Joint Profiling of Chromatin Accessibility and CAR-T Integration Site Analysis at Population and Single-Cell Levels
Total Page:16
File Type:pdf, Size:1020Kb
Load more
										Recommended publications
									
								- 
												  ARMCX3 (NM 177948) Human Untagged Clone – SC124834OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC124834 ARMCX3 (NM_177948) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: ARMCX3 (NM_177948) Human Untagged Clone Tag: Tag Free Symbol: ARMCX3 Synonyms: ALEX3; dJ545K15.2; GASP6 Vector: pCMV6-XL4 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >NCBI ORF sequence for NM_177948, the custom clone sequence may differ by one or more nucleotides ATGGGCTACGCCAGGAAAGTAGGCTGGGTGACCGCAGGCCTGGTGATTGGGGCTGGCGCCTGCTATTGCA TTTATAGACTGACTAGGGGAAGAAAACAGAACAAGGAAAAAATGGCTGAGGGTGGATCTGGGGATGTGGA TGATGCTGGGGACTGTTCTGGGGCCAGGTATAATGACTGGTCTGATGATGATGATGACAGCAATGAGAGC AAGAGTATAGTATGGTACCCACCTTGGGCTCGGATTGGGACTGAAGCTGGAACCAGAGCTAGGGCCAGGG CAAGGGCCAGGGCTACCCGGGCACGTCGGGCTGTCCAGAAACGGGCTTCCCCCAATTCAGATGATACCGT TTTGTCCCCTCAAGAGCTACAAAAGGTTCTTTGCTTGGTTGAGATGTCTGAAAAGCCTTATATTCTTGAA GCAGCTTTAATTGCTCTGGGTAACAATGCTGCTTATGCATTTAACAGAGATATTATTCGTGATCTGGGTG GTCTCCCAATTGTCGCAAAGATTCTCAATACTCGGGATCCCATAGTTAAGGAAAAGGCTTTAATTGTCCT GAATAACTTGAGTGTGAATGCTGAAAATCAGCGCAGGCTTAAAGTATACATGAATCAAGTGTGTGATGAC ACAATCACTTCTCGCTTGAACTCATCTGTGCAGCTTGCTGGACTGAGATTGCTTACAAATATGACTGTTA CTAATGAGTATCAGCACATGCTTGCTAATTCCATTTCTGACTTTTTTCGTTTATTTTCAGCGGGAAATGA AGAAACCAAACTTCAGGTTCTGAAACTCCTTTTGAATTTGGCTGAAAATCCAGCCATGACTAGGGAACTG CTCAGGGCCCAAGTACCATCTTCACTGGGCTCCCTCTTTAATAAGAAGGAGAACAAAGAAGTTATTCTTA AACTTCTGGTCATATTTGAGAACATAAATGATAATTTCAAATGGGAAGAAAATGAACCTACTCAGAATCA
- 
												  Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer ModelDownloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
- 
												  CD56+ T-Cells in Relation to Cytomegalovirus in Healthy Subjects and Kidney Transplant PatientsCD56+ T-cells in Relation to Cytomegalovirus in Healthy Subjects and Kidney Transplant Patients Institute of Infection and Global Health Department of Clinical Infection, Microbiology and Immunology Thesis submitted in accordance with the requirements of the University of Liverpool for the degree of Doctor in Philosophy by Mazen Mohammed Almehmadi December 2014 - 1 - Abstract Human T cells expressing CD56 are capable of tumour cell lysis following activation with interleukin-2 but their role in viral immunity has been less well studied. The work described in this thesis aimed to investigate CD56+ T-cells in relation to cytomegalovirus infection in healthy subjects and kidney transplant patients (KTPs). Proportions of CD56+ T cells were found to be highly significantly increased in healthy cytomegalovirus-seropositive (CMV+) compared to cytomegalovirus-seronegative (CMV-) subjects (8.38% ± 0.33 versus 3.29%± 0.33; P < 0.0001). In donor CMV-/recipient CMV- (D-/R-)- KTPs levels of CD56+ T cells were 1.9% ±0.35 versus 5.42% ±1.01 in D+/R- patients and 5.11% ±0.69 in R+ patients (P 0.0247 and < 0.0001 respectively). CD56+ T cells in both healthy CMV+ subjects and KTPs expressed markers of effector memory- RA T-cells (TEMRA) while in healthy CMV- subjects and D-/R- KTPs the phenotype was predominantly that of naïve T-cells. Other surface markers, CD8, CD4, CD58, CD57, CD94 and NKG2C were expressed by a significantly higher proportion of CD56+ T-cells in healthy CMV+ than CMV- subjects. Functional studies showed levels of pro-inflammatory cytokines IFN-γ and TNF-α, as well as granzyme B and CD107a were significantly higher in CD56+ T-cells from CMV+ than CMV- subjects following stimulation with CMV antigens.
- 
												  A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes MellitusPage 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
- 
												  Structural Basis of UGUA Recognition by the Nudix Protein CFI 25Structural basis of UGUA recognition by the Nudix protein CFIm25 and implications for a regulatory role in mRNA 3′ processing Qin Yang, Gregory M. Gilmartin1, and Sylvie Doublié1 Department of Microbiology and Molecular Genetics, Stafford Hall, University of Vermont, Burlington, VT 05405 Edited by Joan A. Steitz, Howard Hughes Medical Institute, New Haven, CT, and approved April 20, 2010 (received for review January 21, 2010) — Human Cleavage Factor Im (CFIm) is an essential component of the C-terminal RS/RD alternating charge domain a structure simi- pre-mRNA 3′ processing complex that functions in the regulation of lar to that of the SR-protein family of splicing regulators. The 25 poly(A) site selection through the recognition of UGUA sequences small subunit (CFIm ) contains a Nudix domain, a protein do- upstream of the poly(A) site. Although the highly conserved 25 kDa main that most often participates in the hydrolysis of substrates subunit (CFIm25) of the CFIm complex possesses a characteristic containing a nucleotide diphosphate linked to a variable moiety α β α / / Nudix fold, CFIm25 has no detectable hydrolase activity. Here X (15). Found throughout all three kingdoms, Nudix proteins we report the crystal structures of the human CFIm25 homodimer in participate in a wide range of crucial housekeeping functions, in- complex with UGUAAA and UUGUAU RNA sequences. CFIm25 is the cluding the hydrolysis of mutagenic nucleotides, the modulation first Nudix protein to be reported to bind RNA in a sequence- of the levels of signaling molecules, and the monitoring of meta- 25 α β specific manner. The UGUA sequence contributes to binding speci- bolic intermediates (15).
- 
												  The Inactive X Chromosome Is Epigenetically Unstable and Transcriptionally Labile in Breast CancerSupplemental Information The inactive X chromosome is epigenetically unstable and transcriptionally labile in breast cancer Ronan Chaligné1,2,3,8, Tatiana Popova1,4, Marco-Antonio Mendoza-Parra5, Mohamed-Ashick M. Saleem5 , David Gentien1,6, Kristen Ban1,2,3,8, Tristan Piolot1,7, Olivier Leroy1,7, Odette Mariani6, Hinrich Gronemeyer*5, Anne Vincent-Salomon*1,4,6,8, Marc-Henri Stern*1,4,6 and Edith Heard*1,2,3,8 Extended Experimental Procedures Cell Culture Human Mammary Epithelial Cells (HMEC, Invitrogen) were grown in serum-free medium (HuMEC, Invitrogen). WI- 38, ZR-75-1, SK-BR-3 and MDA-MB-436 cells were grown in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen) containing 10% fetal bovine serum (FBS). DNA Methylation analysis. We bisulfite-treated 2 µg of genomic DNA using Epitect bisulfite kit (Qiagen). Bisulfite converted DNA was amplified with bisulfite primers listed in Table S3. All primers incorporated a T7 promoter tag, and PCR conditions are available upon request. We analyzed PCR products by MALDI-TOF mass spectrometry after in vitro transcription and specific cleavage (EpiTYPER by Sequenom®). For each amplicon, we analyzed two independent DNA samples and several CG sites in the CpG Island. Design of primers and selection of best promoter region to assess (approx. 500 bp) were done by a combination of UCSC Genome Browser (http://genome.ucsc.edu) and MethPrimer (http://www.urogene.org). All the primers used are listed (Table S3). NB: MAGEC2 CpG analysis have been done with a combination of two CpG island identified in the gene core. Analysis of RNA allelic expression profiles (based on Human SNP Array 6.0) DNA and RNA hybridizations were normalized by Genotyping console.
- 
												  CPSF6 Links Alternative Polyadenylation to MetabolismTan et al. Journal of Experimental & Clinical Cancer Research (2021) 40:85 https://doi.org/10.1186/s13046-021-01884-z RESEARCH Open Access CPSF6 links alternative polyadenylation to metabolism adaption in hepatocellular carcinoma progression Sheng Tan1†, Ming Zhang2†, Xinglong Shi3†, Keshuo Ding4, Qiang Zhao3, Qianying Guo4, Hao Wang4, Zhengsheng Wu4, Yani Kang3, Tao Zhu5*, Jielin Sun1* and Xiaodong Zhao1* Abstract Background: Alternative polyadenylation (APA) is an important mechanism of gene expression regulation through generation of RNA isoforms with distinct 3′ termini. Increasing evidence has revealed that APA is actively involved in development and disease, including hepatocellular carcinoma (HCC). However, how APA functions in tumor formation and progression remains elusive. In this study, we investigated the role of cleavage factor I (CFIm) subunit CPSF6 in human hepatocellular carcinoma (HCC). Methods: Expression levels of CPSF6 in clinical tissues and cell lines were determined by qRT-PCR and western blot. Functional assays, including the cell number, MTT, colony formation and transwell, were used to determine the oncogenic role of CPSF6 in HCC. Animal experiments were used to determine the role of CPSF6 in HCC tumorigenicity in vivo. Deep sequencing-based 3 T-seq was used to profile the transcriptome-wide APA sites in both HCC cells and CPSF6 knockdown HCC cells. The function of CPSF6-affected target NQO1 with distinct 3′UTRs was characterized by metabolism assays. Results: We observed CPSF6 was upregulated in HCC and the high expression of CPSF6 was associated with poor prognosis in patients. Overexpression of CPSF6 promoted proliferation, migration and invasion of HCC cells in vitro and in vivo.
- 
												  The Autophagy Receptor SQSTM1/P62 Mediates Anti-Inflammatory Actions of the Selective NR3C1/ Glucocorticoid Receptor Modulator Compound a (Cpda) in MacrophagesAutophagy ISSN: 1554-8627 (Print) 1554-8635 (Online) Journal homepage: http://www.tandfonline.com/loi/kaup20 The autophagy receptor SQSTM1/p62 mediates anti-inflammatory actions of the selective NR3C1/ glucocorticoid receptor modulator compound A (CpdA) in macrophages Viacheslav Mylka, Julie Deckers, Dariusz Ratman, Lode De Cauwer, Jonathan Thommis, Riet De Rycke, Francis Impens, Claude Libert, Jan Tavernier, Wim Vanden Berghe, Kris Gevaert & Karolien De Bosscher To cite this article: Viacheslav Mylka, Julie Deckers, Dariusz Ratman, Lode De Cauwer, Jonathan Thommis, Riet De Rycke, Francis Impens, Claude Libert, Jan Tavernier, Wim Vanden Berghe, Kris Gevaert & Karolien De Bosscher (2018) The autophagy receptor SQSTM1/p62 mediates anti- inflammatory actions of the selective NR3C1/glucocorticoid receptor modulator compound A (CpdA) in macrophages, Autophagy, 14:12, 2049-2064, DOI: 10.1080/15548627.2018.1495681 To link to this article: https://doi.org/10.1080/15548627.2018.1495681 © 2018 The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group. Published online: 14 Sep 2018. Submit your article to this journal Article views: 907 View Crossmark data Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=kaup20 AUTOPHAGY 2018, VOL. 14, NO. 12, 2049–2064 https://doi.org/10.1080/15548627.2018.1495681 RESEARCH PAPER - BASIC SCIENCE The autophagy receptor SQSTM1/p62 mediates anti-inflammatory actions of the selective NR3C1/glucocorticoid receptor modulator
- 
												  Loss of Fam60a, a Sin3a Subunit, Results in Embryonic Lethality and Is Associated with Aberrant Methylation at a Subset of GeneRESEARCH ARTICLE Loss of Fam60a, a Sin3a subunit, results in embryonic lethality and is associated with aberrant methylation at a subset of gene promoters Ryo Nabeshima1,2, Osamu Nishimura3,4, Takako Maeda1, Natsumi Shimizu2, Takahiro Ide2, Kenta Yashiro1†, Yasuo Sakai1, Chikara Meno1, Mitsutaka Kadota3,4, Hidetaka Shiratori1†, Shigehiro Kuraku3,4*, Hiroshi Hamada1,2* 1Developmental Genetics Group, Graduate School of Frontier Biosciences, Osaka University, Suita, Japan; 2Laboratory for Organismal Patterning, RIKEN Center for Developmental Biology, Kobe, Japan; 3Phyloinformatics Unit, RIKEN Center for Life Science Technologies, Kobe, Japan; 4Laboratory for Phyloinformatics, RIKEN Center for Biosystems Dynamics Research, Kobe, Japan Abstract We have examined the role of Fam60a, a gene highly expressed in embryonic stem cells, in mouse development. Fam60a interacts with components of the Sin3a-Hdac transcriptional corepressor complex, and most Fam60a–/– embryos manifest hypoplasia of visceral organs and die in utero. Fam60a is recruited to the promoter regions of a subset of genes, with the expression of these genes being either up- or down-regulated in Fam60a–/– embryos. The DNA methylation level of the Fam60a target gene Adhfe1 is maintained at embryonic day (E) 7.5 but markedly reduced at –/– *For correspondence: E9.5 in Fam60a embryos, suggesting that DNA demethylation is enhanced in the mutant. [email protected] (SK); Examination of genome-wide DNA methylation identified several differentially methylated regions, [email protected] (HH) which were preferentially hypomethylated, in Fam60a–/– embryos. Our data suggest that Fam60a is †These authors contributed required for proper embryogenesis, at least in part as a result of its regulation of DNA methylation equally to this work at specific gene promoters.
- 
												  Atlas of Subcellular RNA Localization Revealed by APEX-SeqbioRxiv preprint doi: https://doi.org/10.1101/454470; this version posted October 30, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Atlas of Subcellular RNA Localization Revealed by APEX-seq Furqan M. Fazal1,2,3,*, Shuo Han3,4,5,*, Pornchai Kaewsapsak3,4,5, Kevin R. Parker1,2,3, Jin Xu1,2,3, Alistair N. Boettiger6, Howard Y. Chang1,2,3,7,†, Alice Y. Ting3,4,5,8,9,† 1Center for Personal Dynamics Regulomes, Stanford University School of Medicine, Stanford, CA, USA 2Department of Dermatology, Stanford University School of Medicine, Stanford, CA, USA 3Department of Genetics, Stanford University School of Medicine, Stanford, CA, USA 4Department of Chemistry, Stanford University, Stanford, CA, USA 5Department of Biology, Stanford University, Stanford, CA, USA 6Department of Developmental Biology, Stanford University School of Medicine, CA, USA 7Howard Hughes Medical Institute 8Chan Zuckerberg Biohub, San Francisco, California, USA 9Lead contact *These authors contributed equally to this work †Corresponding authors. Email: [email protected] (A.Y.T.); [email protected] (H.Y.C.) SUMMARY We introduce APEX-seq, a method for RNA sequencing based on spatial proximity to the peroxidase enzyme APEX2. APEX-seq in nine distinct subcellular locales produced a nanometer-resolution spatial map of the human transcriptome, revealing extensive and exquisite patterns of localization for diverse RNA classes and transcript isoforms. We uncover a radial organization of the nuclear transcriptome, which is gated at the inner surface of the nuclear pore for cytoplasmic export of processed transcripts.
- 
												  Noelia Díaz BlancoEffects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr.
- 
												  Mergeomics: Multidimensional Data Integration to Identify Pathogenic Perturbations to Biological SystemsShu et al. BMC Genomics (2016) 17:874 DOI 10.1186/s12864-016-3198-9 METHODOLOGY ARTICLE Open Access Mergeomics: multidimensional data integration to identify pathogenic perturbations to biological systems Le Shu1, Yuqi Zhao1, Zeyneb Kurt1, Sean Geoffrey Byars2,3, Taru Tukiainen4, Johannes Kettunen4, Luz D. Orozco5, Matteo Pellegrini5, Aldons J. Lusis6, Samuli Ripatti4, Bin Zhang7, Michael Inouye2,3,8, Ville-Petteri Mäkinen1,9,10,11* and Xia Yang1,12* Abstract Background: Complex diseases are characterized by multiple subtle perturbations to biological processes. New omics platforms can detect these perturbations, but translating the diverse molecular and statistical information into testable mechanistic hypotheses is challenging. Therefore, we set out to create a public tool that integrates these data across multiple datasets, platforms, study designs and species in order to detect the most promising targets for further mechanistic studies. Results: We developed Mergeomics, a computational pipeline consisting of independent modules that 1) leverage multi-omics association data to identify biological processes that are perturbed in disease, and 2) overlay the disease- associated processes onto molecular interaction networks to pinpoint hubs as potential key regulators. Unlike existing tools that are mostly dedicated to specific data type or settings, the Mergeomics pipeline accepts and integrates datasets across platforms, data types and species. We optimized and evaluated the performance of Mergeomics using simulation and multiple independent datasets, and benchmarked the results against alternative methods. We also demonstrate the versatility of Mergeomics in two case studies that include genome-wide, epigenome-wide and transcriptome-wide datasets from human and mouse studies of total cholesterol and fasting glucose.