DOCSLIB.ORG

Pseudotime Ordering of Single Human Β-Cells Reveals States Of

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Pseudotime Ordering of Single Human Β-Cells Reveals States Of Diabetes Volume 67, September 2018 1783 Pseudotime Ordering of Single Human b-Cells Reveals States of Insulin Production and Unfolded Protein Response Yurong Xin, Giselle Dominguez Gutierrez, Haruka Okamoto, Jinrang Kim, Ann-Hwee Lee, Christina Adler, Min Ni, George D. Yancopoulos, Andrew J. Murphy, and Jesper Gromada Diabetes 2018;67:1783–1794 | https://doi.org/10.2337/db18-0365 Proinsulin is a misfolding-prone protein, making its bio- misfolded protein load. This puts pressure on the endo- synthesis in the endoplasmic reticulum (ER) a stressful plasmic reticulum (ER) and results in accumulation of event. Pancreatic b-cells overcome ER stress by acti- misfolded proinsulin and cellular stress. The large demand vating the unfolded protein response (UPR) and reducing for proinsulin biosynthesis and folding makes b-cells insulin production. This suggests that b-cells transition highly susceptible to ER stress (7–9). between periods of high insulin biosynthesis and UPR- b-Cells are metabolically active, relying on oxidative mediated recovery from cellular stress. We now report phosphorylation for ATP generation (10). This generates ISLET STUDIES b the pseudotime ordering of single -cells from humans reactive oxygen species (ROS) and can result in oxidative without diabetes detected by large-scale RNA sequenc- stress. b-Cells have low antioxidant defense, further in- ing. We identified major states with 1) low UPR and low creasing their susceptibility to stress (11,12). ER stress and insulin gene expression, 2) low UPR and high insulin gene oxidative stress can enhance each other, because protein expression, or 3) high UPR and low insulin gene expres- misfolding results in the production of ROS, and these sion. The latter state was enriched for proliferating cells. Stressed human b-cells do not dedifferentiate and species can perturb the ER redox state and cause damage show little propensity for apoptosis. These data suggest to nascent proteins (13). b that human b-cells transition between states with high To counteract stress conditions, the -cells activate rates of biosynthesis to fulfill the body’s insulin require- a network of signaling pathways termed the unfolded ments to maintain normal blood glucose levels and UPR- protein response (UPR). This is composed of three parallel mediated recovery from ER stress due to high insulin pathways that are initiated by the ER transmembrane production. proteins IRE1, PERK, and ATF6 (14). These regulators trigger a signaling cascade that enhances protein folding activity, reduces ER workload, and promotes clearance of b-Cells of the endocrine pancreas produce large amounts misfolded proteins. Once cellular stress is cleared and of insulin, which is secreted in a finely regulated manner to homeostasis restored, this stress sensor program is deac- maintain blood glucose levels within a narrow range. In- tivated to prevent harmful UPR hyperactivation that could sulin biosynthesis accounts for .10% of total protein otherwise lead to apoptosis (14). production under basal conditions and increases up to b-Cell heterogeneity is well established at the functional 50% in the stimulated state (1,2). Proinsulin is a misfolding- level. Proteome and transcriptome studies confirmed the prone protein because up to 20% of initially synthe- heterogeneous nature of mouse and human b-cells and sized proinsulin fails to reach its mature conformation revealed genes and pathways characterizing these subpop- (3–6). Misfolded proinsulin is refolded or degraded. Under ulations (15). b-Cell heterogeneity likely represents dy- conditions of high insulin demand, proinsulin misfolding namic states rather than stable and distinct subpopulations can exceed the capacity of the b-cells to handle the because functional studies have shown that b-cells transition Regeneron Pharmaceuticals, Tarrytown, NY Y.X. and G.D.G. are co–first authors. Corresponding author: Jesper Gromada, [email protected]. © 2018 by the American Diabetes Association. Readers may use this article as fi Received 29 March 2018 and accepted 9 June 2018. long as the work is properly cited, the use is educational and not for pro t, and the work is not altered. More information is available at http://www.diabetesjournals This article contains Supplementary Data online at http://diabetes .org/content/license. .diabetesjournals.org/lookup/suppl/doi:10.2337/db18-0365/-/DC1. 1784 RNAseq and Human b-Cell States Diabetes Volume 67, September 2018 between periods of activity and rest. The transitions are not Expression Omnibus database using accession number synchronized between b-cells within individual islets (15). GSE114297. In this study, we applied large-scale RNA sequencing Single-Cell Data Analysis (RNAseq) to single human pancreatic islet cells from Cells were removed if the number of detected genes was donors without diabetes. The b-cells were ordered accord- ,500, total number of UMI was ,3,000, or viability score ing to their pseudotime. This was obtained by projecting was .0.2 (16). Viability score was defined by the ratio each cell onto a trajectory, and the ordered sequence of the between the sum of MT-RNR2, MT-ND1, MT-CO1, MT- cells was used to study dynamic changes in gene expres- CO2, MT-ATP8, MT-ATP6, MT-CO3, and MT-CYB expres- sion. This provides a higher resolution view of the gene sion (UMI) and total UMI. A high score indicates low expression landscape due to their dynamic and heteroge- viability. Mclust (R package) was used to assess cell- neous nature and helps understand the complex biolog- cell contamination and identify islet endocrine cell types. ical processes governing b-cell function. We identified DensityMclust function estimated bimodal distribution of distinct states with low UPR and low or high insulin gene GCG, INS, SST, PPY, and GHRL expression, namely, high- expression as well as cells with high UPR activation and expression and low-expression modes. Cells with more low insulin expression. The gene signatures and enriched pathways for each state are described. than one hormone in the high-expression mode were excluded (e.g., GCGhigh and INShigh). Cells with a single- RESEARCH DESIGN AND METHODS hormone in the high-expression mode were identified as + + + + + Human Islets GCG (a), INS (b), SST (d), PPY (PP), and GHRL (e) Islets from 12 donors without diabetes were obtained cells. With the retained single-hormone endocrine and from Prodo Laboratories (Supplementary Table 1). Donor nonendocrine cells, expression data were normalized by information and diabetes status were obtained from the the total UMI and scaled by a factor of 10,000 at cell level. patient’s medical record and, if available, the hemoglobin Seurat package identified cell clusters, cell-type subpop- A1c. Islets were digested at 37°C (10 min) using TrypLE ulations, and cluster-enriched genes. A total of 1,166 Express (Life Technologies). Cells were filtered (30-mm), variable genes were used for the principal component centrifuged, and resuspended (13 PBS containing 0.04% analysis. Cell clusters were identified using FindClusters BSA). Trypan blue staining revealed 91.2 6 3.3% (n = 12) (19 principal components and 0.8 resolution). The first cell viability. two t-Distributed Stochastic Neighbor Embedding di- mensions were used to visualize cell clusters. Enriched RNA Fluorescence In Situ Hybridization genes for each cluster were identified by FindMarkers Dissociated cells were placed on slides using Cytospin and (.25% cell detection; P , 0.05 and log-scale fold change fixed (10% neutral buffered formalin) for 35 min. Islets .0.25). b-Cell subpopulation markers were defined as were fixed in the same way, embedded in paraffin, and enriched genes in one subpopulation over the rest of cut (6-mm sections). Cells and islet sections were permea- the subpopulations, as described above. Enriched endo- bilized and hybridized with mRNA probes (INS and DDIT3, crine genes were obtained by comparing endocrine cells FTL, HSPA5,orSQSTM1), according to the manufacturer’s (a-, b-, d-, PP-, and e-cells) with the nonendocrine cells, instructions (Advanced Cell Diagnostics). A fluorescent kit as described above. was used to amplify the mRNA signal, and fluorescein, Cy3, The alignment analysis of human islet cells between and Cy5 were detected using a microscope slide scanner this study and three previous studies (17–19) was performed (Axio-Scan.Z1; Zeiss). Fluorescence intensities were de- by Seurat using canonical correlation analysis. The union of termined using the HALO image software module for the top 2,000 variable genes of this study and one published RNA fluorescence in situ hybridization (FISH) analysis islet study were used to correlate and integrate data from (Indica Laboratories). the two studies. Common cell types and subpopulations Single-Cell RNAseq and Read Mapping were aligned between the two studies and visualized in two Cells were loaded on a Chromium Single Cell Instrument t-Distributed Stochastic Neighbor Embedding dimensions. (10x Genomics). RNAseq libraries were prepared using Chromium Single Cell 39 Library, Gel Beads & Mutiplex Pseudotime Trajectory Reconstruction Kit (10x Genomics). Sequencing was performed on the b-Cell subpopulation markers were used by monocle v2.4 Illumina NextSeq500 using Read-1 for transcript read (R package) to construct single-cell pseudotime ordering and Read-2 for three indices, I7 index for cell barcode, I5 using the default setting. The b-cell trajectory includes two index for sample index, and unique molecular identifier branch points,
Load more

Recommended publications
  • Use of Mathematical Modeling and Other Biophysical Methods For
    USE OF MATHEMATICAL MODELING AND OTHER BIOPHYSICAL METHODS FOR INSIGHTS INTO IRON-RELATED PHENOMENA OF BIOLOGICAL SYSTEMS A Dissertation by JOSHUA D. WOFFORD Submitted to the Office of Graduate and Professional Studies of Texas A&M University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY Chair of Committee, Paul A. Lindahl Committee Members, David P. Barondeau Simon W. North Vishal M. Gohil Head of Department, Simon W. North December 2018 Major Subject: Chemistry Copyright 2018 Joshua D. Wofford ABSTRACT Iron is a crucial nutrient in most living systems. It forms the active centers of many proteins that are critical for many cellular functions, either by themselves or as Fe-S clusters and hemes. However, Fe is potentially toxic to the cell in high concentrations and must be tightly regulated. There has been much work into understanding various pieces of Fe trafficking and regulation, but integrating all of this information into a coherent model has proven difficult. Past research has focused on different Fe species, including cytosolic labile Fe or mitochondrial Fe-S clusters, as being the main regulator of Fe trafficking in yeast. Our initial modeling efforts demonstrate that both cytosolic Fe and mitochondrial ISC assembly are required for proper regulation. More recent modeling efforts involved a more rigorous multi- tiered approach. Model simulations were optimized against experimental results involving respiring wild-type and Mrs3/4-deleted yeast. Simulations from both modeling studies suggest that mitochondria possess a “respiratory shield” that prevents a vicious cycle of nanoparticle formation, ISC loss, and subsequent loading of mitochondria with iron.
    [Show full text]
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
    [Show full text]
  • Studies of Iron Sulfur Cluster Maturation and Transport DISSERTATION Presented in Partial Fulfillment of the Requirements for Th
    Studies of Iron Sulfur Cluster Maturation and Transport DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Jingwei Li Graduate Program in Chemistry The Ohio State University 2015 Dissertation Committee: Professor James A. Cowan, Advisor Professor Ross E. Dalbey Professor Claudia Turro Copyright by Jingwei Li 2015 Abstract Cellular iron homeostasis is critically dependent on sensory and regulatory mechanisms that maintain a balance of intracellular iron concentrations. Divergence from a healthy iron concentration can result in common disease states such as anemia and ataxia. With the goal of understanding the molecular basis for such health problems, and advancing the knowledge based toward potential remedies, an understanding of the molecular details of cellular iron transport and the biological chemistry of iron species is an essential prerequisite. In that regard, iron-sulfur clusters are ubiquitous iron-containing centers in a variety of proteins and serve a multitude of roles that include electron transfer, catalysis of reactions, and sensors of cellular oxygen and iron levels. Recently, a substantial body of evidence has suggested an essential role for cellular glutathione (a molecule normally implicated with eliminating reactive oxygen species from cells) in the regulation, stabilization and biosynthesis of cellular iron-sulfur clusters in humans and other complex organisms. We have demonstrated that glutathione can naturally bind to iron-sulfur cluster precursors and have isolated and characterized this species and shown it to be stable under physiological conditions. More importantly, we have demonstrated that the glutathione-bound iron-sulfur cluster can be transported by a ii critical export protein from the cellular mitochondrion.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • The Autophagy Receptor SQSTM1/P62 Mediates Anti-Inflammatory Actions of the Selective NR3C1/ Glucocorticoid Receptor Modulator Compound a (Cpda) in Macrophages
    Autophagy ISSN: 1554-8627 (Print) 1554-8635 (Online) Journal homepage: http://www.tandfonline.com/loi/kaup20 The autophagy receptor SQSTM1/p62 mediates anti-inflammatory actions of the selective NR3C1/ glucocorticoid receptor modulator compound A (CpdA) in macrophages Viacheslav Mylka, Julie Deckers, Dariusz Ratman, Lode De Cauwer, Jonathan Thommis, Riet De Rycke, Francis Impens, Claude Libert, Jan Tavernier, Wim Vanden Berghe, Kris Gevaert & Karolien De Bosscher To cite this article: Viacheslav Mylka, Julie Deckers, Dariusz Ratman, Lode De Cauwer, Jonathan Thommis, Riet De Rycke, Francis Impens, Claude Libert, Jan Tavernier, Wim Vanden Berghe, Kris Gevaert & Karolien De Bosscher (2018) The autophagy receptor SQSTM1/p62 mediates anti- inflammatory actions of the selective NR3C1/glucocorticoid receptor modulator compound A (CpdA) in macrophages, Autophagy, 14:12, 2049-2064, DOI: 10.1080/15548627.2018.1495681 To link to this article: https://doi.org/10.1080/15548627.2018.1495681 © 2018 The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group. Published online: 14 Sep 2018. Submit your article to this journal Article views: 907 View Crossmark data Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=kaup20 AUTOPHAGY 2018, VOL. 14, NO. 12, 2049–2064 https://doi.org/10.1080/15548627.2018.1495681 RESEARCH PAPER - BASIC SCIENCE The autophagy receptor SQSTM1/p62 mediates anti-inflammatory actions of the selective NR3C1/glucocorticoid receptor modulator
    [Show full text]
  • UNIVERSITY of CALIFORNIA, IRVINE Combinatorial Regulation By
    UNIVERSITY OF CALIFORNIA, IRVINE Combinatorial regulation by maternal transcription factors during activation of the endoderm gene regulatory network DISSERTATION submitted in partial satisfaction of the requirements for the degree of DOCTOR OF PHILOSOPHY in Biological Sciences by Kitt D. Paraiso Dissertation Committee: Professor Ken W.Y. Cho, Chair Associate Professor Olivier Cinquin Professor Thomas Schilling 2018 Chapter 4 © 2017 Elsevier Ltd. © 2018 Kitt D. Paraiso DEDICATION To the incredibly intelligent and talented people, who in one way or another, helped complete this thesis. ii TABLE OF CONTENTS Page LIST OF FIGURES vii LIST OF TABLES ix LIST OF ABBREVIATIONS X ACKNOWLEDGEMENTS xi CURRICULUM VITAE xii ABSTRACT OF THE DISSERTATION xiv CHAPTER 1: Maternal transcription factors during early endoderm formation in 1 Xenopus Transcription factors co-regulate in a cell type-specific manner 2 Otx1 is expressed in a variety of cell lineages 4 Maternal otx1 in the endodermal conteXt 5 Establishment of enhancers by maternal transcription factors 9 Uncovering the endodermal gene regulatory network 12 Zygotic genome activation and temporal control of gene eXpression 14 The role of maternal transcription factors in early development 18 References 19 CHAPTER 2: Assembly of maternal transcription factors initiates the emergence 26 of tissue-specific zygotic cis-regulatory regions Introduction 28 Identification of maternal vegetally-localized transcription factors 31 Vegt and OtX1 combinatorially regulate the endodermal 33 transcriptome iii
    [Show full text]
  • Genome-Scale Identification of Transcription Factors That Mediate An
    ARTICLE DOI: 10.1038/s41467-018-04406-2 OPEN Genome-scale identification of transcription factors that mediate an inflammatory network during breast cellular transformation Zhe Ji 1,2,4, Lizhi He1, Asaf Rotem1,2,5, Andreas Janzer1,6, Christine S. Cheng2,7, Aviv Regev2,3 & Kevin Struhl 1 Transient activation of Src oncoprotein in non-transformed, breast epithelial cells can initiate an epigenetic switch to the stably transformed state via a positive feedback loop that involves 1234567890():,; the inflammatory transcription factors STAT3 and NF-κB. Here, we develop an experimental and computational pipeline that includes 1) a Bayesian network model (AccessTF) that accurately predicts protein-bound DNA sequence motifs based on chromatin accessibility, and 2) a scoring system (TFScore) that rank-orders transcription factors as candidates for being important for a biological process. Genetic experiments validate TFScore and suggest that more than 40 transcription factors contribute to the oncogenic state in this model. Interestingly, individual depletion of several of these factors results in similar transcriptional profiles, indicating that a complex and interconnected transcriptional network promotes a stable oncogenic state. The combined experimental and computational pipeline represents a general approach to comprehensively identify transcriptional regulators important for a biological process. 1 Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, MA 02115, USA. 2 Broad Institute of MIT and Harvard, Cambridge, MA 02142, USA. 3 Department of Biology, Howard Hughes Medical Institute and David H. Koch Institute for Integrative Cancer Research, Massachusetts Institute of Technology, Cambridge, MA 20140, USA. 4Present address: Department of Pharmacology and Biomedical Engineering, Northwestern University, Evanston 60611 IL, USA.
    [Show full text]
  • Role of Rim101p in the Ph Response in Candida Albicans Michael Weyler
    Role of Rim101p in the pH response in Candida albicans Michael Weyler To cite this version: Michael Weyler. Role of Rim101p in the pH response in Candida albicans. Biomolecules [q-bio.BM]. Université Paris Sud - Paris XI, 2007. English. tel-00165802 HAL Id: tel-00165802 https://tel.archives-ouvertes.fr/tel-00165802 Submitted on 27 Jul 2007 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. UNIVERSITE PARISXI UFR SCIENTIFIQUE D’ORSAY THESE présentée par Michael Weyler pour obtenir le grade de DOCTEUR EN SCIENCES DE L’UNIVERSITE PARISXI-ORSAY LE RÔLE DE RIM101p DANS LA RÉPONSE AU pH CHEZ CANDIDA ALBICANS Soutenance prévue le 6 juillet 2007 devant le jury composé de: Pr. Dr. H. Delacroix Président Dr. J-M. Camadro Rapporteur Pr. Dr. F. M. Klis Rapporteur Dr. G. Janbon Examinateur Dr. M. Lavie-Richard Examinateur Pr. Dr. C. Gaillardin Examinateur Remerciements Tout d’abord je voudrais remercier vivement mon directeur de thèse, Prof. Claude Gaillardin, pour m’avoir permis d’effectuer ce travail au sein de son laboratoire, pour ses conseils et sa disponibilité malgré son calendrier bien remplis. Je lui remercie également pour m’avoir laissé beaucoup de liberté dans mon travail, et pour la possibilité de participer aux différents congrès au cours de ma formation de thèse.
    [Show full text]
  • Programmed Cell-Death by Ferroptosis: Antioxidants As Mitigators
    International Journal of Molecular Sciences Review Programmed Cell-Death by Ferroptosis: Antioxidants as Mitigators Naroa Kajarabille 1 and Gladys O. Latunde-Dada 2,* 1 Nutrition and Obesity Group, Department of Nutrition and Food Sciences, University of the Basque Country (UPV/EHU), 01006 Vitoria, Spain; [email protected] 2 King’s College London, Department of Nutritional Sciences, Faculty of Life Sciences and Medicine, Franklin-Wilkins Building, 150 Stamford Street, London SE1 9NH, UK * Correspondence: [email protected] Received: 9 September 2019; Accepted: 2 October 2019; Published: 8 October 2019 Abstract: Iron, the fourth most abundant element in the Earth’s crust, is vital in living organisms because of its diverse ligand-binding and electron-transfer properties. This ability of iron in the redox cycle as a ferrous ion enables it to react with H2O2, in the Fenton reaction, to produce a hydroxyl radical ( OH)—one of the reactive oxygen species (ROS) that cause deleterious oxidative damage • to DNA, proteins, and membrane lipids. Ferroptosis is a non-apoptotic regulated cell death that is dependent on iron and reactive oxygen species (ROS) and is characterized by lipid peroxidation. It is triggered when the endogenous antioxidant status of the cell is compromised, leading to lipid ROS accumulation that is toxic and damaging to the membrane structure. Consequently, oxidative stress and the antioxidant levels of the cells are important modulators of lipid peroxidation that induce this novel form of cell death. Remedies capable of averting iron-dependent lipid peroxidation, therefore, are lipophilic antioxidants, including vitamin E, ferrostatin-1 (Fer-1), liproxstatin-1 (Lip-1) and possibly potent bioactive polyphenols.
    [Show full text]
  • GTF3A (NM 002097) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC225554 GTF3A (NM_002097) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: GTF3A (NM_002097) Human Tagged ORF Clone Tag: Myc-DDK Symbol: GTF3A Synonyms: AP2; TFIIIA Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC225554 representing NM_002097 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC CTGGATCCGCCGGCCGTGGTCGCCGAGTCGGTGTCGTCCTTGACCATCGCCGACGCGTTCATTGCAGCCG GCGAGAGCTCAGCTCCGACCCCGCCGCGCCCCGCGCTTCCCAGGAGGTTCATCTGCTCCTTCCCTGACTG CAGCGCCAATTACAGCAAAGCCTGGAAGCTTGACGCGCACCTGTGCAAGCACACGGGGGAGAGACCATTT GTTTGTGACTATGAAGGGTGTGGCAAGGCCTTCATCAGGGACTACCATCTGAGCCGCCACATTCTGACTC ACACAGGAGAAAAGCCGTTTGTTTGTGCAGCCAATGGCTGTGATCAAAAATTCAACACAAAATCAAACTT GAAGAAACATTTTGAACGCAAACATGAAAATCAACAAAAACAATATATATGCAGTTTTGAAGACTGTAAG AAGACCTTTAAGAAACATCAGCAGCTGAAAATCCATCAGTGCCAGCATACCAATGAACCTCTATTCAAGT GTACCCAGGAAGGATGTGGGAAACACTTTGCATCACCCAGCAAGCTGAAACGACATGCCAAGGCCCACGA GGGCTATGTATGTCAAAAAGGATGTTCCTTTGTGGCAAAAACATGGACGGAACTTCTGAAACATGTGAGA GAAACCCATAAAGAGGAAATACTATGTGAAGTATGCCGGAAAACATTTAAACGCAAAGATTACCTTAAGC AACACATGAAAACTCATGCCCCAGAAAGGGATGTATGTCGCTGTCCAAGAGAAGGCTGTGGAAGAACCTA TACAACTGTGTTTAATCTCCAAAGCCATATCCTCTCCTTCCATGAGGAAAGCCGCCCTTTTGTGTGTGAA CATGCTGGCTGTGGCAAAACATTTGCAATGAAACAAAGTCTCACTAGGCATGCTGTTGTACATGATCCTG
    [Show full text]
  • Single-Cell RNA-Seq Analysis of the Brainstem of Mutant SOD1 Mice Reveals Perturbed Cell Types and Pathways of Amyotrophic Lateral Sclerosis
    HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Neurobiol Manuscript Author Dis. Author manuscript; Manuscript Author available in PMC 2020 September 26. Published in final edited form as: Neurobiol Dis. 2020 July ; 141: 104877. doi:10.1016/j.nbd.2020.104877. Single-cell RNA-seq analysis of the brainstem of mutant SOD1 mice reveals perturbed cell types and pathways of amyotrophic lateral sclerosis Wenting Liua, Sharmila Venugopala, Sana Majida, In Sook Ahna, Graciel Diamantea, Jason Honga, Xia Yanga,b,c,*, Scott H. Chandlera,b,* aDepartment of Integrative Biology & Physiology, University of California, 2024 Terasaki Bld, 610 Charles E. Young Dr. East, Los Angeles, USA bBrain Research Institute, University of California, Los Angeles, USA cInstitute for Quantitative and Computational Biosciences, University of California, Los Angeles, USA Abstract Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disease in which motor neurons throughout the brain and spinal cord progressively degenerate resulting in muscle atrophy, paralysis and death. Recent studies using animal models of ALS implicate multiple cell-types (e.g., astrocytes and microglia) in ALS pathogenesis in the spinal motor systems. To ascertain cellular vulnerability and cell-type specific mechanisms of ALS in the brainstem that orchestrates oral-motor functions, we conducted parallel single cell RNA sequencing (scRNA-seq) analysis using the high-throughput Drop-seq method. We isolated 1894 and 3199 cells from the brainstem of wildtype and mutant SOD1 symptomatic mice respectively, at postnatal day 100. We recovered major known cell types and neuronal subpopulations, such as interneurons and motor neurons, and trigeminal ganglion (TG) peripheral sensory neurons, as well as, previously uncharacterized interneuron subtypes.
    [Show full text]
  • Integrative Bulk and Single-Cell Profiling of Premanufacture T-Cell Populations Reveals Factors Mediating Long-Term Persistence of CAR T-Cell Therapy
    Published OnlineFirst April 5, 2021; DOI: 10.1158/2159-8290.CD-20-1677 RESEARCH ARTICLE Integrative Bulk and Single-Cell Profiling of Premanufacture T-cell Populations Reveals Factors Mediating Long-Term Persistence of CAR T-cell Therapy Gregory M. Chen1, Changya Chen2,3, Rajat K. Das2, Peng Gao2, Chia-Hui Chen2, Shovik Bandyopadhyay4, Yang-Yang Ding2,5, Yasin Uzun2,3, Wenbao Yu2, Qin Zhu1, Regina M. Myers2, Stephan A. Grupp2,5, David M. Barrett2,5, and Kai Tan2,3,5 Downloaded from cancerdiscovery.aacrjournals.org on October 1, 2021. © 2021 American Association for Cancer Research. Published OnlineFirst April 5, 2021; DOI: 10.1158/2159-8290.CD-20-1677 ABSTRACT The adoptive transfer of chimeric antigen receptor (CAR) T cells represents a breakthrough in clinical oncology, yet both between- and within-patient differences in autologously derived T cells are a major contributor to therapy failure. To interrogate the molecular determinants of clinical CAR T-cell persistence, we extensively characterized the premanufacture T cells of 71 patients with B-cell malignancies on trial to receive anti-CD19 CAR T-cell therapy. We performed RNA-sequencing analysis on sorted T-cell subsets from all 71 patients, followed by paired Cellular Indexing of Transcriptomes and Epitopes (CITE) sequencing and single-cell assay for transposase-accessible chromatin sequencing (scATAC-seq) on T cells from six of these patients. We found that chronic IFN signaling regulated by IRF7 was associated with poor CAR T-cell persistence across T-cell subsets, and that the TCF7 regulon not only associates with the favorable naïve T-cell state, but is maintained in effector T cells among patients with long-term CAR T-cell persistence.
    [Show full text]