DOCSLIB.ORG

Whole-Exome Sequencing in Rare Diseases and Complex Traits

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Whole-Exome Sequencing in Rare Diseases and Complex Traits Whole-exome Sequencing in Rare Diseases and Complex Traits: Analysis and Interpretation by Xiaolin Zhu University Program in Genetics and Genomics Duke University Date:_______________________ Approved: ___________________________ David B. Goldstein, Supervisor ___________________________ Sandeep S. Dave, Chair ___________________________ Andrew S. Allen ___________________________ Yong-Hui Jiang ___________________________ Douglas A. Marchuk ___________________________ Vandana Shashi Dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the University Program in Genetics and Genomics in the Graduate School of Duke University 2017 ABSTRACT Whole-exome Sequencing in Rare Diseases and Complex Traits: Analysis and Interpretation by Xiaolin Zhu University Program in Genetics and Genomics Duke University Date:_______________________ Approved: ___________________________ David B. Goldstein, Supervisor ___________________________ Sandeep S. Dave, Chair ___________________________ Andrew S. Allen ___________________________ Yong-Hui Jiang ___________________________ Douglas A. Marchuk ___________________________ Vandana Shashi An abstract of a dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the University Program in Genetics and Genomics in the Graduate School of Duke University 2017 Copyright by Xiaolin Zhu 2017 Abstract Next-generation sequencing (NGS), including whole-exome sequencing (WES) and whole-genome sequencing (WGS), has dramatically empowered the human genetic analysis of disease. This is clearly demonstrated by the exponential increase in the number of newly identified disease-causing genes since the early applications of WES to study human diseases1. In particular, WES has been extremely successful in determining the causal mutations of sporadic rare disorders that are intractable to genetic mapping due to lack of informative pedigrees, a large proportion of which are later shown to be caused by de novo mutations (DNMs). In the meantime, WES and WGS studies are being performed increasingly in population scale to understand the genetic basis of complex diseases and traits. The discovery power of WES and WGS is expected to boost further as more and more patients and healthy individuals are sequenced with the development of more powerful and less expensive sequencing technologies. Meanwhile, clinical WES and WGS are playing an increasingly important role in guiding physicians to achieve the accurate diagnosis and treatment informed by genetic findings. WES and WGS generate a massive amount of sequence data that include both signals and noises, posing challenges for scientists and clinicians to overcome to fully realize the discovery and diagnostic power of NGS. Indeed, despite the many new disease-associated genes identified to date, methodologies used to analyze sequence data vary across research groups and there seems to be no standardized analysis method like those used in genome-wide association studies. Indeed, the sequence data generated allows different ways to perform genetic analysis, and the approach taken can rely on iv the hypothesis about the underlying genetic architecture of the phenotype, which is often difficult to know precisely. Herein we explored and evaluated two primary approaches to analyzing and interpreting WES data in different contexts. The first is a trio interpretation framework based on variant/genotype filtering and bioinformatic signatures of genes and variants, which can be used to identify the highly penetrant causal mutations responsible for rare genetic conditions given known genotype- phenotype correlations and, at the same time, indicate the presence of novel disease- causing genes. The second is a formal statistical genetics framework comparing the burden of rare, high impact variants gene by gene in case and control subjects, which can be used to identify novel disease-causing genes for both Mendelian and complex traits. We introduced each of these two approaches and provided examples of their implementations. In Chapter 2, we presented our trio interpretation framework and sought to determine the genetic diagnoses of undiagnosed genetic conditions using WES. By further developing a trio interpretation framework reported in our pilot study2 and applying it to interpreting 119 trios (affected children and their unaffected biological parents), we achieved a diagnostic rate of 24% based on known genotype-phenotype correlations when the study was performed. Furthermore, we sought to extract bioinformatic signatures of causal variants and genes and showed that these bioinformatic signatures clearly pointed toward the pathogenic variants in novel disease-causing genes, some of which have been confirmed later by larger, independent studies. Our study highlights the importance of regularly reanalyzing clinical exomes to v achieve the best diagnostic rate of WES by leveraging the latest databases of population- scale sequence (e.g., EVS and ExAC) and genotype-phenotype correlation (e.g., OMIM and ClinVar) as well as advancements in analytical methods. In our documentation of individual cases resolved by trio WES, we also discussed technical details relevant to how the genetic diagnosis was achieved in individual cases. In Chapter 3, we presented our case-control gene-based collapsing framework focusing on ultra-rare variants predicted to have a high functional impact and sought to identify disease-causing genes responsible for two neurodevelopmental disorders: epileptic encephalopathy (EE) and periventricular nodular heterotopia (PVNH), both rare disorders presumably caused by highly penetrant mutations and characterized by genetic heterogeneity. Remarkably, both conditions had been subjected to DNM analyses by us or other groups, which was very successful and implicated novel causal genes for EE. We showed that our genetic association analysis framework successfully identified EE genes originally implicated by DNM analyses, and a novel PVNH gene that would not be identified by a DNM analysis, empirically highlighting the power of case-control gene-based collapsing analysis in identifying disease genes in rare neurodevelopmental disorders, in particular when we have an educated guess of the genetic architecture of the phenotype. In the third project, we extended our gene-based collapsing analysis to quantitative traits and sought to understand the genetic basis of a newly defined quantitative bone microstructure phenotype that was shown to be strongly associated with ethnicity in White and Asian women. We have special interest in this presumably complex trait for mainly two reasons: it can be a potential vi “endophenotype” for important bone diseases including osteoporosis, and its strong association with ethnicity indicates genetic control. In this pilot study, we generated WES data on a small number of White and Asian women and applied our gene-based collapsing analysis framework in order to identify the genes associated with this quantitative trait. A larger sample size would likely yield more definitive genetic discoveries, but our preliminary findings suggest that using WES to study the genetics of such “endophenotypes” and other novel clinically relevant phenotypes can identify causal variants that have a high functional impact and deliver novel biological insights. In conclusion, we introduced a trio WES interpretation framework to identify the genetic diagnoses of unresolved rare genetic diseases and a gene-based collapsing analysis framework focusing on rare, functionally impactful variants to identify genes associated with dichotomous and quantitative traits, and evaluated these methods in multiple human genetic studies. The power of these methods will be boosted by its application to novel phenotypes and the accruing WES and WGS data generated from both patients and healthy individuals. vii Contents Abstract ........................................................................................................................................ .iv List of Tables ............................................................................................................................... xiii List of Figures ............................................................................................................................ xvii Acknowledgements .................................................................................................................... xx 1. Introduction ............................................................................................................................... 1 1.1 Next-generation Sequencing ........................................................................................... 1 1.1.1 WES and WGS ......................................................................................................... 1 1.1.2 Bioinformatic processing of WES and WGS data ............................................... 2 1.2 Human Genome Variation .............................................................................................. 3 1.2.1 The human genome and its variation .................................................................. 3 1.2.2 HapMap.................................................................................................................... 4 1.2.3 Population-scale sequence data ............................................................................ 5 1.2.3.1 1000 Genomes .................................................................................................
Load more

Recommended publications
  • Supplementary Data
    Figure 2S 4 7 A - C 080125 CSCs 080418 CSCs - + IFN-a 48 h + IFN-a 48 h + IFN-a 72 h 6 + IFN-a 72 h 3 5 MRFI 4 2 3 2 1 1 0 0 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 7 B 13 080125 FBS - D 080418 FBS - + IFN-a 48 h 12 + IFN-a 48 h + IFN-a 72 h + IFN-a 72 h 6 080125 FBS 11 10 5 9 8 4 7 6 3 MRFI 5 4 2 3 2 1 1 0 0 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 Molecule Molecule FIGURE 4S FIGURE 5S Panel A Panel B FIGURE 6S A B C D Supplemental Results Table 1S. Modulation by IFN-α of APM in GBM CSC and FBS tumor cell lines. Molecule * Cell line IFN-α‡ HLA β2-m# HLA LMP TAP1 TAP2 class II A A HC§ 2 7 10 080125 CSCs - 1∞ (1) 3 (65) 2 (91) 1 (2) 6 (47) 2 (61) 1 (3) 1 (2) 1 (3) + 2 (81) 11 (80) 13 (99) 1 (3) 8 (88) 4 (91) 1 (2) 1 (3) 2 (68) 080125 FBS - 2 (81) 4 (63) 4 (83) 1 (3) 6 (80) 3 (67) 2 (86) 1 (3) 2 (75) + 2 (99) 14 (90) 7 (97) 5 (75) 7 (100) 6 (98) 2 (90) 1 (4) 3 (87) 080418 CSCs - 2 (51) 1 (1) 1 (3) 2 (47) 2 (83) 2 (54) 1 (4) 1 (2) 1 (3) + 2 (81) 3 (76) 5 (75) 2 (50) 2 (83) 3 (71) 1 (3) 2 (87) 1 (2) 080418 FBS - 1 (3) 3 (70) 2 (88) 1 (4) 3 (87) 2 (76) 1 (3) 1 (3) 1 (2) + 2 (78) 7 (98) 5 (99) 2 (94) 5 (100) 3 (100) 1 (4) 2 (100) 1 (2) 070104 CSCs - 1 (2) 1 (3) 1 (3) 2 (78) 1 (3) 1 (2) 1 (3) 1 (3) 1 (2) + 2 (98) 8 (100) 10 (88) 4 (89) 3 (98) 3 (94) 1 (4) 2 (86) 2 (79) * expression of APM molecules was evaluated by intracellular staining and cytofluorimetric analysis; ‡ cells were treatead or not (+/-) for 72 h with 1000 IU/ml of IFN-α; # β-2 microglobulin; § β-2 microglobulin-free HLA-A heavy chain; ∞ values are indicated as ratio between the mean of fluorescence intensity of cells stained with the selected mAb and that of the negative control; bold values indicate significant MRFI (≥ 2).
    [Show full text]
  • Responses of Bats to White-Nose Syndrome and Implications for Conservation
    University of New Hampshire University of New Hampshire Scholars' Repository Doctoral Dissertations Student Scholarship Spring 2020 Responses of Bats to White-Nose Syndrome and Implications for Conservation Meghan Stark University of New Hampshire, Durham Follow this and additional works at: https://scholars.unh.edu/dissertation Recommended Citation Stark, Meghan, "Responses of Bats to White-Nose Syndrome and Implications for Conservation" (2020). Doctoral Dissertations. 2518. https://scholars.unh.edu/dissertation/2518 This Dissertation is brought to you for free and open access by the Student Scholarship at University of New Hampshire Scholars' Repository. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of University of New Hampshire Scholars' Repository. For more information, please contact [email protected]. RESPONSES OF BATS TO WHITE-NOSE SYNDROME AND IMPLICATIONS FOR CONSERVATION BY MEGHAN A. STARK B.S., University of Alabama at Birmingham, 2013 DISSERTATION Submitted to the University of New Hampshire in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy In Genetics May 2020 i This dissertation was examined and approved in partial fulfillment of the requirements for the degree of Ph.D. in Genetics by: Dissertation Director, Matthew MacManes, Assoc. Prof. UNH MCBS Jeffrey T. Foster, Associate Professor, NAU PMI W. Kelley Thomas, Professor, UNH MCBS Rebecca Rowe, Associate Professor, UNH NREN Thomas Lee, Associate Professor Emeritus, UNH NREN On April 6, 2020 Approval signatures are on file with the University of New Hampshire Graduate School. ii DEDICATION I dedicate this work to all of the strong women in my life: Myra Michele Ange Heather Michelle Coons Kaitlyn Danielle Cagle Brindlee Michelle Coons Patricia Gail Miller Sarah Jean Lane “Here’s to strong women.
    [Show full text]
  • Table 2. Significant
    Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
    [Show full text]
  • Potassium Channels in Epilepsy
    Downloaded from http://perspectivesinmedicine.cshlp.org/ on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press Potassium Channels in Epilepsy Ru¨diger Ko¨hling and Jakob Wolfart Oscar Langendorff Institute of Physiology, University of Rostock, Rostock 18057, Germany Correspondence: [email protected] This review attempts to give a concise and up-to-date overview on the role of potassium channels in epilepsies. Their role can be defined from a genetic perspective, focusing on variants and de novo mutations identified in genetic studies or animal models with targeted, specific mutations in genes coding for a member of the large potassium channel family. In these genetic studies, a demonstrated functional link to hyperexcitability often remains elusive. However, their role can also be defined from a functional perspective, based on dy- namic, aggravating, or adaptive transcriptional and posttranslational alterations. In these cases, it often remains elusive whether the alteration is causal or merely incidental. With 80 potassium channel types, of which 10% are known to be associated with epilepsies (in humans) or a seizure phenotype (in animals), if genetically mutated, a comprehensive review is a challenging endeavor. This goal may seem all the more ambitious once the data on posttranslational alterations, found both in human tissue from epilepsy patients and in chronic or acute animal models, are included. We therefore summarize the literature, and expand only on key findings, particularly regarding functional alterations found in patient brain tissue and chronic animal models. INTRODUCTION TO POTASSIUM evolutionary appearance of voltage-gated so- CHANNELS dium (Nav)andcalcium (Cav)channels, Kchan- nels are further diversified in relation to their otassium (K) channels are related to epilepsy newer function, namely, keeping neuronal exci- Psyndromes on many different levels, ranging tation within limits (Anderson and Greenberg from direct control of neuronal excitability and 2001; Hille 2001).
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name vacuolar protein sorting 13 homolog D (S. cerevisiae) Gene Symbol VPS13D Organism Human Gene Summary This gene encodes a protein belonging to the vacuolar-protein-sorting-13 gene family. In yeast vacuolar-protein-sorting-13 proteins are involved in trafficking of membrane proteins between the trans-Golgi network and the prevacuolar compartment. While several transcript variants may exist for this gene the full-length natures of only two have been described to date. These two represent the major variants of this gene and encode distinct isoforms. Gene Aliases FLJ23066 RefSeq Accession No. NC_000001.10, NT_021937.19 UniGene ID Hs.439381 Ensembl Gene ID ENSG00000048707 Entrez Gene ID 55187 Assay Information Unique Assay ID qHsaCID0012130 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000543710, ENST00000356315, ENST00000358136, ENST00000543766, ENST00000011700 Amplicon Context Sequence CCTTGTCTCCAAAGACCATGGGAAGGTGTATGTGCAGGTGACCAAGAAAGCCGT GAGCACGAGCAGTGGAGTGTCCATCCCCGGCCCCTCCCACCAGAAGCCCATGG TCCATGTGAAATCTGAGGTCCTTGCTGTCAA Amplicon Length (bp) 108 Chromosome Location 1:12567042-12568978 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 100 R2 0.9991 cDNA Cq 21.41 cDNA Tm (Celsius) 86 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq 35.2 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report VPS13D, Human Amplification Plot Amplification of
    [Show full text]
  • Experiences of Rare Diseases: an Insight from Patients and Families
    Experiences of Rare Diseases: An Insight from Patients and Families Unit 4D, Leroy House 436 Essex Road London N1 3QP tel: 02077043141 fax: 02073591447 [email protected] www.raredisease.org.uk By Lauren Limb, Stephen Nutt and Alev Sen - December 2010 Web and press design www.raredisease.org.uk WordsAndPeople.com About Rare Disease UK Rare Disease UK (RDUK) is the national alliance for people with rare diseases and all who support them. Our membership is open to all and includes patient organisations, clinicians, researchers, academics, industry and individuals with an interest in rare diseases. RDUK was established by Genetic RDUK is campaigning for a Alliance UK, the national charity strategy for integrated service of over 130 patient organisations delivery for rare diseases. This supporting all those affected by would coordinate: genetic conditions, in conjunction with other key stakeholders | Research in November 2008 following the European Commission’s | Prevention and diagnosis Communication on Rare Diseases: | Treatment and care Europe’s Challenges. | Information Subsequently RDUK successfully | Commissioning and planning campaigned for the adoption of the Council of the European into one cohesive strategy for all Union’s Recommendation on patients affected by rare disease in an action in the field of rare the UK. As well as securing better diseases. The Recommendation outcomes for patients, a strategy was adopted unanimously by each would enable the most effective Member State of the EU (including use of NHS resources. the
    [Show full text]
  • Open Dogan Phdthesis Final.Pdf
    The Pennsylvania State University The Graduate School Eberly College of Science ELUCIDATING BIOLOGICAL FUNCTION OF GENOMIC DNA WITH ROBUST SIGNALS OF BIOCHEMICAL ACTIVITY: INTEGRATIVE GENOME-WIDE STUDIES OF ENHANCERS A Dissertation in Biochemistry, Microbiology and Molecular Biology by Nergiz Dogan © 2014 Nergiz Dogan Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy August 2014 ii The dissertation of Nergiz Dogan was reviewed and approved* by the following: Ross C. Hardison T. Ming Chu Professor of Biochemistry and Molecular Biology Dissertation Advisor Chair of Committee David S. Gilmour Professor of Molecular and Cell Biology Anton Nekrutenko Professor of Biochemistry and Molecular Biology Robert F. Paulson Professor of Veterinary and Biomedical Sciences Philip Reno Assistant Professor of Antropology Scott B. Selleck Professor and Head of the Department of Biochemistry and Molecular Biology *Signatures are on file in the Graduate School iii ABSTRACT Genome-wide measurements of epigenetic features such as histone modifications, occupancy by transcription factors and coactivators provide the opportunity to understand more globally how genes are regulated. While much effort is being put into integrating the marks from various combinations of features, the contribution of each feature to accuracy of enhancer prediction is not known. We began with predictions of 4,915 candidate erythroid enhancers based on genomic occupancy by TAL1, a key hematopoietic transcription factor that is strongly associated with gene induction in erythroid cells. Seventy of these DNA segments occupied by TAL1 (TAL1 OSs) were tested by transient transfections of cultured hematopoietic cells, and 56% of these were active as enhancers. Sixty-six TAL1 OSs were evaluated in transgenic mouse embryos, and 65% of these were active enhancers in various tissues.
    [Show full text]
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
    [Show full text]
  • Restoration of Epithelial Sodium Channel Function by Synthetic Peptides in Pseudohypoaldosteronism Type 1B Mutants
    ORIGINAL RESEARCH published: 24 February 2017 doi: 10.3389/fphar.2017.00085 Restoration of Epithelial Sodium Channel Function by Synthetic Peptides in Pseudohypoaldosteronism Type 1B Mutants Anita Willam 1*, Mohammed Aufy 1, Susan Tzotzos 2, Heinrich Evanzin 1, Sabine Chytracek 1, Sabrina Geppert 1, Bernhard Fischer 2, Hendrik Fischer 2, Helmut Pietschmann 2, Istvan Czikora 3, Rudolf Lucas 3, Rosa Lemmens-Gruber 1 and Waheed Shabbir 1, 2 1 Department of Pharmacology and Toxicology, University of Vienna, Vienna, Austria, 2 APEPTICO GmbH, Vienna, Austria, 3 Vascular Biology Center, Medical College of Georgia, Augusta University, Augusta, GA, USA Edited by: The synthetically produced cyclic peptides solnatide (a.k.a. TIP or AP301) and its Gildas Loussouarn, congener AP318, whose molecular structures mimic the lectin-like domain of human University of Nantes, France tumor necrosis factor (TNF), have been shown to activate the epithelial sodium Reviewed by: channel (ENaC) in various cell- and animal-based studies. Loss-of-ENaC-function Stephan Kellenberger, University of Lausanne, Switzerland leads to a rare, life-threatening, salt-wasting syndrome, pseudohypoaldosteronism type Yoshinori Marunaka, 1B (PHA1B), which presents with failure to thrive, dehydration, low blood pressure, Kyoto Prefectural University of Medicine, Japan anorexia and vomiting; hyperkalemia, hyponatremia and metabolic acidosis suggest *Correspondence: hypoaldosteronism, but plasma aldosterone and renin activity are high. The aim of Anita Willam the present study was to investigate whether the ENaC-activating effect of solnatide [email protected] and AP318 could rescue loss-of-function phenotype of ENaC carrying mutations at + Specialty section: conserved amino acid positions observed to cause PHA1B.
    [Show full text]
  • RNF11 at the Crossroads of Protein Ubiquitination
    biomolecules Review RNF11 at the Crossroads of Protein Ubiquitination Anna Mattioni, Luisa Castagnoli and Elena Santonico * Department of Biology, University of Rome Tor Vergata, Via della ricerca scientifica, 00133 Rome, Italy; [email protected] (A.M.); [email protected] (L.C.) * Correspondence: [email protected] Received: 29 September 2020; Accepted: 8 November 2020; Published: 11 November 2020 Abstract: RNF11 (Ring Finger Protein 11) is a 154 amino-acid long protein that contains a RING-H2 domain, whose sequence has remained substantially unchanged throughout vertebrate evolution. RNF11 has drawn attention as a modulator of protein degradation by HECT E3 ligases. Indeed, the large number of substrates that are regulated by HECT ligases, such as ITCH, SMURF1/2, WWP1/2, and NEDD4, and their role in turning off the signaling by ubiquitin-mediated degradation, candidates RNF11 as the master regulator of a plethora of signaling pathways. Starting from the analysis of the primary sequence motifs and from the list of RNF11 protein partners, we summarize the evidence implicating RNF11 as an important player in modulating ubiquitin-regulated processes that are involved in transforming growth factor beta (TGF-β), nuclear factor-κB (NF-κB), and Epidermal Growth Factor (EGF) signaling pathways. This connection appears to be particularly significant, since RNF11 is overexpressed in several tumors, even though its role as tumor growth inhibitor or promoter is still controversial. The review highlights the different facets and peculiarities of this unconventional small RING-E3 ligase and its implication in tumorigenesis, invasion, neuroinflammation, and cancer metastasis. Keywords: Ring Finger Protein 11; HECT ligases; ubiquitination 1.
    [Show full text]
  • Inherited Renal Tubulopathies—Challenges and Controversies
    G C A T T A C G G C A T genes Review Inherited Renal Tubulopathies—Challenges and Controversies Daniela Iancu 1,* and Emma Ashton 2 1 UCL-Centre for Nephrology, Royal Free Campus, University College London, Rowland Hill Street, London NW3 2PF, UK 2 Rare & Inherited Disease Laboratory, London North Genomic Laboratory Hub, Great Ormond Street Hospital for Children National Health Service Foundation Trust, Levels 4-6 Barclay House 37, Queen Square, London WC1N 3BH, UK; [email protected] * Correspondence: [email protected]; Tel.: +44-2381204172; Fax: +44-020-74726476 Received: 11 February 2020; Accepted: 29 February 2020; Published: 5 March 2020 Abstract: Electrolyte homeostasis is maintained by the kidney through a complex transport function mostly performed by specialized proteins distributed along the renal tubules. Pathogenic variants in the genes encoding these proteins impair this function and have consequences on the whole organism. Establishing a genetic diagnosis in patients with renal tubular dysfunction is a challenging task given the genetic and phenotypic heterogeneity, functional characteristics of the genes involved and the number of yet unknown causes. Part of these difficulties can be overcome by gathering large patient cohorts and applying high-throughput sequencing techniques combined with experimental work to prove functional impact. This approach has led to the identification of a number of genes but also generated controversies about proper interpretation of variants. In this article, we will highlight these challenges and controversies. Keywords: inherited tubulopathies; next generation sequencing; genetic heterogeneity; variant classification. 1. Introduction Mutations in genes that encode transporter proteins in the renal tubule alter kidney capacity to maintain homeostasis and cause diseases recognized under the generic name of inherited tubulopathies.
    [Show full text]
  • Deletion of Stk11 and Fos in Mouse BLA Projection Neurons
    RESEARCH ARTICLE Deletion of Stk11 and Fos in mouse BLA projection neurons alters intrinsic excitability and impairs formation of long- term aversive memory David Levitan1†*, Chenghao Liu1†, Tracy Yang1, Yasuyuki Shima1, Jian-You Lin2,3, Joseph Wachutka2, Yasmin Marrero2, Ramin Ali Marandi Ghoddousi1, Eduardo da Veiga Beltrame2, Troy A Richter1, Donald B Katz2,3, Sacha B Nelson1,3* 1Departments of Biology, Brandeis University, Waltham, United States; 2Departments of Psychology, Brandeis University, Waltham, United States; 3Volen Center for Complex Systems, Brandeis University, Waltham, United States Abstract Conditioned taste aversion (CTA) is a form of one-trial learning dependent on basolateral amygdala projection neurons (BLApn). Its underlying cellular and molecular mechanisms remain poorly understood. RNAseq from BLApn identified changes in multiple candidate learning- related transcripts including the expected immediate early gene Fos and Stk11, a master kinase of the AMP-related kinase pathway with important roles in growth, metabolism and development, but not previously implicated in learning. Deletion of Stk11 in BLApn blocked memory prior to training, but not following it and increased neuronal excitability. Conversely, BLApn had reduced excitability following CTA. BLApn knockout of a second learning-related gene, Fos, also increased excitability and impaired learning. Independently increasing BLApn excitability chemogenetically during CTA *For correspondence: also impaired memory. STK11 and C-FOS activation were independent
    [Show full text]