DOCSLIB.ORG

Targeted MS Quantitation Assays for Signal Transduction Protein Pathways

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Targeted MS Quantitation Assays for Signal Transduction Protein Pathways Targeted MS quantitation assays for signal transduction protein pathways Paul Haney R&D Platform Manager Thermo Scientific Protein Research Products Rockford, IL Why Targeted Quantitative Proteomics via Mass Spec? . Measure protein abundance and protein isoforms (e.g. splice variants, PTMs) without the need for antibodies . Avoid immuno-based cross- reactivity during multiplexing. Validate relative quantitation data from discovery proteomic experiments 2 How Do You Select Peptides for Targeted MS Assays? List of Proteins Spectral library Discovery data repositories In silico prediction Pinpoint 1.2 Hypothesis Experimental List of target peptides and transitions 3 How Do You Select Peptides for Targeted MS Assays? List of Proteins Spectral library Discovery data repositories In silico prediction Pinpoint 1.2 Hypothesis Experimental Validation Assay results List of target peptides and transitions 4 Tools for Target Peptide Identification and Scheduling . Active-site probes for enzyme subclass enrichment . Rapid recombinant heavy protein expression using human cell-free extracts . Peptide retention time calibration mixture for chromatography QC and targeted method 100 80 60 acquisition scheduling Intensity 40 20 0 5 10 15 20 25 30 5 Tools for Target Peptide Identification and Scheduling . Active-site probes for enzyme subclass enrichment . Rapid recombinant heavy protein expression using human cell-free extracts • Stergachis, A. & MacCoss, M. (2011) Nature Methods (submitted) . Peptide retention time calibration mixture for 100 80 chromatography QC and targeted method 60 Intensity acquisition scheduling 40 20 0 5 10 15 20 25 30 6 How Do You Select Peptides for Targeted MS Assays? List of Proteins Discovery data Spectral library Repositories? In silico prediction? Reliable List of detectable target peptides and transitions? 7 ESPPredictor and SRM Concordance In silico prediction? Peptides ranked by ESPPredictor have very low correlation for good SRM signals 8 Number of Transcription Factor Spectra in NIST Database Spectral library Repositories? 9 In Vitro Protein Expression using Human IVT 2009 Products New Product Development SummaryDiscovery data Human vs Rabbit reticulocyte Human IVT Advantages: IVT Protein Expression . Rapid expression of full-length proteins (< 2 hr.) Human lysate . µg/ml Functional proteins with relevant post-translational modifications (phospho, glyco PTMs) Rabbit reticulocyte lysate . Ability to express pro-apoptotic or toxic proteins Luciferase . Amenable to modification of proteins through mutation and reaction supplements 10 High Throughput Transcription Factor Assay Development >100 transcription factor clones 11 IVT Expressed Transcription Factors are Pure & Full-length 12 Are These Peptides Useful for Targeted Assays in Lysate? IVT Extract Nuclear Extract c-Jun 13 Relative Abundance of Transcription Factors in Cell Lines Cell Line 14 Heavy Protein In Vitro Translation (IVT) Purification Purified Protein Expressed Protein Digestion Cells grown in standard suspension media Peptides Harvest Cells LC-MS Cell Lysate Reaction Mixture: IVT Data Analysis Vector - Stable isotope-labeled DNA amino acids - tRNA - mRNA stabilizers - RNA polymerase Expressed Protein 15 Heavy GFP Expression Timecourse Time course for GFP Expression 100 100 80 80 60 60 Concentration % Heavy (µg/mL) 40 40 20 20 0 0 0 2 4 6 Incubation time (hours) 16 Heavy Protein Expression of Phosphorylated BAD Schematic of BAD Signaling Pathway Heavy BAD Protein Expression Akt1 BAD BAD BAD P P + 14-3-3σ 14-3-3 Bcl-2 Bax BAD Cell survival Cell death 17 Heavy Protein Expression of Phosphorylated BAD 110 HSSYPAGTEDDEGmGEEPSPFr 105 807.9967 t acted o \ ya \Ju y 0 \ ea y e by ad3 3 # 0 6 6 R=47700 z=3 100 ITMS, CID, z=+3, Mono m/z=807.66321 Da, MH+=2420.97507 Da, Match Tol.=0.8 Da 95 807.6632 y₅⁺ R=47605 z=3 90 12 613.35 b₁₇²⁺ 85 904.84 10 ) 3 80 ^ 0 b₁₆²⁺ 1 ( >95% isotope ] 8 840.59 808.3307 s 75 t n R=47704 u y₆⁺ b₁₉²⁺ o c z=3 [ 70 742.37 y 996.92 t 6 i s n incorporation e 65 t n b₂₁²⁺ I y₃⁺ b₁₃⁺ 4 1119.32 1346.44 60 429.28 y₄⁺ b₁₂⁺ 55 2 y₅²⁺ 516.36 1289.59 b₁₆⁺ b₁₇⁺ 307.34 Relative Abundance Relative 1808.76 50 1679.59 0 45 500 1000 1500 2000 m/z 40 808.6644 R=47504 35 z=3 30 25 20 808.9987 R=48004 15 z=3 10 804.6613 807.3299 809.3320 804.3274 804.9958 803.6577 R=45000 805.8584 806.3579 806.9905 R=44104 R=48204 809.6719 5 R=43705 R=46704 R=33704 z=3 R=42604 R=48504 R=43104 z=? z=3 R=50604 z=3 z=3 z=? z=? z=? z=? z=3 0 803.0 803.5 804.0 804.5 805.0 805.5 806.0 806.5 807.0 807.5 808.0 808.5 809.0 809.5 810.0 m/z Light Heavy 18 Summary of IVT-SRM Results . IVT-SRM is a scalable strategy for targeted peptide selection . Empirical peptide strategy is more successful than in silico prediction • Saves money on synthetic peptides • Improves sensitivity by identifying best peptides • Identifies peptides likely to be modified in cells . Human proteins expressed using Heavy IVT system show > 90% heavy isotope incorporation . Protein phosphorylation and heterodimers known to interact with BAD protein were identified demonstrating PTM and proper folding 19 Tools for Target Peptide Identification and Scheduling . Active-site probes for enzyme subclass enrichment . Rapid recombinant protein expression using human cell-free extracts . Peptide retention time calibration mixture for chromatography QC and targeted method 100 80 60 acquisition scheduling Intensity 40 20 0 5 10 15 20 25 30 20 Peptide Retention Time Calibration Mixture # Observed Mass Hydrophobicity Sequence ( Z=2) Factor (HF) HF 1 SSAAPPPPPR* 493.77 7.57 2 GISNEGQNASIK* 613.32 15.50 3 HVLTSIGEK* 499.28 15.52 4 DIPVPKPK* 451.28 17.65 5 IGDYAGIK* 422.73 19.15 6 TASEFDSAIAQDK* 695.83 25.88 7 SAAGAFGPELSR* 586.80 25.24 8 ELGQSGVDTYLQTK* 773.89 28.37 9 GLILVGGYGTR* 558.32 32.18 10 GILFVGSGVSGGEEGAR* 801.41 34.52 11 SFANQPLEVVYSK* 745.39 34.96 12 LTILEELR* 498.80 37.30 13 NGFILDGFPR* 573.30 40.42 14 ELASGLSFPVGFK* 679.37 41.18 15 LSSEAPALFQFDLK* 787.42 46.66 21 Evaluate and Monitor System Performance Thermo Scientific LTQ Orbitrap XL Gradient: 0.25 % per minute; 300 nL per minute Column: C18 (Michrom Magic C18; 3 µm; 200 Å ; 0.075 mm x 20 cm) 0 60.73 NL: 1.13E8 741.39 Base Peak F: FTMS 100 8 + p NSI Full ms 2 3 50.41 10 11 [400.00-1600.00] 20.63 6 769.89 59.92 80 609.31 21.62 5 40.79 12 MS 31.63 796.41 68.69 492.28 691.83 neattrainersetpointper 418.73 7 493.80 centc 60 43.71 1373.51 76.7514 31.90 581.80 58.02 568.30 676.37 418.73 553.32 40 9 77.00 15.321 676.37 Relative Abundance 488.77 20 28.234 1583.38 22.92 34.40 53.15 62.99 78.29 14.25 19.95 469.32 39.88 48.06 64.56 70.64 783.42 89.39 429.09 565.80 609.80 418.73 654.98 453.35 770.38 760.89 741.88 544.32 559.30 667.36 0 20.50 60.64 NL: 1.14E8 741.39 68.55 Base Peak F: FTMS 100 609.31 59.69 493.80 + p NSI Full ms 21.68 796.41 [400.00-1600.00] 492.28 31.37 MS 80 40.69 50.17 418.73 neattrainersetpointper 691.83 769.89 57.79 73.44 centd 60 43.60 553.32 568.30 581.80 76.63 676.37 40 15.13 488.77 44.02 20 27.87 581.80 83.27 14.27 20.24 22.88 469.32 32.81 39.67 52.30 53.56 62.94 64.51 70.72 78.04 783.42 88.97 429.09 552.29 609.80 418.73 655.31 770.38 851.43 760.89 741.88 544.32 559.30 429.09 0 10 15 20 25 30 35 40 45 50 55 60 65 70 75 80 85 Time (min) Thermo Scientific TSQ Vantage Gradient: 0.25 % per minute; 180 µL per minute Column: C18 (Thermo Hypersil Gold C18; 3 µm; 100 Å ;1.0 mm x 15 cm) 610.29 2.57E4 100 5 Base Peak 9 66.45 MS 80 28.54 772.46 point25perc 666.34 12 entrtcm15_ 1 7 3 60 5.94 660.38 40.29 10 11 2 19.823 658.35 57.48 13 40 6 8 17.23 747.42 934.52 4 70.67 717.39 37.61 46.82 Relative Abundance 25.36 704.37 20 994.48 15 6.49 665.43 1111.56 14 1.14 660.38 15.56 21.74 30.55 32.42 40.87 49.12 61.25 73.46 80.32 83.98 87.77 553.27 910.50 805.42 666.34 645.36 658.35 910.50 376.22 781.42 1078.59 561.26 522.29 0 53.81 NL: 610.29 66.42 2.54E4 100 28.67 772.46 Base Peak 666.34 MS 80 point25perc entrtcm15_ 5.94 4 60 660.38 40.22 57.32 19.88 805.42 934.52 40 747.42 17.33 70.64 717.39 37.73 46.69 704.37 20 25.23 461.24 1111.56 6.49 80.79 0.27 665.43 40.94 47.45 73.59 84.55 660.38 16.71 30.68 37.07 57.97 63.37 77.36 1004.52 89.15 553.27 717.39 666.34 388.26 805.42 660.38 934.52 659.37 781.42 547.32 546.29 553.27 0 0 5 10 15 20 25 30 35 40 45 50 55 60 65 70 75 80 85 90 Time (min) 22 Retention Time as a Function of Hydrophobicity 23 Predicted Retention Time for Targeting HeLa Peptides Tryptic Digest of HeLa Protein Extract 24 Scheduling Enables Targeted Quantitation and Mutiplexing RT: 8.54 - 9.39 11.66 NL: 100 9.18 1.28E5NL: scheduled 100 9.17E4 90 90 TIC MSTIC MS 9.17 transferrin_ 80 10.19 9.20 transferrin_ 80 9.86 scheduled_scheduled_ 9.18 70 11.03 101113061 70 101113061331 60 11.63 331 9.17 9.15 60 9.20 50 8.71 8.72 11.06 9.21 9.84 409.88 8.74 11.69 50 8.69 30 9.13 Relative Abundance 10.22 12.47 12.85 9.23 40 8.72 9.15 8.75 11.48 9.10 20 8.68 9.21 12.829.07 9.09 30 8.74 8.66 8.77 11.88 9.25 Relative Abundance 8.69 10 11.00 8.79 9.04 12.87 9.13 8.55 10.468.65 8.82 8.87 8.88 8.99 9.02 9.26 9.28 9.35 20 9.23 0 11.91 10.49 11.42 12.89 9.18 NL: 8.68 9.09 9.81 100 5.58E4 10 9.25 11.94 12.96 8.30 90 10.52 TIC MS 8.25 9.79 13.29 13.54 13.59 transferrin_ 0 80 8.71 11.65 NL: unschedule d_1011130 100 70 9.24 1.01E5 10.24 70445 90 60 TIC MS 50 transferrin_ 80 unscheduled 9.8940 unschedule 70 11.06 d_1011130 30 8.77 9.12 70445 60 9.18 20 8.71 10 8.65 9.06 50 8.54 8.65 8.67 8.75 8.8311.548.83 8.89 8.94 8.98 9.05 9.09 9.16 9.19 9.28 9.30 9.36 8.71 0 10.48 12.49 40 9.24 8.6 8.7 8.8 8.9 9.0 12.849.1 9.2 9.3 Time (min) 30 11.00 11.47 12.89 13.36 20 8.77 11.91 12.55 12.91 9.83 10.18 10 8.30 10.77 11.41 12.00 13.42 8.18 9.06 9.30 9.71 13.60 0 8.0 8.5 9.0 9.5 10.0 10.5 11.0 11.5 12.0 12.5 13.0 13.5 14.0 Time (min) 25 PRTC Summary Thermo Scientific Pierce Peptide Retention Time Calibration Mixture (PRTC) uses: .
Load more

Recommended publications
  • Deregulated Gene Expression Pathways in Myelodysplastic Syndrome Hematopoietic Stem Cells
    Leukemia (2010) 24, 756–764 & 2010 Macmillan Publishers Limited All rights reserved 0887-6924/10 $32.00 www.nature.com/leu ORIGINAL ARTICLE Deregulated gene expression pathways in myelodysplastic syndrome hematopoietic stem cells A Pellagatti1, M Cazzola2, A Giagounidis3, J Perry1, L Malcovati2, MG Della Porta2,MJa¨dersten4, S Killick5, A Verma6, CJ Norbury7, E Hellstro¨m-Lindberg4, JS Wainscoat1 and J Boultwood1 1LRF Molecular Haematology Unit, NDCLS, John Radcliffe Hospital, Oxford, UK; 2Department of Hematology Oncology, University of Pavia Medical School, Fondazione IRCCS Policlinico San Matteo, Pavia, Italy; 3Medizinische Klinik II, St Johannes Hospital, Duisburg, Germany; 4Division of Hematology, Department of Medicine, Karolinska Institutet, Stockholm, Sweden; 5Department of Haematology, Royal Bournemouth Hospital, Bournemouth, UK; 6Albert Einstein College of Medicine, Bronx, NY, USA and 7Sir William Dunn School of Pathology, University of Oxford, Oxford, UK To gain insight into the molecular pathogenesis of the the World Health Organization.6,7 Patients with refractory myelodysplastic syndromes (MDS), we performed global gene anemia (RA) with or without ringed sideroblasts, according to expression profiling and pathway analysis on the hemato- poietic stem cells (HSC) of 183 MDS patients as compared with the the French–American–British classification, were subdivided HSC of 17 healthy controls. The most significantly deregulated based on the presence or absence of multilineage dysplasia. In pathways in MDS include interferon signaling, thrombopoietin addition, patients with RA with excess blasts (RAEB) were signaling and the Wnt pathways. Among the most signifi- subdivided into two categories, RAEB1 and RAEB2, based on the cantly deregulated gene pathways in early MDS are immuno- percentage of bone marrow blasts.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • MARK4 with an Alzheimer's Disease-Related Mutation Promotes
    bioRxiv preprint doi: https://doi.org/10.1101/2020.05.20.107284; this version posted May 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. MARK4 with an Alzheimer’s disease-related mutation promotes tau hyperphosphorylation directly and indirectly and exacerbates neurodegeneration Toshiya Obaa, Taro Saitoa,b, Akiko Asadaa,b, Sawako Shimizua, Koichi M. Iijimac,d and Kanae Andoa,b, * aGraduate School of Science, Tokyo Metropolitan University, Tokyo 192-0397, Japan, bDepartment of Biological Sciences, School of Science, Tokyo Metropolitan University, Tokyo 192-0397, Japan, cDepartment of Alzheimer’s Disease Research, National Center for Geriatrics and Gerontology, Obu, Aichi 474-8511, Japan, dDepartment of Experimental Gerontology, Graduate School of Pharmaceutical Sciences, Nagoya City University, Nagoya, Aichi 467-8603, Japan *Corresponding author Kanae Ando, Ph.D. E-mail: [email protected] Running title: Mutant MARK4 enhances phospho-tau accumulation Abstract Accumulation of the microtubule-associated protein tau is associated with Alzheimer’s disease (AD). In AD brain, tau is abnormally phosphorylated at many sites, and phosphorylation at Ser262 and Ser356 play critical roles in tau accumulation and toxicity. Microtubule-affinity regulating kinase 4 (MARK4) phosphorylates tau at those sites, and a double de novo mutation in the linker region of MARK4, ΔG316E317InsD, is associated with an elevated risk of AD. However, it remains unclear how this mutation affects phosphorylation, aggregation, and accumulation of tau and tau-induced neurodegeneration. Here, we report that MARK4ΔG316E317D increases the abundance of highly phosphorylated, insoluble tau species and exacerbates neurodegeneration via Ser262/356-dependent and -independent mechanisms.
    [Show full text]
  • A Feed-Forward Cycle
    GMJ.2020;9:e1681 www.gmj.ir Received 2019-08-08 Revised 2019-11-11 Accepted 2019-11-24 Tau Abnormalities and Autophagic Defects in Neurodegenerative Disorders; A Feed-forward Cycle Nastaran Samimi 1, 2, Akiko Asada 3, 4, Kanae Ando 3, 4 1 Noncommunicable Diseases Research Center, Fasa University of Medical Sciences, Fasa, Iran 2 Department of Brain and Cognitive Sciences, Cell Science Research Center, Royan Institute for Stem Cell Biology and Technology, ACECR, Tehran, Iran 3 Department of Biological Sciences, School of Science, Tokyo Metropolitan University, Tokyo, Japan 4 Graduate School of Science, Tokyo Metropolitan University, Tokyo, Japan Abstract Abnormal deposition of misfolded proteins is a neuropathological characteristic shared by many neurodegenerative disorders including Alzheimer’s disease (AD). Generation of excessive amounts of aggregated proteins and impairment of degradation systems for misfolded proteins such as autophagy can lead to accumulation of proteins in diseased neurons. Molecules that contribute to both these effects are emerging as critical players in disease pathogenesis. Furthermore, impairment of autophagy under disease conditions can be both a cause and a consequence of abnormal protein accumulation. Specifically, disease-causing proteins can impair autophagy, which further enhances the accumulation of abnormal proteins. In this short review, we focus on the relationship between the microtubule-associated protein tau and autophagy to highlight a feed-forward mechanism in disease pathogenesis. [GMJ.2020;9:e1681] DOI:10.31661/gmj.v9i0.1681 Keywords: Neurodegenerative Diseases; Tauopathy; Autophagy; Microtubule Binding Pro- tein; Tau; Phosphorylation; Vesicle Trafficking Tau phosphorylation in physiology and dis- However, tau detaches from microtubules and ease misfolds to form insoluble filaments in neuro- isfolded tau protein is deposited in a fibrillary tangles in the brains of patients with Mgroup of neurodegenerative diseases tauopathies [4-9].
    [Show full text]
  • Analysis of the Human Serum Proteome
    Cedarville University DigitalCommons@Cedarville Pharmaceutical Sciences Faculty Publications Department of Pharmaceutical Sciences 6-2004 Analysis of the Human Serum Proteome King C. Chan David A. Lucas Denise Hise Carl F. Schaefer Zhen Xiao See next page for additional authors Follow this and additional works at: https://digitalcommons.cedarville.edu/ pharmaceutical_sciences_publications Part of the Pharmacy and Pharmaceutical Sciences Commons This Article is brought to you for free and open access by DigitalCommons@Cedarville, a service of the Centennial Library. It has been accepted for inclusion in Pharmaceutical Sciences Faculty Publications by an authorized administrator of DigitalCommons@Cedarville. For more information, please contact [email protected]. Authors King C. Chan, David A. Lucas, Denise Hise, Carl F. Schaefer, Zhen Xiao, George M. Janini, Kenneth H. Buetow, Haleem J. Issaq, Timothy D. Veenstra, and Thomas P. Conrads Clinical Proteomics Journal Copyright ©Humana Press Inc. All rights of any nature whatsoever are reserved. ISSN 1542-6416/04/01:101–225/$25.00 Serum/Plasma Proteome Analysis of the Human Serum Proteome King C. Chan,1,† David A. Lucas,1,† Denise Hise,2 Carl F. Schaefer,2 Zhen Xiao,1 George M. Janini,1 Kenneth H. Buetow,2 Haleem J. Issaq,1 Timothy D.Veenstra,1 and Thomas P. Conrads1,* 1Laboratory of Proteomics and Analytical Technologies, National Cancer Institute at Frederick, SAIC-Frederick, Inc, PO Box B, Frederick, MD 21702 2Center for Bioinformatics, National Cancer Institute, Bethesda, MD 20892 †These authors contributed equally to this work. each of which was analyzed by microcapillary Abstract reversed-phase liquid chromatography coupled Changes in serum proteins that signal online with MS/MS analysis.
    [Show full text]
  • A Calcium- and Calmodulin-Dependent Kinase I␣/ Microtubule Affinity Regulating Kinase 2 Signaling Cascade Mediates Calcium-Dependent Neurite Outgrowth
    The Journal of Neuroscience, April 18, 2007 • 27(16):4413–4423 • 4413 Cellular/Molecular A Calcium- and Calmodulin-Dependent Kinase I␣/ Microtubule Affinity Regulating Kinase 2 Signaling Cascade Mediates Calcium-Dependent Neurite Outgrowth Nataliya V. Uboha,1 Marc Flajolet,2 Angus C. Nairn,1,2 and Marina R. Picciotto1 1Department of Psychiatry, Yale University School of Medicine, New Haven, Connecticut 06508, and 2Laboratory of Molecular and Cellular Neuroscience, The Rockefeller University, New York, New York 10021 Calcium is a critical regulator of neuronal differentiation and neurite outgrowth during development, as well as synaptic plasticity in adulthood. Calcium- and calmodulin-dependent kinase I (CaMKI) can regulate neurite outgrowth; however, the signal transduction cascades that lead to its physiological effects have not yet been elucidated. CaMKI␣ was therefore used as bait in a yeast two-hybrid assay and microtubule affinity regulating kinase 2 (MARK2)/Par-1b was identified as an interacting partner of CaMKI in three independent screens. The interaction between CaMKI and MARK2 was confirmed in vitro and in vivo by coimmunoprecipitation. CaMKI binds MARK2 within its kinase domain, but only if it is activated by calcium and calmodulin. Expression of CaMKI and MARK2 in Neuro-2A (N2a) cells and in primary hippocampal neurons promotes neurite outgrowth, an effect dependent on the catalytic activities of these enzymes. In addition, decreasing MARK2 activity blocks the ability of the calcium ionophore ionomycin to promote neurite outgrowth. Finally, CaMKI phosphorylates MARK2 on novel sites within its kinase domain. Mutation of these phosphorylation sites decreases both MARK2 kinase activity and its ability to promote neurite outgrowth.
    [Show full text]
  • Profiling Data
    Compound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8
    [Show full text]
  • PDF Download
    MEK-7 Polyclonal Antibody Catalog No : YT2725 Reactivity : Human,Mouse,Rat Applications : WB,ELISA Gene Name : MAP2K7 Protein Name : Dual specificity mitogen-activated protein kinase kinase 7 Human Gene Id : 5609 Human Swiss Prot O14733 No : Mouse Gene Id : 26400 Mouse Swiss Prot Q8CE90 No : Rat Gene Id : 363855 Rat Swiss Prot No : Q4KSH7 Immunogen : The antiserum was produced against synthesized peptide derived from human MAP2K7. AA range:241-290 Specificity : MEK-7 Polyclonal Antibody detects endogenous levels of MEK-7 protein. Formulation : Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. Source : Rabbit Dilution : Western Blot: 1/500 - 1/2000. ELISA: 1/20000. Not yet tested in other applications. Purification : The antibody was affinity-purified from rabbit antiserum by affinity- chromatography using epitope-specific immunogen. Concentration : 1 mg/ml 1 / 3 Storage Stability : -20°C/1 year Molecularweight : 47485 Observed Band : 47 Cell Pathway : MAPK_ERK_Growth,MAPK_G_Protein,ErbB_HER,Toll_Like,T_Cell_Receptor, Fc epsilon RI,Neurotrophin,GnRH, Background : mitogen-activated protein kinase kinase 7(MAP2K7) Homo sapiens The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase specifically activates MAPK8/JNK1 and MAPK9/JNK2, and this kinase itself is phosphorylated and activated by MAP kinase kinase kinases including MAP3K1/MEKK1, MAP3K2/MEKK2,MAP3K3/MEKK5, and MAP4K2/GCK. This kinase is involved in the signal transduction mediating the cell
    [Show full text]
  • Application of a MYC Degradation
    SCIENCE SIGNALING | RESEARCH ARTICLE CANCER Copyright © 2019 The Authors, some rights reserved; Application of a MYC degradation screen identifies exclusive licensee American Association sensitivity to CDK9 inhibitors in KRAS-mutant for the Advancement of Science. No claim pancreatic cancer to original U.S. Devon R. Blake1, Angelina V. Vaseva2, Richard G. Hodge2, McKenzie P. Kline3, Thomas S. K. Gilbert1,4, Government Works Vikas Tyagi5, Daowei Huang5, Gabrielle C. Whiten5, Jacob E. Larson5, Xiaodong Wang2,5, Kenneth H. Pearce5, Laura E. Herring1,4, Lee M. Graves1,2,4, Stephen V. Frye2,5, Michael J. Emanuele1,2, Adrienne D. Cox1,2,6, Channing J. Der1,2* Stabilization of the MYC oncoprotein by KRAS signaling critically promotes the growth of pancreatic ductal adeno- carcinoma (PDAC). Thus, understanding how MYC protein stability is regulated may lead to effective therapies. Here, we used a previously developed, flow cytometry–based assay that screened a library of >800 protein kinase inhibitors and identified compounds that promoted either the stability or degradation of MYC in a KRAS-mutant PDAC cell line. We validated compounds that stabilized or destabilized MYC and then focused on one compound, Downloaded from UNC10112785, that induced the substantial loss of MYC protein in both two-dimensional (2D) and 3D cell cultures. We determined that this compound is a potent CDK9 inhibitor with a previously uncharacterized scaffold, caused MYC loss through both transcriptional and posttranslational mechanisms, and suppresses PDAC anchorage- dependent and anchorage-independent growth. We discovered that CDK9 enhanced MYC protein stability 62 through a previously unknown, KRAS-independent mechanism involving direct phosphorylation of MYC at Ser .
    [Show full text]
  • Epigenetic Loss of the RNA Decapping Enzyme NUDT16 Mediates C-MYC Activation in T-Cell Acute Lymphoblastic Leukemia
    OPEN Leukemia (2017) 31, 1622–1657 www.nature.com/leu LETTERS TO THE EDITOR Epigenetic loss of the RNA decapping enzyme NUDT16 mediates C-MYC activation in T-cell acute lymphoblastic leukemia Leukemia (2017) 31, 1622–1625; doi:10.1038/leu.2017.99 Having found the aforementioned NUDT16 CpG island methy- lation profiles, we studied in greater detail their association with the possible transcriptional inactivation of the NUDT16 gene at the RNA and protein levels in leukemia cell lines. We first It is possible that the occurrence of intrinsic defects in RNA performed bisulfite genomic sequencing of mutiple clones in the – processing pathways, such as RNA decapping,1 3 contribute to the T-cell Acute Lymphoblastic Leukemia (T-ALL) cell lines CCRF-CEM, distorted RNA landscapes of cancer cells. After transcription by Jurkat, MOLT-4 and MOLT-16 using primers that encompassed the RNA polymerase II, RNA molecules are equipped with a 5´-end transcription start site-associated CpG island and confirmed the N7-methyl guanosine (m7G)-cap. This m7G-cap is essential for hypermethylated status of the 5′-end region of NUDT16 in translation, stabilizing the RNA molecule and protecting it from comparison to normal T lymphocytes (Figure 1b), validating the – exonucleolytic breakdown.1 3 For RNA decay to occur the DNA methylation patterns obtained by the microarray approach m7G-cap first needs to be removed. This process is known as (Supplementary Figure S2). In contrast, normal T lymphocytes, the – decapping.1 3 The decapping mRNA 2 (DCP2) enzyme,4 also T-ALL cell lines KOPN-8, REH and RS4;11 and the leukemia cell known as the nucleoside diphosphate-linked moiety X motif lines HL-60 and K562 derived from myeloid lineage were all found 20 (NUDT20), was originally thought to be the only mammalian to be unmethylated (Figure 1b; Supplementary Figure S2).
    [Show full text]
  • Gene Expression Profiling of Micrornas Associated with UCA1 in Bladder Cancer Cells
    INTERNATIONAL JOURNAL OF ONCOLOGY 48: 1617-1627, 2016 Gene expression profiling of microRNAs associated with UCA1 in bladder cancer cells XIAOJUAN XIE1,2, JINGJING PAN1, LIQIANG WEI2, SHOUZHEN WU3, HUILIAN HOU4, XU LI3 and WEI CHEN1 1Department of Clinical Laboratory, The First Affiliated Hospital of Xi'an Jiaotong University, Xi'an, Shaanxi 710061; 2Shaanxi Center for Clinical Laboratory, Shaanxi Provincial People's Hospital, Xi'an, Shaanxi 710068; 3Center for Translational Medicine, 4Department of Pathology, The First Affiliated Hospital of Xi'an Jiaotong University, Xi'an, Shaanxi 710061, P.R. China Received November 11, 2015; Accepted December 27, 2015 DOI: 10.3892/ijo.2016.3357 Abstract. Emerging evidence indicates that non-coding and positively correlated with miR-196a, whereas UCA1 and RNAs, such as lncRNAs and microRNAs, play important miR-196a were negatively correlated with p27kip1, which was roles in diverse diseases, such as cancer, immune diseases downregulated in bladder cancer patients. Thus, our findings and cardiovascular diseases. Interestingly, lncRNAs could provided valuable information on miRNAs associated with directly or indirectly regulate the expression of miRNAs. UCA1 in bladder cancer, which could be helpful to further However, the expression profiling of miRNAs associated with explore the related genes and molecular networks fundamental UCA1 in bladder cancer remains unknown. Here, we used in bladder cancer progression. Illumina deep sequencing to sequence miRNA libraries from both the UCA1 knockdown and normal high-expression 5637 Introduction cells. We identified 225 and 235 miRNAs expressed in 5637 cells of normal high-expression and knockdown of UCA1, Recently, emerging studies have demonstrated that 70-90% of respectively.
    [Show full text]