sign in sign up
<<
Home , Haruka (citrus)

Plant Breed. Biotech. 2018 (September) 6(3):245~256 Online ISSN: 2287-9366 https://doi.org/10.9787/PBB.2018.6.3.245 Print ISSN: 2287-9358 RESEARCH ARTICLE

Determination of R Gene Composition in a Ctv Locus Conferring Tristeza Virus Resistance from the Genetic Resources of Citrus and Its Relatives

1† 1† 2 3 3 4 1 Jiyeon Jeong , Jin-Kyu Woo , Young Chul Park , Sukman Park , Su-Hyun Yun , Yi Lee , Gun-Hyoung Cho , 5,6 1,7 Kwan Jeong Song *, Ho Bang Kim *

1 Life Sciences Research Institute, Biomedic Co., Ltd., Bucheon 14548, Korea 2 Agricultural Research and Extension Services, Jeju Special Self-Governing Province, Seogwipo 63556, Korea 3 Citrus Research Institute, National Institute of Horticultural & Herbal Science, Seogwipo 63607, Korea 4 Department of Industrial Plant Science and Technology, Chungbuk National University, Cheongju 28644, Korea 5 Major of Horticultural Science, Faculty of Bioscience and Industry, SARI, Jeju National University, Jeju 63243, Korea 6 Research Institute for Subtropical Agriculture & Biotechnology, Jeju National University, Jeju 63243, Korea 7 Major of Biomaterials, Faculty of Biotechnology, Jeju National University, Jeju 63243, Korea

ABSTRACT Regardless of the importance of a viral pathogen, (CTV), in citrus industry, molecular marker tools closely associated with its resistance trait have not been developed yet. Map-based cloning of a Ctv locus, one of at least two CTV-resistant loci, was previously reported from trifoliate . The genetic locus displayed a distinct feature of enriched composition of R genes that encode coiled-coil-nucleotide-binding site-leucine-rich repeat (CC-NBS-LRR) receptors. Based on the previous molecular characteristics of the genetic locus, we developed multiplex PCR marker sets to specifically detect seven R genes consisting of a Ctv locus. By using the multiplex PCR marker sets, we determined composition of seven R genes consisting of the genetic locus in a total of 155 citrus genetic resources including 12 of Korean landrace citrus. Genetic composition of seven R genes in the locus was variable among the genetic resources investigated. However, all of seven R genes were detected only in both , Poncirus trifoliata and its derivative , P. trifoliata ‘Flying Dragon’, which have been reported to be resistant to CTV. Multiplex PCR marker sets established in this study would be an effective molecular tool to develop scion or rootstock with high resistance trait against CTV in citrus breeding program. Keywords Citrus tristeza virus, Ctv locus, R gene, CC-NBS-LRR, Molecular marker, Citrus genetic resources

INTRODUCTION decreases tree vigor, fruit size and quality, and productivity regardless of rootstock (Gmitter et al. 2007). CTV has Citrus tristeza virus (CTV) is the most significant infected 100 million citrus trees, mainly in the Americas pathogenic virus in citrus worldwide, which causes two and Mediterranean (Donkersley et al. 2018). There are only major serious disease syndromes, that is, quick decline and three Citrus relatives which have been reported to be stem-pitting. The former causes tree death resulting from resistant to CTV; Severinia buxifolia (Poir.) Tenore, phloem necrosis below the graft union of infected scions on Swinglea glutinosa (Blanco) Merr., and Poncirus trifoliata sour orange (Citrus aurantium L.) rootstock. The latter (L.) Raf. (Garnsey et al. 1987; Garnsey et al. 1997; Mestre

Received June 20, 2018; Revised August 12, 2018; Accepted August 14, 2018; Published September 1, 2018 *Corresponding author Kwan Jeong Song, [email protected], Tel: +82-64-754-3328, Fax: +82-64-725-4905 *Corresponding author Ho Bang Kim, [email protected], Tel: +82-32-218-1515, Fax: +82-32-218-1517 † These authors contributed equally.

Copyright ⓒ 2018 by the Korean Society of Breeding Science This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. 246 ∙ Plant Breed. Biotech. 2018 (September) 6(3):245~256

et al. 1997a). In the genus Citrus, some of C. maxima could be strong Ctv candidates (US patent No. 7126044B2). (Burm.) Merrill are known to have resistance to CTV. The Rai (2006) introduced ten Ctv resistance candidates including CTV resistance gene was characterized as a single R genes into CTV-susceptible variety, C. paradisi, dominant gene (Yoshida 1985, 1993) and designated Ctv by Agrobacterium-mediated transformation approach. Trans- (Gmitter et al. 1996). Fang and Roose (1999) subsequently genic lines displayed either an absence of initiation of identified another single dominant gene (Ctv2) conferring infection or its slow spread (R2 lines), or an initial CTV resistance from ʻChandlerʼ pumello [C. maxima appearance of infection and its subsequent obliteration (R1 (Burm.) Merrill], which was an independently assorting and R4 lines). These previous findings suggest that four R gene from Ctv. genes (R1 through R4) might play major roles in CTV For the map-based cloning (MBC) of Ctv gene, many resistance. Asins et al. (2012) reported that the position of molecular markers associated with CTV resistance have the major QTL for CTV resistance is conserved among C. been developed from the bulked segregant analysis (BSA) grandis, C. aurantium, and P. trifoliata, and located on for the genetic cross or backcross population using trifoliate linkage group 4b. These previous results strongly suggest orange (P. trifoliata); random amplified polymorphic DNA that R genes in Ctv locus could be useful gene markers for (RAPD), inter simple sequence repeat (ISSR), sequence MAS in citrus breeding program. characterized amplified regions (SCAR), and restriction Regardless of the importance of CTV resistance trait in fragment length polymorphism (RFLP). Many efforts have citrus industry, molecular breeding programs to produce been further focused on the construction of genetic linkage CTV resistant cultivars have not been systematically maps for the CTV resistance locus and marker-assisted operated due to the absence of robust molecular markers selection (MAS) by using the developed molecular tightly linked to the agronomic traits (Kim et al. 2016). Up markers (Gmitter et al. 1996; Deng et al. 1997; Mestre et al. to now, systematic molecular surveys of a Ctv locus in 1997b; Fang et al. 1998). citrus have not been performed yet, although molecular Bacterial artificial chromosome (BAC) libraries were cloning and characterization of a Ctv locus have been constructed for MBC of Ctv gene (Deng et al. 2001a; Yang reported (Yang et al. 2003; Rai 2006). In this report, in et al. 2001). BAC contig map covering Ctv locus was order to make early selection of CTV resistant cultivars constructed from chromosome walking using molecular possible, we developed molecular marker sets to efficiently markers closely linked to Ctv and BAC clone searches by detect whole R gene sets in a Ctv locus and comprehensively resistance gene candidate (RGC) markers (Deng et al. explored distribution of the CTV resistant locus in the 2001b; Yang et al. 2001). Finally, Yang et al. (2003) genetic resources of citrus and its relatives. determined nucleotide sequences of 282 kb of BAC contigs covering Ctv region and performed gene prediction. They found that the contig contained R gene cluster consisted of MATERIALS AND METHODS seven coiled-coil-nucleotide-binding site-leucine-rich repeat (CC-NBS-LRR) genes and suggested that one of the R Citrus genetic resources and genomic DNA isolation genes may be a Ctv gene conferring broad spectrum Citrus genetic resources of two public research institutes resistance against CTV. Two BAC contig sequences in Jeju, Korea, were used in this study; Agricultural containing either resistant (Ctv) or susceptible allele (ctv) Research and Extension Services, Jeju Special Self- were isolated from BAC libraries of ‘Thong Dee’ pumello Governing Province, and Citrus Research Institute, (C. grandis L.) and CTV-resistant USDA 17-47 line National Institute of Horticultural & Herbal Science, Rural (‘Thong Dee’ pumello x P. trifoliata). Comparison between Development Administration. Citrus leaf tissues were Ctv and ctv contig sequences revealed that two CC-NBS-LRR collected from the accessions growing in the experimental genes, R2 and R3, were found only in the contig sequence research plantation. The leaves were rinsed with running containing resistant allele, indicating that these two R genes tap water and then were kept at ‒80°C until use. Genomic R Gene Composition in a Ctv Locus Conferring CTV Resistance ∙ 247

® DNA was extracted from leaf tissues using Biomedic 1.5 (R4/CTV#11): 2 (R6/CTV#18): 1 (R7/CTV#21). The Plant gDNA Extraction Kit (Biomedic Co., Ltd., Korea; PCR mixtures included 1 µL of genomic DNA (10 ng/µL), TM www.ibiomedic.co.kr) according to the manufacturer's 4 µL of primer mixtures, 10 µL of 2x HS Taq mix protocol. DNA quantity and quality were determined using (Dongsheng Biotech.), and 5 µL of distilled water. Multiplex DeNovix DS-11+ Spectrophotometer (DeNovix, Wilmington, PCR condition was the same as described above. DE, USA) and agarose gel electrophoresis, respectively.

PCR amplification RESULTS Primers to specifically amplify seven R genes encoding CC-NBS-LRR receptors are listed in Table 1. The PCR Establishment of multiplex PCR sets specifically Ctv mixtures included 1 µL of genomic DNA (10 ng/µL), each detecting a locus 0.5 µL of forward and reverse primers (each 10 pmol/µL), In order to develop DNA-based molecular markers TM 5 µL of 2x HS Taq mix (Dongsheng Biotech., Guangzhou, specifically detecting a Ctv locus, we performed multiple China), and 3 µL of distilled water. PCR condition to amplify nucleotide sequence alignment using genic sequences for the individual R genes was as follows; 95°C, 5 minutes for seven R genes, which were obtained from a public database initial denaturation, followed by 95°C for 30 seconds, 55°C (GenBank accession No. AF506028; Poncirus trifoliata for 30 seconds, 72°C for 1 minute (total 35 cycles) with 10 citrus tristeza virus resistance gene locus, complete minutes of the final extension at 72°C. The amplified PCR sequence) (data not shown). Individual seven R genes were products were separated on a 1% (w/v) agarose gel containing specifically detected by the designed PCR primer sets (Fig. ethidium bromide. In order to perform multiplex PCR, 1A). Multiplex PCR system consisted of two primer sets primer sets were divided into two groups, groups A and B. was further developed for robust and efficient detection of Groups A and B were composed of 4 and 3 primer sets, seven R gene sets in a Ctv locus. Groups A and B primer respectively. The mixing ratio of each primer sets for two sets were able to specifically and efficiently detect their groups were as follows; for group A, 2 (R1/CTV#4 and corresponding 4 (R1/CTV#4, R2/CTV#7, R3/CTV#8, and R3/CTV#8): 1 (R2/CTV#7 and R5/CTV#17); for group B, R5/CTV#17) and 3 genes (R4/CTV#11, R6/CTV#18, and

Table 1. Primer list used in this study. Gene ID Primer name Primer sequences (5’→3’) Amplicon size (bps) z) y) R1 (CTV#4 ) CTV#4F CTCGTTACATGGGATTATTGGTA 713 CTV#4R TGCAAATGCGTTTGGATTTCCA R2 (CTV#7) CTV#7F AATCGCAATCGATGGTGCTGT 437 CTV#7R ATTGCATGCCCACCGCTGCA R3 (CTV#8) CTV#8F TGAAAGGCCTATCGAGCCAGC 885 CTV#8R CCAGTTACTTTTAGGAAACCTTCC R4 (CTV#11) CTV#11F GCGACGGCGCTCTCTTTAAC 988 CTV#11R AGAATATCGGGATGACTGTTCATG R5 (CTV#17) CTV#17F AAAGGCAACAAATGAGCCGCC 210 CTV#17R CCATTAAAGTCTCCACAAGTTGC R6 (CTV#18) CTV#18F TGAGAGTACAACTAATTTTAATAGGAA 553 CTV#18R GAACTTGATGTTCTTAACACTTGG R7 (CTV#21) CTV#21F GGAGACCGAAGCTGGTCAAC 381 CTV#21R CAATCAAAATCGTTTGGCACTTG z) R gene name designated by Yang et al. (2003). y) Nomenclature by consecutive numbers of total coding genes in a Ctv locus. 248 ∙ Plant Breed. Biotech. 2018 (September) 6(3):245~256

R7/CTV#21), respectively (Fig. 1B).

Determination of R gene composition in a Ctv locus from the genetic resources of citrus and its relatives using the multiplex PCR sets We performed two independent multiplex PCRs to determine the composition of seven R genes consisting of a Ctv locus in 143 accessions belonging to the genetic Fig. 1. Development of DNA-based molecular markers resources of citrus and its relatives. Fig. 2 illustrates the specifically amplifying individual seven R genes multiplex PCR results of individual seven R genes in a Ctv in a Ctv locus, which confers CTV resistance (A) locus from each two representative accessions of 14 citrus and establishment of multiplex PCR system consisted groups. Table 2 summarizes composition of seven R genes of two primer sets, groups A and B, which amplify 4 (R1/CTV#4, R2/CTV#7, R3/CTV#8, and R5/CTV#17) including four major R genes (R1 through R4) in 143 and 3 genes (R4/CTV#11, R6/CTV#18, and R7/CTV#21), accessions belonging to 14 citrus groups of the genetic respectively (B). M, 1 kb plus DNA ladder. resources of citrus and its relatives. The multiplex PCR revealed that all of the genetic resources commonly

Fig. 2. Amplification of individual seven R genes in a Ctv locus from representative cultivars belonging to 14 citrus groups. The seven R genes were amplified by multiplex PCR system consisted of 2 primer sets, groups A and B, which amplify 4 (R1/CTV#4, R2/CTV#7, R3/CTV#8, and R5/CTV#17) and 3 genes (R4/CTV#11, R6/CTV#18, and R7/CTV#21), respectively. 1: C. paradisi, 2: C. paradisi 'Flame', 3: F. crassifolia 'Meiwa', 4: Fortunella spp. 'Puchimaru', 5: C. latifolia, 6. C. aurantifolia 'West Indian ', 7. C. limon, 8: C. limon 'Lisbon ', 9: C. reticulata '', 10: C. reticulata 'Daisy', 11: C. maxima 'Banbeiyu', 12: C. maxima 'Reinking', 13: C. sulcata, 14: C. taiwanica, 15: C. sinensis 'Yoshida Navel', 16: C. sinensis 'Valencia Late', 17: C. sphaerocarpa, 18: C. junos 'Sibori', 19: C. iyo 'Ootaniiyokan', 20: Citrus 'Suneat', 21: Citrus hybrid 'Nova', 22: Citrus hybrid 'Lee', 23: P. trifoliata, 24: P. trifoliata 'Flying Dragon', 25: 'Swingle', M: 1 kb plus DNA ladder. R Gene Composition in a Ctv Locus Conferring CTV Resistance ∙ 249

Table 2. Composition of seven R genes consisting of a Ctv locus in a total of 143 accessions including the genetic resources of citrus and its relatives. R1 R2 R3 R4 R5 R6 R7 Citrus group Species/Cultivar name (CTV#4) (CTV#7) (CTV#8) (CTV#11) (CTV#17) (CTV#18) (CTV#21) Grapefruit C. paradisi ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. paradisi ‘Star Ruby’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. paradisi ‘Golden Special’ −/−−/− ＋/＋ −/− ＋/＋ −/− ＋/＋ C. paradisi ‘Flame’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. paradisi ‘Rio Red’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. paradisi ‘Red Blush’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. paradisi ‘Ray Ruby’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Fortunella crassifolia ‘Meiwa’ −/−−/− ＋/＋＋/＋ −/−−/− ＋/＋ Fortunella spp. ‘Puchimaru’ −/−−/− ＋/＋＋/＋ −/−−/− ＋/＋ Lime C. latifolia ＋/＋ −/−−/− ＋/＋＋/＋ −/− ＋/＋ C. aurantifolia ‘West Indian −/−−/− ＋/＋＋/＋ −/−−/− ＋/＋ Lime’ C. aurantifolia ‘Mexican ＋/＋ −/−−/− ＋/＋＋/＋ −/− ＋/＋ Lime’ Lemon C. limon −/−−/−−/− ＋/＋＋/＋ −/− ＋/＋ C. limon ‘Lisbon Lemon’ −/−−/−−/− ＋/＋＋/＋ −/− ＋/＋ C. limon ‘Allen-Newman −/−−/−−/− ＋/＋＋/＋ −/− ＋/＋ Eureka Lemon’ C. limon ‘Frost Nucellar −/−−/−−/− ＋/＋＋/＋ −/− ＋/＋ Eureka Lemon’ C. limon ‘Jeramon’ −/−−/−−/− ＋/＋＋/＋ −/− ＋/＋ Mandarin C. reticulata ‘Ponkan’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. reticulata (‘Ponkan’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ seedless line) C. reticulata ‘Yosida Ponkan’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. reticulata ‘Dancy’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. reticulata ‘Daisy’ −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. reticulata ‘Nakano No.3’ −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. reticulata ‘Page’ −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. reticulata ‘Hayata Ponkan’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. reticulata ‘Fortune’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. reticulata ‘Oota Ponkan’ −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. clementina ‘Oroval’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. deliciosa ‘Avana Tardivo ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ di Ciaculli’ C. reticulata ‘Batangas’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. clementina ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. clementina ‘Fina Sodea’ −/−−/−−/− ＋/＋＋/＋ −/− ＋/＋ C. clementina (Israel line) ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. clementina (France line) ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. clementina (New Zealand ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ line) C. clementina ‘Rubino VCR’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. deliciosa ‘Avana Apireno’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. unshiu ‘Imamura Unshiu’ −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. unshiu ‘Chungchon −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Unshiu’ 250 ∙ Plant Breed. Biotech. 2018 (September) 6(3):245~256

Table 2. Continued 1. R1 R2 R3 R4 R5 R6 R7 Citrus group Species/Cultivar name (CTV#4) (CTV#7) (CTV#8) (CTV#11) (CTV#17) (CTV#18) (CTV#21) C. unshiu ‘Hyangmoongam’ −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. unshiu ‘Aoshima 4 Gou’ −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. unshiu ‘Katayama Unshiu’ −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. unshiu ‘Kinokuni Unshiu’ −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. unshiu ‘Miyagawa Wase’ −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. unshiu ‘Okitsu Wase’ −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. unshiu ‘Nankan 20 Gou’ −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. unshiu ‘Sasaki Unshiu’ −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. unshiu ‘Nichinan 1 Gou’ −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. unshiu ‘Miyamoto Wase’ −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. kinokuni ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. reticulata ‘Nankou’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Citrus hybrid ‘Hayaka’ −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Citrus hybrid ‘Mihocore’ −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Citrus spp. ‘Inchangkyul’ −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Pumello C. maxima ＋/＋ −/− ＋/＋＋/＋ −/−−/− ＋/＋ C. maxima ‘Mato Buntan’ ＋/＋ −/− ＋/＋＋/＋ −/−−/− ＋/＋ C. maxima ‘Banbeiyu’ −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. maxima ‘Chandler’ ＋/＋ −/−−/− ＋/＋＋/＋ −/− ＋/＋ C. maxima ‘Reinking’ ＋/＋ −/− ＋/＋＋/＋ −/−−/− ＋/＋ C. maxima ‘Siamese Pink’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. pseudogulgul ＋/＋ −/−−/− ＋/＋＋/＋ −/− ＋/＋ C. tamurana −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. hassaku ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. hassaku ‘Beni Hassaku’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Citrus spp. ‘Suyou’ ＋/＋ −/− ＋/＋＋/＋ −/−−/− ＋/＋ Citrus hybrid ‘Haruka’ −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Sour orange C. sulcata −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. taiwanica ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. obovoidea ＋/＋ −/− ＋/＋＋/＋ −/−−/− ＋/＋ Sweet orange C. sinensis ‘Yoshida Navel’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. sinensis ‘Valencia Late’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. sinensis ‘Shirayanagi ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Navel’ C. sinensis ‘Morita Navel’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. sinensis ‘Seike Navel’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. sinensis ‘Tarocco’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. sinensis ‘Hamlin’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. sinensis ‘Trovita’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. sinensis ‘Navelate’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. sinensis ‘Washington ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Navel’ C. sinensis ‘Delfino Blood ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Orange’ C. sinensis ‘Vaniglia ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Sanguino’ R Gene Composition in a Ctv Locus Conferring CTV Resistance ∙ 251

Table 2. Continued 2. R1 R2 R3 R4 R5 R6 R7 Citrus group Species/Cultivar name (CTV#4) (CTV#7) (CTV#8) (CTV#11) (CTV#17) (CTV#18) (CTV#21) C. sinensis 'Bream ‘arocco’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. sinensis ‘Blood Shamouti’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. sinensis ‘Smith Red’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. sinensis ‘Washington ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Sanguine’ C. sinensis ‘Tarocco Rosso’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. sinensis ‘Tarocco Meli’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. sinensis ‘Tarocco Scire’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. sinensis ‘Tarocco Ippolito’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. sinensis ‘Rohde Red ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Valencia’ C. sinensis ‘Cara Cara’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. sinensis ‘Moro’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. sinensis ‘Arnold Blood’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. sphaerocarpa ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. ＋/＋ −/− ＋/＋＋/＋ −/−−/− ＋/＋ Citrus spp. ‘Sankyul’ ＋/＋ −/− ＋/＋＋/＋ −/−−/− ＋/＋ Papeda hybrid C. junos ＋/＋ −/−−/− ＋/＋＋/＋ −/− ＋/＋ C. junos ‘Sibori’ ＋/＋ −/−−/− ＋/＋＋/＋ −/− ＋/＋ C. junos ‘Yamane’ ＋/＋ −/−−/− ＋/＋＋/＋ −/− ＋/＋ C. iyo ‘Miyauchiyokan’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. iyo ‘Ootaniiyokan’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Citrus hybrid ‘’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Citrus hybrid ‘56-423’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Citrus hybrid ‘S-1129’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Citrus hybrid ‘Hinoyutaka’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Citrus hybrid ‘’ −/−−/−−/−−/− ＋/＋ −/− ＋/＋ Citrus hybrid ‘Ariake’ −/−−/− ＋/＋＋/＋ −/−−/− ＋/＋ Citrus hybrid ‘Akemi’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Citrus hybrid ‘Tsunokaori’ −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Citrus hybrid ‘Amakusa’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Citrus hybrid ‘’ −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Citrus hybrid ‘Seihou’ −/−−/− ＋/＋＋/＋ −/−−/− ＋/＋ Citrus hybrid ‘Harehime’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Citrus hybrid ‘Harumi’ −/−−/−−/−−/− ＋/＋ −/− ＋/＋ Citrus hybrid ‘Shiranuhi’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Citrus hybrid −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ ‘Wonkyoah-danbaiseong No.1’ Citrus hybrid ＋/＋ −/− ＋/＋＋/＋ −/−−/− ＋/＋ ‘Wonkyoah-danbaiseong No.3’ Citrus hybrid ‘Benibae’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Citrus hybrid ‘Tamdo1ho’ −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Citrus hybrid ‘Suneat’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Citrus hybrid ‘Satonokaori’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Citrus hybrid ‘Tamami’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Citrus hybrid ‘Okitsu No. 46’ −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ 252 ∙ Plant Breed. Biotech. 2018 (September) 6(3):245~256

Table 2. Continued 3. R1 R2 R3 R4 R5 R6 R7 Citrus group Species/Cultivar name (CTV#4) (CTV#7) (CTV#8) (CTV#11) (CTV#17) (CTV#18) (CTV#21) Citrus hybrid ‘Okitsu No. 47’ −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Citrus hybrid ‘Sunburst’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Citrus hybrid ‘Southern Red’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Citrus hybrid ‘Nova’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Citrus hybrid ‘Lee’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Citrus hybrid ‘Minneola’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Citrus hybrid ‘Seminole’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Citrus hybrid ‘Sweetspring’ −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Citrus hybrid ‘Orlando’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Citrus hybrid ‘Southern −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Yellow’ Citrus hybrid ‘Fallglo’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. natsudaidai −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. natsudaidai −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ ‘Whanggumhagyul’ C. natsudaidai ‘Sunholt’ −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ C. natsudaidai −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ ‘Shinamanatsu’ C. natsudaidai ‘Tachibana −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Orange’ C. natsudaidai −/−−/− ＋/＋＋/＋＋/＋ −/− ＋/＋ ‘Kawanonatsudaidai’ Trifoliate orange Poncirus trifoliata ＋/＋＋/＋＋/＋＋/＋＋/＋＋/＋＋/＋ P. trifoliata ‘Flying Dragon’ ＋/＋＋/＋＋/＋＋/＋＋/＋＋/＋＋/＋ Trifoliate hybrid Citrumelo ‘Swingle’ ＋/＋ −/− ＋/＋＋/＋＋/＋ −/− ＋/＋ Two independent multiplex PCRs were performed for each accession. +: presence, ‒: absence. contained R7 (CTV#21) gene. R2 (CTV#7) and R6 (CTV#18) (Table 2 and Fig. 2). However, Citrumelo hybrid ʻSwingleʼ, genes were detected only in two accessions belonging to which was derived from the genetic crossing between trifoliate orange group. R4 (CTV#11) gene was not present ‘Duncan’ grapefruit (C. paradisi) and P. trifoliata, was only in three accessions belonging to either grapefruit (C. missing two R genes, R2 (CTV#7) and R6 (CTV#18) (Fig. paradisi ʻGolden Specialʼ) or tangor (Citrus hybrid ʻSetokaʼ 2). In order to confirm if seven R genes in a Ctv locus are and Citrus hybrid ʻHarumiʼ). All of accessions belonging to intact and functional in two accessions of trifoliate orange kumquat and lemon groups contained only 3 out of 7 R group, we performed PCRs to amplify full length genomic genes, which was the smallest number of R genes as sequences for each R gene from P. trifoliata and its compared to other groups. In case of lemon group, all of derivative cultivar, P. trifoliata ‘Flying Dragon’ (Supple- five accessions only contained R4 gene out of four major R mentary Table S1 and Fig. S1). The PCR amplification genes. P. trifoliata and its derivative cultivars are widely showed intact size of amplicon for each R gene, as predicted used as rootstocks in citrus industry due to its strong from the nucleotide sequences of the GenBank database resistance against CTV. Among three of the genetic (Accession No. AF506028). collections belonging to trifoliate orange and its hybrid Korean landrace citrus is known to have resistance group, all of seven R genes were detected only in two against environmental stresses such as low temperature, accessions, P. trifoliata and P. trifoliata ‘Flying Dragon’ and bacterial and fungal pathogens (Kim 1988, 1991). In R Gene Composition in a Ctv Locus Conferring CTV Resistance ∙ 253

Table 3. Composition of seven R genes consisting of a Ctv locus in twelve Korean landrace . R1 R2 R3 R4 R5 R6 R7 Type Scientific name Common name (CTV#4) (CTV#7) (CTV#8) (CTV#11) (CTV#17) (CTV#18) (CTV#21) Mandarin C. platymamma Byungkyul −/−−/− +/+ +/+ +/+ −/− +/+ type Hort. ex TANAKA C. sunki Hort. ex Jinkyul −/−−/− +/+ +/+ +/+ −/− +/+ TANAKA C. nippokoreana Cheongkyul +/+ −/− +/+ +/+ +/+ −/− +/+ TANAKA C. tangerina Hort. Pyunkyul −/−−/− +/+ +/+ +/+ −/− +/+ ex TANAKA C. leiocarpa Hort. Binkyul −/−−/− +/+ +/+ +/+ −/− +/+ ex TANAKA C. erythrosa Hort. Dongjeongkyul +/+ −/− +/+ +/+ +/+ −/− +/+ ex TANAKA C. tachibana Hongkyul −/−−/− +/+ +/+ +/+ −/− +/+ TANAKA C. pseudogulgul Sadoogam −/−−/− +/+ +/+ +/+ −/− +/+ Hort. ex TANAKA C. benikoji Hort. ex Gamza −/−−/− +/+ +/+ +/+ −/− +/+ TANAKA Non-man- C. grandis OSBEK Dangyooza +/+ −/− +/+ +/+ +/+ −/− +/+ darin type C. aurantium LINN Jigak +/+ −/− +/+ +/+ +/+ −/− +/+ C. junos SIEB. ex Yooza +/+ −/−−/− +/+ +/+ −/− +/+ TANAKA Two independent multiplex PCRs were performed for each accession. +: presence, ‒: absence. order to obtain the information if Korean landrace citrus DISCUSSION has a possible resistance against CTV, we determined composition of seven R genes consisting of a Ctv locus in CTV is one of the most deleterious pathogenic viruses the 12 landraces that are classified into two groups, threatening citrus industry worldwide. CTV resistance trait mandarin and non-mandarin types (Yi et al. 2018, Table 3). has been reported from P. trifoliata and very narrow Four R genes including R3 (CTV#8), R4 (CTV#11), R5 genetic resources belonging to the genus Citrus (Yoshida (CTV#17), and R7 (CTV#21), were commonly detected in 1985; Garnsey et al. 1987; Yoshida 1993; Mestre et al. both groups, except for the absence of R3 (CTV#8) in 1997a). Regardless of the importance of this viral disease, ‘Yooza’ belonging to non-mandarin type. R1 (CTV#4) robust and efficient molecular markers closely linked to gene was detected only in two mandarin type (‘Cheongkyul’ CTV resistance trait have not been developed yet. In this and ‘Dongjeongkyul’) and three non-mandarin type report, we developed multiplex PCR sets specifically (‘Dangyooza’, ‘Jigak’, and ‘Yooza’). Four Korean landrace detecting R gene sets and performed comprehensive analysis citrus accessions including ‘Cheongkyul’, ‘Dongjeongkyul’, to determine R gene composition in a Ctv locus conferring ‘Dangyooza’, and ‘Jigak’ contain three genes out of four CTV resistance in the genetic resources of citrus and its major R genes in a Ctv locus (Table 3). relatives. Complete nucleotide sequences on the BAC clones covering a Ctv locus revealed that the genetic locus contained seven R genes encoding CC-NBS-LRR receptors, which were highly predicted to be involved in CTV 254 ∙ Plant Breed. Biotech. 2018 (September) 6(3):245~256

resistance (Yang et al. 2003). Molecular genetics and genes including two major genes were not detected (Table transgenic approaches revealed that four R genes, R1 2). Another single dominant gene (Ctv2) conferring CTV through R4, may play critical function for CTV resistance resistance, which was an independently assorting gene (Rai 2006; USDA patent No. 7126044). Comprehensive from Ctv, was identified from ʻChandlerʼ pumello [C. analysis of R gene composition in a Ctv locus from the maxima (Burm.) Merrill] (Fang and Roose 1999). However, genetic resources of citrus and its relatives revealed that C. maxima ʻChandler' lacked R2 (CTV#7) and R3 (CTV#8) whole R gene sets in the genetic locus were detected only in that were key R genes in a Ctv locus (Table 2). If five trifoliate orange and its derivative cultivar, further suggesting accessions of C. maxima including ʻChandlerʼ and two the underlying molecular mechanism of their strong accessions of kumquat investigated in this study have some resistance against CTV infection (Garnsey et al. 1987; degree of resistance against CTV, their resistance could be Mestre et al. 1997a). Our result on R gene composition in a attributable to Ctv2 locus. Ctv locus also further supports the critical role of R2 gene in The genetic erosion is also one of the significant threats the resistance pathway against CTV, as reported previously in citrus breeding. Ogwu et al. (2014) emphasized the (USDA patent No. 7126044). Among seven R genes of a importance of conserving and utilizing landraces as Ctv locus, R6 (CTV#18) gene was detected only in trifoliate valuable genetic resources for modern plant breeding. Kim orange and its derivative cultivar ‘Flying Dragon’ (Table 2 (1988, 1991) reported that approximately 20-30 of Korean and Fig. 2), indicating that R6 gene also might play pivotal landrace citrus had been recorded in old literatures. role in CTV resistance, although its functional role during However, most of them are now extinct and only twelve CTV infection has not been studied yet. On the other hand, landraces are currently conserved as germplasm collections. R7 (CTV#21) gene was detected in all of the accessions Korean landrace citrus has been known to be resistant to investigated in this study (Table 2). This result strongly pathogens (Kim 1988, 1991). Out of twelve conserved suggests that R7 gene is not involved in the resistance landraces, four accessions such as ‘Cheongkyul’, pathway against CTV. ʻSwingleʼ citrumelo is also widely ‘Dongjeongkyul’, ‘Dangyooza’, and ‘Jigak’ contained three used as a rootstock in several countries including Brazil genes out of four major R genes in a Ctv locus (Table 3). (Mourão Filho et al. 2009). However, two possible key R The results indicate that these four landraces are likely genes conferring CTV resistance, R2 and R6, were not tolerant to CTV infection, although the resistance would be detected in ʻSwingleʼ citrumelo (Table 2 and Fig. 2). This much milder than trifoliate orange and its derivative result indicates that this rootstock cultivar is likely much cultivar ‘Flying Dragon’. milder resistance against CTV, as compared to trifoliate In conclusion, we developed multiplex PCR marker sets orange and ‘Flying Dragon’ cultivar. to specifically amplify seven R genes consisting of a Ctv Kumquat, lime, and lemon groups contained less than locus, one of two CTV-resistant loci identified previously, two genes out of four major R genes (Table 2). Especially, which its sequence information was unveiled. By using the lemon group contains only R4 (CTV#11) out of four major CTV marker sets, we determined composition of seven R R genes, suggesting that are susceptible or the genes consisting of a Ctv locus in a total of 155 citrus weakest resistance against CTV. Some of C. maxima genetic resources including twelve Korean landrace (Burm.) Merrill belonging to the pumello group are known citruses. Genetic composition of seven R genes was variable to have resistance against CTV infection (Yoshida 1985, among the genetic resources. However, all of seven R 1993). Kumquat species including F. crassifolia have also genes were detected only in both trifoliate orange and its been known to be resistant to CTV (Mestre et al. 1997a; derivative cultivar ‘Flying Dragon’. Multiplex PCR marker Asins et al. 1999). C. maxima and its three derivative sets developed in this study would be an effective cultivars, ‘Mato Buntan’, ‘Reinking’, and ‘Siamese Pink’, molecular tool to breed scion or rootstock cultivars with contained four to five genes out of seven R genes including strong resistance trait against CTV in citrus breeding three major genes (Table 2). In case of kumquat, four R program. The R gene marker-based genotyping results of a R Gene Composition in a Ctv Locus Conferring CTV Resistance ∙ 255

Ctv locus will be combined with resistance or susceptibility Fine genetic mapping and BAC contig development for test of all citrus accessions against CTV in near future, the citrus tristeza virus resistance gene locus in Poncirus which will further increase effectiveness of the marker sets trifoliata (Raf.). Mol. Genet. Genomics 265: 739-747. established in this study. Donkersley P, Silva FWS, Carvalho CM, Al-Sadi AM, Elliot SL. 2018. Biological, environmental and socioeconomic threats to citrus lime production. J. Plant Dis. Prot. 125: ACKNOWLEDGEMENTS 339-356. Fang DQ, Federici CT, Roose ML. 1998. A high-resolution linkage map of the citrus tristeza virus resistance gene This research was supported by “Golden Seed Project region in Poncirus trifoliata (L.) Raf. Genetics 150: 883- (Center for Horticultural Seed Development, No. 890. 213007-05-2-WTP11)”, Ministry of Agriculture, Food and Fang DQ, Roose ML. 1999. A novel gene conferring citrus Rural Affairs (MAFRA), Ministry of Oceans and Fisheries tristeza virus resistance in Citrus maxima (Burm.) Merrill. (MOF), Rural Development Administration (RDA) and HortScience 34: 334-335. Korea Forest Service (KFS), and “Cooperative Research Garnsey SM, Barrett HC, Hutchison DJ. 1987. Identification Program for Agriculture Science & Technology Development of citrus tristeza virus resistance in citrus relatives and its (Project No. PJ01344501)”, Rural Development Adminis- potential applications. Phytophylactica 19: 187-192. tration, Korea. Authors appreciate Dr. Kyung Uk Yi for Garnsey SM, Su HJ, Tsai MC. 1997. Differential susceptibility proofreading of the manuscript. of pummelo and Swingle citrumelo to isolates of citrus tristeza virus, p. 138-146. In: JV. Da Graca, P. Moreno P., RK. Yokomi (eds.). Proc. 13th Conf. Intl. Organ. Citrus REFERENCES Virologists. Univ. California Press, Riverside, CA. Gmitter FG Jr, Xiao SY, Huang S, Hu XL, Garnsey SM, Deng Asíns MJ, Mestre PF, Navarro L, Carbonell EA. 1999. Z. 1996. A localized linkage map of the citrus tristeza Strategies to search for new Citrus Tristeza Virus virus resistance gene region. Theor. Appl. Genet. 92: resistant genotypes in a germplasm bank. p. 251-256. In: 688-695. GTS. Mugnozza, E. Porceddu, MA. Pagnotta (eds.). Gmitter FG Jr, Deng Z, Chen C. 2007. Cloning and Genetics and breeding for crop quality and resistance. characterization of disease resistance genes, p. 287-305. Developments in plant breeding, vol. 8. Springer, In: I. Khan (ed.). Citrus genetics, breeding and biotechnology. Dordrecht. CAB International, Oxfordshire, UK. Asíns MJ, Fernández-Ribacoba J, Bernet GP, Gadea J, Kim HB, Kim JJ, Oh CJ, Yun S-H, Song KJ. 2016. Current Cambra M, Gorris MT et al. 2012. The position of the status and prospects of molecular marker development major QTL for citrus tristeza virus resistance is conserved for systematic breeding program in citrus. J. Plant among Citrus grandis, C. aurantium and Poncirus trifoliata. Biotechnol. 43: 261-271. Mol. Breed. 29: 575-587. Kim HY. 1988. Distribution, taxonomy, horticultural characters Deng Z, Huang S, Xiao SY, Gmitter FG. 1997. Development of the local Citrus spp. in Cheju, and the genetic markers and characterization of SCAR markers linked to the citrus among them. PhD dissertation. Chonnam National Uni- tristeza virus resistance gene from Poncirus trifoliata. versity (in Korean). Genome 40: 697-704. Kim HY. 1991. Taxonomy and horticultural characters of the Deng Z, Tao Q, Chang YL, Huang S, Ling P, Yu C, et al. local Citrus spp. in Cheju. J. Cheju Studies 8: 59-99. 2001a. Construction of a bacterial artificial chromosome Mestre PF, Asins MJ, Pina JA, Navarro L. 1997a. Efficient (BAC) library for citrus and identification of BAC search for new resistant genotypes to the citrus tristeza contigs containing resistance gene candidates. Theor. closterovirus in the orange subfamily Aurantioideae. Appl. Genet. 102: 1177-1184. Theor. Appl. Genet. 95: 1282-1288. Deng Z, Huang S, Ling P, Yu C, Tao Q, Chen C, et al. 2001b. Mestre PF, Asins MJ, Pina JA, Carbonell EA, Navarro L. 256 ∙ Plant Breed. Biotech. 2018 (September) 6(3):245~256

1997b. Molecular markers flanking citrus tristeza virus artificial chromosome library of Poncirus trifoliata (L.) resistance gene from Poncirus trifoliata (L) Raf. Theor. Raf. Genome 44: 382-393. Appl. Genet. 94: 458-464. Yang ZN, Ye XR, Molina J, Roose ML, Mirkov TE. 2003. Mourão Filho FAA, Girardi EA, Couto HTZ. 2009. ‘Swingle’ Sequence analysis of a 282-kb region surrounding the citrumelo propagation by cuttings for citrus nursery tree citrus tristeza virus resistance gene (Ctv) locus in production or inarching. Sci. Hortic. 120: 207-212. Poncirus trifoliata L. Raf. Plant Physiol. 131: 482-492. Ogwu MC, Osawaru ME, Ahana CM. 2014. Challenges in Yi KU, Kim HB, Song KJ. 2018. Karyotype diversity of conserving and utilizing plant genetic resources (PGR). Korean landrace mandarins by CMA banding pattern and Int. J. Genet. Mol. Biol. 6: 16-22. rDNA loci. Sci. Hortic. 228: 26-32. Rai M. 2006. Refinement of the Citrus tristeza virus resistance Yoshida T. 1985. Inheritance of susceptibility to citrus tristeza gene (Ctv) positional map in Poncirus trifoliata and virus in trifoliate orange (Poncirus trifoliata Raf.). Bull. generation of transgenic grapefruit (Citrus paradisi) Fruit Trees Res. Sta. 12: 17-26. plant lines with candidate resistance genes in this region. Yoshida T. 1993. Inheritance of immunity to citrus tristeza Plant Mol. Biol. 61: 399-414. virus of trifoliate orange (Poncirus trifoliata) in some Yang ZN, Ye XR, Choi S, Molina J, Moonan F, Wing RA, et citrus intergeneric hybrids. Bull. Fruit Trees Res. Sta. 25: al. 2001. Construction of a 1.2-Mb contig including the 33-43. citrus tristeza virus resistance gene locus using a bacterial