[CANCER RESEARCH56, 2655-2661. June 1, 19961 Biallelic Alterations of Both ETV6 and CDKN1B in a t(12;21) Childhood Acute Lymphoblastic Leukemia Case1

Iwona Wlodarska, Mathijs Baens, Pieter Peeters, Jeroen Aerssens, Cristina Mecucci, Penelope Brock, Peter Marynen, and Herman Van den Berghe2

Center for Human Genetics, Flanders Interuniversity Institute for Biotechnology Ii. W., M. B., P. P., J. A.. P. M.. H. V. d. B.] and Department of Pediatrics [P. B.J, University of Leuven, Herestraat 49, 3000 Leuven, Belgium, and Hematology and Bone Marrow Transplantation Unit, University of Perugia, 06100 Perugia. Italy [C. M.J

ABSTRACT ETV6-l0q24 (13), have been identified in ALL, AML, and myelo dysplastic syndrome, respectively, indicating that the is espe Recently, a new recurrent t(12;21)(p13;q22) has been identified in a cially prone to alterations that may affect cells of myeloid as well as B-cell lineage childhood acute lymphoblastic leukemia (ALL). The tram lymphoid origin. Moreover, detection of loss of heterozygosity at location results in a fusion of two known genes, ETV6/TEL (l2pl3) and l2pl3 and FISH analysis of l2p abnormalities in patients with various AMLJ (21q22), previously shown to be involved in the pathogenesis of myeloid disorders. We report results of cytogenetic fluorescence in situ hematological disorders revealed that ETV6 and the CDKNJB gene hybridization and molecular studies of a B-cell childhood common ALL encoding the cyclin-dependent kinase inhibitor p27'<@―aresituated in with a cryptic 12;21 translocation. Aberrations identified in this case the smallest critically deleted region (5, 6) and that both genes are involve both 12 and include not only the ETV6-AMLJgene frequently deleted in a type of childhood ALL (14). fusion and two different microdeletions of ETV6 but also the hemizygous The second gene rearranged by t(12;21), AMLJ, was cloned from loss of CDKNJB, D12S119, and KRAS2 lcd and a putative rearrangement a breakpoint of a t(8;21)(q22;q22) translocation that has been of the second CDKNJBallele as a result of an inv(12)(p13q24). Moreover, observed in about 40% of karyotypically abnormal cases of it was shown that the AMLJ-ETV6 reciprocal chimeric transcript was not AML-M2 (15). The translocation results in a fusion of the DNA present in the malignant cells, and hence may not play a major role in binding runt domain of the AMLJ gene and the entire ETO/MTG8 leukemogenesis. In addition, the putative loss of wild-type function of gene, which encodes a putative transcription factor. Several trans CDKNJB and ETV6 could indicate a synergistic effect of both genes in the pathogenesis of this leukemia case. locations involving the AMLJ gene have been identified in myeloid leukemias and in all of them the resulting chimeric genes contain the AMLJ promoter and runt domain fused to other partner genes INTRODUCTION including the EAP, MDSJ, and EVIl genes on 3 (16). Therefore, t(l2;21) is unique among AMLI variant translocations Chromosomal abnormalities involving the short arm of chromo because it involves the entire AMLJ gene and affects leukemias of some 12, observed in a broad spectrum of hematological disorders lymphoid origin. (1), appear to be particularly common in a type of childhood ALL3 In the recently published series of studies of ALL, the ETV6-AMLJ (2, 3). These aberrations consist of both deletions and reciprocal or fusion has been documented in 16—36%of pediatric patients (17, 18), nonreciprocal translocations of l2p with various partner chromo so making it the most common abnormality in this subtype of leuke somes, and according to recently published FISH and molecular mia. Moreover, Shurtleff et a!. (17) reported that ETV6-AMLJ-ex data, they remain underestimated by classical cytogenetics (4—6). pressing ALLs constitute a clinically distinct entity affecting children For example, a t(12;21)(p13;q22) that was recently identified as a ages 1—10years with B lineage, nonhyperdiploid leukemic lympho recurrent translocation in a type of childhood B-cell ALL escaped blasts, and favorable prognosis. One of the striking molecular findings routine banding analysis and was initially discovered by FISH in these patients is a frequent deletion of the nontranslocated ETV6 analysis (7). Two groups independently demonstrated that the allele resulting in a loss of wild-type ETV6 function in the leukemic molecular consequence of the (l2;21)(p13;q22) translocation is the cells. The consistency of the involvement of the ETV6-AMLJ rear fusion of two known genes, namely ETV6, mapped to l2pl3, and rangement in childhood ALL is emphasized in the present paper in AMLJ, located at 21q22, previously shown to be involved in which we report a cryptic t(12;21)(p13;q22) masked by a dic(12; chromosomal translocations characteristic of myeloid malignan 13)(p1 1;qlO) and detected by FISH. In addition, the ETV6-AMLJ cies (8, 9). The resulting chimeric consists of the helix gene fusion in this patient was associated with rather complex aber loop-helix domain of ETV6 and the entire AMLJ gene, including its rations involving both chromosome 12s, which were further investi DNA binding and transactivation domains. gated by FISH and gene rearrangement studies. The ETV6 gene, encoding an ETS-like putative transcription factor, was initially identified by its fusion with the platelet derived growth factor receptor @3in chronic myelomonocytic leukemia associated PATIENTS AND METHODS with a t(5;12)(q33;pl 3) (10). In addition, other chimeric transcripts, namely ETV6-ABL (1 1) and ETV6-MNJ (12), plus a translocation Patient. The patient, a 15-year-oldgirl, was admitted in June 1995because of bone pain, fatigue, and fever. Her previous medical history was unremark able. Clinical examination revealed a pale skin and a slight hepatosplenomeg Received 12/7/95; accepted 3/26/96. The costs of publication of this article were defrayed in part by the payment of page aly. Hematological data were as follows: hemoglobin, 9.9 g/dl; platelets, charges. This article must therefore be hereby marked advertisement in accordance with 111 X l0@;and white blood cells, 9.9 X 109/L with 9% neutrophils, 37% 18 U.S.C. Section 1734 solely to indicate this fact. lymphocytes, and 54% lymphoblasts. Bone marrow was hypercellular with a I This text presents research results of the Belgian program on Interuniversity Poles of proportion of 85% of blast cells expressing CD34, CD19, CD22, CD1O, HDR, Attraction initiated by the Belgian State, Prime Minister's Office, Science Policy Pro gramming. The scientific responsibility is assumed by its authors. The work was sup CD33, and CD13. The diagnosis of common ALL, classified as L2 according ported in part by National Fonds voor Wetenschappelyk Onderzoek Grant 9.0153 96 to the FAB criteria, was established. Chemotherapy following a standard awarded to P. M. and H. V. d. B. protocol for childhood ALL (EORTC 5881) was started. 2 To whom requests for reprints should be addressed. Cytogenetics. Chromosome analysis was performed on direct cultures of 3 The abbreviations used are: ALL, acute lymphoblastic leukemia; FISH, fluorescence in situ hybridization; AML, acute myeloid leukemia; YAC, yeast artificial chromosome; bone marrow cells prior to treatment. Ten R- and G-banded karyotypes were RT-PCR, reverse transcription-PCR. analyzed and classified according to ISCN 1995 (19). 2655

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 1996 American Association for Cancer Research. ff1/6 AND CDKNIB ALTERATIONS IN ALL

ETV6 cosmids 12p JlOkb telom .179A6exon1bp1.57

D12S158 .... YAC958B8

PRB3 I

50F4 ETV6 I exon 2 bp 58-187 Fig. 1. Diagram of the short arm of with indicated probes applied in FISH, in relation to their l2p localization.

CDKN1B I

D12S119 II @. 163E7 .. 2G8 exon 3 bp188-352

@ I : exon 4 bp353-487 KRAS2 I .. 184C4

@ ... exon 5 bp488-1033

@ Dl 2S934 ... . exon 8 bp1278-.. cen

FISH. FISHwas performedas previouslydescribed(20). Chromosome12 standard procedures with pd(N6) random primers. The following primers abnormalities were analyzed using eleven l2p cosmid probes and YAC 958B8 derived from E'TV6and AMLJ sequences were used to amplify the ETV6- (Fig. 1) labeled with biotin. 958B8 is a 1.2-Mb YAC containing the ETV6 A/tiLl fusion RNA: ETV6F (5'-TCCCCGCCTGAAGAGCACGCC) and gene, as was previously published by Golub et a!. (10). The ETV6 locus was AMLJR (5'-AGCGGCAACGCCrCGCFCAT). For the amplification of the investigated with the following LL12NCO1 cosmid probes (Lawrence Liver AMLJ-E1V6 fusion RNA, the following primers were used: AMLJF (5'- more National Laboratories, Livermore, CA) ordered as follows: S'end GGAGGAAGCGATGGCTTCAGACAGC) and ETV6R (5'-CCACAGTC l79A6-50F4-2G8-l63E7-1 84C4-l48B6-3'end. The different ETV6 exons GAGCCAGTCCGTFGG). present in the cosmids are shown in Fig. 1.'@Cosmidprobes for D12S158, DNA was isolated from a bone marrow sample and used for Southern PRB3, D12S119, and KRAS2 were described before by Chaffanet et aL (21) analysis by standard methods. A probe for CDKNJB was obtained by PCR and for D12S934 by Baens et al. (22). with the following primers derived from the CDKNJB cDNA (F: GCIGACT Further FISH experiments were performed using a chromosome 13ql3 TGGAGAAGCACTGC; R: GGGTCTGTAGTAGAACTCGG), amplifying a specific cocktail probe IGMTA94/013 (Integrated Genetics), a chromosome genomic fragment of 1.2 kb. 13/21 centromere probe (pUC 1.76), a cosmid containing CSFJR mapped to 5q33 (23), cosmid ICRFC1O2D12118 (2lq22.3, ICRF) and a whole chromo RESULTS some 12 painting probe (WCP 12, Imagenetics). Chromosome l2s were identified by cohybridization with the Texas Red-5-dUTP labeled chromosome Cytogenetics and FISH. Cytogenetic analysis of the reported 12 alphoid probe (pBR12; Ref. 24) and simultaneous G-banding analysis using case performed at the time of diagnosis revealed clonal chromo 4'6-diamidino-2phenylindole dihydrochloride counterstaining. The number of somal abnormalities in 50% (5 of 10) of analyzed bone marrow analyzed abnormal cells in each experiment is indicated in Table 1. The FISH data were collected on a Leitz DMRB fluorescence microscope equipped with cells described as 44, X, —X, del(2)(q14q22), del(5)(pl3pl4), a cooled black-and-white charge-coupled device camera (Photometrics) run by inv(l2)(p12q24), der(l2)t(l2;13)(pl l;q12), —13.A representative R SmartCapture software (Vysis, Stuttgart, Germany). banded karyotype is shown in Fig. 2. To confirm the inv(12) detected Molecular Analysis. Total RNA was isolated from bone marrow cells by cytogenetics, FISH was performed with a chromosome 12 painting using the Trizol reagent (BRL). First strand cDNA was reverse transcribed probe (WCP 12) and YAC 958B8 containing ETV6. The uniform from I i.@gRNA with MuMLV-reverse transcriptase (BRL) according to painting of the inv(12) and a hybridization signal from the YAC on the long arm of this abnormal chromosome were in agreement with 4 P. Marynen, unpublished results. the cytogenetic data. However, a second hybridization signal from this 2656

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 1996 American Association for Cancer Research. F_-1v6ANDCDKNJBALTERA11ONSINALL

analysisProbesLocalizationinv(l2) Table 1 Results of FISH analyzedD12S158l2pl3.3—+ l2pinv(12) 12q der(l2)der(2l)der(5)No. of abnormal cells —+—6958B8l2pl3—+ —+—10179A612p13—— —+—950F4l2p13——

—+—62G812p13——

—+—8l63E7l2p13——

—+—6l84C4l2pl3——

—+—10l48B6l2pl3—+ ———9l23C1212p13++ ———6D12S11912p12+— ———6KRAS212p12+—

———8D12S93412p11+—

+——6pBR@l2acent +——7pUC 12++ ++—7IGMTA94/0l313q13——1.76cent-l3/21—— ++—8ICRFCIO2D ——+7CSFJR5q33——1211821q22—— ——+5a

PBR-l2 was additional!y used as a marker for chromosome 12 in the majority of FISH experiments.

l2pl3/ETV6 specific 958B8 YAC was unexpectedly detected on a der(l2)t(l2;l3) (Fig. 3E). Taken together, these observations mdi small acrocentric, identified as a chromosome 21 (Fig. 3A). This cated the dicentric nature of this derivative chromosome with a l2p observation suggested a cryptic t(12;21) translocation masked by a breakpoint telomeric to D12S934. The cosmid specific for 2lq22.3 t(12;13) and prompted us to investigate this case with other l2p- hybridized to a normal chromosome 21 and, unexpectedly, to a short specific DNA probes. D12S158, a l2pl33 specific cosmid, and the arm of chromosome 5, which was further confirmed by cohybridiza ETh'6 probes 179A6, 50F4, 208, l63E7, and l84C4 were present on tion with 5q33 specific CSFJR probe (Fig. 3F). chromosome 21 (e.g., 50F4; Fig. 3B), whereas l48B6 was absent (Fig. Interestingly, FISH analysis with the same l2p cosmid probes 3C). These results confirmed the translocation of the distal part of performed on the inv(12) chromosome showed splitting of the signal chromosome l2p to chromosome 21, with a l2p breakpoint within ofthe CDKNJB probe demonstrating that the l2p breakpoint occurred ETV6 between l84C4 and 148B6. All these ETV6-specific probes, within or near the CDKNJB gene. Consequently, hybridization signals together with probes for CDKNJB, D12S1 19, and KRAS2, were from other probes centromeric to CDKNJB, namely, D12S119, absent from the dcr(12)t(12;13) (e.g., CDKNJB; Fig. 3D) and KRAS2, and D12S934, were found on the short arm of the inv(12) D12S934(l2pll) waspresent,demonstratinganinterstitialdeletion chromosome. These experiments unexpectedly also revealed an inter of l2p sequences ranging from exon 8 of ETV6 (148B6) distal to stitial microdeletion that involved the 5' end of ETV6. Briefly, hy D12S934 [del(12)(pllpl3)]. bridization signals from 179A6, 50F4, 2G8, l63E7, and l84C4 probes The complex rearrangements involving chromosomes 12, 13, and were lost (e.g., 50F4; Fig. 3B), but the 3' end ETV6 probe l48B6 21 were further analyzed by FISH with a chromosome l3ql3 cocktail hybridized to the inv(12) chromosome (Fig. 3C). Taken together with probe (IGMTA94/013), chromosome 12 (pBR12), 13/21 (pUC 1.76) the normal signal observed with the YAC 958B8 described above, this centromeric probes, and a cosmid assigned to 21q22.3. The 13ql3 indicates the presence of a microdeletion possibly limited to 5'-ETV6. probe hybridized to the normal chromosome 13 and the der(l2)t(12; All FISH results are summarized in Table 1 and schematically 13). The pUC 1.76 probe marked chromosome 13 and centromeres of illustrated in Fig. 4. The FISH findings led to a correction of the both chromosomes 21 and also cohybridized with pBRl2 on description of the original karyotype as follows: 44, X, —X, -@-@-----@e-----@ -;:--! !@J ‘. %@ a.

@ ___I 2 3 — @ -: Fig.2.R-bandedkaryotypeofthereportedcase. -I Arrows, chromosomes involved in complex rear rangements described in “Results.― 6 7 8 9 10 11 12 x x —@----“—“

13 14 15 16 17 _ 18 if -ss—.@ e 21 22 V 19 20 9

2657

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 1996 American Association for Cancer Research. E1V6 AND CDKNIB ALTERATIONS IN ALL

A

4

C D

4. S K,

V 4

&

Fig. 3. Examples of FISH results with YAC 958B8 (A); cosmids 50F4 (B), l46B6 (C), and CDKNIB (D); centromeric probes for chromosome 12 and 13/21 (E); and 2lq22.3 probe (F). Big arrows, arrowheads, and small arrows, inv(l2), der(l2)t(l2;l3), and chromosome 2ls, respectively. @.anormal chromosome 13 (E) and der(5) (F). E, inset, the der(5) chromosome identified by a cohybridization of 2lq22.3- and 5q33-specific cosmid probes.

2658

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 1996 American Association for Cancer Research. E1V6 AND CDKNIB ALTERATIONS IN ALL

del(2)(q14q22), del(5)(pl3pl4). ish der(5)t(5;21)(p13;q22) (CSFJR+, 123C12/CDKNIB @ 12p13 ,@•f D12S119 12118+), inv(l2)(p12q24). ish inv(12)(p13q24) del(12)(p13) (wcpl2+, Dl2Sl58mv, 958B8mv, l79A6—, 50F4—,208—, 163E7—,l84C—, — U KP.AS2 D12S934 l48B6mv, l23c12 sp, D12S119+, KRAS2+, D12S934+, pBR-12+), der(l2)t(12;l3)(pll;ql2). ish dic(l2;l3)(pll;pll) del(12)(pllpl3) (D12S158—, 958B8—, l79A6—, 50F4—,2G8—, 163E7—,184C4—, U l48B6—, l23Cl2—, D12S119—, KRAS2—, D12S934+, pBR-l2+, U 123C12/CDKNIB pUC1.76+, IGMTA94/0l3+), —13. ish der(2l)t(12;21) (p13;q22) 958B8 (pUCl.76+, 12118—, l84C4+, 163E7+, 2G8+, 50F4+, 179A6+, 12q24 U /“ 148B6/ETV6 958B8+, D12S158+). — —D12S158 Molecular Investigations. The expression of ETV6, AMLI, and chimeric ETV6-AMLJ mRNAs was investigated by RT-PCR (Fig. 5). inv(12)(pl 3q24) A signal for the ETV6-AMLI transcript was present in the bone marrow sample of the patient and absent in a control EBV-trans formed lymphocyte sample, confirming the translocation of S'ETV6 to chromosome 2 1. The size of the PCR products also demonstrates that I MC4@ fusion occurred between the same ETV6 and AMLJ exons as de 2G8 I ETV6 scribed by Romana et a!. (9) and Golub et a!. (8). No products were 50F4 I obtained with primers designed to amplify an AMLJ-ETV6 chimeric 179A&J mRNA. This is in agreement with the translocation of 2lq sequences 958B8 21q22@/ I to chromosome 5. A control PCR amplifying a E7V6 fragment (bp — D12S158 991-1 164 of the ETV6 cDNA; Ref. 8) showed a clear signal for the EBV-transformed sample and a weak signal with the patient's bone der(21)t(12;21)(pl 3;q22) marrow RNA (data not shown). Because FISH data show that this part of ETV6 is completely deleted in the leukemic cells, the signal must result from normal cells present in the bone marrow sample, a finding —12118 (21q22) 5p13 confirmed by the chromosome data. FISH with cosmid l23Cl2, which carries the CDKNIB gene, resulted in a split signal. To investigate this, DNA isolated from the bone marrow sample was digested with EcoRI, BamHI, and HinDlil, and a Southern hybridization was performed with a CDKNJB probe I obtained by PCR. With EcoRI, the tumor sample showed an aberrant I fragment of 8 kb, whereas the control yielded a band at 13 kb. To exclude a polymorphism, the same probe was hybridized to a South I ern blot with 20 normal control DNAs, and in each case, a band at 13 — kb was detected. With BamHI and HinDIII, genomic fragments of N CSFIR approximately 6.5 kb were detected in both the tumor sample and the control sample (Fig. 6).

der(5)t(5;21)(pl3;q22)

ETV6-AMLIAMLI-E7V6

N a) -)‘; 0 0 @ F- F- , pUCI.76(can-i3) —7 D12S934 @@ 12p11 ..—pBR-12 (cen-12) 506bp - U I U 154bp - —

@@ . . . . . ,@: dic(12;13@p11;pll) Fig. 5. RT-PCR analysis. RNA from the tumor sample (Ml) and a white blood cell (WBC) control sample were reverse transcribed. EI'V6-AMLI and E1V6-TEL cDNA was Fig. 4. Schematic representation of four abnormal chromosomes involved in complex amplified using the primers described in “MaterialsandMethods.―TheE7V6-AMLI rearrangements with indicated localization of probes used for FISH. cDNA appears as a product of 158 bp. Marker size is indicated to the left. 2659

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 1996 American Association for Cancer Research. E1V6 AND CDKNIB ALTERATIONS IN ALL

kb,5 and together with the observation of normal FISH signals with PATIENTCONTROL— the 958B8 probe, this indicates that the deletion is limited to the ETV6 gene. This finding strongly suggests that E1V6 is the actual target of = l2pl3 deletions associated with t( l2;2l ). The biallelic alteration of

. C.) CD ETV6 caused by the t(l2;2l), plus a partial deletion, leading to its LU @fl :@0 Lu co :t functional inactivation in leukemic cells, fulfills a criterion for its being a tumor suppressor gene. However, recent reports indicate that •@k- @@:‘ -@— 13 kb del(l2)(p) is a secondary event in ALL with t(l2;2l) (25) and does not ..< occur in all cases with ETV6-AML1 fusion (17, 18, 25), so the @ 8kb —@ ,, .‘ ... alternative possibility remains that t(12;2l) fusion act in a ..@- recessive fashion and thus requires a deletion of the normal ETV6 .-. allele. Another intriguing FISH finding in our case is a putative rearrange Fig. 6. Southern analysis of tumor DNA with a CDKNIB probe. Tumor DNA and a ment of CDKNJB as a result of the inv(12)(p13q24). Southern blot white blood cell control sample were digested with EcoRI, BamHl, or HinDifi separated by gel electrophoresis and transferred to a nylon membrane. The membrane was hybrid analysis with a genomic probe containing the two coding exons of ized with a CDKNIB probe obtained by PCR and containing the coding exons of CDKNJB detected an abnormal fragment after digestion with EcoRI. CDKNIB. This indicates that the breakpoint occurred within a 8-kb fragment containing the CDKNJB gene, and it is tempting to speculate that this rearrangement inactivated the CDKNIB gene. We also showed that DISCUSSION the CDKNJB allele on the dic(12;l3) was deleted; hence, the tumor Recurrent involvement of the short arm of chromosome 12 in cells might present a homozygous inactivation of CDKNJB. The karyotypic abnormalities observed in hematological malignancies presence of normal cells in the tumor sample prevents an analysis of suggests a significant role of this chromosome region in leukemogen this by RT-PCR, and further molecular studies are necessary to prove esis. The ETV6 gene, recently identified and assigned to l2pl3, was this point. until now the only gene on chromosome l2p shown to be rearranged The CDKNJB gene, which is situated at most 2.9 Mb centromeric by chromosomal translocations in leukemias. One of these recurrent to ETV6 (5), belongs to a family of genes coding cyclin-dependent translocations, t(l2;2l)(pl3;q22), not apparent at the cytogenetic kinase inhibitors including pl5m@@4B,p16INK4A,p18 and p2lwAFI, level, appeared as the most common anomaly in childhood B-cell which may act as tumor suppressors (26—30).p27―1―@',theproduct of ALL (17, 18). Using FISH with 12p-specific DNA probes, we not CDKNJB, has 42% homology with pl6h1W@4d@proteinin its NH2- only identified another cryptic 12;21 translocation in a pediatric terminal region and is also involved in G@cell cycle arrest. However, patient with B-cell ALL, masked by a dic( 12; 13)(pl 1;pl 1), but dis in contrast to p16INK4A,in which biallelic deletions have been fre covered additional biallelic rearrangements of CDKNJB. This masked quently found in hematological malignancies (31, 32), except for two t(l2;2l) translocation resulted in a ETV6-AMLI fusion similar to the cases with a homozygous CDKNIB deletion found by Morosetti et a!. one described by Romana et a!. (9) and Golub et al. (8). FISH (33) in a series of 119 analyzed non-Hodgkin's lymphomas and ALLs, revealed that the breakpoint occurred proximally to cosmid l84C4, no other biallelic inactivation of CDKNJB could be demonstrated in a which contains two exons coding for bp 353-1033 of ETV6, and the series of human leukemias and solid tumors (34—36).Thus, our case presence of ETV6-AMLJ fusion mRNA in leukemic cells was dem is exceptional in this respect, and it is tempting to speculate that onstrated by RT-PCR, which detected a fragment of the same size as biallelic alterations of both ETV6 and CDKNJB might have a syner expected based on previous observations. In addition, FISH results gistic effect in the development of some acute leukemias. More showed that the 3' end ETV6 domain (l48B6) was deleted from the extensive molecular studies of CDKNJB gene in ALL should be dic(l 2;l3) chromosome together with CDKNJB, DJ2SJ 19, and performed to investigate this possibility. KRAS2, and that the 21q22.3 sequences were translocated to the short In summary, important observations were made in the present arm of chromosome 5. Therefore, the reciprocal chimeric transcript study. First, a t(12;21), which is not evident on a cytogenetic level, containing the 5' end AMLJ and the 3' end ETV6 domain is absent in can occur as a consequence of several possibly complex chromosomal the malignant cells, as confirmed by the RT-PCR experiments. In translocations, and a l2pl3/ETV6 specific breakpoint can be masked contrast, Romana et al. (9) and Golub et a!. (8) found that both by an interstitial deletion in the same chromosome 12. In addition, we derivative chromosomes of a t(l2;2l) are transcriptionally active, showed that the 5'-ETV6-AMLJ-3' chimeric gene, rather than the although the level of the 5'-AMLJ-ETV6-3' mRNA expression in two reciprocal product of a t( l2;2l ), plays a critical role in leukemo cases analyzed by the latter group was low. The results presented here, genesis. together with the recent data reported by Shurtleff et a!. (17) and Moreover, the intragenic microdeletion of the 5' part of the E1V6 Romana et a!. (18), clearly indicate that the 5'-ETV6-AMLJ-3' chi allele unaffected by the translocations strongly indicates that the gene meric protein is sufficient for the development of leukemia. is the target of l2p deletions associated with a t(l2;2l) in childhood In the previously published ETV6-AMLJ documented ALLs, the ALL. Finally, the inactivation of the wild-type function of ETV6 and wild-type ETV6 allele was frequently deleted, as demonstrated using the putative homozygous inactivation of CDKNJB in the leukemic Southern blot and FISH approach (8, 9, 17, 18, 25). FISH analysis of cells suggest a synergistic involvement of these two candidate tumor the inv(l2) of the case reported here revealed that a microdeletion suppressor genes in pathogenesis of the reported ALL. More cases occurred within the region covered by YAC 958B8 that affected only need to be analyzed in detail to answer this question. the 5' end of ETV6 encoding the helix-loop-helix domain (probes I79A6, 50F4, 2G8, I63E7, and I84C4) but not the 3' end of ETV6

(148B6). The part of ETV6 that is deleted spans approximately 270 5 P. Marynen, unpublished observation. 2660

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 1996 American Association for Cancer Research. L7V6 AND CDKNIB ALTERATIONS IN ALL

ACKNOWLEDGMENTS 18. Romana, S. P., Poirel, H., Leconiat, M., Flexor, M-A., Mauchauffé,M.,Jonveaux, P., Macintyre, E. A., Berger. R., and Bernard, 0. A. High frequency of t(12;21) in The authors thank Magda Dehaen for technical assistance and Rita Logist childhood B-lineage acute lymphoblastic leukemia. Blood, 86: 4263—4269, 1995. for her help in the preparation of the manuscript. 19. Mitelman, F. (ed). ISCN 1995: An International System for Human Cytogenetic Nomenclature. Basel: Karger (in collaboration with Cytogenet. Cell Genet.), 1995. 20. Wlodarska, I., Mecucci, C., Vandenberghe, E., Dc Wolf-Peeters, C., Thomas, J., REFERENCES Hilliker, C., Schoenmakers, E., Stul, M., Marynen, P., Cassiman, J. J., and Van den Berghe, H. Dup(l2)(q13—'qter) in two t(14;18)-negative follicular B-non-Hodgkin's 1. Mitelman, F. Catalog of Chromosome Aberrations in Cancer, Ed. 5. New York: lymphomas. Genes Chromosomes & Cancer, 4: 302—308,1992. Wiley-Liss, Inc., 1994. 21. Chaffanet, M., Baens, M., Aerssens, J., Schoenmakers, E., Cassiman, J. J., and 2. Raimondi, S. C., Williams, D. L., Callihan, T., Peiper, S., Rivera, G. K., and Murphy, Marynen, P. Mapping of an ordered set of 14cosmids to human chromosome 12p by S. B. Nonrandom involvement of the 12pl2 breakpoint in chromosome abnormalities two-color in situ hybridization. Cytogenet. Cell Genet., 69: 27—32,1995. of childhood acute lymhoblastic leukemia. Blood, 68: 69—75,1986. 22. Baens, M., Aerssens, J., Van Zand, K., Cassiman, J. J., Van den Berghe, H., and 3. Raimondi, S. C. Current status of cytogenetic research in childhood acute lympho Marynen, P. Isolation and regional assignment of human chromosome l2p cDNAs. blastic leukemia. Blood, 81: 22.37—2251, 1993. Genomics, 29: 44—52,1995. 4. Kobayashi, H., and Rowley, J. D. Identification ofcytogenetically undetected l2pl3 23. Thangavelu, M.. Neuman, W. L., Espinosa, R., Nakamura, Y., Westbrook, C. A., and translocations and associated deletions with fluorescence in situ hybridization. Genes Le Beau, M. M. A physical and genetic linkage map of the distal long arm of human Chromosomes & Cancer, 12: 66—69,1995. chromosome 5. Cytogenet. Cell Genet., 59: 27—30,1992. 5. Sato, Y., Suto, Y., Pietenpol, J., Golub, T. R., Gilliland, G., Davis, E. M., Le Beau, 24. Baldini, A., Rocchi, M., Archidiacono, N., Miller, 0. J., and Miller, D. A. A human M. M., Roberts, J. M., Vogelstein, B., Rowley, J. D., and Bohlander, S. K. TEL and a satellite DNA subset specific for chromosome 12. Am. J. Hum. Genet., 46: lap, define the smallest region ofdeletions on l2pl3 in hematopoietic malignancies. 784—788, 1990. Blood, 86: 1525—1533,1995. 25. Romana, S. P., Le Coniat, M., Poirel, H., Marynen, P., Bernard, 0. A., Berger, R. 6. Wlodarska, I., Marynen, P., La Stana, R., Mecucci, C., and Van den Berghe, H. The Deletion of the short arm of chromosome 12 is a secondary event in acute lympho TEL, CDKNIB and D12S178 loci are involved in a segment commonly deleted in blastic leukemia with t(12;2l). Leukemia (Baltimore), 10: 167—170,1995. various l2p aberrations in different hematological malignancies. Cytogenet. Cell 26. Polyak, K., Lee, M. H., Erdjument-Bromage, H., Koff, A., Roberts, J. M., Tempot, P., Genet., 72: 229—235,1996. and Massagué,J.Cloning of p27―@,a cyclin-dependent kinase inhibitor and a 7. Romana, S. P., Le Coniat, M., and Berger, R. t(12;2l): a new recurrent translocation potential mediator of extracellular antimitogenic signals. Cell, 78: 59—68,1994. in acute lymphoblastic leukemia. Genes Chromosomes & Cancer, 9: 186—191,1994. 27. Toyoshima, H., and Hunter, T. p27, a novel inhibitor of GI Cycin-CdK protein 8. Golub, T. R., Barker, G. F., Bohiander, S. K., Hiebert, S. W., Ward, D. C., Bray kinase activity, is related to p21. Cell, 78: 67—74,1994. Ward, P., Morgan, E., Raimondi, S. C., Rowley, J. D., and Gilliland, D. G. Fusion of 28. Serrano, M., Hannon, G. J., and Beach, D. A new regulatory motif in cell cycle theTELgeneon l2pl3 totheAML1geneon21q22inacutelymphoblasticleukemia. control causing specific inhibition ofcyclin D/CDK4. Nature (Lond.), 366: 704—707, Proc. Nati. Acad. Sci. USA, 92: 4917—4921, 1995. 1993. 9. Romana. S. P., Mauchauffé,M.,Leconiat, M., Chumakov, I., Le Paslier, D., Berger, 29. Guan, K. L., Jenkins, C. W., Li, Y., Nichols, M. A., Wu, X., O'Keefe, C. L., R., and Bernard, 0. A. The t(12;2l) of acute lymphoblastic leukemia results in a Matera, A. G., and Xiong, Y. Growth suppression by p18, a pl6@@'@- and tel-AMLI gene fusion. Blood, 85: 3662—3670,1995. pl4mK4@rs2@related CDK6 inhibitor, correlate with wild-type pRb function. Genes 10. Golub, T. R., Barker, G. F., Lovett, M., and Gilliland, D. G. Fusion ofPDGF receptor & Dcv., 8: 2939—2952,1994. 13to a novel ets-like gene, tel, in chronic myelomonocytic leukemia with t(5;12) 30. Hannon, G. J., and Beach, D. @15m@@49isa potential effector of TGF-B-induced cell chromosomal translocation. Cell, 77: 307—316,1994. cycle arrest. Nature (Lond.), 37!: 257—261,1994. I 1. Papadopoulos, P., Ridge, S. A., Boucher, C. A., Stocking, C., and Wiedemann, L M. 31. Quesnel, B., Preudhomme, C., Philippe, N., Vanrumbeke, M., Dervite, I., Lai, J. L., The novel activation of ARL by fusion to an ets-related gene, TEL. Cancer Res., 55: Bauters, F., Wattel, E., and Fenaux, P. p'6 gene homozygous deletions in acute 34—38,1995. lymphoblastic leukemia. Blood, 85: 657—663, 1995. 12. Buijs, A., Sherr, S., van Baal, S., van Bezouw, S., van der Plas, D., Geurts van Kessel, 32. Ogawa, S. 0., Hangaishi, A., Miyawaki, S., Hirosawa, S., Miura, Y., Takeyama, K., A., Riegman, P., Lekanne Deprez, R., Zwarthoff, E., Hagemeijer, A., and Grosveld, Kamada, N., Ohtake, S., Uike, N., Shimazaki, C., Toyama, K., Hirano, M., Mizogu G. Translocation (l2;22Xpl3;ql I) in myeloproliferative disorders results in fusion of theETS-likeTELgeneonl2pl3totheMNlgenein22qll.Oncogene,10:1511—1519, chi, H., Kobayashi, Y., Furusawa, S., Saito, M., End, N., Yazaki, Y., Ueda, R., and 1995. Hirai, H. Loss of the cyclin-dependent kinase 4-inhibitor (pl6; MTS1) gene is 13. WlOdarska, I., Mecucci, C., Marynen, P., Guo, C., Franckx, D., La Starza, R., frequent in and highly specific to lymphoid tumors in primary human hematopoietic Aventin, A., Bosly, M. F., Martelli, J. J., Cassiman, J. J., and Van den Berghe, H. TEL malignancies. Blood, 86: 1548—1556,1995. gene is involved in myelodysplastic syndromes with either the typical t(5;12)(q33; 33. Morosetti, R., Kawamata, N., Gombart, A. F., Miller, C. W., Hatta, Y., Hirama, T., pl3) or its variantt(l0;12@q24;p13).Blood,85: 2848—2852,1995. Said, J. W., Tomonag, M., and Koefflar, H. P. Alterations of the p27t――gene in 14. Stegmaier, K., Pendse, S., Barker, G. F., Bray-Ward, P., Ward, D. C., Montgomer, non-Hodgkin's lymphomas and adult T-cell leukemia/lymphoma. Blood, 86: 1924— K. T., Krauter, K. S., Reynolds, C., SkIar, J., Donelly, M., Bohlandr, S. K., Rowley, 1930, 1995. J. D., Sallan, S. E., Gilliland, D. G., and Golub, T. R. Frequent loss of heterozygosity 34. Bullrich, F., MacLachlan, T. K., Sang, N., Druck, T., Veronese, M. L., Allen, S. L., at the TEL gene locus in acute lymphoblastic leukemia of childhood. Blood, 86: Chioras.zi,N., Koff, A., Heubner, K., Croce, C. M., and Giordano, A. Chromosomal 38—44, 1995. mapping of members of the cdc2 family of protein kinases, cdk3, cdk6, PISSLRE, and 15. Miyohi, H., Shiinizu, K., Kozu, T., MacId, N., Kaneko, Y., and Ohki, M. t(8;2l) PITALRE, and a cdk inhibitor,p27―, to regions involved in human cancer. Cancer breakpointson chromosome21 in acute myeloidleukemiaare clusteredwithina limited Res., 55: 1199—1205,1995. region of a single gene, AMLI. Proc. Nail. Acad. Sci. USA, 88: 14031-10434, 1991. 35. Pietenpol, J. A., Bohlander, S. K., Sato, Y., Papadopoulos, N., Liu, B., Friedman, C.. 16. Nucifora, G., and Rowley, J. D. AMLJ and the 8;2l and 3;2l translocations in acute Trask, B. J., Roberts, J. M., Kinzler, K. W., Rowley, J. D., and Vogelstein, B. andchronicmyeloidleukemia.Blood,86: 1—14,1995. Assignment of the human p27'@―gene to l2pl3 and its analysis in leukemias. Cancer 17. Shurtleff, S. A., Buijs, A., Behm, F. G., Rubnitz, J. E., Raimondi, S. C., Hancock, Res., 55: 1206—1210,1995. M. L, Chan, G. C-F., Pui, C-H., Grosveld, G., and Downing, J. R. TEUAMLI fusion 36. Ponce-Castañeda, M. V., Lee, M. H., Latres, E., Polyak, K., Lacombe, L., Montgom resulting from a cryptic t(12;21) is the most common genetic lesion in pediatric ALL cry, K., Mathew, S., Krauter, K., Sheinfeld, J., Massague, J., and Cordon-Cardo, C. and defines a subgroup of patients with an excellent prognosis. Leukemia (Baltimore), p27'@P': chromosomal mapping to l2pl2—l2p13;l and absence of mutations in 9: 1985—1989,1995. human tumors. Cancer Res., 55: 121 1—1214,1995.

2661

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 1996 American Association for Cancer Research. Biallelic Alterations of Both ETV6 and CDKN1B Genes in a t(12;21) Childhood Acute Lymphoblastic Leukemia Case

Iwona Wlodarska, Mathijs Baens, Pieter Peeters, et al.

Cancer Res 1996;56:2655-2661.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/56/11/2655

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/56/11/2655. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 1996 American Association for Cancer Research.