[CANCER RESEARCH56, 2655-2661. June 1, 19961 Biallelic Alterations of Both ETV6 and CDKN1B Genes in a t(12;21) Childhood Acute Lymphoblastic Leukemia Case1 Iwona Wlodarska, Mathijs Baens, Pieter Peeters, Jeroen Aerssens, Cristina Mecucci, Penelope Brock, Peter Marynen, and Herman Van den Berghe2 Center for Human Genetics, Flanders Interuniversity Institute for Biotechnology Ii. W., M. B., P. P., J. A.. P. M.. H. V. d. B.] and Department of Pediatrics [P. B.J, University of Leuven, Herestraat 49, 3000 Leuven, Belgium, and Hematology and Bone Marrow Transplantation Unit, University of Perugia, 06100 Perugia. Italy [C. M.J ABSTRACT ETV6-l0q24 (13), have been identified in ALL, AML, and myelo dysplastic syndrome, respectively, indicating that the gene is espe Recently, a new recurrent t(12;21)(p13;q22) has been identified in a cially prone to alterations that may affect cells of myeloid as well as B-cell lineage childhood acute lymphoblastic leukemia (ALL). The tram lymphoid origin. Moreover, detection of loss of heterozygosity at location results in a fusion of two known genes, ETV6/TEL (l2pl3) and l2pl3 and FISH analysis of l2p abnormalities in patients with various AMLJ (21q22), previously shown to be involved in the pathogenesis of myeloid disorders. We report results of cytogenetic fluorescence in situ hematological disorders revealed that ETV6 and the CDKNJB gene hybridization and molecular studies of a B-cell childhood common ALL encoding the cyclin-dependent kinase inhibitor p27'<@―aresituated in with a cryptic 12;21 translocation. Aberrations identified in this case the smallest critically deleted region (5, 6) and that both genes are involve both chromosomes 12 and include not only the ETV6-AMLJgene frequently deleted in a type of childhood ALL (14). fusion and two different microdeletions of ETV6 but also the hemizygous The second gene rearranged by t(12;21), AMLJ, was cloned from loss of CDKNJB, D12S119, and KRAS2 lcd and a putative rearrangement a breakpoint of a t(8;21)(q22;q22) translocation that has been of the second CDKNJBallele as a result of an inv(12)(p13q24). Moreover, observed in about 40% of karyotypically abnormal cases of it was shown that the AMLJ-ETV6 reciprocal chimeric transcript was not AML-M2 (15). The translocation results in a fusion of the DNA present in the malignant cells, and hence may not play a major role in binding runt domain of the AMLJ gene and the entire ETO/MTG8 leukemogenesis. In addition, the putative loss of wild-type function of gene, which encodes a putative transcription factor. Several trans CDKNJB and ETV6 could indicate a synergistic effect of both genes in the pathogenesis of this leukemia case. locations involving the AMLJ gene have been identified in myeloid leukemias and in all of them the resulting chimeric genes contain the AMLJ promoter and runt domain fused to other partner genes INTRODUCTION including the EAP, MDSJ, and EVIl genes on chromosome 3 (16). Therefore, t(l2;21) is unique among AMLI variant translocations Chromosomal abnormalities involving the short arm of chromo because it involves the entire AMLJ gene and affects leukemias of some 12, observed in a broad spectrum of hematological disorders lymphoid origin. (1), appear to be particularly common in a type of childhood ALL3 In the recently published series of studies of ALL, the ETV6-AMLJ (2, 3). These aberrations consist of both deletions and reciprocal or fusion has been documented in 16—36%of pediatric patients (17, 18), nonreciprocal translocations of l2p with various partner chromo so making it the most common abnormality in this subtype of leuke somes, and according to recently published FISH and molecular mia. Moreover, Shurtleff et a!. (17) reported that ETV6-AMLJ-ex data, they remain underestimated by classical cytogenetics (4—6). pressing ALLs constitute a clinically distinct entity affecting children For example, a t(12;21)(p13;q22) that was recently identified as a ages 1—10years with B lineage, nonhyperdiploid leukemic lympho recurrent translocation in a type of childhood B-cell ALL escaped blasts, and favorable prognosis. One of the striking molecular findings routine banding analysis and was initially discovered by FISH in these patients is a frequent deletion of the nontranslocated ETV6 analysis (7). Two groups independently demonstrated that the allele resulting in a loss of wild-type ETV6 function in the leukemic molecular consequence of the (l2;21)(p13;q22) translocation is the cells. The consistency of the involvement of the ETV6-AMLJ rear fusion of two known genes, namely ETV6, mapped to l2pl3, and rangement in childhood ALL is emphasized in the present paper in AMLJ, located at 21q22, previously shown to be involved in which we report a cryptic t(12;21)(p13;q22) masked by a dic(12; chromosomal translocations characteristic of myeloid malignan 13)(p1 1;qlO) and detected by FISH. In addition, the ETV6-AMLJ cies (8, 9). The resulting chimeric protein consists of the helix gene fusion in this patient was associated with rather complex aber loop-helix domain of ETV6 and the entire AMLJ gene, including its rations involving both chromosome 12s, which were further investi DNA binding and transactivation domains. gated by FISH and gene rearrangement studies. The ETV6 gene, encoding an ETS-like putative transcription factor, was initially identified by its fusion with the platelet derived growth factor receptor @3in chronic myelomonocytic leukemia associated PATIENTS AND METHODS with a t(5;12)(q33;pl 3) (10). In addition, other chimeric transcripts, namely ETV6-ABL (1 1) and ETV6-MNJ (12), plus a translocation Patient. The patient, a 15-year-oldgirl, was admitted in June 1995because of bone pain, fatigue, and fever. Her previous medical history was unremark able. Clinical examination revealed a pale skin and a slight hepatosplenomeg Received 12/7/95; accepted 3/26/96. The costs of publication of this article were defrayed in part by the payment of page aly. Hematological data were as follows: hemoglobin, 9.9 g/dl; platelets, charges. This article must therefore be hereby marked advertisement in accordance with 111 X l0@;and white blood cells, 9.9 X 109/L with 9% neutrophils, 37% 18 U.S.C. Section 1734 solely to indicate this fact. lymphocytes, and 54% lymphoblasts. Bone marrow was hypercellular with a I This text presents research results of the Belgian program on Interuniversity Poles of proportion of 85% of blast cells expressing CD34, CD19, CD22, CD1O, HDR, Attraction initiated by the Belgian State, Prime Minister's Office, Science Policy Pro gramming. The scientific responsibility is assumed by its authors. The work was sup CD33, and CD13. The diagnosis of common ALL, classified as L2 according ported in part by National Fonds voor Wetenschappelyk Onderzoek Grant 9.0153 96 to the FAB criteria, was established. Chemotherapy following a standard awarded to P. M. and H. V. d. B. protocol for childhood ALL (EORTC 5881) was started. 2 To whom requests for reprints should be addressed. Cytogenetics. Chromosome analysis was performed on direct cultures of 3 The abbreviations used are: ALL, acute lymphoblastic leukemia; FISH, fluorescence in situ hybridization; AML, acute myeloid leukemia; YAC, yeast artificial chromosome; bone marrow cells prior to treatment. Ten R- and G-banded karyotypes were RT-PCR, reverse transcription-PCR. analyzed and classified according to ISCN 1995 (19). 2655 Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 1996 American Association for Cancer Research. ff1/6 AND CDKNIB ALTERATIONS IN ALL ETV6 cosmids 12p JlOkb telom .179A6exon1bp1.57 D12S158 .... YAC958B8 PRB3 I 50F4 ETV6 I exon 2 bp 58-187 Fig. 1. Diagram of the short arm of chromosome 12 with indicated probes applied in FISH, in relation to their l2p localization. CDKN1B I D12S119 II @. 163E7 .. 2G8 exon 3 bp188-352 @ I : exon 4 bp353-487 KRAS2 I .. 184C4 @ ... exon 5 bp488-1033 @ Dl 2S934 ... exon 8 bp1278-.. cen FISH. FISHwas performedas previouslydescribed(20). Chromosome12 standard procedures with pd(N6) random primers. The following primers abnormalities were analyzed using eleven l2p cosmid probes and YAC 958B8 derived from E'TV6and AMLJ sequences were used to amplify the ETV6- (Fig. 1) labeled with biotin. 958B8 is a 1.2-Mb YAC containing the ETV6 A/tiLl fusion RNA: ETV6F (5'-TCCCCGCCTGAAGAGCACGCC) and gene, as was previously published by Golub et a!. (10). The ETV6 locus was AMLJR (5'-AGCGGCAACGCCrCGCFCAT). For the amplification of the investigated with the following LL12NCO1 cosmid probes (Lawrence Liver AMLJ-E1V6 fusion RNA, the following primers were used: AMLJF (5'- more National Laboratories, Livermore, CA) ordered as follows: S'end GGAGGAAGCGATGGCTTCAGACAGC) and ETV6R (5'-CCACAGTC l79A6-50F4-2G8-l63E7-1 84C4-l48B6-3'end. The different ETV6 exons GAGCCAGTCCGTFGG). present in the cosmids are shown in Fig. 1.'@Cosmidprobes for D12S158, DNA was isolated from a bone marrow sample and used for Southern PRB3, D12S119, and KRAS2 were described before by Chaffanet et aL (21) analysis by standard methods. A probe for CDKNJB was obtained by PCR and for D12S934 by Baens et al. (22). with the following primers derived from the CDKNJB cDNA (F: GCIGACT Further FISH experiments were performed using a chromosome 13ql3 TGGAGAAGCACTGC; R: GGGTCTGTAGTAGAACTCGG), amplifying a specific cocktail probe IGMTA94/013 (Integrated Genetics), a chromosome genomic fragment of 1.2 kb. 13/21 centromere probe (pUC 1.76), a cosmid containing CSFJR mapped to 5q33 (23), cosmid ICRFC1O2D12118 (2lq22.3, ICRF) and a whole chromo RESULTS some 12 painting probe (WCP 12, Imagenetics). Chromosome l2s were identified by cohybridization with the Texas Red-5-dUTP labeled chromosome Cytogenetics and FISH. Cytogenetic analysis of the reported 12 alphoid probe (pBR12; Ref. 24) and simultaneous G-banding analysis using case performed at the time of diagnosis revealed clonal chromo 4'6-diamidino-2phenylindole dihydrochloride counterstaining.