from zebrafish (Danio rerio), which consists of a single GR with the splice variant GRß, recently discovered (Alsop and Vijayan, 2009;

Schaaf et al., 2008). Phylogenetic analyses suggest the presence of multiple GR isoforms arose from the whole-genome duplication event ~350 million years ago (Alsop and

Vijayan, 2009). GR2 is more sensitive to low levels of cortisol due to a high binding affinity, whereas GR1 is predominantly activated when high levels of cortisol are present

(Bury et al., 2003; Bury and Sturm, 2007).

Like mammals, fish also express a single MR even though the mineralocorticoid, aldosterone, is absent in these organisms (Sturm et al., 2005). While cortisol displays a high affinity for MR, the conversion of cortisol to inactive cortisone by 11ß- hydroxysteroid dehydrogenase type 2 (11ß-HSD2) in MR-specific tissues, allows for other ligands, in addition to cortisol, to activate MR-mediated signalling (Alderman and

Vijayan, 2012; Prunet et al., 2006). Although 11-deoxycorticosterone (DOC) has been

postulated as a possible ligand for MR (Sturm et al., 2005), a role for this receptor in mediating cortisol actions remains poorly understood in fish (Colombe et al., 2000;

Prunet et al., 2006; Takahashi and Sakamoto, 2013). In fish, mRNA expression of the corticosteroid receptors is detected in almost all tissue types (Alderman et al., 2012;

Takahashi and Sakamoto, 2013).

Most studies dedicated towards glucocorticoid signalling in fish have focused on the genomic (GR) signalling pathway. The genomic (transcriptional) actions of cortisol mediate several physiological processes including intermediary metabolism and energy substrate repartitioning, growth and development, osmoregulation, immunity, and neuronal function for stress adaptation (Aluru and Vijayan, 2009; Borski, 2000; Faught and Vijayan, 2016; Mommsen et al., 1999; Nesan et al., 2012). For example, cortisol enhances the liver’s metabolic capacity by activating genes in the gluconeogenesis pathway, including the rate-limiting enzyme phosphoenolpyruvate carboxykinase

(PEPCK; Aluru and Vijayan, 2009; Mommsen et al., 1999). In the brain, cortisol decreases CRH mRNA expression (Doyon et al., 2006) and reduces StaR mRNA levels in steroidogenic tissue (Alderman et al., 2012) during negative feedback of the stress response. In addition, stress-induced levels of cortisol have produced immunosuppressive effects in fish immune cells (Philip and Vijayan, 2015; Tort, 2011), including reduced expression of interleukin-6 (IL-6), transforming growth factor beta (TGF-ß), and tumour necrosis factor (TNF) cytokines in macrophages (Castillo et al., 2009).

1.1.2.2 Nongenomic glucocorticoid pathway

Nongenomic steroid effects have been demonstrated for all classes of steroids

(Lösel and Wehling, 2003; Thomas, 2012). The nongenomic steroidal pathway is

mediated by activation of membrane receptors and downstream second-messenger signalling cascades including cyclic adenosine monophosphate (cAMP), intracellular

Ca2+, and protein kinases (Borski, 2000; Borski et al., 2002; Lösel and Wehling, 2003).

While the genomic pathway involves steroid-mediated activation of gene regulation, the nongenomic pathway occurs independently of GR-mediated transcription and translation, which is a time-consuming process (Borski, 2000; Lösel and Wehling, 2003).

Nongenomic effects are rather rapid, occurring within seconds to a few minutes of hormone release and are insensitive to transcriptional and translational inhibitors such as actinomycin-D and cycloheximide, respectively (Borski, 2000; Groeneweg et al., 2011;

Losel et al., 2003). Impermeable steroid (cortisol) analogues coupled to large proteins such as bovine serum albumin (BSA) are often used as a tool to confirm nongenomic steroid signalling at the membrane and further differentiate the effects associated with each signalling pathway (Lösel and Wehling, 2003).

1.1.2.2.1 Mechanisms of rapid cortisol action

Based on studies conducted in mammals, the nongenomic actions of glucocorticoids are remarkably diverse as well as tissue and species-specific. However, the mechanisms by which nongenomic glucocorticoid actions are taking place are not well characterized, particularly in teleost models. Currently, there are three working hypotheses on the mode of action of cortisol in mediating rapid effects in fish (Fig. 1.2).

The first hypothesis involves the intercalation of glucocorticoids into the lipid bilayer mediating changes to the biophysical properties of the plasma membrane and leading to the activation of downstream intracellular signalling pathways (Dindia et al., 2012; Vigh et al., 2007; Whiting et al., 2000). Based on early studies that have examined fluidizing

and membrane ordering effects in mammals (Gerritsen et al., 1991; Ghosh et al., 1996), our laboratory was the first to show altered membrane fluidity and anisotropy due to elevated cortisol treatment in rainbow trout (Oncorhynchus mykiss) liver (Dindia et al.,

2013, 2012), suggesting that changes to membrane biophysical properties can lead to mechanotransduction-related activation of downstream signalling pathways (Vigh et al.,

2007). However, the mechanisms by which changes to the biophysical properties of the membrane by cortisol are transduced into rapid cellular effects remains to be elucidated.

The second working hypothesis involves the activation of membrane-mediated

(novel) receptor(s) on the plasma membrane that is independent of GR and MR, initiating downstream signalling cascades as shown in mammals for the mineralocorticoid, aldosterone (Borski, 2000; Lösel et al., 2002; Lösel and Wehling, 2003). It has been hypothesized that these novel membrane receptors may belong to the G-protein coupled receptor (GPCR) family similar to the nongenomic signalling of sex steroids in fishes

(reviewed in Thomas et al., 2006). This is supported by the rapid activation of second messengers, including cAMP and Ca2+ (Borski et al., 1991; Espinoza et al., 2017; Hyde et al., 2004; Vijayan et al., 2017), as well as rapid phosphorylation of substrate proteins of the protein kinase A (PKA), B (PKB/Akt), and C (PKC) pathways using membrane- impermeable cortisol in rainbow trout hepatocytes (Dindia et al., 2013, 2012). Although studies have proposed a putative membrane-bound receptor mediating rapid activation of signalling pathways in response to glucocorticoid stimulation, to date, there has not been a putative membrane receptor for cortisol sequenced and cloned in any model organism

(Faught and Vijayan, 2016; Tasker et al., 2006). Only a single study had performed a partial purification of a membrane-GR from the brain of the rough-skinned newt, Taricha

granulosa (Evans et al., 2000). Cortisol-Sepharose affinity resin identified the peptide as a 63 kDa glycoprotein, making this distinct from the classical GR, and binds to cortisol with high affinity (Evans et al., 2000).

Furthermore, membrane binding sites for glucocorticoids have been reported in various mammalian tissues including mouse lymphocytes (Gametchu, 1987), chicken liver (Trueba et al., 1987), rodent liver and pituitary (Koch et al., 1977; Quelle et al.,

1988), and amphibian brain (Orchinik et al., 1991). In fish, cortisol binding sites have been reported in the liver (high affinity; Kd = 9.5 nM) and kidney (low affinity; Kd =

30.08 nM) of the Mozambique tilapia, Oreochromis mossambicus (Johnstone et al.,

2013) and presented distinct binding moieties from the intracellular GR (Bury et al.,

2003; Johnstone et al., 2013).

The third working hypothesis involves activation of the classical intracellular receptors (GR and MR) or translocation of these receptors to the plasma membrane modulating rapid activation of secondary-messengers (Groeneweg et al., 2011; Lösel and

Wehling, 2003; Löwenberg et al., 2007). Support for cortisol signalling by GR in fish was seen from studies that showed rapid abolishment of glucocorticoid-mediated effects by RU486 (Mifepristone), a GR antagonist (Espinoza et al., 2017; Roy and Rai, 2009).

More recently, results from our laboratory suggested the presence of both GR and MR on the plasma membrane of rainbow trout liver by immunodetection using western blotting with antibodies to trout and zebrafish, respectively (Chapter Four). It is currently unknown what the mechanism of action of these receptors are in activating rapid nongenomic signalling in this tissue. Future studies are still warranted to further our

understanding of the role of nongenomic cortisol signalling in mediating an integrated response for acute stress adaptation.

Fig. 1.2 Proposed mechanisms of nongenomic cortisol actions in fish There are three proposed models for which cortisol elicits rapid signalling in fish: 1. Biophysical changes to the lipid bilayer; 2. Activation of novel membrane cortisol receptors; 3. Activation of the intracellular receptors (GR and MR) or translocation of these receptors to the plasma membrane. Once activated, glucocorticoid actions may be mediated by several second-messengers such as various protein kinases, intracellular Ca2+, and cAMP initiating downstream signalling pathways that are highly integrated. Abbreviations: GR – glucocorticoid receptor; MR – mineralocorticoid receptor; cAMP – cyclic adenosine monophosphate.

1.1.2.2.2 Physiological actions of cortisol

1.1.2.2.2.1 Salinity acclimation

The physiological relevance of nongenomic actions began with the investigation of the rapid control of the HPA axis in mammals (Abou-Samra et al., 1986). However, evidence of nongenomic cortisol action in teleost systems has not been overly explored.

One of the first studies that explored rapid cortisol action in teleosts was in the pituitary of the Mozambique tilapia, which showed cortisol inhibited prolactin release by suppressing cAMP and Ca2+ signalling pathways within 20 min in vitro (Borski et al.,

2001, 1991; Hyde et al., 2004). The translational inhibitor, cycloheximide, did not abolish this inhibiting effect, suggesting an effect independent of protein synthesis and, therefore, not involving GR signalling (Borski et al., 2002). This led to the proposal that a membrane-associated receptor may be involved, as the effect was also mimicked by the membrane-impermeable form of cortisol-21 hemisuccinate coupled to BSA (Borski et al.,

2001). In gill tissue, Na+/K+ and Ca2+ATPase activities were rapidly activated in response to elevated cortisol and corticosterone treatments both in vivo and in vitro, and these effects were insensitive to the transcriptional inhibitor, actinomycin-D (Sunny and

Oommen, 2001). In addition, cortisol rapidly induced mitogen-activated protein kinase

(MAPK) activity through modulation of extracellular signal-regulated kinase 1/2

(ERK1/2) in the gills of this same species (Kiilerich et al., 2011), further suggesting a key nongenomic role of cortisol in salinity acclimation and modulation of ion transporters in euryhaline species moving from hyperosmotic to hypoosmotic environments or vice versa. However, the mechanisms remain unknown.

1.1.2.2.2.2 Metabolic stress response

Considering that the liver is one of the largest targets for cortisol action

(Mommsen et al., 1999), there have been very few reports of rapid cortisol effects in this tissue (Table 1.1). In the Mozambique tilapia, cortisol decreases the activities of liver malic enzyme, glucose-6-phosphate dehydrogenase, and isocitrate dehydrogenase within

5-10 min with effects persistent in the presence of actinomycin-D (Sunny et al., 2002), but the mechanisms by which these actions are taking place remain to be elucidated. A more recent study showed that cortisol increased membrane fluidity and changed the topography within 10 min of hormone treatment in rainbow trout membranes (Dindia et al., 2012). This effect corresponded to a rapid phosphorylation of substrate proteins by

PKA, PKC, and Akt in hepatocytes with similar results obtained using benzyl alcohol, a known membrane fluidizer (Dindia et al., 2012). In a subsequent in vivo experiment, acute stress altered hepatic membrane anisotropy within 30 min (Dindia et al., 2013).

This response was blocked by metyrapone, an inhibitor of cortisol synthesis (Dindia et al., 2013). Cortisol elevation rapidly increased the phosphorylation status of ERK1/2 as well as PKA and PKC substrate proteins (Dindia et al., 2013), similar to that observed in cortisol-treated hepatocytes in vitro (Dindia et al., 2012). These results suggest that cortisol action may also occur independently of membrane receptor activation by rapidly altering membrane fluidity, and stimulating mechanotransduction pathways. Finally, these results suggest that the rapid action of cortisol may involve liver energy substrate repartitioning to cope with the enhanced energy demands associated with acute stressor exposure (Dindia et al., 2013).

1.1.2.2.2.3 Muscle, cardiovascular, and innate immune systems

Until recently, nongenomic glucocorticoid signalling in teleost skeletal muscle, cardiovascular, and immune systems have been scarce in the literature (Table 1.1).

Myotubules isolated from rainbow trout showed cortisol rapidly induced reactive oxygen species (ROS) mediated by the activities of NADPH oxidase and phospholipase A2

(Espinoza et al., 2017). The effects were inhibited by the GR antagonist, RU486, but not by the MR antagonist, RU28318 (Espinoza et al., 2017). Rapid activation of kinase pathways upon exposure to cortisol-BSA was evident through phosphorylation of

ERK1/2 MAPK and cAMP response element binding protein (CREB; Espinoza et al.,

2017). With regards to the cardiovascular system, a single study reported that cortisol- induced stimulation increased coronary vasoconstriction in rainbow trout within 15 min

(Agnisola et al., 2004), suggesting that cortisol-induced vasoconstriction may negatively affect blood circulation under stressed conditions. In addition, suppression of phagocytic activity within 15 min and a more profound inhibition at 1 h in the spleen of the spotted murrel (Channa punctatus) was observed in response to cortisol treatment (Roy and Rai,

2009). Inhibitors of GR (RU486), adenylate cyclase, and PKA completely abolished cortisol-mediated phagocytosis suggesting the involvement of a membrane-bound GR, as well as the cAMP-PKA pathway in mediating these rapid responses (Roy and Rai, 2009).

Table 1.1 Nongenomic cortisol signalling in fish Abbreviations: cAMP – cyclic adenosine monophosphate; PKA – protein kinase A; PKB – protein kinase B; PKC – protein kinase C; ROS – reactive oxygen species; ERK1/2 – extracellular signal-regulated protein kinase 1/2; CREB – cAMP response element binding protein; pgc1a – peroxisome proliferator-activated receptor gamma coactivator 1 alpha.

Treatment Species Tissue Key Findings Reference

Cortisol Oreochromis Pituitary Suppression of prolactin release by Ca2+ and (Borski et al., 2002, 1991; mossambicus cAMP inhibition Hyde et al., 2004)

Gill Increased Na+/K+ ATPase and Ca2+ ATPase (Kiilerich et al., 2011; Sunny activity; increased ERK1/2 phosphorylation and Oommen, 2001)

Liver Decreased glucose-6-phosphate dehydrogenase, (Sunny et al., 2002) malic enzyme and isocitrate dehydrogenase activities

Liver and Putative glucocorticoid membrane binding sites (Johnstone et al., 2013) kidney

Oncorhynchus Heart Increased coronary vasoconstriction (Agnisola et al., 2004) mykiss Liver Increased plasma membrane fluidity; increased (Dindia et al., 2013, 2012) phosphorylation of PKA, PKB, PKC substrates

Skeletal Increased ROS; increased ERK1/2 and CREB (Espinoza et al., 2017) myotubules phosphorylation; increased pgc1a expression

Channa Macrophages Reduced phagocytosis by adenylate cyclase- (Roy and Rai, 2009) punctatus cAMP pathway

1.2 Experimental rationale and research objectives

A role for nongenomic glucocorticoid signalling in modulating the stress response and their implications on stress coping mechanisms for re-establishing homeostasis is far from clear (Tasker and Herman, 2011). Research surrounding nongenomic cortisol action and the mechanisms that mediate this rapid response is greatly lacking in teleost models, and even more so in the peripheral (hepatic) system. Interestingly, there is also nothing known about a plasma membrane receptor(s) specific to cortisol in any model organism

(Borski, 2000). Therefore, this thesis was intended to further characterize the rapid effects of cortisol and elucidate signalling mechanisms for nongenomic cortisol actions for stress adaptation. Rainbow trout (Oncorhynchus mykiss) liver is a well-known model for metabolic studies and was used to highlight the physiological relevance of rapid cortisol signalling in stress adaptation and homeostasis (Faught and Vijayan, 2016;

Mommsen et al., 1999). The over-riding hypothesis was that the nongenomic actions of cortisol in liver involve rapid activation of secondary-signalling cascades with effects mediated by membrane glucocorticoid receptor(s). The specific objectives of this thesis were to:

I. Investigate the rapid effects of cortisol on secondary-signalling pathways

independent of GR and MR in rainbow trout hepatocytes (Chapter Two).

II. Examine rapid cellular and molecular responses to stress in trout liver in vivo and in

vitro (Chapter Three).

III. Isolate and identify corticosteroid receptors on the plasma membrane as a

mechanism for nongenomic activation in trout liver (Chapter Four).

1.3 Acknowledgements

A section of this chapter was published in the mini-review:

Das, C., Thraya, M., Vijayan, M.M., 2018. Nongenomic cortisol signalling in fish. Gen. Comp. Endocrinol, 1-7.

All authors contributed equally to the writing of the above mini-review. Marwa

Thraya is the writer for the above section in this chapter.

Chapter Two: Rapid effects of cortisol on secondary-signalling pathways in rainbow trout hepatocytes

2.1 Introduction

Glucocorticoids are a class of steroid hormones that regulate a variety of physiological functions following exposure to a stressor (Aluru and Vijayan, 2007;

Mommsen et al., 1999). The primary role of cortisol, the predominant glucocorticoid in teleost fish, is to increase energy availability in order for the organism to cope with a stressor and restore homeostasis (Faught and Vijayan, 2016; Mommsen et al., 1999).

Cortisol primarily exerts physiological effects by binding to the intracellular corticosteroid receptors, glucocorticoid receptor (GR) and mineralocorticoid receptor

(MR; Mommsen et al., 1999). Cortisol interaction with the corticosteroid receptors, which are ligand-induced transcription factors, activates the homo-dimerization and translocation of the ligand-receptor complex to the nucleus (Mommsen et al., 1999). In the nucleus, GR binds to glucocorticoid response elements (GRE) to positively or negatively regulate the transcription of target genes (Bury et al., 2003; Bury and Sturm,

2007; Mommsen et al., 1999). However, growing evidence in more recent years has pointed towards nongenomic activation that is rapid (seconds to minutes) and occurs independently of GR-regulated mRNA transcription and de novo protein synthesis

(Borski, 2000). Nongenomic glucocorticoid actions are thought to involve modulation of downstream second-messenger signalling cascades and effector proteins (Borski, 2000;

Lösel and Wehling, 2003). In fish, these cascades can be initiated by biophysical

alterations to the plasma membrane (Dindia et al., 2012), novel membrane receptor(s) activation (Dindia et al., 2013; Dindia, 2013), and/or activation of membrane-associated corticosteroid receptors (Espinoza et al., 2017; Roy and Rai, 2009). Although the mechanisms of rapid glucocorticoid signalling have gained considerable interest over the years, a putative membrane receptor remains elusive in any model organism (Faught and

Vijayan, 2016). Overall, there is a dearth of information in lower vertebrates with the majority of reported studies conducted in mammals (reviewed in Das et al., 2018).

The liver is a prime target for cortisol action as this organ is a key player in the metabolic response to stress (Mommsen et al., 1999). For example, following stress and the attendant rise in cortisol, genomic signalling via GR enhances energy availability by activating gluconeogenic genes such as phosphoenolpyruvate carboxykinase (PEPCK;

Aluru and Vijayan, 2009). Indeed, early work conducted in rat hepatocytes showed glucocorticoid-induced rapid activation of glycogen phosphorylase after 10 min of dexamethasone treatment and this was mediated by Ca2+ signalling (Gomez-Muñoz et al.,

1989). In fish, studies of rapid cortisol actions have shown that cortisol rapidly decreases the activities of liver malic enzyme, glucose-6-phosphate dehydrogenase, and isocitrate dehydrogenase in the Mozambique tilapia (Oreochromis mossambicus) within 15 min of cortisol exposure (Sunny et al., 2002). While the rapid modulation of energy enzymes may provide some insight into the role of rapid glucocorticoid action, the mechanisms remain unknown. One possible mechanism may be through activation of secondary- signalling cascades, which has been reported in rainbow trout (Oncorhynchus mykiss) hepatocytes (Dindia et al., 2012). Cortisol treatment rapidly increased plasma membrane fluidity and altered membrane topography within 10 min post-cortisol treatment (Dindia

et al., 2012). This effect directly corresponded to rapid phosphorylation of protein kinase

A (PKA), B (PKB or Akt), and C (PKC) substrates in hepatocytes with a similar response exhibited using benzyl alcohol, a known membrane fluidizer (Dindia et al., 2012).

Besides these studies, reports of the physiological effects of rapid cortisol signalling and its implications on cellular signalling pathways in fish liver are non-existent.

In this study, we tested the hypothesis that the rapid effects of cortisol on downstream secondary pathways occur independently of genomic signalling receptors.

Rainbow trout hepatocytes were used as a model of study due to its crucial role in regulating liver metabolism in response to stress (reviewed in Faught and Vijayan, 2016).

In order to determine the role of the corticosteroid receptors on the rapid cortisol response and to eliminate genomic signalling, both GR (RU486/Mifepristone) and MR

(eplerenone) antagonists were used because of their effectiveness at blocking GR and

MR-mediated actions previously (Kelly and Chasiotis, 2011; Vijayan et al., 2003). The phosphorylation status of PKA, PKC, and Akt substrate proteins commonly implicated in nongenomic steroidal pathways (Dindia et al., 2013, 2012) was used to assess rapid signalling activation. Specific downstream effectors were also examined as confirmation in the modulation of these secondary-signalling cascades during stress: cAMP response element binding protein (CREB), extracellular regulated kinase 1/2 (ERK1/2) MAPK, and mammalian target of rapamycin (mTOR). Membrane-impermeable cortisol conjugated to bovine serum albumin (cortisol-BSA) was used to assess whether signalling alterations were a result of membrane-receptor activation.

2.2 Materials and Methods

2.2.1 Experimental fish

Rainbow trout (100 - 200 g) purchased from Allison Creek Hatchery (Crowsnest

Pass, AB, CAN) were kept at the University of Calgary’s aquatic facility at the Life and

Environmental Sciences Animal Resources Centre. The tanks were exposed to a 12-h light:12-h darkness photoperiod and were provided with a continuous supply of aerated water (11 ± 2°C). Fish were fed commercial trout food (Martin Mill, CAN) to satiety once a day. Trout were acclimated for at least two weeks prior to the start of experimentation. All protocols pertaining to the following experiments adhered to the guidelines set out by the Canadian Council on Animal Care and were approved by the

University of Calgary’s Animal Care Committee.

2.2.2 Hepatocyte primary culture and experimental treatment

All chemicals were purchased from Sigma Aldrich (MO, USA) unless specified otherwise. Rainbow trout were terminally anaesthetized in 0.1% (vol/vol) 2- phenoxyethanol and euthanized by severing the spinal cord. High yields of liver hepatocytes were isolated by an in-situ perfusion technique with collagenase (Type II;

Gibco, Thermo Fisher, USA) as described previously (Vijayan et al., 2003). The cells were suspended in Leibovitz’s (L-15) media (Gibco, Thermo Fisher, USA) and plated onto six-well tissue culture plates (Sarstedt, Inc., USA) at a density of 1.5 million cells/well (0.75 million cells/mL). Cell viability was determined using the trypan blue exclusion method with a survival range > 95% for all experiments. The cells were maintained overnight at 11°C and the media replaced 2 h prior to the start of experiments

24 h after plating. Hepatocytes were incubated alone with either control (ethanol) media, 23

hydrocortisone (cortisol; 100 ng/mL), cortisol-BSA (membrane impermeable; 100 ng/mL), RU486 (1000 ng/mL), eplerenone (1000 ng/mL) or in medium containing a combination of hormone and antagonist. RU486 is also a known progesterone receptor antagonist (Vijayan et al., 1994; Vijayan and Leatherland, 1992). However, hepatocytes cultured in vitro lack progesterone, and, therefore, any effects observed can be attributed to RU486 binding to GR. The cortisol concentration used was indicative of physiologically stressed levels in fish (Dindia et al., 2012; Wendelaar Bonga, 1997), while the concentration of RU486 was shown to inhibit GR-mediated effects previously

(Aluru and Vijayan, 2007; Vijayan et al., 2003). Similarly, eplerenone was used at a concentration 10-fold higher than cortisol or cortisol-BSA (Kelly and Chasiotis, 2011).

Antagonists were added 30 min prior to the addition of the hormone (Dindia, 2013). Cells were sampled at 10 min post-hormone treatment with the addition of 100 µL lysis buffer

(50 mM TRIS, 0.25 M sucrose, 1% SDS, 10 mM NaF, 5 mM EDTA, 5 mM NEM, 0.1%

Nonidet-P40). Samples were heated at 98°C for 5 min followed by brief sonication (sonic dismembrator; Fisher Scientific, CAN). Cells were then centrifuged for two min at

10,000xg (Thermo Scientific, USA) and the supernatant collected. This was repeated with hepatocytes sampled from six independent fish.

2.2.3 SDS-PAGE and immunodetection

Protein concentration was determined using the bicinchoninic acid (BCA) protocol (Smith et al., 1985) with standards derived from BSA. Samples were diluted in

Laemmli’s buffer (0.06 M TRIS-HCl (pH 6.8), 20% (v/v) glycerol, 0.02% (w/v) SDS,

0.025% (w/v) bromophenol blue, 5% ß-mercaptoethanol) with 40 µg protein separated on

8% SDS-PAGE gels (1.5 mm thick) and transferred onto a 0.45-µm-nitrocellulose membrane (Bio-Rad, CAN). At room temperature, the membranes were blocked for 1 h in 5% skim milk following an overnight incubation at 4°C with the appropriate primary

(rabbit) phospho-specific or total antibody prepared in 5% BSA and 0.05% NaN3. All antibodies were purchased from Cell Signalling (MA, USA): phospho-PKA (RRXS/T) substrate (#9624; 1:1000 dilution), phospho-PKC (Ser) substrate (#2261; 1:1000 dilution), phospho-Akt (RXXS/T) substrate (#9614; 1:1000 dilution), phospho-specific

ERK1/2 MAPK (#9101; 1:1000 dilution), total ERK1/2 MAPK (#9102; 1:500 dilution), phospho-specific CREB (#9198; 1:1000 dilution), total CREB (#4820; 1:1000 dilution), and phospho-specific mTOR (#5536; 1:1000 dilution). Membranes were incubated with anti-rabbit horseradish peroxidase (HRP)-labeled secondary antibody (1:3300 dilution in

5% skim milk) for 1 h. Protein bands were detected with ECL chemiluminescence (Bio-

Rad, CAN) according to the manufacturer’s instructions and imaged using the Syngene

G-Box Imager (GeneSys software, MD, USA). β-actin (rabbit Cy3-conjugated monoclonal antibody; Sigma #C5838; 1:1000 dilution) was used to confirm equal loading of each sample (probed on the same membrane). Densitometric values were quantified using the ImageJ software (NIH, USA). Based on antibody detection and availability, the densitometry ratio of phosphorylated to total was used to determine the level of activation for CREB and ERK1/2 MAPK proteins only.

2.2.4 Statistical analysis

All statistical analyses were conducted using PRISM (GraphPad Software, Inc.,

USA). A paired Student’s t-test was used to test for significance between the control and

cortisol or cortisol-BSA-treated groups for activation of substrates and specific downstream proteins. Hepatocytes treated with the antagonists utilized a repeated- measures one-way analysis of variance (ANOVA), which have met the assumptions of normality and equal variance. Statistics were performed on raw data and all results were expressed as percentage of control (mean ± SEM). A probability of p < 0.05 was used to test for significance between treatments.

2.3 Results

2.3.1 Phosphorylation of PKA, PKC, and Akt substrates

Cortisol did not significantly alter the phosphorylation status of PKA (p = 0.859;

Fig. 2.1A), PKC (p = 0.287; Fig. 2.1B), and Akt (p = 0.896; Fig. 2.1C) substrate proteins within 10 min post-cortisol treatment. Similarly, cortisol-BSA did not significantly alter the phosphorylation of PKA (p = 0.683; Fig. 2.2A), PKC (p = 0.811; Fig. 2.2B), and Akt

(p = 0.566; Fig. 2.2C) putative substrate proteins at the same time point.

2.3.2 Phosphorylation of CREB, ERK1/2 MAPK, and mTOR target proteins

Cortisol significantly and rapidly increased CREB phosphorylation (p = 0.042;

Fig. 2.3A) at 10 min after cortisol treatment. However, there was no statistical difference in the phosphorylation status of ERK1/2 between control and cortisol-treated hepatocytes

(p = 0.782; Fig. 2.3B). In addition, cortisol produced no significant effect on mTOR activation (p = 0.078; Fig. 2.3C) within 10 min. Likewise, cortisol-BSA treated hepatocytes did not significantly increase CREB phosphorylation (p = 0.071; Fig. 2.4A)

and no changes to ERK1/2 phosphorylation was observed (p = 0.973; Fig. 2.4B). mTOR phosphorylation levels by cortisol-BSA were unaltered at 10 min (p = 0.077; Fig. 2.4C).

2.3.3 Effect of RU486 and eplerenone on CREB and mTOR signalling

Treatment with either antagonist did not significantly block CREB (F (5, 25) =

0.802, p = 0.487; Fig. 2.5A) and mTOR (F (5, 25) = 4.973, p = 0.451; Fig. 2.5B) cortisol- mediated activation within 10 min. These effects were mimicked using cortisol-BSA in trout hepatocytes (CREB, F (5, 25) = 1.02, p = 0.403; Fig. 2.6A; mTOR, F (5, 25) = 4.128, p

= 0.060; Fig. 2.6B).

Fig. 2.1 Rapid regulation of PKA, PKC, and Akt substrate phosphorylation by cortisol Hepatocytes were incubated with cortisol (100 ng/mL) and sampled 10 min post-cortisol treatment. Cell homogenates (40 µg protein) were probed using phospho-specific PKA (A), PKC (B) and Akt (C) substrate protein antibodies. β-actin was used to confirm equal loading of each sample. Representative blots are shown for each of the substrates in the order of treatments they appear in the graphs. Densitometric values are plotted as percent control (mean ± SEM; paired Student’s t-test, p > 0.05; n = 6 independent fish).

Fig. 2.2 Rapid regulation of PKA, PKC, and Akt substrate phosphorylation by cortisol-BSA Hepatocytes were incubated with cortisol-BSA (100 ng/mL) and sampled 10 min post- cortisol treatment. Cell homogenates (40 µg protein) were probed using phospho-specific PKA (A), PKC (B) and Akt (C) substrate protein antibodies. β-actin was used to confirm equal loading of each sample. Representative blots are shown for each of the substrates in the order of treatments they appear in the graphs. Densitometric values are plotted as % control (mean ± SEM; paired Student’s t-test, p > 0.05; n = 6 independent fish). 29

Fig. 2.3 Rapid regulation of CREB, ERK1/2, and mTOR phosphorylation by cortisol Hepatocytes were incubated with cortisol (100 ng/mL) and sampled 10 min post-cortisol treatment. Cell homogenates (40 µg protein) were probed using phospho-specific and total CREB (A), ERK1/2 MAPK (B) and phospho-specific mTOR (C) antibodies. β-actin was used to confirm equal loading of each sample. Representative blots are shown for each protein in the order of treatments they appear in the graphs. Densitometric values are plotted as percent control (mean ± SEM). Bars with * indicate significance (paired Student’s t-test, p < 0.05; n = 6 independent fish).

Fig. 2.4 Rapid regulation of CREB, ERK1/2, and mTOR phosphorylation by cortisol-BSA Hepatocytes were incubated with cortisol-BSA (100 ng/mL) and sampled 10 min post- cortisol-BSA treatment. Cell homogenates (40 µg protein) were probed using phospho- specific and total CREB (A), ERK1/2 MAPK (B), and phospho-specific mTOR (C) antibodies. β-actin was used to confirm equal loading of each sample. Representative blots are shown for each protein in the order of treatments they appear in the graphs. Densitometric values are plotted as % control (mean ± SEM; paired Student’s t-test, p > 0.05; n = 6 independent fish).

Fig. 2.5 Rapid CREB and mTOR cortisol-mediated signalling Hepatocytes were incubated with RU486 (1000 ng/mL) and eplerenone (1000 ng/mL) or in combination with cortisol (100 ng/mL) and sampled 10 min post-hormone treatment. Antagonists were added 30 min prior to the addition of cortisol. Cell homogenates (40 µg protein) were probed using phospho-specific and total CREB (A) and phospho-specific mTOR (B) antibodies. β-actin was used to confirm equal loading of each sample. Representative blots are shown for each protein in the order of treatments they appear in the graphs. Densitometric values are plotted as percent control (mean ± SEM; repeated- measures one-way ANOVA, p > 0.05; n = 6 independent fish).

Fig. 2.6 Rapid CREB and mTOR membrane-mediated signalling by cortisol-BSA Hepatocytes were incubated with RU486 (1000 ng/mL) and eplerenone (1000 ng/mL) or in combination with cortisol-BSA (100 ng/mL) and sampled 10 min post-cortisol treatment. Antagonists were added 30 min prior to the addition of cortisol. Cell homogenates (40 µg protein) were probed using phospho-specific and total CREB (A) and phospho-specific mTOR (B) antibodies. β-actin was used to confirm equal loading of each sample. Representative blots are shown for each protein in the order of treatments they appear in the graphs. Densitometric values are plotted as % control (mean ± SEM; repeated-measures one-way ANOVA, p > 0.05; n = 6 independent fish).

2.4 Discussion

While there is considerable literature examining the genomic glucocorticoid actions in response to stress (Aluru and Vijayan, 2009), studies delineating nongenomic cortisol signalling and the mechanisms that mediate these rapid effects remain poorly understood in fish (Das et al., 2018). Studies conducted in mammals underscore how multiple signalling cascades are highly integrated in regulating nongenomic cortisol action in target tissues, but this is less clear in teleost models. For the first time, the results of this study show that secondary-signalling rapidly activates transcription factor

CREB, a target of PKA and Akt, for mediation of rapid metabolic functions in response to acute stress.

In the liver, both PKA and Akt signalling events are known to regulate glucose and glycogen metabolism and homeostasis (Klover and Mooney, 2004; Ramnanan et al.,

2011) while the PKC pathway is commonly implicated in the regulation of insulin, carbohydrate, and lipid metabolism (Samuel et al., 2010, 2007). The rapid increase in phosphorylation of PKA, PKB/Akt, and PKC substrates by cortisol has been previously documented in rainbow trout hepatocytes both in vitro and in vivo (Dindia et al., 2013,

2012), supporting a nongenomic role for cortisol in hepatic glucose homeostasis essential for cellular stress adaptation. Earlier studies in mammals have demonstrated activation of

PKA, Akt, and PKC by membrane perturbations (Butler et al., 2002; Lei et al., 2009;

Vigh et al., 2007) and in trout hepatocytes, these signalling events were sensitive to increased membrane fluidity as confirmed with benzyl alcohol, which mediated biophysical changes to the plasma membrane (Dindia et al., 2013, 2012). However, the observations in this study demonstrated that rapid cortisol treatment in hepatocytes did

not alter the phosphorylation of substrate proteins by PKA, PKC, and Akt (Fig. 2.1).

Similarly, membrane impermeable cortisol-BSA produced no significant changes to the phosphorylation status of these substrate proteins (Fig. 2.2). While the reason for this discrepancy remains unknown, a possible explanation includes differences in the reproductive stage of rainbow trout used. Dindia et al., (2012, 2013) used juvenile fish for experimentation while the trout used in this study were adults that had reached reproductive maturity. Although sex-specific cortisol effects were not examined, previous reports have shown differences to cortisol levels in response to stressor exposure between sexes as well as mature and immature rainbow trout (Kubokawa et al., 2001; Pickering et al., 1987; Pottinger et al., 1995). Conversely, experiments in this study utilized a different strain of rainbow trout than Dindia et al., (2013, 2012) where different strains and stocks of fish within the same species displayed variation in responses to stress as measured by plasma cortisol levels (Iwama et al., 1992; Pottinger and Moran, 1993).

CREB, a downstream substrate of both PKA and Akt, is an important transcription factor due to its role in regulating genes for restoring glucose homeostasis

(Mayr and Montminy, 2001), including the upregulation of phosphoenolpyruvate carboxykinase (PEPCK), the rate-limiting enzyme in the gluconeogenic pathway

(Altarejos and Montminy, 2011). Nongenomic activation of CREB by cortisol has been demonstrated previously in rainbow trout skeletal myotubules (Espinoza et al., 2017) and hepatocytes (Dindia, 2013), while aldosterone (MR agonist) also activated CREB signalling in non-teleost models (Christ et al., 1999; Lösel and Wehling, 2003). Our results show an increase in the phosphorylation status of CREB (ratio of phosphorylated to total) by cortisol within 10 min post-hormone treatment (Fig. 2.3A), providing further

evidence of a rapid nongenomic effect of cortisol in cultured hepatocytes, and that the activation of CREB is a conserved response. This finding is particularly telling as rapid modulation of CREB may facilitate highly coordinated cross-talk between the genomic

(slow-acting) and nongenomic signalling pathways through transcriptional regulation

(Lösel and Wehling, 2003), including genes involved in metabolism and energy substrate repartitioning essential for stress adaptation in the liver (Aluru and Vijayan, 2009).

MAPK signalling pathways play critical roles in modulating cellular processes during acute stressor exposure in the pituitary and immune system of mammals (Ayroldi et al., 2012; Solito et al., 2003). In fish, cortisol has been reported to positively modulate

MAPK, particularly the intermediate ERK1/2, in the gills of the Mozambique tilapia

(Kiilerich et al., 2011), rainbow trout skeletal myotubules (Espinoza et al., 2017) and liver post-stressor in vivo (Dindia et al., 2013). However, our results did not show an effect of cortisol or cortisol-BSA on the status of ERK1/2 (ratio of phosphorylated to total) in trout hepatocytes in vitro (Fig. 2.3B, 2.4B). Like the phosphorylation of substrate proteins by PKA, Akt, and PKC, we propose that the lack of consistent results regarding the effect of cortisol on ERK1/2 activation in vivo and in vitro may depend on several factors, including the reproductive stage, trout strain, and experimental conditions that may have introduced additional stress factors.

To further determine whether rapid cortisol signalling could modulate substrates downstream of Akt and MAPK signalling cascades, we examined the phosphorylation of mTOR. The Akt/mTOR signalling pathway is a well-known component of the insulin pathway for promoting glucose metabolism and protein synthesis (Samuel et al., 2010;

Taniguchi et al., 2006) and has shown to be regulated by cortisol in fishes (Sadoul and

Vijayan, 2016). In this study, incubation of hepatocytes with cortisol and cortisol-BSA did not significantly and rapidly phosphorylate mTOR protein (Fig. 2.3C, 2.4C). The mTOR regulation or lack of in the liver may be due to several possibilities. Firstly, cortisol-mediated mTOR activation may be tissue-specific. In muscle, cortisol-mediated mTOR phosphorylation is essential for protein synthesis and muscle growth (Seiliez et al., 2008). For instance, dexamethasone, a synthetic glucocorticoid, inhibited mTOR signalling in rat myoblasts as confirmed by decreased phosphorylation of ribosomal protein S6 kinase 1 (S6K1) and eukaryotic initiation factor binding protein 1 (4E-BP1) downstream targets (Wang et al., 2006). Secondly, activation of mTOR signalling by glucocorticoids suppressed GR transcription in muscle tissue (Shimizu et al., 2011), demonstrating a genomic effect of cortisol on mTOR signalling. Additionally, this finding might also suggest that mTOR is not a target of rapid cortisol signalling and that cortisol is responsible for the specific regulation of alternative pathways such as CREB in the liver.

Furthermore, antagonists for the corticosteroid receptors have been used previously to pharmacologically block receptor-mediated responses in fish (Kelly and

Chasiotis, 2011; Vijayan et al., 2003). In our study, cortisol-mediated activation of CREB was not inhibited by either GR (RU486) or MR (eplerenone) antagonists in trout hepatocytes (Fig. 2.5A), highlighting a corticosteroid receptor-independent mechanism may be initiating rapid CREB phosphorylation. However, the precise mechanism of action remains unknown. One possibility includes biophysical alterations to the lipid bilayer potentially modulating CREB activation as seen with PKA, PKC, and Akt

substrates and MAPK signalling (Dindia et al., 2013, 2012). However, further work is required to elucidate this potential mechanism for rapid CREB signalling.

In conclusion, the results presented in this chapter highlight an adaptive mechanism for cortisol in rapidly regulating cellular processes and signalling pathways for hepatic liver function during acute stress exposure. Specifically, cortisol rapidly and nongenomically modulated CREB signalling in trout hepatocytes. This rapid and indirect modulation of transcription factors may prime the cell for genomic actions that are necessary for stress adaptation. Since the genomic effects of glucocorticoids have a longer latency period, nongenomic CREB activation may play a critical role in the early phase of the acute stress response and aid in the restoration of stress-related homeostasis.

Therefore, while many of the mechanisms that mediate nongenomic cortisol action are not understood, future studies can be targeted at investigating the rapid responses and their effects in relation to the genomic pathway (Groeneweg et al., 2011).

2.5 Acknowledgements

This study was supported by the Natural Sciences Engineering Research Council

(NSERC) of Canada discovery grant awarded to MMV. MT was the recipient of the

Queen Elizabeth II Masters scholarship and the sole author of this manuscript.

Chapter Three: Stress-induced rapid cortisol effects in rainbow trout liver

3.1 Introduction

The catabolic actions in response to a stressor result in a highly-coordinated physiological response involving the rapid release of catecholamines and the long-term activation of the hypothalamus-pituitary-interrenal (HPI) axis, leading to glucocorticoid elevation in the blood (Mommsen et al., 1999; Wendelaar Bonga, 1997). The classical model of glucocorticoid action relays genomic signalling through modulation of gene transcription and translation mediated by specific corticosteroid receptor dimers in target tissues (Bury et al., 2003; Mommsen et al., 1999). The corticosteroid receptors, the glucocorticoid receptor (GR) and mineralocorticoid receptor (MR), are ligand-activated transcription factors that regulate a wide variety of glucocorticoid-responsive genes for stress adaptation (Bury and Sturm, 2007; Mommsen et al., 1999).

GR is expressed in nearly every tissue (Alderman et al., 2012), exhibiting pleiotropic actions that become necessary for an organism to cope with a stressor

(Mommsen et al., 1999). The stressor-induced physiological responses to glucocorticoids are highly diverse. For instance, cortisol plays a critical role in liver carbohydrate, lipid, and amino acid metabolism (Faught and Vijayan, 2016), including the upregulation of phosphoenolpyruvate carboxykinase (PEPCK; Aluru and Vijayan, 2009, 2007), arginase

(Vijayan et al., 1996), and triacylglycerol lipase (Lidman, 1979) mRNA levels, respectively. Glucocorticoids have also been shown to genomically suppress the activities

of cytokines that regulate the inflammatory response under stress (Castillo et al., 2009;

Philip and Vijayan, 2015; Tort, 2011).

While the majority of known glucocorticoid actions impinge on transcriptional events, growing evidence suggests that glucocorticoids stimulate rapid (short-latency) non-transcriptional effects via nongenomic signalling pathways (Borski, 2000). Rapid responses are mediated by downstream second-messenger protein kinase signalling events and occur independently of genomic activation (Lösel and Wehling, 2003).

Although the proposed mechanisms of cortisol action are not very well-characterized, experimental evidence thus far suggests three modes of action for mediating nongenomic glucocorticoid responses. These include changes to the biophysical properties of the plasma membrane (Dindia et al., 2012), novel membrane receptor(s) activation (Dindia et al., 2013; Dindia, 2013; Lösel and Wehling, 2003), and the activation of GR and/or MR or translocation of these receptors to the plasma membrane (Espinoza et al., 2017;

Groeneweg et al., 2011; Roy and Rai, 2009; Stahn et al., 2007).

Nongenomic glucocorticoid signalling remains poorly characterized in teleost models and even more so in the liver, despite the importance of this tissue in regulating physiological and metabolic adjustments associated with elevated stress (Mommsen et al., 1999). Recently, it was shown that cortisol and impermeable cortisol conjugated to bovine serum albumin (cortisol-BSA) rapidly induced reactive oxygen species (ROS), a marker of the cellular stress response, in rainbow trout (Oncorhynchus mykiss) skeletal myotubules (Espinoza et al., 2017). This corresponded to a rapid induction of cAMP response element binding protein (CREB) and extracellular signal-regulated kinase 1/2

(ERK1/2) signalling proteins, a nongenomic response triggered by membrane GRs

(Espinoza et al., 2017). At physiologically relevant concentrations, ROS are involved in signal transduction and often generated as by-products of metabolism (Srikanth et al.,

2013). Therefore, we tested the hypothesis that glucocorticoids rapidly affect oxidative stress in rainbow trout in the liver. This was tested by examining the effects of acute stressor exposure on ROS generation as demonstrated by Espinoza et al. (2017) and the redox regulator, glutathione (GSH), in vivo. Also, in vitro analysis using liver slices incubated with the GR antagonist, RU486 (Mifepristone), was conducted to determine if a stress-mediated ROS response was facilitated by a nongenomic GR-mediated signalling pathway. Additionally, RU486 was utilized to demonstrate a role for cortisol in rapidly modulating stress-responsive gene expression using real-time (quantitative) PCR in trout hepatocytes. Genes investigated included cellular stress response markers associated with the corticosteroid receptors as well as immune, growth, metabolic, and oxidative stress biomarkers established previously (Faught and Vijayan, 2016; Kratschmar et al., 2012;

Mommsen et al., 1999; Philip and Vijayan, 2015; Sathiyaa and Vijayan, 2003; Tort,

2011).

3.2 Materials and Methods

3.2.1 Experimental Fish

Rainbow trout (~100 g) purchased from Allison Creek Hatchery (Crowsnest Pass,

AB, CAN) were kept at the University of Calgary’s aquatic facility at the Life and

Environmental Sciences Animal Resources Centre. The tanks were exposed to a 12-h light:12-h darkness photoperiod and were provided with a continuous supply of aerated

water (11 ± 2°C). Fish were fed commercial trout food (Martin Mill, CAN) to satiety once a day. Trout were acclimated for at least two weeks prior to the start of experimentation. All protocols pertaining to the following experiments adhered to the guidelines set out by the Canadian Council on Animal Care and have been approved by the University of Calgary’s Animal Care Committee.

3.2.2 In vivo stress experiment

All chemicals were purchased from Sigma Aldrich (MO, USA) unless specified otherwise. Rainbow trout were kept in four 100 L tanks with 7-8 fish per tank. Two tanks were left undisturbed (unstressed) while the remaining two tanks were exposed to a three- min handling stressor as described in Dindia et al. (2013). Fish were then sampled at 30 min and 4 h (recovery period) post-stressor exposure. All fish were terminally anaesthetized in 0.1% (vol/vol) 2-phenoxyethanol and euthanized by severing the spinal cord. Whole livers were removed and flash frozen in -80°C for the measurement of ROS and GSH. When required, samples (50 mg) were homogenized by sonication (sonic dismembrator; Fisher Scientific, CAN) in 200 µL ROS buffer (0.32 mM sucrose, 20 mM

HEPES, 1 mM MgCl2, 0.5 mM PMSF, pH 7.4), centrifuged for two min at 13,000xg

(Thermo Scientific, USA), and the supernatant collected. Trout plasma cortisol levels were measured using an in-house competitive enzyme-linked immunosorbent assay

(ELISA) as described previously (Faught et al., 2016).

3.2.3 Liver slices and experimental treatment

Livers from the unstressed (control) fish group were finely sliced using an MD-

1100 liver slicer (Munford, USA). Thin slices were washed with ice-cold modified

Hank’s buffer (136.9 mM NaCl, 5.4 mM KCl, 0.8 mM MgSO4•7H2O, 0.33 mM

Na2HPO4•12H2O, 0.44 mM KH2PO4, 5 mM HEPES, 5 mM HEPES Na) containing 1.5 mM CaCl2 and 5 mM glucose. The slices were placed in 24-well tissue culture plates

(Sarstedt, Inc., USA) containing Leibovitz’s (L-15) media (Gibco, Thermo Fisher, USA).

Plates were maintained at 11°C with the media replaced after 1 h of constant rocking

(Dindia, 2013). Slices were treated 2 h after the first L-15 media replacement with either control (ethanol) media, hydrocortisone (cortisol; 100 ng/mL), RU486 (1000 ng/mL), or medium containing a combination of cortisol and RU486. RU486 is also a known progesterone receptor antagonist (Vijayan et al., 1994; Vijayan and Leatherland, 1992).

However, slices cultured in vitro lack progesterone, and, therefore, any effects observed can be attributed to RU486 binding to GR. The cortisol concentration was indicative of physiologically stressed levels in fish (Wendelaar Bonga, 1997), while the concentration of RU486 has been shown to inhibit GR-mediated effects in liver previously (Aluru and

Vijayan, 2007). RU486 was added 30 min prior to the addition of the hormone (Dindia,

2013) and the slices were sampled at 30 min and 1 h post-cortisol treatment with the addition of 100 µL of ice-cold ROS buffer. Tissues were immediately sonicated (sonic dismembrator; Fisher Scientific, CAN), centrifuged for two min at 13,000xg (Thermo

Scientific, USA), and the supernatant collected. This was repeated with livers collected from six independent fish.

3.2.4 Determination of ROS generation

Protein concentration was determined using the bicinchoninic acid (BCA) protocol (Smith et al., 1985) with standards derived from BSA. Both whole livers

(section 3.2.2) and liver slices (section 3.2.3) homogenized in ROS buffer (Rosa et al.,

2008) were added to black-bottom 96-well plates (Corning Incorporated, USA). A total of 1 ug/mL of DCFDA (2’,7’– dichlorofluorescein diacetate; cell permeant fluorogenic dye) was preloaded into each sample for measurement of ROS. The plate was left incubating for 1 h at room temperature and relative fluorescence was read using the

SpectraMax® Paradigm® (Molecular Devices, USA) at 435 nm excitation and 535 nm emission.

3.2.5 Determination of total GSH

Total GSH was quantitatively measured using the EnzyChrom™ GSH/GSSG

Assay kit (BioAssay Systems, USA) according to the manufacturer’s instructions with a single modification: 5% metaphosphoric acid was replaced with 5% perchloric acid for deproteination. Oxidized GSH levels were too low to detect using this kit.

3.2.6 Hepatocyte primary culture for transcript abundance

Rainbow trout (~100 g) were terminally anaesthetized in 0.1% (vol/vol) 2- phenoxyethanol and euthanized by severing the spinal cord. High yields of liver hepatocytes were isolated by an in-situ perfusion technique with collagenase (Type II;

Gibco, Thermo Scientific, USA) as described previously (Vijayan et al., 2003). The cells were suspended in L-15 media and plated onto six-well tissue culture plates at a density of 1.5 million cells/well (0.75 million cells/mL). Cell viability was determined using the trypan blue exclusion method with a survival range > 95% for all experiments. The cells were maintained overnight at 11°C and the media replaced 2 h prior to the start of experiments 24 h after plating. Hepatocytes were incubated either without (control) or

with physiologically relevant concentration of hydrocortisone (100 ng/mL), RU486 (1000 ng/mL), or a combination of cortisol and antagonist. RU486 was added 1 h prior to the addition of cortisol and sampled 1 h after hormone addition. Cells were gently scraped and spun at 13,000xg (Thermo Scientific, USA) for two min and immediately frozen at -

80°C. This was repeated with hepatocytes isolated from five independent fish.

3.2.7 Total RNA extraction, cDNA synthesis and real-time (quantitative) PCR

Total RNA was isolated using RiboZol reagent (Invitrogen, USA) according to the manufacturer’s instructions. RNA was quantified by measuring absorbance at 260 and

280 nm using the SpectraDrop Low-Volume Microplate (Thermo Scientific, USA). All samples were DNase-treated and cleared of genomic DNA contamination. A total of 1 µg of RNA was used to synthesize cDNA using the High Capacity cDNA Reverse

Transcription kit (Applied Biosystems, USA) according to the manufacturer’s instructions. Gene abundance using real-time PCR was measured using specifically designed primers for select glucocorticoid target genes in rainbow trout (Table 3.1). The genes selected were intended to highlight the various facets of genomic cortisol action in the stress response, immunity, growth, metabolism, and oxidative stress established previously (Borski, 2000; Faught and Vijayan, 2016; Kratschmar et al., 2012; Mommsen et al., 1999; Philip and Vijayan, 2015; Tort, 2011; Vijayan et al., 2003). Gene quantification was carried out as described in Aluru and Vijayan (2007). Ct values were normalized to the reference gene, elfa (elongation factor 1 alpha) before plotting.

3.2.8 Statistical analysis

All statistical analyses were carried out using PRISM (GraphPad Software, Inc.,

USA). The in vivo and in vitro liver slices experiments were analyzed using a two-way analysis of variance (ANOVA) between treatment (unstressed/stressed or hormone/antagonist) and time as independent factors. Significant differences were analyzed by a Tukey’s post-hoc test. Examination of transcript abundance utilized a repeated-measures one-way ANOVA. Statistical assumptions for the ANOVA test

(normality and equal variance) were met. Statistics were performed on raw data and all transcript levels were expressed as percentage of control (mean ± SEM). A probability of p < 0.05 was used to test for significance.

Table 3.1 Gene-specific primers for select target genes Genes without an accession number suggest multiple sequence alignments used to obtain suitable primer sequences. EF1α was used as the reference gene. Abbreviations: F – forward primer; R – reverse primer; bp – base pairs.

Gene ID GenBank Primer Sequences (5’ → 3’) Temperature Amplicon Accession (°C) Size (bp) Number

CREB (cAMP response element - F: ATACAGTCACCACAGGTCCAG 60 100 binding protein) R: TGCGTTTCTGAGAGTCAGTCA

EF1α (elongation factor 1 alpha) AF498320.1 F: CATTGACAAGAGAACCATTGA 56 95 R: CCTTCAGCTTGTCCAGCAC

GR1 (glucocorticoid receptor 1) Z54210 F: TTCCAAGTCCACCAATCAA 60 115 R: GGAGAGCTCCATCTGAGTCG

GR2 (glucocorticoid receptor 2) A4495372.1 F: GGGGTGATCAAACAGGAGAA 60 140 R: CTCACCCCACAGATGGAGAT

IGF-1 (insulin-like growth factor M95183.1 F: TGGACACGCTGCAGTTTGTGTGT 68 109 1) R: CACTCGTCCACAATACCACGGTT

IκBα (inhibitor of NF-κBα) NM_001124368.1 F: CGTGGTGGTGTGAAGTCAAG 61 118 R: AGGCCAGCTCTATGTGGCT

MR (mineralocorticoid receptor) NM_001124740.1 F: ACCAACAACATGAGGGCTTC 60 131 R: AGTTCACTAGCAGGGCTGGA

NFE2L2 (nuclear factor - F: CCAAACACCAGCTCAACGAAG 56 120 (erythroid-derived 2)-like 2) R: CCAATCCCACGATGTTCTCCA

p53 (tumour protein 53) NM_001124692.1 F: TTCTACCCTGGACACTGGCT 60 88 R: GAAACGTAGCTGGAACCCCA

SOCS 1 (suppressor of cytokine AM748721 F: GATTAATACCGCTGGGATTCTGTG 63.3 136 signalling 1) R: CTCTCCCATCGCTACACAGTTCC

SOCS 2 (suppressor of cytokine AM748722 F: TCGGATGACTTTTGGCCTAC 60 102 signalling 2) R: CCGTTCTTCTCTCGTTTTCG

SOCS 3 (suppressor of cytokine AM748723 F: TAGCCCTGAGCCTGGAAGTA 60 113 signalling 3) R: GGTTGCTAGGCAGTTTCCTG

STAT5 (signal transducer and NM_001124261.1 F: TCAAACTGGGACACTACGCC 60 106 activator of transcription 5) R: ACTAGCCTCTGCTCCGTGTA

3.3 Results

3.3.1 ROS and total GSH generation in vivo

Plasma cortisol was measured using a competitive ELISA which showed significantly elevated cortisol levels in fish under stress (data not shown). There was a significant interaction effect for ROS between stress condition and time (F (1, 26) = 5.769, p = 0.024; Fig. 3.1A). Under stress, ROS generation significantly decreased at 0.5 h compared to unstressed fish. In addition, unstressed fish sampled 4 h post-stressor showed a significant decrease in ROS production compared to unstressed fish at 0.5 h.

There was no change in ROS between unstressed and stressed fish 4 h post-stress induction. The results for ROS corresponded to a similar interaction effect for total GSH between stress condition and time (F (1, 20) = 17.760, p = 0.0004; Fig. 3.1B). GSH was significantly reduced at 0.5 h in the stressed fish while control fish at 0.05 and 4 h post- stressor differed significantly from one another.

3.3.2 ROS generation in vitro

Cortisol did not significantly affect ROS production at 0.5 or 1 h post-hormone induction in vitro and treatment with the antagonist did not abolish this response (F (1, 5) =

2.443, p = 0.179; Fig. 3.2).

3.3.3 Rapid cortisol-mediated transcript abundance

Cortisol did not significantly increase the mRNA levels of GR1, GR2, and MR

(Fig. 3.3) in trout hepatocytes. This trend resonated with all associated immune (IκBα,

SOCS1, SOCS2, and SOCS3; Fig. 3.4) and growth-responsive genes (p53, STAT5, and

IGF-1; Fig. 3.5) examined 1 h post-cortisol treatment. In addition, CREB and NFE2L2

transcript levels were not affected by cortisol stimulation (Fig. 3.6). The p-values for all the genes investigated were > 0.05.

Fig. 3.1 Stress-mediated ROS and GSH generation in vivo (A) ROS and (B) total GSH from trout livers that were exposed to a three-min handling stressor sampled at 30 min and 4 h post-stressor exposure. Relative fluorescence for ROS was read at 435 nm excitation and 535 nm emission. All values represent mean ± SEM (n = 6 - 8 independent fish). Bars with different letters suggest significance (two-way ANOVA, p < 0.05). Abbreviations: RFU – relative fluorescence units.

Fig. 3.2 ROS generation using liver slices in vitro Liver slices from the unstressed (control) group were incubated with cortisol (100 ng/mL), RU486 (1000 ng/mL), or in combination and sampled 30 min and 1 h post- hormone treatment. RU486 was added 30 min prior to the addition of cortisol. Relative fluorescence was read at 435 nm excitation and 535 nm emission. All values represent mean ± SEM (repeated-measures two-way ANOVA, p > 0.05; n = 6 independent fish). Abbreviations: RFU – relative fluorescence units.

Fig. 3.3 Rapid modulation of the expression of corticosteroid receptors by cortisol (A) GR1, (B) GR2, and (C) MR mRNA levels in trout hepatocytes incubated with cortisol (100 ng/mL), RU486 (1000 ng/mL) or in combination and sampled 1 h post- hormone treatment. RU486 was added 30 min prior to the addition of cortisol. Ct values were normalized to the reference gene, elfa. All values represent mean ± SEM (% control; repeated-measures one-way ANOVA, p > 0.05; n = 5 independent fish).

Fig. 3.4 Rapid modulation of the expression of immune-related genes by cortisol (A) IKBa, (B) SOCS-1, (C) SOCS-2, and (D) SOCS-3 mRNA levels in trout hepatocytes incubated with cortisol (100 ng/mL), RU486 (1000 ng/mL) or in combination and sampled 1 h post-hormone treatment. RU486 was added 30 min prior to the addition of cortisol. Ct values were normalized to the reference gene, elfa. All values represent mean ± SEM (% control; repeated-measures one-way ANOVA, p > 0.05; n = 5 independent fish).

Fig. 3.5 Rapid modulation of the expression of growth-related genes by cortisol (A) p53, (B) STAT5, and (C) IGF-1 mRNA levels in trout hepatocytes incubated with cortisol (100 ng/mL), RU486 (1000 ng/mL) or in combination and sampled 1 h post- hormone treatment. RU486 was added 30 min prior to the addition of cortisol. Ct values were normalized to the reference gene, elfa. All values represent mean ± SEM (% control; repeated-measures one-way ANOVA, p > 0.05; n = 5 independent fish).

Fig. 3.6 Rapid modulation of the expression of CREB and NFE2L2 genes by cortisol (A) CREB and (B) NFE2L2 mRNA levels in trout hepatocytes incubated with cortisol (100 ng/mL), RU486 (1000 ng/mL) or in combination and sampled 1 h post-hormone treatment. RU486 was added 30 min prior to the addition of cortisol. Ct values were normalized to the reference gene, elfa. All values represent mean ± SEM (% control; repeated-measures one-way ANOVA, p > 0.05; n = 5 independent fish).

3.4 Discussion

One of the objectives in this study was to provide novel insight into the role of rapid stress-induced ROS response and elucidate a possible mechanism for metabolic function in teleost liver. Previously, it has been reported that dexamethasone induced

ROS production via genomic mechanisms in mammals (Asayama et al., 1992). However, there has been no assessment as to whether ROS effects are modulated nongenomically.

To our knowledge, this is the first study to report a rapid reduction in ROS (Fig. 3.1A) following exposure to an acute handling stressor in liver using an in vivo approach. The observations presented here are unique compared to the findings reported by Espinoza et al. (2017) where cortisol rapidly induced ROS in rainbow trout skeletal muscle.

Therefore, the data support the possibility that stress-mediated ROS effects may be dependent on tissue-type due to cellular and functional differences between muscle and hepatic systems. Furthermore, only a single study reported nongenomic ROS production by the mineralocorticoid, aldosterone, in rat cardiac myocytes within 5 min of aldosterone addition (Hayashi et al., 2008). The response was insensitive to transcriptional and translational inhibitors, and the MR antagonist, eplerenone, was successful at inhibiting aldosterone-mediated effects (Hayashi et al., 2008), further suggesting that the nongenomic effects of cortisol on ROS production may also be species and steroid-specific.

Multiple studies report elevated ROS concentrations as apoptosis inducers in many different cell systems (reviewed in Simon et al., 2000). For instance, ROS- mediated apoptosis was evident in eosinophils of rat and the antioxidant, GSH, completely prevented this response (Wedi et al., 1999). GSH is an important non-

enzymatic antioxidant acting as a cellular defence mechanism against increased ROS concentrations by maintaining the reduction/oxidation balance associated with oxidative stress (Jozefczak et al., 2012; Srikanth et al., 2013). Since our results demonstrating ROS reduction also coincided with a decrease in total GSH (Fig. 3.1B), we are proposing a possible protective or adaptive role of ROS in liver stress adaptation as a safeguarding mechanism against apoptosis. This may be related to the ability of the liver to repartition energy reserves, and decrease the energy demand to maintain an appropriate redox environment in this tissue.

Furthermore, this study demonstrates that intracellular ROS production was not affected by cortisol treatment at physiologically relevant concentrations in vitro (Fig.

3.2). While stress-mediated ROS was reduced in vivo, reasons for this discrepancy in vitro may have manifested differently due to experimental conditions attributed to the in vivo and in vitro research methods. The lack of a significant ROS response with cortisol in liver slices in vitro argues against a direct role for cortisol in the stressor-mediated rapid effects on oxidative stress response in the liver in vivo. Also, RU486 was utilized to discriminate the participation of GR in the production of ROS. However, the ROS response was not mediated by GR since treatment with the antagonist did not abolish the cortisol-mediated changes (Fig. 3.2). This result is contrary to findings established by

Espinoza et al. (2017) as the cortisol-mediated effect in rainbow trout muscle was abolished by RU486, but not by the MR antagonist, RU28318. This suggests a membrane-GR may be participating in this rapid glucocorticoid response, which was further supported by the identification of canonical GRs in the cell membrane fraction isolated from muscle tissue (Espinoza et al., 2017). Since an inhibitory response to ROS

by RU486 was not evident, we speculate the presence /activation of a novel membrane receptor(s) as a potential mechanism for rapid glucocorticoid signalling in response to an acute stressor. However, future studies are still warranted as a putative glucocorticoid receptor(s) on the plasma membrane has not been cloned and sequenced in any model organism (Das et al., 2018).

The genomic glucocorticoid signalling pathway has been extensively characterized and reviewed in teleost models (Aluru and Vijayan, 2009; Borski, 2000;

Bury et al., 2003; Mommsen et al., 1999; Prunet et al., 2006; Stolte et al., 2006).

However, the role of transcript changes in stress adaptation is far from clear (Faught et al., 2016a). Genes that are genomically regulated post-stressor exposure are variable and include transcripts involved in energy metabolism including glucose and protein metabolism, immune, and growth-related processes (Aluru and Vijayan, 2009; Mommsen et al., 1999). Although variable, the majority of the transcript responses to cortisol stimulation are modulated over a 24 h period (reviewed in Faught et al., 2016a). For instance, GR mRNA expression was significantly elevated in trout hepatocytes after 4 h post-cortisol treatment (Sathiyaa and Vijayan, 2003). Cortisol downregulates the mRNA expression of NF-κB and upregulates IκB transcript levels through a GR-dependent pathway (McKay and Cidlowski, 1999), while SOCS-1 and SOCS-2 transcript abundance were positively regulated by cortisol in rainbow trout liver at 24 h and RU486 completely abolished this effect (Philip et al., 2012). In addition, it was shown that cortisol decreases

IGF-1 mRNA resulting in a reduction in the phosphorylation of STAT5 at the protein level in liver tissue (Philip and Vijayan, 2015), while exposure to cortisol inhibited the

NFE2L2-dependent antioxidant pathway increasing ROS in hepatic cells (Kratschmar et al., 2012).

The present study, however, showed no alterations to any of the transcript levels investigated after 1 h post-cortisol treatment (Fig. 3.3, 3.4, 3.5, 3.6). Therefore, it is plausible that the rapid effects of cortisol do not involve modulation of gene transcription in the liver, highlighting a role for genomic regulation for coping with stress. Although the contribution of gene transcription and translation to the metabolic energy demand is not known in fish (Faught et al., 2016a), we hypothesize a possible explanation for the mismatch with the results of this study might lie in the short incubation period the cells were exposed to cortisol as this may have been a small window to see any changes.

In conclusion, cortisol rapidly reduced ROS production in the liver, but the exact mechanism of action remains unknown. Since ROS decreased under stress, we suggest that ROS may be playing a protective role against apoptosis for stress adaptation in this tissue. The lack of a significant ROS response with cortisol in liver slices in vitro argues against a direct role for cortisol in the stressor-mediated rapid effects on oxidative stress response in the liver in vivo. Furthermore, several cortisol-mediated genes commonly implicated during stress were not rapidly altered by cortisol, underscoring a direct role for genomic signalling in regulating the stress response. We postulate that the short hormone induction period may be playing a role since mRNA transcription is a time and energy- consuming process (Faught et al., 2016a).

3.5 Acknowledgements

This study was supported by the Natural Sciences Engineering Research Council

(NSERC) of Canada discovery grant awarded to MMV. MT is the recipient of the Queen

Elizabeth II scholarship and the sole author of this manuscript. Thank you to Erin Faught for assistance in conducting the in vivo experiment and for measuring plasma cortisol levels.

Chapter Four: Putative corticosteroid receptors on the plasma membrane of rainbow trout liver

4.1 Introduction

The corticosteroids are a group of steroid hormones recognized for their regulatory roles in the metabolic response for stress adaptation, particularly in the liver

(Faught and Vijayan, 2016; Mommsen et al., 1999). Cortisol is released upon stressor exposure via the hypothalamus-pituitary-interrenal (HPI) axis (Mommsen et al., 1999;

Wendelaar Bonga, 1997). Once in circulation, cortisol primarily exerts its physiological effects by binding to the intracellular glucocorticoid receptor (GR) and mineralocorticoid receptor (MR), which are ligand-bound transcription factors of the nuclear receptor superfamily to regulate target gene transcription (Bury et al., 2003; Mommsen et al.,

1999; Stolte et al., 2006). Besides the genomic signalling pathway, cortisol like the sex steroids, produces rapid (short-latency) physiological responses through nongenomic signalling pathways (Borski, 2000; Thomas, 2003). This pathway typically involves alterations to intracellular second-messenger cascades initiated at the cell surface (Borski,

2000). However, many of the mechanisms that mediate the rapid actions of glucocorticoids are poorly characterized.

There are three main hypotheses for the elucidation of rapid cortisol actions in fish. The first mechanism involves corticosteroid-mediated changes to the biophysical properties and structure of plasma membranes (Dindia et al., 2012; Whiting et al., 2000).

For example, cortisol-mediated increase in membrane fluidity was revealed in rainbow

trout (Oncorhynchus mykiss) hepatocytes altering topography and anisotropy within minutes of cortisol treatment (Dindia et al., 2013, 2012). This membrane response activated downstream signalling pathways, including protein kinase A (PKA), B or Akt

(PKB), and C (PKC) substrate proteins (Dindia et al., 2013, 2012) and mitogen-activated protein kinases (MAPK) including extracellular signal-regulated protein kinase 1/2

(ERK1/2; Dindia et al., 2013). The second mechanism of action involves activation of novel membrane receptors unrelated to members of the nuclear receptor superfamily

(Lösel and Wehling, 2003). These novel glucocorticoid membrane proteins are hypothesized to belong to the seven-transmembrane family of G-protein coupled receptors (GPCR) as demonstrated for aldosterone (Lösel et al., 2002) and the sex steroids (reviewed in Thomas, 2012; Thomas et al., 2006). The third hypothesis involves the modulation of the intracellular corticosteroid receptors (GR and MR) or translocation of the receptors to the plasma membrane capable of eliciting rapid signalling cascades in addition to regulating transcriptional events (Das et al., 2018; Groeneweg et al., 2011;

Lösel and Wehling, 2003). In fish, this was supported by studies that showed rapid abolishment of cortisol-mediated responses by RU486, a GR antagonist in rainbow trout myotubules (Espinoza et al., 2017) and macrophages in the spotted murrel, Channa punctatus (Roy and Rai, 2009).

To date, glucocorticoid membrane receptors have not been conclusively cloned or sequenced in any model organism (Borski, 2000). High-affinity cortisol-binding sites on the plasma membranes of liver and kidney tissues were identified in the Mozambique tilapia, Oreochromis mossambicus (Johnstone et al., 2013). Ligand-binding studies revealed distinct binding characteristics from the intracellular GR (Bury et al., 2003),

which suggested the presence of novel membrane receptors. Therefore, the objective of this study was to isolate and identify liver membrane receptor(s) for cortisol in rainbow trout as a mechanism for rapid stress signalling.

4.2 Materials and Methods

4.2.1 Experimental fish

Rainbow trout (100 - 300 g) purchased from Allison Creek Hatchery (Crowsnest

Pass, AB, CAN) were kept at the University of Calgary’s aquatic facility at the Life and

Environmental Sciences Animal Resource Centre. The tanks were exposed to a 12-h light:12-h darkness photoperiod and were provided with a continuous supply of aerated water (11 ± 2°C). Fish were fed commercial trout food (Martin Mill, CAN) to satiety once a day. Trout were acclimated for at least two weeks prior to the start of experimentation. All protocols pertaining to the following experiments adhered to the guidelines set out by the Canadian Council on Animal Care and have been approved by the University of Calgary’s Animal Care Committee.

4.2.2 Crude membrane isolation

All chemicals were purchased from Sigma Aldrich (MO, USA) unless specified otherwise. Rainbow trout were terminally anaesthetized in 0.1% (vol/vol) 2- phenoxyethanol and euthanized by severing the spinal cord. Whole trout livers were homogenized in TCD buffer (300 mM sucrose, 10 mM TRIS-HCl, 1 mM dithiothreitol,

0.5 mM CaCl2, Roche protease inhibitor (Roche Diagnostics, CAN)) using a glass dounce homogenizer. The homogenate was centrifuged for 10 min at 1000xg (Thermo

Scientific, USA) followed by a second spin at 3300xg for 15 min, and a final centrifugation step at 100,000xg for 1 h (Beckman, USA). All steps, including centrifugation, were performed at 4°C. Membrane fraction enrichment and cytosolic contamination was determined by measuring the enzyme activities of 5’AMP nucleotidase (Solyom et al., 1972) and lactate dehydrogenase (LDH; Gravel et al., 2009), respectively. Membrane-associated proteins were extracted from crude membranes

(pellets from the last centrifugation step) using the Mem-PERTM Plus Membrane Protein

Extraction Kit (Thermo Scientific, USA) according to the manufacturer’s instructions.

This was repeated with 5-7 independent fish.

4.2.3 Sucrose gradients for the purification of plasma membranes

Purified plasma membranes derived from whole liver were isolated using a sucrose gradient established by Sulakhe (1987) with a few modifications. First, the homogenate was centrifuged at 800xg for 5 min (Thermo Scientific, USA), followed by a

10,000xg spin for 12 min, and a final spin at 24,000xg for 20 min. The final pellet was suspended in 46.5% (sucrose) TCD buffer with a 41% TCD buffer overlay. The samples were centrifuged for 75 min at 100,000xg (Beckman, USA). The white, opaque layer in between the two TCD buffers was carefully collected. All steps, including centrifugation, were performed at 4°C. Like the crude membrane isolation, membrane fraction enrichment and cytosolic contamination was determined by measuring the enzyme activities of 5’AMP nucleotidase and LDH, respectively. This was repeated with five independent fish.

4.2.4 Enzyme activities: LDH and 5’AMP nucleotidase

LDH (EC 1.1.127) was measured in 50 mM (pH 7.5) imidazole enzyme buffer containing 0.12 mM NADH with 1 mM pyruvic acid as the reaction initiator (Gravel et al., 2009). Measurements were taken using continuous spectrophotometry for 15 min (10 sec increments) at 340 nm in a microplate reader (SpectraMax, Molecular Devices,

USA).

5’AMP nucleotidase (EC 3.1.3.5) was measured in reaction buffer containing 75 mM TRIS, 10 mM KCl, 5 mM MgCl2, 5 mM 5’AMP, pH 9.0. Termination of the reaction used water and phosphate assay soup ((NH4)6MoO4 in 6 N HCl, PVA, malachite green, and water in a 2:2:4:1 ratio, respectively) as described in Solyom et al. (1972).

Measurements were taken at 620 nm in a microplate reader (SpectraMax, Molecular

Devices, USA) after a 10 min incubation period at room temperature.

4.2.5 Cortisol-agarose affinity chromatography

Hydrocortisone-21-hemisuccinate was coupled to an agarose gel (Affi-gel 102;

Bio-Rad, CAN) according to the manufacturer’s instructions. Briefly, 50 µM of hydrocortisone-21-hemisuccinate was coupled to agarose beads in a 1:1 ratio with water.

Proceeding immediately, 10 mg of EDAC activating reagent was added to the gel and the pH was readjusted to 4.7 using 1 N HCl. The gel was left overnight in the 4°C fridge with gentle shaking. Subsequently, the gel was transferred to 10 mL affinity columns and washed once with 50 mM sodium acetate solution (pH 7.4) and equilibrated with binding buffer A (20 mM HEPES, 1 mM EGTA, 5 mM MgCl2, Roche proteinase inhibitor cocktail (Roche Diagnostics, CAN), pH 7.4; Dindia, 2013). Purified plasma membrane

proteins from crude membranes (4 mg/mL; 1.5 mL total) were loaded onto the gel and were left in the 4°C fridge overnight with gentle end-over-end rocking. Unbound proteins were washed with binding buffer A in 1 mL aliquots while any cortisol-bound proteins were eluted using binding buffer A containing 0.5 mg/mL hydrocortisone. All fractions were immediately frozen at -80°C. To concentrate the proteins in both the wash and eluted fractions, Amicon® Ultra 15 mL Centrifugal filters were used with a 10,000- molecular weight cut-off (Millipore, CAN) according to the manufacturer’s instructions.

4.2.6 SDS-PAGE, immunodetection and mass spectrometry

Protein concentration was determined using the bicinchoninic acid (BCA) protocol (Smith et al., 1985) with standards derived from bovine serum albumin (BSA).

Membrane samples were diluted in Laemmli’s buffer (156 mM TRIS, 50% (v/v) glycerol, 5% SDS, 0.0625% bromophenol blue, 25% 2-mercaptoethanol) with 10-40 µg of protein separated on 8% SDS-PAGE gels. Both the crude membrane and purified membrane proteins were transferred onto a 0.45-µm nitrocellulose membrane (Bio-Rad,

CAN). At room temperature, membranes were blocked for 1 h in 5% skim milk and

0.05% NaN3 following an overnight incubation at 4°C with the appropriate in-house primary antibody prepared in 5% skim milk: zebrafish affinity purified MR (1:500 dilution) and recombinant trout GR (1:1000 dilution). The blots were incubated with anti- rabbit horseradish peroxidase (HRP)-labeled secondary antibody (1:3300 dilution in 5% skim milk) for an additional 1 h. The protein bands were detected with ECL chemiluminescence (Bio-Rad, CAN) according to the manufacturer’s instructions and imaged using the Syngene G-Box Imager (GeneSys software, MD, USA). Densitometric

values for GR and MR were quantified using the ImageJ software (NIH, US) and normalized to total protein.

For novel proteins isolated using the affinity chromatography columns, the gel (1 mm thick) was stained using SYPRO-Ruby protein gel stain (Bio-Rad, CAN) according to the manufacturer’s instructions. Bands of interest were carefully cut out of the gel and sequenced using In-Gel nanoLC-mass spectrometry at the University of Calgary’s SAMS centre (CAN). Sequences obtained were aligned using the rainbow trout (Oncorhynchus mykiss) genome database.

4.2.7 Statistical analysis

All statistical analyses were carried out using PRISM (GraphPad Software, Inc.,

USA). A paired Student’s t-test was used to confirm the enrichment of membranes using

5’AMP nucleotidase as a membrane biomarker and LDH for cytosolic contamination.

Statistics were performed on raw data. A probability of p < 0.05 was used to test for significance.

4.3 Results

4.3.1 Hepatic membrane enrichment: 5’AMP nucleotidase and LDH

For the isolation of crude membranes, a significant increase was observed for

5’AMP in the membrane fraction (p = 0.045; Fig. 4.1A) while a significant decrease for

LDH was evident in the membrane fraction (p = 0.014; Fig. 4.1B). This trend was also observed for the purified plasma membranes isolated using the sucrose gradients (5’AMP nucleotidase, p = 0.004; Fig. 4.1C; LDH, p = 0.008; Fig. 4.1D).

4.3.2 Presence of corticosteroid receptors on hepatic membranes

Crude membranes and purified membrane proteins isolated from whole liver were probed with the classical GR and MR antibodies to determine the presence of these receptors on the plasma membrane. Although protein levels were extremely low, both crude membranes and purified plasma membranes identified MR (Fig. 4.2A and C, respectively) and GR (Fig. 4.2B and D, respectively) proteins.

4.3.3 Novel corticosteroid receptors using cortisol-agarose affinity chromatography

Concentrated bands from the washed and eluted fractions were detected using the

SYPRO protein gel stain and the identification of two bands were evident at ~ 90 kDa and 63 kDa (Fig. 4.3). To determine whether the band at ~90 kDa was GR, proteins were probed with the classical GR antibody but the protein of interest was not detected (Fig.

4.4). Results from mass spectrometry produced several hits aligned to the rainbow trout database. The results identified G6P/PDH endoplasmic bifunctional protein and adenosylhomocysteinase, respectively, as the most probable proteins isolated from the affinity columns (Table 4.1).

Fig. 4.1 Enrichment of hepatic membranes Crude membranes and purified plasma membranes were isolated from whole liver and the activity of 5’AMP nucleotidase was measured to confirm enrichment of membranes from both membrane isolation techniques (A and C). LDH was measured to confirm a reduction in cytosolic contamination (B and D). Bars represent mean ± SEM. Bars with * indicate significance (paired Student’s t-test, p < 0.05; n = 5 independent fish). Abbreviations: LDH – lactate dehydrogenase.

Fig. 4.2 The presence of GR and MR are located on the plasma membrane of trout liver Crude membranes and purified plasma membranes were isolated from whole liver. Homogenates (40 µg) were probed with affinity-purified zebrafish MR (A, C) and recombinant trout GR (B, D) antibodies. Representative blots for each receptor are shown for the crude membrane (A, B) and sucrose gradient isolation (C, D) techniques. Densitometric values were normalized to total protein. Bars represent mean ± SEM (n = 5-7 independent fish). Abbreviations: H – liver homogenate control; CM – crude membranes; PPMP – purified plasma membrane proteins; PPM – purified plasma membranes isolated using a sucrose gradient. 72

Fig. 4.3 Isolation of cortisol-bound proteins by affinity chromatography Purified plasma membrane proteins (1.5 mg/mL) were loaded onto affinity-agarose columns and placed in the 4°C fridge overnight with gentle end-over-end rocking. Unbound proteins were washed with binding buffer A while any cortisol-bound proteins were eluted using binding buffer A containing 0.5 mg/mL hydrocortisone. Proteins were concentrated using the Amicon® Ultra 15 mL Centrifugal filters with a 10,000-molecular weight cut-off. The gel was stained using SYPRO-Ruby (10 µg protein). Bands surrounded by red squares were sent for mass spectrometry at the University of Calgary sequencing facility (see Table 4.1 for peptide sequences). Lanes: 1 - molecular ladder; 2- 3 – concentrated washes; 4-5 – concentrated elutions.

Fig. 4.4 Identity confirmation of cortisol-bound proteins by affinity chromatography Concentrated proteins (10 µg) isolated using affinity columns were probed using recombinant trout GR antibody. Lanes: 1 – molecular ladder; 2-3 – concentrated washes; 4-6 – concentrated elutions using the Amicon tubes.

Table 4.1 Mass spectrometry results for select hits of putative cortisol-bound proteins Gel was stained using SYPRO-Ruby (10 µg protein) with the bands removed and sent for mass spectrometry at the University of Calgary sequencing facility. Protein band numbers correspond to the red boxes in Fig. 4.3. Sequences were aligned using the rainbow trout (Oncorhynchus mykiss) database.

Protein Sequence Molecular Unique Sequences Band # Identification # Weight Peptides (kDa)

(K)DKATPFLFEALK(G) (K)LAEYWQLK(T) (K)TSEDYQALGK(H) (K)HLTEQLTQEGIVEAGR (L) 1 gi|642106777 90 13 (K)HLDPIWNK(H) (R)IPFYDQYGVIR(D) GDP/6PGL (K)IFSALQHLDR(N) endoplasmic (K)MPIILTSGK(M) bifunctional protein- (R)LAADLQASAEK(A) like (R)CVPLTELDSNFR(T) (K)VGVLVMGK(S) (K)SKHELVTQLSR(V) (K)SKHELVTQLSR(V)

(R)ELYGQSKPLK(G) (K)TGVPVYAWK(G) (K)GVSEETTTGVHNLYK( 2 gi|642121680 48 8 M) (K)IPAINVNDSVTK(S) adenosylhomocysteina (R)ESLIDGIKR(A) se (R)ATDVMIAGK(V) (K)VAVVAGYGDVGK(G) (K)KLDEEVAAAHLDK(L)

4.4 Discussion

To date, a membrane cortisol receptor(s) has not been identified in any model organism (Das et al., 2018). Therefore, the objective of this study was to identify and isolate cortisol-binding membrane proteins from rainbow trout liver using various purification techniques and elucidate a role for these receptors in mediating nongenomic cortisol effects for stress adaptation.

The results from this study suggest the presence of the corticosteroid receptors

(GR and MR) on the plasma membrane fractions of trout liver (Fig. 4.2) as evident using the classical recombinant GR and affinity purified MR antibodies. Rapid effects of glucocorticoids in mammals have reportedly suggested the involvement of GR in eliciting rapid signalling events. For instance, cortisol reduced adrenocorticotropic hormone (ACTH) from a rat pituitary cell line in a GR-dependent pathway (Solito et al.,

2003), suggesting a feedback mechanism upon cortisol treatment. Another study showed cortisol rapidly inhibited phosphorylation of Lck and Fyn substrates via a GR-mediated pathway in human lymphocytes (Lowenberg et al., 2005), demonstrating a role for glucocorticoids in modulating immunosuppressive processes.

Indeed, the intracellular cortisol receptors have been extensively characterized and reviewed in fish models (Bury et al., 2003; Faught and Vijayan, 2016; Mommsen et al.,

1999; Prunet et al., 2006; Stolte et al., 2006). In fish, cortisol rapidly induced reactive oxygen species (ROS) in rainbow trout skeletal myotubules within 15 min of cortisol induction (Espinoza et al., 2017). This response was blocked by RU486, a GR antagonist but not by the MR antagonist, RU23180, suggesting that a membrane-GR mechanism

may be participating in rapid glucocorticoid signalling involved in muscle metabolism

(Espinoza et al., 2017). In the liver of the Mozambique tilapia, cortisol decreases the activities of liver malic enzyme, glucose-6-phosphate dehydrogenase, and isocitrate dehydrogenase within 5-l0 min in vitro (Sunny et al., 2002). Tilapia injected with cortisol in a short-term in vivo study also showed similar results within 30 min of hormone addition, further suggesting a role in regulating lipid metabolism and possibly promoting gluconeogenesis (Sunny et al., 2002).

We further examined whether a novel corticosteroid receptor(s) distinct from the intracellular GR and MR, were present on hepatic plasma membranes. The results suggest the elution of two proteins of approximately 90 kDa and 63 kDa in size, respectively (Fig. 4.3). The 90 kDa novel protein suggests an identity that was distinct from the classical GR as examined through western blotting probed with the classical GR antibody (Fig. 4.4). Interestingly, the 63 kDa protein was in accordance with a partial purification and biochemical characterization of a cortisol-binding protein identified in neuronal membranes of the rough-skinned newt, Taricha granulosa (Evans et al., 2000).

The identities of the two protein bands sent for mass spectrometry produced sequence hits that were inconclusive with plasma membrane proteins (Table 4.1). Although the enrichment of the membranes was confirmed using known biomarkers (5’AMP nucleotidase and LDH; Fig. 4.1), we suspect possible translocation of these proteins

(GDP/6PGL endoplasmic bifunctional protein and adenosylhomocysteinase) to the membrane, as evident with the intracellular corticosteroid receptors (Das et al., 2018).

However, it is still unclear whether a novel membrane receptor is involved in the rapid activation of corticosteroids and the functional characterization remains incomplete.

Ligand binding studies have located membrane binding sites for corticosteroids reported in various non-teleost tissues including mouse lymphocytes (Gametchu, 1987), amphibian brain (Orchinik et al., 1991), plasma, liver, lymphoid organs, and brain of zebra finches (Schmidt et al., 2010), chicken liver (Trueba et al., 1987), and rodent pituitary (Koch et al., 1977). However, less is known in fish models. A single study examined a unique membrane binding moiety on the liver and kidney in the Mozambique tilapia, Oreochromis mossambicus (Johnstone et al., 2013). These binding sites showed high affinity for cortisol: liver (Kd = 9.5 nM) and kidney (Kd = 30.08 nM; Johnstone et al., 2013). Interestingly, RU486 and dexamethasone displayed no affinity for the membrane receptors (Johnstone et al., 2013), demonstrating that these ligand binding sites are distinct from the classical receptors (Bury et al., 2003). In addition, there has been extensive research examining nonclassical steroid actions with regards to the sex steroids such as androgens, estrogens, and progestins (Thomas et al., 2006). Reports of non-classical steroid receptors have been identified in mammalian and non-mammalian models. For example, membrane progesterone receptor alpha (mPRα) is expressed on the cell surface of fish oocytes involved in the rapid progestin induction of oocyte maturation

(Hanna and Zhu, 2009; Tokumoto et al., 2006) while the membrane estrogen receptor, G- protein coupled receptor 30 (GPCR30), localized on the cell surface of Atlantic croaker

(Micropagonias undulatus) and zebrafish oocytes are known to mediate oocyte maturation of estrogen inhibition (Pang and Thomas, 2010, 2009).

In conclusion, the results suggest for the first time that the classical GR and MR are localized at the plasma membrane and we postulate the potential of these receptors to act as initiators for nongenomic cortisol signalling in the liver. Furthermore, we propose a

role for these receptors in mediating rapid stress signalling in trout, possibly through gluconeogenesis and energy substrate repartitioning, but this has not been elucidated yet.

While the identity of putative glucocorticoid membrane receptors requires further examination, the discovery of possible receptors will have huge implications in our understanding of adaptive stress coping mechanisms. However, ligand-binding studies will need to be conducted for further characterization of these proteins.

4.5 Acknowledgements

This study was supported by the Natural Sciences Engineering Research Council

(NSERC) of Canada discovery grant awarded to MMV. MT is the recipient of the Queen

Elizabeth II Masters scholarship and the sole author of this manuscript.

Chapter Five: General Conclusions

5.1 Summary of findings

The mechanisms of nongenomic cortisol action in lower vertebrates is greatly lacking in comparison to mammalian systems (reviewed in Das et al., 2018; Chapter

One). Previous work from our laboratory established that cortisol could cause activation of signalling cascades due to changes in membrane fluidity (Dindia et al., 2013, 2012), however, the physiological consequences remain unknown. The overall goal of this thesis was to further examine the mechanisms involved in nongenomic glucocorticoid signalling and elucidate the contribution of the rapid signalling pathway on the metabolic response to stress in rainbow trout (Oncorhynchus mykiss). We tested the hypothesis that rapid cortisol action mediating rapid physiological responses in the liver involved membrane-bound glucocorticoid receptor activation with effects likely to contribute to acute stress adaptation. For the first time, we established that:

I. Cortisol rapidly activated CREB within 10 min of cortisol treatment in trout

hepatocytes (Chapter Two). The response was neither abolished by the GR (RU486)

or MR (eplerenone) antagonists. The hypothesis is that CREB activation may be

stimulated by direct perturbations to the plasma membrane as observed for MAPK

and PKA, Akt (PKB), and PKC substrate proteins (Dindia et al., 2013, 2012).

II. Stressor exposure significantly reduced ROS production and GSH in vivo (Chapter

Three). The postulation is that stress-mediated reduction in ROS and GSH may be

playing protective roles during acute stressor exposure. The rapid response of ROS

to stress was not mediated by GR signalling as RU486 did not block this effect in

liver slices in vitro.

III. Cortisol does not rapidly affect the transcription of glucocorticoid-targeted genes

associated with the corticosteroid receptors, and biomarkers for immune, growth,

metabolic, and oxidative stress systems (Chapter Three). Therefore, we hypothesize

a role for genomic activation in directly regulating the stress response at the

transcriptional level.

IV. The corticosteroid receptors, GR and MR, are also seen on the plasma membrane of

trout liver (Chapter Four). Novel corticosteroid membrane receptor(s) remain

unidentified in teleost models and requires further investigation.

Overall, this thesis emphasizes the physiological implications of rapid cortisol signalling. It is clear from the overview of this thesis that cortisol may be affecting the metabolic stress response in a nongenomic manner as certain signalling pathways such as

CREB (Fig. 5.1) are altered, which may be playing a role in the energetic repartitioning process for stress adaptation. In addition, stress-mediated reduction in oxidative stress may be beneficial against apoptosis and in reducing energy demanding processes for coping with stress in the liver. Therefore, possible mechanisms of action worthy of future research include CREB-activated transcription and signalling pathways as well as ROS- regulated systems for modulation of the metabolic response to stress in this tissue. While it is known that GR can rapidly translocate to the membrane (Das et al., 2018), and remain associated with the membrane (Chapter Four; Fig. 5.1), RU486 had no effect on the endpoints examined in this thesis and, thus, do not appear to be regulated by GR.

Therefore, the results further support a novel receptor-mediated stress response through activation of membrane-bound corticosteroid receptors.

Fig. 5.1 Schematic diagram representing nongenomic cortisol action in teleost liver In response to stress, cortisol signals through genomic (delayed; pink arrows) and nongenomic (rapid; black arrows) mechanisms. The rapid response is initiated at the membrane to induce a plethora of cellular processes for coping with stress. Abbreviations: GR – glucocorticoid receptor; MR – mineralocorticoid receptor; PKA – protein kinase A; PKB – protein kinase B; PKC – protein kinase C; MAPK – mitogen-activated protein kinase; CREB – cAMP response element binding protein; ROS – reactive oxygen species. 83

5.2 Future directions

Ligand-binding assays have been one of the most useful tools for measuring ligand-receptor interactions as well as in determining the binding affinity and specificity of receptors to their ligands (De Jong et al., 2005). Radioactively-labeled ligands have proven advantageous for their effectiveness and sensitivity for measuring binding parameters and have been used previously for the identification of membrane receptors for the sex steroids in fish (Hanna and Zhu, 2009; Tokumoto et al., 2006). Therefore, it would be interesting to conduct follow-up experiments to characterize the binding activity of these novel corticosteroid receptor(s) in the liver. This would allow us to clone and sequence the novel receptors and produce a peptide antibody to study the regulation patterns of the receptor and its response on downstream signalling pathways.

In addition, future studies should also be targeted at further investigating the mechanisms of nongenomic corticosteroid action and the receptors that mediate these changes to better understand stress coping mechanisms (Das et al., 2018). For instance, advances in gene knockout and knockdown technologies such as CRISPR/Cas9 and

Morpholinos, respectively, would aid in differentiating cortisol effects mediated by GR activation and those mediated by corticosteroid membrane receptors. Furthermore, this would better highlight the functional relevance of GR in regulating rapid signalling events during stress adaptation.

Bibliography

Abou-Samra, A.B., Catt, K.J., Aguilera, G., 1986. Biphasic inhibition of adrenocorticotropin release by corticosterone in cultured anterior pituitary cells. Endocrinology 119, 972–977.

Agnisola, C., Masullo, P., Mustafa, T., 2004. Short-term responses of coronary circulation to cortisol and estrogen in trout (Oncorhynchus mykiss). Gen. Comp. Endocrinol. 135, 210–216.

Alderman, S.L., McGuire, A., Bernier, N.J., Vijayan, M.M., 2012. Central and peripheral glucocorticoid receptors are involved in the plasma cortisol response to an acute stressor in rainbow trout. Gen. Comp. Endocrinol. 176, 79–85.

Alderman, S.L., Vijayan, M.M., 2012. 11β-Hydroxysteroid dehydrogenase type 2 in zebrafish brain: a functional role in hypothalamus-pituitary-interrenal axis regulation. J. Endocrinol. 215, 393–402.

Alsop, D., Vijayan, M., 2009. The zebrafish stress axis: Molecular fallout from the teleost-specific genome duplication event. Gen. Comp. Endocrinol. 161, 62–66.

Altarejos, J.Y., Montminy, M., 2011. CREB and the CRTC co-activators: Sensors for hormonal and metabolic signals. Nat. Rev. Mol. Cell Biol. 12, 141-151.

Aluru, N., Vijayan, M.M., 2009. Stress transcriptomics in fish: A role for genomic cortisol signaling. Gen. Comp. Endocrinol. 164, 142–150.

Aluru, N., Vijayan, M.M., 2007. Hepatic transcriptome response to glucocorticoid receptor activation in rainbow trout. Physiol Genomics 31, 483–491.

Asayama, K., Hayashibe, H., Dobashi, K., Uchida, N., Kato, K., 1992. Effect of dexamethasone on antioxidant enzymes in fetal rat lungs and kidneys. Biol. Neonate 62, 136–144.

Ayroldi, E., Cannarile, L., Migliorati, G., Nocentini, G., Delfino, D. V., Riccardi, C., 2012. Mechanisms of the anti-inflammatory effects of glucocorticoids: Genomic and nongenomic interference with MAPK signaling pathways. FASEB J. 26, 4805– 4820.

Barton, B.A., 2002. Stress in fishes: A diversity of responses with particular reference to changes in circulating corticosteroids. Integr. Comp. Biol. 42, 517–525.

Best, C., Melnyk-Lamont, N., Gesto, M., Vijayan, M.M., 2014. Environmental levels of the antidepressant venlafaxine impact the metabolic capacity of rainbow trout. Aquat. Toxicol. 155, 190–198.

Borski, R.J., 2000. Nongenomic membrane actions of glucocorticoids in vertebrates. Trends Endocrinol. Metab. 11, 427–436.

Borski, R.J., Helms, L.M., Richman, N.H., Grau, E.G., 1991. Cortisol rapidly reduces prolactin release and cAMP and 45Ca2+ accumulation in the cichlid fish pituitary in vitro. Proc. Natl. Acad. Sci. U. S. A. 88, 2758–62.

Borski, R.J., Hyde, G.N., Fruchtman, S., 2002. Signal transduction mechanisms mediating rapid, nongenomic effects of cortisol on prolactin release. Steroids 67, 539–548.

Borski, R.J., Hyde, G.N., Fruchtman, S., Tsai, W.S., 2001. Cortisol suppresses prolactin release through a non-genomic mechanism involving interactions with the plasma membrane. Comp. Biochem. Physiol. - B Biochem. Mol. Biol. 129, 533–541.

Bury, N.R., Sturm, A., 2007. Evolution of the corticosteroid receptor signalling pathway in fish. Gen. Comp. Endocrinol. 153, 47–56.

Bury, N.R., Sturm, A., Le Rouzic, P., Lethimonier, C., Ducouret, B., Guiguen, Y., Robinson-Rechavi, M., Laudet, V., Rafestin-Oblin, M.E., Prunet, P., 2003. Evidence for two distinct functional glucocorticoid receptors in teleost fish. J. Mol. Endocrinol. 31, 141–156.

Butler, P.J., Tsou, T.C., Li, J.Y.S., Usami, S., Chien, S., 2002. Rate sensitivity of shear- induced changes in the lateral diffusion of endothelial cell membrane lipids: a role for membrane perturbation in shear-induced MAPK activation. FASEB J. 16, 216– 218.

Castillo, J., Teles, M., Mackenzie, S., Tort, L., 2009. Stress-related hormones modulate cytokine expression in the head kidney of gilthead seabream (Sparus aurata). Fish Shellfish Immunol. 27, 493–499.

Christ, M., Günther, A., Heck, M., Schmidt, B.M.W., Falkenstein, E., Wehling, M., 1999. Aldosterone, not estradiol, is the physiological agonist for rapid increases in cAMP in vascular smooth muscle cells. Circulation 99, 1485–1491.

Colombe, L., Fostier, A., Bury, N., Pakdel, F., Guiguen, Y., 2000. A mineralocorticoid- like receptor in the rainbow trout, Oncorhynchus mykiss: cloning and characterization of its steroid binding domain. Steroids 65, 319–28.

Das, C., Thraya, M., Vijayan, M.M., 2018. Nongenomic cortisol signaling in fish. Gen. Comp. Endocrinol. 1–7.

De Bosscher, K., Vanden Berghe, W., Haegeman, G., Vanden, B.W., 2003. The interplay

between the glucocorticoid receptor and nuclear factor-kappa B or activator protein- 1: molecular mechanisms for gene repression. Endocr. Rev. 24, 488–522.

De Jong, L.A.A., Uges, D.R.A., Franke, J.P., Bischoff, R., 2005. Receptor-ligand binding assays: Technologies and applications. J. Chromatogr. B Anal. Technol. Biomed. Life Sci. 829, 1–25.

Dindia, L., Faught, E., Leonenko, Z., Thomas, R., Vijayan, M.M., 2013. Rapid cortisol signaling in response to acute stress involves changes in plasma membrane order in rainbow trout liver. Am. J. Physiol. Endocrinol. Metab. 304, E1157-66.

Dindia, L., Murray, J., Faught, E., Davis, T.L., Leonenko, Z., Vijayan, M.M., 2012. Novel Nongenomic Signaling by Glucocorticoid May Involve Changes to Liver Membrane Order in Rainbow Trout. PLoS One 7.

Dindia, L.A., 2013. Rapid and Nongenomic Glucocorticoid Signaling in Rainbow Trout. PhD Thesis.

Doyon, C., Leclair, J., Trudeau, V.L., Moon, T.W., 2006. Corticotropin-releasing factor and neuropeptide Y mRNA levels are modified by glucocorticoids in rainbow trout, Oncorhynchus mykiss. Gen. Comp. Endocrinol. 146, 126–135.

Ducouret, B., Tujaguei, M., Ashraf, J., Mouchel, N., Servel, N., Valotaire, Y., Thompson, E.B., 1995. Cloning of a teleost fish glucocorticoid receptor shows that it contains a deoxyribonucleic acid-binding domain different from that of mammals. Endocrinology 136, 3774–3783.

Espinoza, M.B., Aedo, J.E., Zuloaga, R., Valenzuela, C., Molina, A., Valdes, J.A., 2017. Cortisol induces reactive oxygen species through a membrane glucocorticoid receptor in rainbow trout myotubes. J. Cell. Biochem. 118, 718–725.

Evans, S.J., Murray, T.F., Moore, F.L., 2000. Partial purification and biochemical characterization of a membrane glucocorticoid receptor from an amphibian brain. J. Steroid Biochem. Mol. Biol. 72, 209–221.

Faught, E., Aluru, N., Vijayan, M.M., 2016a. The Molecular Stress Response, Fish Physiology. Elsevier Inc. 35, 113–166.

Faught, E., Best, C., Vijayan, M.M., 2016b. Maternal stress-associated cortisol stimulation may protect embryos from cortisol excess in zebrafish. R. Soc. 3, 1–9.

Faught, E., Vijayan, M.M., 2016. Mechanisms of cortisol action in fish hepatocytes. Comp. Biochem. Physiol. Part - B Biochem. Mol. Biol. 199, 136–145.

Gametchu, B., 1987. Glucocorticoid receptor-like antigen in lymphoma cell membranes:

correlation to cell lysis. Science 236, 456–61.

Gerritsen, M.E., Schwarz, S.M., Medow, M.S., 1991. Glucocorticoid-mediated alterations in fluidity of rabbit cardiac muscle microvessel endothelial cell membranes: influences on eicosanoid release. BBA - Biomembr. 1065, 63–68.

Ghosh, A.K., Pore, N., Basu, R., De, S., Nandy, P., 1996. Lipid perturbation by corticosteroids: An anisotropic study. Colloids Surfaces B Biointerfaces 7, 65–68.

Gomez-Muñoz, a, Hales, P., Brindley, D.N., Sancho, M.J., 1989. Rapid activation of glycogen phosphorylase by steroid hormones in cultured rat hepatocytes. Biochem. J. 262, 417–23.

Gravel, A., Wilson, J.M., Pedro, D.F.N., Vijayan, M.M., 2009. Non-steroidal anti- inflammatory drugs disturb the osmoregulatory, metabolic and cortisol responses associated with seawater exposure in rainbow trout. Comp. Biochem. Physiol. - C Toxicol. Pharmacol. 149, 481–490.

Groeneweg, F.L., Karst, H., de Kloet, E.R., Joëls, M., 2011. Rapid non-genomic effects of corticosteroids and their role in the central stress response. J. Endocrinol. 209, 153–167.

Hanna, R.N., Zhu, Y., 2009. Expression of membrane progestin receptors in zebrafish (Danio rerio) oocytes, testis and pituitary. Gen. Comp. Endocrinol. 161, 153–157.

Hayashi, H., Kobara, M., Abe, M., Tanaka, N., Gouda, E., Toba, H., Yamada, H., Tatsumi, T., Nakata, T., Matsubara, H., 2008. Aldosterone Nongenomically Produces NADPH Oxidase–Dependent Reactive Oxygen Species and Induces Myocyte Apoptosis. Hypertens Res 31, 363–375.

Hyde, G.N., Seale, A.P., Grau, E.G., Borski, R.J., 2004. Cortisol rapidly suppresses intracellular calcium and voltage-gated calcium channel activity in prolactin cells of the tilapia (Oreochromis mossambicus). Am. J. Physiol. Endocrinol. Metab. 286, E626–E633.

Iwama, G.K., McGeer, J.C., Bernier, N.J., 1992. The effects of stock and rearing history on the stress response in juvenile coho salmon (Oncorhynchus kisutch). Introd. Transf. Aquat. Species. 1990 17–83.

Johnstone, W.M., Mills, K.A., Alyea, R.A., Thomas, P., Borski, R.J., 2013. Characterization of membrane receptor binding activity for cortisol in the liver and kidney of the euryhaline teleost, Mozambique tilapia (Oreochromis mossambicus). Gen. Comp. Endocrinol. 192, 107–114.

Jozefczak, M., Remans, T., Vangronsveld, J., Cuypers, A., 2012. Glutathione is a key

player in metal-induced oxidative stress defenses. Int. J. Mol. Sci. 13, 3145–3175.

Kelly, S.P., Chasiotis, H., 2011. Glucocorticoid and mineralocorticoid receptors regulate paracellular permeability in a primary cultured gill epithelium. J. Exp. Biol. 214, 2308–2318.

Kiilerich, P., Tipsmark, C.K., Borski, R.J., Madsen, S.S., 2011. Differential effects of cortisol and 11-deoxycorticosterone on ion transport protein mRNA levels in gills of two euryhaline teleosts, Mozambique tilapia (Oreochromis mossambicus) and striped bass (Morone saxatilis). J. Endocrinol. 209, 115–126.

Klover, P.J., Mooney, R.A., 2004. Hepatocytes: Critical for glucose homeostasis. Int. J. Biochem. Cell Biol. 36, 753–758.

Koch, B., Lutz Bucher, B., Briaud, B., Mialhe, C., 1977. Glucocorticoid binding to plasma membranes of the adenohypophysis. J. Endocrinol. 73, 399–400.

Kratschmar, D. V., Calabrese, D., Walsh, J., Lister, A., Birk, J., Appenzeller-Herzog, C., Moulin, P., Goldring, C.E., Odermatt, A., 2012. Suppression of the Nrf2-dependent antioxidant response by glucocorticoids and 11β-HSD1-mediated glucocorticoid activation in hepatic cells. PLoS One 7.

Kubokawa, K., Yoshioka, M., Iwata, M., 2001. Sex-specific Cortisol and Sex Steroids Responses in Stressed Sockeye Salmon during Spawning Period. Zoolog. Sci. 18, 947–954.

Lei, B., Morris, D.P., Smith, M.P., Schwinn, D.A., 2009. Lipid rafts constrain basal α1A- adrenergic receptor signaling by maintaining receptor in an inactive conformation. Cell. Signal. 21, 1532–1539.

Lidman U., D.G.J.-S.M.L., 1979. Metabolic effects of cortisol in the European eel, Anguilla anguilla (L.). Comp. Biochem. Physiol. 63, 339–344.

Lösel, R., Feuring, M., Wehling, M., 2002. Non-genomic aldosterone action: From the cell membrane to human physiology. J. Steroid Biochem. Mol. Biol. 83, 167–171.

Lösel, R., Wehling, M., 2003. Nongenomic actions of steroid hormones. Nat. Rev. Mol. Cell Biol. 4, 46–56.

Losel, R.M., Falkenstein, E., Feuring, M., Schultz, A., Tillmann, H.-C., Rossol-Haseroth, K., Wehling, M., 2003. Nongenomic steroid action: controversies, questions, and answers. Physiol. Rev. 83, 965–1016.

Lowenberg, M., Tuynman, J., Bilderbeek, J., Gaber, T., Buttgereit, F., Van Deventer, S., Peppelenbosch, M., Hommes, D., 2005. Rapid immunosuppressive effects of

glucocorticoids mediated through Lck and Fyn. Blood 106, 1703–1710.

Löwenberg, M., Verhaar, A.P., van den Brink, G.R., Hommes, D.W., 2007. Glucocorticoid signaling: a nongenomic mechanism for T-cell immunosuppression. Trends Mol. Med. 13, 158–163.

Mayr, B., Montminy, M., 2001. Transcriptional regulation by the phosphorylation- dependent factor creb. Nat. Rev. Mol. Cell Biol. 2, 599–609.

McKay, L.I., Cidlowski, J. a, 1999. Molecular Control of Immune / Inflammatory Responses: Interactions Between Nuclear Factor- kB and Steroid Receptor- Signaling Pathways. Endocr. Rev. 20, 435–459.

Metz, J.R., Peters, J.J.M., Flik, G., 2006. Molecular biology and physiology of the melanocortin system in fish: a review. Gen. Comp. Endocrinol. 148, 150–162.

Mommsen, T.P., Vijayan, M.M., Moon, T.W., 1999. Cortisol in teleosts: dynamics, mechanisms of action, and metabolic regulation. Rev. Fish Biol. Fish. 9, 211–268.

Nesan, D., Kamkar, M., Burrows, J., Scott, I.C., Marsden, M., Vijayan, M.M., 2012. Glucocorticoid receptor signaling is essential for mesoderm formation and muscle development in zebrafish. Endocrinology 153, 1288–1300.

Olla, B.L., Davis, M.W., Schreck, C.B., 1995. Stress-induced impairment of predator evasion and non-predator mortality in Pacific salmon. Aquac. Res. 26, 393–398.

Orchinik, M., Murray, T.F., Moore, F.L., 1991. A corticosteroid receptor in neuronal membranes. Science 252, 1848–51.

Pang, Y., Thomas, P., 2010. Role of G protein-coupled estrogen receptor 1, GPER, in inhibition of oocyte maturation by endogenous estrogens in zebrafish. Dev. Biol. 342, 194–206.

Pang, Y., Thomas, P., 2009. Involvement of estradiol-17β and its membrane receptor, G protein coupled receptor 30 (GPR30) in regulation of oocyte maturation in zebrafish, Danio rario. Gen. Comp. Endocrinol. 161, 58–61.

Philip, A.M., Daniel Kim, S., Vijayan, M.M., 2012. Cortisol modulates the expression of cytokines and suppressors of cytokine signaling (SOCS) in rainbow trout hepatocytes. Dev. Comp. Immunol. 38, 360–367.

Philip, A.M., Vijayan, M.M., 2015. Stress-immune-growth interactions: Cortisol modulates suppressors of cytokine signaling and JAK/STAT pathway in rainbow trout liver. PLoS One 10.

Pickering, A.D., Pottinger, T.G., Sumpter, J.P., 1987. On the use of dexamethasone to block the pituitary-interrenal axis in the brown trout, Salmo trutta L. Gen. Comp. Endocrinol. 65, 346–353.

Pottinger, T.G., Balm, P.H.M., Pickering, A.D., 1995. Sexual maturity modifies the responsiveness of the pituitary-interrenal axis to stress in male rainbow trout. Gen. Comp. Endocrinol. 98, 311–320.

Pottinger, T.G., Moran, T.A., 1993. Differences in plasma cortisol and cortisone dynamics during stress in two strains of rainbow trout (Oncorhynchus mykiss). J. Fish Biol. 43, 121–130.

Prunet, P., Sturm, A., Milla, S., 2006. Multiple corticosteroid receptors in fish: From old ideas to new concepts. Gen. Comp. Endocrinol.147, 17–23.

Quelle, F.W., Smith, R. V., Hrycyna, C.A., Kaliban, T.D., Crooks, J.A., O’Brien, J.M., 1988. [3H]Dexamethasone binding to plasma membrane-enriched fractions from liver of nonadrenalectomized rats. Endocrinology 123, 1642–1651.

Ramnanan, C.J., Edgerton, D.S., Kraft, G., Cherrington, A.D., 2011. Physiologic action of glucagon on liver glucose metabolism. Diabetes, Obes. Metab. 13, 118–125.

Reid, S.D., Moon, T.W., Perry, S.F., 1992. Rainbow trout hepatocyte beta-adrenoceptors, catecholamine responsiveness, and effects of cortisol. Am. J. Physiol. 262, R794- 799.

Romero, L.M., Dickens, M.J., Cyr, N.E., 2009. The reactive scope model - A new model integrating homeostasis, allostasis, and stress. Horm. Behav. 55, 375–389.

Rosa, C.E., Figueiredo, M.A., Lanes, C.F.C., Almeida, D. V., Monserrat, J.M., Marins, L.F., 2008. Metabolic rate and reactive oxygen species production in different genotypes of GH-transgenic zebrafish. Comp. Biochem. Physiol. - B Biochem. Mol. Biol. 149, 209–214.

Roy, B., Rai, U., 2009. Genomic and non-genomic effect of cortisol on phagocytosis in freshwater teleost Channa punctatus: An in vitro study. Steroids 74, 449–455.

Sadoul, B., Vijayan, M.M., 2016. Stress and Growth, Fish Physiology. Elsevier Inc. 35, 167–205.

Samuel, V.T., Liu, Z.-X., Wang, A., Beddow, S. a, Geisler, J.G., Kahn, M., Zhang, X., Monia, B.P., Bhanot, S., Shulman, G.I., 2007. Inhibition of protein kinase Cepsilon prevents hepatic insulin resistance in nonalcoholic fatty liver disease. J. Clin. Invest. 117, 739–45.

Samuel, V.T., Petersen, K.F., Shulman, G.I., 2010. Lipid-induced insulin resistance: unravelling the mechanism. Lancet. 375, 2267–2277.

Sapolsky, R.M., Romero, L.M., Munck, A.U., 2000. How do glucocorticoids influence stress responses? Integrating permissive, suppressive, stimulatory, and preparative actions. Endocr. Rev. 21, 55–89.

Sathiyaa, R., Vijayan, M.M., 2003. Autoregulation of glucocorticoid receptor by cortisol in rainbow trout hepatocytes. AJP Cell Physiol. 284, C1508–C1515.

Schaaf, M.J.M., Champagne, D., van Laanen, I.H.C., van Wijk, D.C.W. a, Meijer, A.H., Meijer, O.C., Spaink, H.P., Richardson, M.K., 2008. Discovery of a functional glucocorticoid receptor beta-isoform in zebrafish. Endocrinology 149, 1591–9.

Schmidt, K.L., Malisch, J.L., Breuner, C.W., Soma, K.K., 2010. Corticosterone and cortisol binding sites in plasma, immune organs and brain of developing zebra finches: Intracellular and membrane-associated receptors. Brain. Behav. Immun. 24, 908–918.

Seiliez, I., Gabillard, J.-C., Skiba-Cassy, S., Garcia-Serrana, D., Gutiérrez, J., Kaushik, S., Panserat, S., Tesseraud, S., 2008. An in vivo and in vitro assessment of TOR signaling cascade in rainbow trout (Oncorhynchus mykiss). Am. J. Physiol. Regul. Integr. Comp. Physiol. 295, 329–335.

Shimizu, N., Yoshikawa, N., Ito, N., Maruyama, T., Suzuki, Y., Takeda, S.I., Nakae, J., Tagata, Y., Nishitani, S., Takehana, K., Sano, M., Fukuda, K., Suematsu, M., Morimoto, C., Tanaka, H., 2011. Crosstalk between glucocorticoid receptor and nutritional sensor mTOR in skeletal muscle. Cell Metab. 13, 170–182.

Simon, H.-U., Haj-Yehia, A., Levi-Schaffer, F., 2000. Role of reactive oxygen species (ROS) in apoptosis induction. Apoptosis 5, 415–418.

Smith, P.K., Krohn, R.I., Hermanson, G.T., Mallia, A.K., Gartner, F.H., Provenzano, M.D., Fujimoto, E.K., Goeke, N.M., Olson, B.J., Klenk, D.C., 1985. Measurement of protein using bicinchoninic acid. Anal. Biochem. 150, 76–85.

Solito, E., Mulla, A., Morris, J.F., Christian, H.C., Flower, R.J., Buckingham, J.C., 2003. Dexamethasone induces rapid serine-phosphorylation and membrane translocation of annexin 1 in a human folliculostellate cell line via a novel nongenomic mechanism involving the glucocorticoid receptor, protein kinase C, phosphatidylinositol 3-kinase, and mitogen-activated protein kinase. Endocrinology 144, 1164–1174.

Solyom, A., Lauter, C.J., Trams, E.G., 1972. Plasma membranes from isolated liver cells. BBA - Biomembr. 274, 631–637.

Srikanth, K., Pereira, E., Duarte, A.C., Ahmad, I., 2013. Glutathione and its dependent enzymes’ modulatory responses to toxic metals and metalloids in fish-a review. Environ. Sci. Pollut. Res. 20, 2133–2149.

Stahn, C., Löwenberg, M., Hommes, D.W., Buttgereit, F., 2007. Molecular mechanisms of glucocorticoid action and selective glucocorticoid receptor agonists. Mol. Cell. Endocrinol. 275, 71–78.

Stocco, D.M., 2000. The role of the StAR protein in steroidogenesis: Challenges for the future. J. Endocrinol. 164, 247–253.

Stolte, E.H., Verburg van Kemenade, B.M.L., Savelkoul, H.F.J., Flik, G., 2006. Evolution of glucocorticoid receptors with different glucocorticoid sensitivity. J. Endocrinol. 190, 17–28.

Sturm, A., Bury, N., Dengreville, L., Fagart, J., Flouriot, G., Rafestin-Oblin, M.E., Prunet, P., 2005. 11-Deoxycorticosterone is a potent agonist of the rainbow trout (Oncorhynchus mykiss) mineralocorticoid receptor. Endocrinology 146, 47–55.

Sturm, A., Colliar, L., Leaver, M.J., Bury, N.R., 2011. Molecular determinants of hormone sensitivity in rainbow trout glucocorticoid receptors 1 and 2. Mol. Cell. Endocrinol. 333, 181–189.

Sulakhe, S.J., 1987. Hepatic adrenergic receptors in the genetically diabetic C57 BL/KsJ (db/db) mouse. Int. J. Biochem. 19, 1181–1186.

Sunny, F., Lakshmy, P.S., Oommen, O. V., 2002. Rapid action of cortisol and testosterone on lipogenic enzymes in a fresh water fish Oreochromis mossambicus: Short-term in vivo and in vitro study. Comp. Biochem. Physiol. Biochem. Mol. Biol. 131, 297–304.

Sunny, F., Oommen, O. V, 2001. Rapid action of glucocorticoids on branchial ATPase activity in Oreochromis mossambicus : an in vivo and in vitro study. Comp. Biochem. Physiol. - B Biochem. Mol. Biol. 130, 323–330.

Takahashi, H., Sakamoto, T., 2013. The role of “mineralocorticoids” in teleost fish: Relative importance of glucocorticoid signaling in the osmoregulation and “central” actions of mineralocorticoid receptor. Gen. Comp. Endocrinol. 181, 223–228.

Taniguchi, C.M., Kondo, T., Sajan, M., Luo, J., Bronson, R., Asano, T., Farese, R., Cantley, L.C., Kahn, C.R., 2006. Divergent regulation of hepatic glucose and lipid metabolism by phosphoinositide 3-kinase via Akt and PKCλ/ζ. Cell Metab. 3, 343– 353.

Tasker, J.G., Di, S., Malcher-Lopes, R., 2006. Minireview: Rapid glucocorticoid signaling via membrane-associated receptors. Endocrinology 147, 5549–5556.

Tasker, J.G., Herman, J.P., 2011. Mechanisms of rapid glucocorticoid feedback inhibition of the hypothalamic–pituitary–adrenal axis. Stress 14, 398–406.

Thomas, P., 2012. Rapid steroid hormone actions initiated at the cell surface and the receptors that mediate them with an emphasis on recent progress in fish models. Gen. Comp. Endocrinol. 175, 367–383.

Thomas, P., 2003. Rapid, nongenomic steroid actions initiated at the cell surface: Lessons from studies with fish. Fish Physiol. Biochem. 28, 3–12.

Thomas, P., Dressing, G., Pang, Y., Berg, H., Tubbs, C., Benninghoff, A., Doughty, K., 2006. Progestin, estrogen and androgen G-protein coupled receptors in fish gonads. Steroids 71, 310–316.

Tokumoto, M., Nagahama, Y., Thomas, P., Tokumoto, T., 2006. Cloning and identification of a membrane progestin receptor in goldfish ovaries and evidence it is an intermediary in oocyte meiotic maturation. Gen. Comp. Endocrinol. 145, 101– 108.

Tort, L., 2011. Stress and immune modulation in fish. Dev. Comp. Immunol. 35, 1366– 1375.

Trueba, M., Guantes, J.M., Vallejo, a I., Sancho, M.J., Marino, a, Macarulla, J.M., 1987. Characterization of cortisol binding sites in chicken liver plasma membrane. Int. J. Biochem. 19, 957–62.

Vigh, L., Nakamoto, H., Landry, J., Gomez-Munoz, A., Harwood, J.L., Horvath, I., 2007. Membrane regulation of the stress response from prokaryotic models to mammalian cells, in: Annals of the New York Academy of Sciences. pp. 40–51.

Vijayan, M., Das, C., Wildering, W.C., 2017. Nongenomic action of cortisol in rainbow trout hepatocytes. FASEB J. 31, 1005–1009.

Vijayan, M., Mommsen, T., GlÉMet, H., Moon, T., 1996. Metabolic effects of cortisol treatment in a marine teleost, the sea raven. J. Exp. Biol. 199, 1509–14.

Vijayan, M.M., Leatherland, J.F., 1992. In vivo effects of the steroid analogue RU486 on some aspects of intermediary and thyroid metabolism of brook charr, Salvelinus fontinalis. J. Exp. Zool. 263, 265–271.

Vijayan, M.M., Raptis, S., Sathiyaa, R., 2003. Cortisol treatment affects glucocorticoid receptor and glucocorticoid-responsive genes in the liver of rainbow trout. Gen.

Comp. Endocrinol. 132, 256–263.

Vijayan, M.M., Reddy, P.K., Leatherland, J.F., Moon, T.W., 1994. The effects of cortisol on hepatocyte metabolism in rainbow trout: A study using the steroid analogue RU486. Gen. Comp. Endocrinol. 96, 75–94.

Wang, H., Kubica, N., Ellisen, L.W., Jefferson, L.S., Kimball, S.R., 2006. Dexamethasone represses signaling through the mammalian target of rapamycin in muscle cells by enhancing expression of REDD1. J. Biol. Chem. 281, 39128–39134.

Wedi, B., Straede, J., Wieland, B., Kapp, A., 1999. Eosinophil apoptosis is mediated by stimulators of cellular oxidative metabolisms and inhibited by antioxidants: involvement of a thiol-sensitive redox regulation in eosinophil cell death. Blood 94, 2365–2373.

Wendelaar Bonga, S.E., 1997. The stress response in fish. Physiol. Rev. 77, 591–625.

Whiting, K.P., Restall, C.J., Brain, P.F., 2000. Steroid hormone-induced effects on membrane fluidity and their potential roles in non-genomic mechanisms. Life Sci. 67, 743–757.

APPENDIX A: SUPPLEMENTARY MATERIAL TO CHAPTER THREE

A.1. Materials and Methods

A.1.1. Glucose measurement using liver slices in vitro

Glucose was measured as a biomarker for changes in the metabolic state upon acute stressor exposure. All chemicals were purchased from Sigma Aldrich (MO, USA) unless specified otherwise. Treatment of the liver slices was described in Chapter Three.

Glucose was measured calorimetrically using enzymatic hexokinase as described previously (Best et al., 2014).

A.1.2. Metabolomics

In addition to measuring changes in mRNA and protein levels, it is unknown whether cortisol rapidly modulates whole liver metabolome. Hepatocytes from rainbow trout were isolated and maintained as described in Chapter Three. Cells were incubated alone with control (ethanol) media or hydrocortisone (cortisol; 100 ng/mL) and sampled

30 min post-cortisol treatment. Cells were gently scraped, spun at 13,000xg (Thermo

Scientific, USA) for two min, and immediately frozen at -80°C. Pellets were homogenized in 50 mM TRIS and Roche protease inhibitor (Roche Diagnostics, CAN) followed by brief sonication (sonic dismembrator; Fisher Scientific, CAN). Samples were dissolved in 50% HPLC-grade methanol and the metabolites processed via mass spectrometry in the Metabolomics Laboratory at the University of Calgary (CAN). Peak intensity for each metabolite identified was sorted using the MAVEN software (WA,

USA). Protein concentration was determined using the bicinchoninic acid (BCA)

protocol (Smith et al., 1985) with standards derived from bovine serum albumin (BSA).

This was repeated with hepatocytes sampled from five independent fish.

A.1.3. Statistical analysis

The in vitro liver slices were analyzed using a two-way analysis of variance

(ANOVA) carried out in PRISM (GraphPad Software, Inc., USA) and conducted between treatment and time as independent factors. Statistics were performed on raw data. A probability of p < 0.05 was used to test for significance between treatments.

Metabolomics was analyzed using a principal component analysis (PCA) using the

MetaboAnalyst Software (McGill, CAN).

A.3. Results

Fig. A.1 Glucose production is not rapidly altered by cortisol in vitro Liver slices from the unstressed (control) group were incubated with cortisol (100 ng/mL), RU486 (1000 ng/mL), or in combination and sampled 0.5 and 1 h post-hormone treatment. RU486 was added 30 min prior to the addition of cortisol. All values represent mean ± SEM (repeated-measures two-way ANOVA, p > 0.05; n = 6 independent fish).

Fig. A.2 Cortisol does not rapidly affect whole liver metabolome PCA of hepatocytes incubated with control media or cortisol (100 ng/mL) and sampled 30 min post-hormone treatment. Metabolite values were normalized to total protein before plotting (n = 5 independent fish). Legend: red – control metabolites; green – cortisol-treated metabolites. Thank you to Ryan Groves at the University of Calgary’s Metabolomics facility for processing the samples.

APPENDIX B: SUPPLEMENTARY MATERIAL TO CHAPTER FOUR

B.1. Introduction

In addition to the three working hypotheses on the rapid mode of action of cortisol, it has been hypothesized that rapid cortisol effects in teleosts may involve alterations to intracellular Ca2+ levels by modulating Ca2+ channels located on the plasma membrane independently of membrane receptors (Das et al., 2018; Vijayan et al., 2017).

In fish, only a single study using prolactin cells has demonstrated a reduction in intracellular Ca2+ which involved suppression of voltage-gated Ca2+ channel activity in the Mozambique tilapia (Hyde et al., 2004). Therefore, it was interesting to examine whether any of the liver membrane proteins purified using the affinity columns were

ORAI-1 (Ca2+ release-activated Ca2+ CRAC channel subunit), which mediates Ca2+ influx following depletion stores of intracellular Ca2+ (Das et al., 2018).

B.2. Materials and Methods

B.2.1. SDS-PAGE and immunodetection

Purified cortisol membrane proteins isolated using affinity columns (prepared in

Laemmli’s buffer; see Chapter Four) were separated on an 8% SDS-PAGE gel and transferred onto a 0.45-µm-nitrocellulose membrane (Bio-Rad, CAN). At room temperature, the membrane was blocked for 1 h in 5% skim milk following an overnight incubation at 4°C with the zebrafish ORAI-1 primary (rabbit) polyclonal antibody (1:250 dilution; ProteinTech #13130-1-AP) prepared in 5% BSA and 0.05% NaN3. The blot was

100

incubated with anti-rabbit horseradish peroxidase (HRP)-labeled secondary antibody

(1:3300 dilution in 5% skim milk) for an additional 1 h. The protein bands were detected with ECL chemiluminescence (Bio-Rad, CAN) according to the manufacturer’s instructions and imaged using the Syngene G-Box Imager (GeneSys software, MD,

USA).

B.3. Results

Fig. B.1 Affinity chromatography purified cortisol proteins probed with ORAI-1 Concentrated proteins (10 µg) isolated using affinity columns were probed using ORAI-1 antibody overnight. The antibody detects two bands at 50 kDa and 35 kDa which were absent in the concentrated eluted fraction. Lanes: 1 – molecular ladder; 2 – crude membrane control; 3 – purified membrane protein control; 4 – concentrated eluate; 5 – concentrated wash.

101