DOCSLIB.ORG

Plk4 Is Required for Cytokinesis and Maintenance of Chromosomal Stability

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Plk4 Is Required for Cytokinesis and Maintenance of Chromosomal Stability Plk4 is required for cytokinesis and maintenance of chromosomal stability Carla O. Rosarioa,b, Michael A. Koa,c,d,1, Yosr Z. Haffania,1, Rebecca A. Gladdya,c,d, Jana Paderovae, Aaron Pollettb, Jeremy A. Squiree, James W. Dennisa,b,f, and Carol J. Swallowa,b,c,d,2 aSamuel Lunenfeld Research Institute, Mount Sinai Hospital, Toronto, ON M5G 1X5, Canada; bDepartment of Laboratory Medicine and Pathobiology, cDepartment of Surgery, dInstitute of Medical Science, and fDepartment of Molecular Genetics, University of Toronto, Toronto, ON M5S 1A1, Canada; and eDepartment of Pathology and Molecular Medicine, Queen’s University, Kingston, ON K7L 3N6, Canada Edited by David Pellman, Dana-Farber Cancer Institute, Boston, MA, and accepted by the Editorial Board February 16, 2010 (received for review September 25, 2009) Aneuploidy is a characteristic feature of established cancers and dumbbell-shaped cells with anaphase bridges, indicating that can promote tumor development. Aneuploidy may arise directly, Plk4 is also required in late mitosis, possibly at telophase (8). − through unequal distribution of chromosomes into daughter cells, Plk4+/ embryos develop normally, but adult mice display a 16- or indirectly, through a tetraploid intermediate. The polo family fold increase in the incidence of spontaneous hepatomas com- kinase Plk4/Sak is required for late mitotic progression and is pared with Plk4+/+ littermates. The wild-type Plk4 allele was haploinsufficient for tumor suppression in mice. Here we show retained in the liver tumors, indicating that Plk4 is a hap- that loss of heterozygosity (LOH) occurs at the Plk4 locus in 50% of loinsufficient tumor suppressor (9). Cell cycle progression was − human hepatocellular carcinomas (HCC) and is present even in impaired in regenerating Plk4+/ liver with a ≈6-h delay in M preneoplastic cirrhotic liver nodules. LOH at Plk4 is associated with phase completion, whereas multipolar spindle formation was reduced Plk4 expression in HCC tumors but not with mutations in increased 6-fold and p53 activation was impaired. These defects − the remaining allele. Plk4+/ murine embryonic fibroblasts (MEFs) culminated in widespread disorganization of liver architecture − at early passage show a high incidence of multinucleation, super- and eventually generalized hepatic dysplasia in 100% of Plk4+/ numerary centrosomes, and a near-tetraploid karyotype. Under- animals after hepatectomy. lying these phenotypes is a high rate of primary cytokinesis Toinvestigate the mechanisms underlying Plk4haploinsufficiency failure, associated with aberrant actomyosin ring formation, for tumorigenesis, we examined the cellular phenotypes of murine − reduced RhoA activation, and failure to localize the RhoA guanine embryonic fibroblasts (MEFs) isolated from Plk4+/ embryos. Here − nucleotide exchange factor Ect2 to the spindle midbody. We fur- we report a primary defect in cytokinesis in Plk4+/ MEFs associated ther show that Plk4 normally localizes to the midbody and binds to with failure to appropriately localize the actomyosin contractile ring +/− and phosphorylates Ect2 in vitro. With serial passaging Plk4 and failure to complete cleavage furrow ingression. We show that − MEFs rapidly immortalize, acquiring an increasing burden of non- RhoGTPase activation in the Plk4+/ cells is impaired and identify a clonal and clonal gross chromosomal irregularities, and form potential substrate for Plk4, the mitotic Rho GEF (guanine tumors in vivo. Our results indicate that haploid levels of Plk4 nucleotide exchange factor) Ect2. Defective cytokinesis resulted in disrupt RhoGTPase function during cytokinesis, resulting in aneu- multiple centrosomes, multinucleation, and a near-tetraploid kar- ploidy and tumorigenesis, thus implicating early LOH at Plk4 as yotype, and with serial passaging immortalization in vitro, aneu- − one of the drivers of human hepatocellular carcinogenesis. These ploidy, and tumorigenesis in vivo. These Plk4+/ phenotypes were fi ndings represent an advance in our understanding of genetic exaggerated in the absence of p53 function, a circumstance known to predisposition to HCC, which continues to increase in incidence favor survival of tetraploid cells. globally and particularly in North America. Results and Discussion aneuploidy | hepatocellular carcinoma | Polo-like kinase | RhoA | Ect2 To determine the Plk4 status in human hepatocellular carcinoma (HCC), we queried six microsatellite markers within/near the he role of aneuploidy as a cause rather than a consequence of Plk4 locus in 32 sequential cases resected and banked at our Tcancer development has recently been demonstrated for genes institution, looking for loss of heterozygosity (LOH) in micro- encoding the mitotic checkpoint machinery (1–3). Heterozygosity dissected tumor tissue compared with adjacent nonneoplastic for Mad1, Mad2, or CENP-E allows anaphase to proceed despite liver. For the four markers closest to the Plk4 locus, the LOH the presence of lagging chromosomes, increasing the rates of rate averaged 50%, whereas at more distal sites the rate fell to aneuploidy, chromosomal instability, and spontaneous tumori- background levels of 10–15% (Fig. 1A and Fig. S1A). By com- genesis. CENP-E in particular is not known to have a function apart parison, the majority of unrelated informative microsatellite from its role as a mitotic motor and checkpoint protein, suggesting markers show an LOH rate of <20% in human HCC (10). The − that the development of spontaneous tumors in CENP-E+/ mice is present results, taken together with those of a small initial series a result of chromosomal instability per se (1). In murine mammary epithelial cells lacking p53 function, tetraploidy precedes aneu- ploidy and predisposes to tumor development (4). Defects in Author contributions: C.O.R., M.A.K., Y.Z.H., R.A.G., J.A.S., J.W.D., and C.J.S. designed research; C.O.R., M.A.K., Y.Z.H., J.P., and A.P. performed research; J.A.S. and J.P. contrib- cytokinesis result in both tetraploidy and multiple centrosomes, uted new reagents/analytic tools; C.O.R., M.A.K., Y.Z.H., R.A.G., J.P., J.A.S., J.W.D., and C.J. which can form multipolar spindle intermediates, resulting in S. analyzed data; and C.O.R., M.A.K., Y.Z.H., J.W.D., and C.J.S. wrote the paper. unequal segregation of chromosomes (5). Thus mutations that The authors declare no conflict of interest. impair cytokinesis and induce tolerance of the tetraploid state are This article is a PNAS Direct Submission. D.P. is a guest editor invited by the likely to be carcinogenic. However, our knowledge of the roles Editorial Board. played in cancer progression by pathways controlling telophase and Freely available online through the PNAS open access option. by genetic mutations leading to tetraploidy is incomplete. 1M.A.K. and Y.Z.H contributed equally to this work. The polo family member Plk4 localizes to centrioles 2To whom correspondence should be addressed. E-mail: [email protected]. throughout the cell cycle and is essential for centriole duplication This article contains supporting information online at www.pnas.org/cgi/content/full/ (6, 7). Plk4 null embryos arrest at day 7.5 post coitus and display 0910941107/DCSupplemental. 6888–6893 | PNAS | April 13, 2010 | vol. 107 | no. 15 www.pnas.org/cgi/doi/10.1073/pnas.0910941107 Downloaded by guest on September 29, 2021 A Marker LOH rate B liver. This is in keeping with the increased Plk4 expression we previously observed in neoplastic compared with paired nonneo- TGGA14 7.1% fi 1.5 plastic tissues (13), further highlighting the signi cance of the LOH at Plk4 INTU decreased Plk4 expression in hepatoma cases with LOH. Thus, 1.0 4q28.1 CA17 40% Retention LOH at the Plk4 locus and reduced Plk4 expression may occur early SLC25A31 GT22 57% 0.5 in the process of human hepatocellular carcinogenesis and play a HSPA4L causative role in tumor initiation, consistent with the high rate of Plk4 A35 45% 0.0 +/− AAAT11N 55% T:N)(Log spontaneous hepatocellular cancer development in Plk4 mice. MSFD88 mRNAPlk4 -0.5 Primary MEFs were used to investigate the mechanism of Plk4 4q28.2 +/− AAAT11 16% haploinsufficiency for tumor suppression. Plk4 MEFs became -1.0 LARP1B – 0.1Mb immortalized within 10 12 routine passages (19 of 20 lines; Fig. 1C). Under the same culture conditions, Plk4+/+ MEF lines (15 C D of 15) became senescent by passage 9 without the emergence of 6 +/− 9.0×10 Plk4+/+, n=10 embryos immortal colonies (Fig. 1D). Six of ten P15 Plk4 lines gave +/- 5.0×10 6 Plk4 , n=10 embryos Plk4+/+ Plk4+/- rise to palpable tumors when injected s.c. into nonobese diabetic/ 2.0×10 6 Plk4+/+ fi E +/- severe combined immunode cient (NOD-SICD) mice (Fig. 1 ), Plk4 +/+ +/− 30 whereas P3 Plk4 and P3 Plk4 MEFs were not tumorigenic 1.0×10 6 +/− Growth index (observed to 8 months). The P15 Plk4 derived tumors were 20 * (# of cells/10 cm dish) grossly palpable after a latency period of 2–20 weeks and on 0 10 P3 P4 P5 P6 P7 P8 P9 P10P15P20 histologic evaluation showed a high mitotic index, consistent with Passage 0 E beta-Gal positive cells (%) cells beta-Gal positive P3 P8 rapid proliferation (Fig. 1 ). Even at early passage (P3), the incidence of multinucleation was +/− +/+ E 100 higher in Plk4 than Plk4 MEFs (Fig. 2A). In addition, a sig- fi +/− +/+ 80 ni cantly greater fraction of P3 Plk4 than P3 Plk4 MEFs contained three or more centrosomes, as identified by staining for 60 centrin, pericentrin, γ-tubulin, and Plk4 itself (Fig. 2B and Fig. S2A). 40 The supernumerary centrosomes were structurally intact by electron P3 Plk4+/+ (n=9) microscopy, and the majority stained positive for the mother cen- 20 P3 Plk4+/- (n=12) A B +/- triole marker Cep-170 (14) (Fig. S2 and ). FACS analysis showed P15 Plk4 (n=50) +/− Palpable tumor-free (%) 0 increasing DNA content with serial passage of Plk4 MEFs, 0102030 whereas Plk4+/+ MEFs remained largely diploid (Fig.
Load more

Recommended publications
  • Deregulated Gene Expression Pathways in Myelodysplastic Syndrome Hematopoietic Stem Cells
    Leukemia (2010) 24, 756–764 & 2010 Macmillan Publishers Limited All rights reserved 0887-6924/10 $32.00 www.nature.com/leu ORIGINAL ARTICLE Deregulated gene expression pathways in myelodysplastic syndrome hematopoietic stem cells A Pellagatti1, M Cazzola2, A Giagounidis3, J Perry1, L Malcovati2, MG Della Porta2,MJa¨dersten4, S Killick5, A Verma6, CJ Norbury7, E Hellstro¨m-Lindberg4, JS Wainscoat1 and J Boultwood1 1LRF Molecular Haematology Unit, NDCLS, John Radcliffe Hospital, Oxford, UK; 2Department of Hematology Oncology, University of Pavia Medical School, Fondazione IRCCS Policlinico San Matteo, Pavia, Italy; 3Medizinische Klinik II, St Johannes Hospital, Duisburg, Germany; 4Division of Hematology, Department of Medicine, Karolinska Institutet, Stockholm, Sweden; 5Department of Haematology, Royal Bournemouth Hospital, Bournemouth, UK; 6Albert Einstein College of Medicine, Bronx, NY, USA and 7Sir William Dunn School of Pathology, University of Oxford, Oxford, UK To gain insight into the molecular pathogenesis of the the World Health Organization.6,7 Patients with refractory myelodysplastic syndromes (MDS), we performed global gene anemia (RA) with or without ringed sideroblasts, according to expression profiling and pathway analysis on the hemato- poietic stem cells (HSC) of 183 MDS patients as compared with the the French–American–British classification, were subdivided HSC of 17 healthy controls. The most significantly deregulated based on the presence or absence of multilineage dysplasia. In pathways in MDS include interferon signaling, thrombopoietin addition, patients with RA with excess blasts (RAEB) were signaling and the Wnt pathways. Among the most signifi- subdivided into two categories, RAEB1 and RAEB2, based on the cantly deregulated gene pathways in early MDS are immuno- percentage of bone marrow blasts.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Use of the Polo-Like Kinase 4 (PLK4) Inhibitor Centrinone to Investigate Intracellular Signaling Networks Using SILAC-Based Phos
    bioRxiv preprint doi: https://doi.org/10.1101/2020.05.22.110767; this version posted May 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Use of the Polo-like kinase 4 (PLK4) inhibitor centrinone to 2 investigate intracellular signaling networks using SILAC-based 3 phosphoproteomics 4 Dominic P Byrne1#, Christopher J Clarke1,2#, Philip J Brownridge2, Anton Kalyuzhnyy1, 5 3, Simon Perkins1, 3, Amy Campbell1,2, David Mason4, Andrew R Jones1, 3, Patrick A 6 Eyers1* and Claire E Eyers1,2* 7 1 Department of Biochemistry and Systems Biology, Institute of Systems, Molecular & 8 Integrative Biology, University of Liverpool, L69 7ZB, UK. 9 2 Centre for Proteome Research, Department of Biochemistry and Systems Biology, 10 Institute of Systems, Molecular & Integrative Biology, University of Liverpool, L69 7ZB, 11 UK. 12 13 3 Computational Biology Facility, Department of Biochemistry and Systems Biology, 14 Institute of Systems, Molecular & Integrative Biology, University of Liverpool, L69 7ZB, 15 UK. 16 17 4 Centre for Cell Imaging, Department of Biochemistry and Systems Biology, Institute 18 of Systems, Molecular & Integrative Biology, University of Liverpool, L69 7ZB, UK. 19 20 # Equal contribution 21 *Correspondence to CEE ([email protected]) and PAE 22 ([email protected]) 23 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.05.22.110767; this version posted May 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • PLK4, Active (SRP5315)
    PLK4, active, GST-tagged, human Ò PRECISIO Kinase recombinant, expressed in Sf9 cells Catalog Number SRP5315 Storage Temperature –70 °C Synonyms: SAK, STK18 Figure 1. SDS-PAGE Gel of Typical Lot: Product Description ³70% (SDS-PAGE, densitometry) PLK4 or polo-like kinase 4 is a member of the polo family of serine/threonine protein kinases, which localizes to centrioles, the complex microtubule-based structures found in centrosomes, and regulates centriole duplication during the cell cycle. The overexpression of PLK4 triggered the simultaneous formation of multiple procentrioles around each preexisting centriole, which results in centriole amplification and thus, PLK4-induced centriole biogenesis in human cells.1 The reduced PLK4 gene dosage increases the probability of mitotic errors and cancer development.2 Figure 2. Specific Activity of Typical Lot: Recombinant human PLK4 (1-836) was expressed by 4.5–6.7 nmole/min/mg baculovirus in Sf9 insect cells using an N-terminal GST-tag. The PLK4 gene accession number is NM_014264. It is supplied in 50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 10 mM glutathione, 0.1 mM EDTA, 0.25 mM DTT, 0.1 mM PMSF, and 25% glycerol. Molecular mass: ~140 kDa Precautions and Disclaimer This product is for R&D use only, not for drug, household, or other uses. Please consult the Material Safety Data Sheet for information regarding hazards Procedure and safe handling practices. Preparation Instructions Kinase Assay Buffer – 25 mM MOPS, pH 7. 2, 12.5 mM Storage/Stability glycerol 2-phosphate, 25 mM MgC12, 5 mM EGTA, and The product ships on dry ice and storage at –70 °C is 2 mM EDTA.
    [Show full text]
  • Synthesis, Biological Evaluation and in Silico Studies of Certain Oxindole–Indole Conjugates As Anticancer CDK Inhibitors
    molecules Article Synthesis, Biological Evaluation and In Silico Studies of Certain Oxindole–Indole Conjugates as Anticancer CDK Inhibitors Tarfah Al-Warhi 1, Ahmed M. El Kerdawy 2,3 , Nada Aljaeed 1, Omnia E. Ismael 4, Rezk R. Ayyad 5, Wagdy M. Eldehna 6,* , Hatem A. Abdel-Aziz 7 and Ghada H. Al-Ansary 8,9,* 1 Department of Chemistry, College of Science, Princess Nourah bint Abdulrahman University, Riyadh 12271, Saudi Arabia; [email protected] (T.A.-W.); [email protected] (N.A.) 2 Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Cairo University, Kasr El-Aini Street, Cairo 11562, Egypt; [email protected] 3 Department of Pharmaceutical Chemistry, Faculty of Pharmacy, New Giza University, Newgiza, km 22 Cairo–Alexandria Desert Road, Cairo 12577, Egypt 4 Department of Biochemistry, Faculty of Pharmacy, Egyptian Russian University, Badr City, Cairo 11829, Egypt; [email protected] 5 Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Al-Azhar University, Cairo 11651, Egypt; [email protected] 6 Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Kafrelsheikh University, Kafrelsheikh 33516, Egypt 7 Department of Applied Organic Chemistry, National Research Center, Dokki, Giza 12622, Egypt; [email protected] 8 Department of Pharmaceutical Chemistry, Pharmacy Program, Batterejee Medical College, Jeddah 6231, Saudi Arabia 9 Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Ain Shams University, Abbassia, Cairo 11566, Egypt * Correspondence: [email protected] (W.M.E.); [email protected] (G.H.A.) Academic Editor: Sandra Gemma Received: 3 April 2020; Accepted: 23 April 2020; Published: 27 April 2020 Abstract: On account of their overexpression in a wide range of human malignancies, cyclin-dependent kinases (CDKs) are among the most validated cancer targets, and their inhibition has been featured as a valuable strategy for anticancer drug discovery.
    [Show full text]
  • Centrosome Impairment Causes DNA Replication Stress Through MLK3
    bioRxiv preprint doi: https://doi.org/10.1101/2020.01.09.898684; this version posted January 10, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Centrosome impairment causes DNA replication stress through MLK3/MK2 signaling and R-loop formation Zainab Tayeh 1, Kim Stegmann 1, Antonia Kleeberg 1, Mascha Friedrich 1, Josephine Ann Mun Yee Choo 1, Bernd Wollnik 2, and Matthias Dobbelstein 1* 1) Institute of Molecular Oncology, Göttingen Center of Molecular Biosciences (GZMB), University Medical Center Göttingen, Göttingen, Germany 2) Institute of Human Genetics, University Medical Center Göttingen, Göttingen, Germany *Lead Contact. Correspondence and requests for materials should be addressed to M. D. (e-mail: [email protected]; ORCID 0000-0001-5052-3967) Running title: Centrosome integrity supports DNA replication Key words: Centrosome, CEP152, CCP110, SASS6, CEP152, Polo-like kinase 4 (PLK4), DNA replication, DNA fiber assays, R-loops, MLK3, MK2 alias MAPKAPK2, Seckel syndrome, microcephaly. Highlights: • Centrosome defects cause replication stress independent of mitosis. • MLK3, p38 and MK2 (alias MAPKAPK2) are signalling between centrosome defects and DNA replication stress through R-loop formation. • Patient-derived cells with defective centrosomes display replication stress, whereas inhibition of MK2 restores their DNA replication fork progression and proliferation. 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.01.09.898684; this version posted January 10, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Centriole Overduplication Is the Predominant Mechanism Leading to Centrosome Amplification in Melanoma
    Published OnlineFirst January 12, 2018; DOI: 10.1158/1541-7786.MCR-17-0197 Oncogenes and Tumor Suppressors Molecular Cancer Research Centriole Overduplication is the Predominant Mechanism Leading to Centrosome Amplification in Melanoma Ryan A. Denu1,2, Maria Shabbir3, Minakshi Nihal3, Chandra K. Singh3, B. Jack Longley3,4,5, Mark E. Burkard2,4, and Nihal Ahmad3,4,5 Abstract Centrosome amplification (CA) is common in cancer and can evaluated. PLK4 is significantly overexpressed in melanoma com- arise by centriole overduplication or by cell doubling events, pared with benign nevi and in a panel of human melanoma cell including the failure of cell division and cell–cell fusion. To assess lines (A375, Hs294T, G361, WM35, WM115, 451Lu, and SK-MEL- the relative contributions of these two mechanisms, the number of 28) compared with normal human melanocytes. Interestingly, centrosomes with mature/mother centrioles was examined by although PLK4 expression did not correlate with CA in most cases, immunofluorescence in a tissue microarray of human melanomas treatment of melanoma cells with a selective small-molecule PLK4 and benign nevi (n ¼ 79 and 17, respectively). The centrosomal inhibitor (centrinone B) significantly decreased cell proliferation. protein 170 (CEP170) was used to identify centrosomes with The antiproliferative effects of centrinone B were also accompa- mature centrioles; this is expected to be present in most centro- nied by induction of apoptosis. somes with cell doubling, but on fewer centrosomes with over- duplication. Using this method, it was determined that the major- Implications: This study demonstrates that centriole overdupli- ity of CA in melanoma can be attributed to centriole overduplica- cation is the predominant mechanism leading to centrosome tion rather than cell doubling events.
    [Show full text]
  • The Use of Phosphoproteomic Data to Identify Altered Kinases and Signaling Pathways in Cancer
    The use of phosphoproteomic data to identify altered kinases and signaling pathways in cancer By Sara Renee Savage Thesis Submitted to the Faculty of the Graduate School of Vanderbilt University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE in Biomedical Informatics August 10, 2018 Nashville, Tennessee Approved: Bing Zhang, Ph.D. Carlos Lopez, Ph.D. Qi Liu, Ph.D. ACKNOWLEDGEMENTS The work presented in this thesis would not have been possible without the funding provided by the NLM training grant (T15-LM007450) and the support of the Biomedical Informatics department at Vanderbilt. I am particularly indebted to Rischelle Jenkins, who helped me solve all administrative issues. Furthermore, this work is the result of a collaboration between all members of the Zhang lab and the larger CPTAC consortium. I would like to thank the other CPTAC centers for processing the data, and Chen Huang and Suhas Vasaikar in the Zhang lab for analyzing the colon cancer copy number and proteomic data, respectively. All members of the Zhang lab have been extremely helpful in answering any questions I had and offering suggestions on my work. Finally, I would like to acknowledge my mentor, Bing Zhang. I am extremely grateful for his guidance and for giving me the opportunity to work on these projects. ii TABLE OF CONTENTS Page ACKNOWLEDGEMENTS ................................................................................................ ii LIST OF TABLES............................................................................................................
    [Show full text]
  • PRLR and PLK4 Are Promising Druggable Targets for Treating
    Sequence and Pathway analysis PRLR and PLK4 are promising druggable targets for treating Parkinson Disease that control activity of HSF2, POU2F1 and RAD21 transcription factors on promoters of differentially expressed genes Demo User geneXplain GmbH [email protected] Data received on 02/07/2020 ; Run on 27/10/2020 ; Report generated on 28/10/2020 Genome Enhancer release 2.2 (TRANSFAC®, TRANSPATH® and HumanPSD™ release 2020.3) Abstract In the present study we applied the software package "Genome Enhancer" to a data set that contains transcriptomics data. The study is done in the context of Parkinson Disease. The goal of this pipeline is to identify potential drug targets in the molecular network that governs the studied pathological process. In the first step of analysis pipeline discovers transcription factors (TFs) that regulate genes activities in the pathological state. The activities of these TFs are controlled by so- called master regulators, which are identified in the second step of analysis. After a subsequent druggability checkup, the most promising master regulators are chosen as potential drug targets for the analyzed pathology. At the end the pipeline comes up with (a) a list of known drugs and (b) investigational active chemical compounds with the potential to interact with selected drug targets. From the data set analyzed in this study, we found the following TFs to be potentially involved in the regulation of the differentially expressed genes: HSF2, POU2F1, AR, RAD21 and ESR2. The subsequent network analysis suggested Caspase-8 integrins nek10:Raf-1{pS338}:MEK1{pS218}{pS222} plk4 prlr:tec:Vav Caspase-8 as the most promising molecular targets for further research, drug development and drug repurposing initiatives on the basis of identified molecular mechanism of the studied pathology.
    [Show full text]
  • Androgen Receptor
    RALTITREXED Dihydrofolate reductase BORTEZOMIB IsocitrateCannabinoid dehydrogenase CB1EPIRUBICIN receptor HYDROCHLORIDE [NADP] cytoplasmic VINCRISTINE SULFATE Hypoxia-inducible factor 1 alpha DOXORUBICINAtaxin-2 HYDROCHLORIDENIFENAZONEFOLIC ACID PYRIMETHAMINECellular tumor antigen p53 Muscleblind-likeThyroidVINBURNINEVINBLASTINETRIFLURIDINE protein stimulating 1 DEQUALINIUM SULFATEhormone receptor CHLORIDE Menin/Histone-lysine N-methyltransferasePHENELZINE MLLLANATOSIDE SULFATE C MELATONINDAUNORUBICINBETAMETHASONEGlucagon-like HYDROCHLORIDEEndonuclease peptide 4 1 receptor NICLOSAMIDEDIGITOXINIRINOTECAN HYDROCHLORIDE HYDRATE BISACODYL METHOTREXATEPaired boxAZITHROMYCIN protein Pax-8 ATPase family AAA domain-containing proteinLIPOIC 5 ACID, ALPHA Nuclear receptorCLADRIBINEDIGOXIN ROR-gammaTRIAMTERENE CARMUSTINEEndoplasmic reticulum-associatedFLUOROURACIL amyloid beta-peptide-binding protein OXYPHENBUTAZONEORLISTAT IDARUBICIN HYDROCHLORIDE 6-phospho-1-fructokinaseHeat shockSIMVASTATIN protein beta-1 TOPOTECAN HYDROCHLORIDE AZACITIDINEBloom syndromeNITAZOXANIDE protein Huntingtin Human immunodeficiency virus typeTIPRANAVIR 1 protease VitaminCOLCHICINE D receptorVITAMIN E FLOXURIDINE TAR DNA-binding protein 43 BROMOCRIPTINE MESYLATEPACLITAXEL CARFILZOMIBAnthrax lethalFlap factorendonucleasePrelamin-A/C 1 CYTARABINE Vasopressin V2 receptor AMITRIPTYLINEMicrotubule-associated HYDROCHLORIDERetinoidTRIMETHOPRIM proteinMothers X receptor tau against alpha decapentaplegic homolog 3 Histone-lysine N-methyltransferase-PODOFILOX H3 lysine-9OXYQUINOLINE
    [Show full text]
  • The Curing AI for Precision Medicine
    The Curing AI for Precision Medicine Hoifung Poon 1 Medicine Today Is Imprecise Top 20 drugs 80% non-responders Wasted 1/3 health spending $750 billion / year 2 Disruption 1: Big Data 2009 2013: 40% 93% 3 Disruption 2: Pay-for-Performance Goal: 75% by 2020 4 Vemurafenib on BRAF-V600 Melanoma Before Treatment 15 Weeks 5 Vemurafenib on BRAF-V600 Melanoma Before Treatment 15 Weeks 23 Weeks 6 Why We Haven’t Solved Precision Medicine? … ATTCGGATATTTAAGGC … … ATTCGGGTATTTAAGCC … … ATTCGGATATTTAAGGC … … ATTCGGGTATTTAAGCC … … ATTCGGATATTTAAGGC … … ATTCGGGTATTTAAGCC … High-Throughput Data Discovery Bottleneck #1: Knowledge Bottleneck #2: Reasoning AI is the key to overcome these bottlenecks 7 Use Case: Molecular Tumor Board 8 www.ucsf.edu/news/2014/11/120451/bridging-gap-precision-medicine Use Case: Molecular Tumor Board Problem: Hard to scale U.S. 2015: 1.6 million new cases, 600K deaths 902 cancer hospitals Memorial Sloan Kettering 2016: Sequence: Tens of thousand Board can review: A few hundred Wanted: Decision support for cancer precision medicine 9 First-Generation Molecular Tumor Board Knowledge bottleneck E.g., given a tumor sequence, determine: What genes and mutations are important What drugs might be applicable Can do manually but hard to scale 10 Next-Generation Molecular Tumor Board Reasoning bottleneck E.g., personalize drug combinations Can’t do manually, ever 11 Big Medical Data Decision Support Precision Medicine Machine Predict Reading Drug Combo 12 13 PubMed 26 millions abstracts Two new abstracts every minute Adds over one million every year 14 Machine Reading PMID: 123 … VDR+ binds to SMAD3 to form … PMID: 456 Knowledge … JUN expression Base is induced by SMAD3/4 … …… 15 Machine Reading Involvement of p70(S6)-kinase activation in IL-10 up-regulation in human monocytes by gp41 envelope protein of human immunodeficiency virus type 1 ..
    [Show full text]
  • Targeted MS Quantitation Assays for Signal Transduction Protein Pathways
    Targeted MS quantitation assays for signal transduction protein pathways Paul Haney R&D Platform Manager Thermo Scientific Protein Research Products Rockford, IL Why Targeted Quantitative Proteomics via Mass Spec? . Measure protein abundance and protein isoforms (e.g. splice variants, PTMs) without the need for antibodies . Avoid immuno-based cross- reactivity during multiplexing. Validate relative quantitation data from discovery proteomic experiments 2 How Do You Select Peptides for Targeted MS Assays? List of Proteins Spectral library Discovery data repositories In silico prediction Pinpoint 1.2 Hypothesis Experimental List of target peptides and transitions 3 How Do You Select Peptides for Targeted MS Assays? List of Proteins Spectral library Discovery data repositories In silico prediction Pinpoint 1.2 Hypothesis Experimental Validation Assay results List of target peptides and transitions 4 Tools for Target Peptide Identification and Scheduling . Active-site probes for enzyme subclass enrichment . Rapid recombinant heavy protein expression using human cell-free extracts . Peptide retention time calibration mixture for chromatography QC and targeted method 100 80 60 acquisition scheduling Intensity 40 20 0 5 10 15 20 25 30 5 Tools for Target Peptide Identification and Scheduling . Active-site probes for enzyme subclass enrichment . Rapid recombinant heavy protein expression using human cell-free extracts • Stergachis, A. & MacCoss, M. (2011) Nature Methods (submitted) . Peptide retention time calibration mixture for 100 80 chromatography
    [Show full text]