Centrosome Impairment Causes DNA Replication Stress Through MLK3
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Deregulated Gene Expression Pathways in Myelodysplastic Syndrome Hematopoietic Stem Cells
Leukemia (2010) 24, 756–764 & 2010 Macmillan Publishers Limited All rights reserved 0887-6924/10 $32.00 www.nature.com/leu ORIGINAL ARTICLE Deregulated gene expression pathways in myelodysplastic syndrome hematopoietic stem cells A Pellagatti1, M Cazzola2, A Giagounidis3, J Perry1, L Malcovati2, MG Della Porta2,MJa¨dersten4, S Killick5, A Verma6, CJ Norbury7, E Hellstro¨m-Lindberg4, JS Wainscoat1 and J Boultwood1 1LRF Molecular Haematology Unit, NDCLS, John Radcliffe Hospital, Oxford, UK; 2Department of Hematology Oncology, University of Pavia Medical School, Fondazione IRCCS Policlinico San Matteo, Pavia, Italy; 3Medizinische Klinik II, St Johannes Hospital, Duisburg, Germany; 4Division of Hematology, Department of Medicine, Karolinska Institutet, Stockholm, Sweden; 5Department of Haematology, Royal Bournemouth Hospital, Bournemouth, UK; 6Albert Einstein College of Medicine, Bronx, NY, USA and 7Sir William Dunn School of Pathology, University of Oxford, Oxford, UK To gain insight into the molecular pathogenesis of the the World Health Organization.6,7 Patients with refractory myelodysplastic syndromes (MDS), we performed global gene anemia (RA) with or without ringed sideroblasts, according to expression profiling and pathway analysis on the hemato- poietic stem cells (HSC) of 183 MDS patients as compared with the the French–American–British classification, were subdivided HSC of 17 healthy controls. The most significantly deregulated based on the presence or absence of multilineage dysplasia. In pathways in MDS include interferon signaling, thrombopoietin addition, patients with RA with excess blasts (RAEB) were signaling and the Wnt pathways. Among the most signifi- subdivided into two categories, RAEB1 and RAEB2, based on the cantly deregulated gene pathways in early MDS are immuno- percentage of bone marrow blasts. -
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Mutations in CDK5RAP2 Cause Seckel Syndrome Go¨ Khan Yigit1,2,3,A, Karen E
ORIGINAL ARTICLE Mutations in CDK5RAP2 cause Seckel syndrome Go¨ khan Yigit1,2,3,a, Karen E. Brown4,a,Hu¨ lya Kayserili5, Esther Pohl1,2,3, Almuth Caliebe6, Diana Zahnleiter7, Elisabeth Rosser8, Nina Bo¨ gershausen1,2,3, Zehra Oya Uyguner5, Umut Altunoglu5, Gudrun Nu¨ rnberg2,3,9, Peter Nu¨ rnberg2,3,9, Anita Rauch10, Yun Li1,2,3, Christian Thomas Thiel7 & Bernd Wollnik1,2,3 1Institute of Human Genetics, University of Cologne, Cologne, Germany 2Center for Molecular Medicine Cologne (CMMC), University of Cologne, Cologne, Germany 3Cologne Excellence Cluster on Cellular Stress Responses in Aging-Associated Diseases (CECAD), University of Cologne, Cologne, Germany 4Chromosome Biology Group, MRC Clinical Sciences Centre, Imperial College School of Medicine, Hammersmith Hospital, London, W12 0NN, UK 5Department of Medical Genetics, Istanbul Medical Faculty, Istanbul University, Istanbul, Turkey 6Institute of Human Genetics, Christian-Albrechts-University of Kiel, Kiel, Germany 7Institute of Human Genetics, Friedrich-Alexander University Erlangen-Nuremberg, Erlangen, Germany 8Department of Clinical Genetics, Great Ormond Street Hospital for Children, London, WC1N 3EH, UK 9Cologne Center for Genomics, University of Cologne, Cologne, Germany 10Institute of Medical Genetics, University of Zurich, Schwerzenbach-Zurich, Switzerland Keywords Abstract CDK5RAP2, CEP215, microcephaly, primordial dwarfism, Seckel syndrome Seckel syndrome is a heterogeneous, autosomal recessive disorder marked by pre- natal proportionate short stature, severe microcephaly, intellectual disability, and Correspondence characteristic facial features. Here, we describe the novel homozygous splice-site Bernd Wollnik, Center for Molecular mutations c.383+1G>C and c.4005-9A>GinCDK5RAP2 in two consanguineous Medicine Cologne (CMMC) and Institute of families with Seckel syndrome. CDK5RAP2 (CEP215) encodes a centrosomal pro- Human Genetics, University of Cologne, tein which is known to be essential for centrosomal cohesion and proper spindle Kerpener Str. -
Synergistic Genetic Interactions Between Pkhd1 and Pkd1 Result in an ARPKD-Like Phenotype in Murine Models
BASIC RESEARCH www.jasn.org Synergistic Genetic Interactions between Pkhd1 and Pkd1 Result in an ARPKD-Like Phenotype in Murine Models Rory J. Olson,1 Katharina Hopp ,2 Harrison Wells,3 Jessica M. Smith,3 Jessica Furtado,1,4 Megan M. Constans,3 Diana L. Escobar,3 Aron M. Geurts,5 Vicente E. Torres,3 and Peter C. Harris 1,3 Due to the number of contributing authors, the affiliations are listed at the end of this article. ABSTRACT Background Autosomal recessive polycystic kidney disease (ARPKD) and autosomal dominant polycystic kidney disease (ADPKD) are genetically distinct, with ADPKD usually caused by the genes PKD1 or PKD2 (encoding polycystin-1 and polycystin-2, respectively) and ARPKD caused by PKHD1 (encoding fibrocys- tin/polyductin [FPC]). Primary cilia have been considered central to PKD pathogenesis due to protein localization and common cystic phenotypes in syndromic ciliopathies, but their relevance is questioned in the simple PKDs. ARPKD’s mild phenotype in murine models versus in humans has hampered investi- gating its pathogenesis. Methods To study the interaction between Pkhd1 and Pkd1, including dosage effects on the phenotype, we generated digenic mouse and rat models and characterized and compared digenic, monogenic, and wild-type phenotypes. Results The genetic interaction was synergistic in both species, with digenic animals exhibiting pheno- types of rapidly progressive PKD and early lethality resembling classic ARPKD. Genetic interaction be- tween Pkhd1 and Pkd1 depended on dosage in the digenic murine models, with no significant enhancement of the monogenic phenotype until a threshold of reduced expression at the second locus was breached. -
Use of the Polo-Like Kinase 4 (PLK4) Inhibitor Centrinone to Investigate Intracellular Signaling Networks Using SILAC-Based Phos
bioRxiv preprint doi: https://doi.org/10.1101/2020.05.22.110767; this version posted May 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Use of the Polo-like kinase 4 (PLK4) inhibitor centrinone to 2 investigate intracellular signaling networks using SILAC-based 3 phosphoproteomics 4 Dominic P Byrne1#, Christopher J Clarke1,2#, Philip J Brownridge2, Anton Kalyuzhnyy1, 5 3, Simon Perkins1, 3, Amy Campbell1,2, David Mason4, Andrew R Jones1, 3, Patrick A 6 Eyers1* and Claire E Eyers1,2* 7 1 Department of Biochemistry and Systems Biology, Institute of Systems, Molecular & 8 Integrative Biology, University of Liverpool, L69 7ZB, UK. 9 2 Centre for Proteome Research, Department of Biochemistry and Systems Biology, 10 Institute of Systems, Molecular & Integrative Biology, University of Liverpool, L69 7ZB, 11 UK. 12 13 3 Computational Biology Facility, Department of Biochemistry and Systems Biology, 14 Institute of Systems, Molecular & Integrative Biology, University of Liverpool, L69 7ZB, 15 UK. 16 17 4 Centre for Cell Imaging, Department of Biochemistry and Systems Biology, Institute 18 of Systems, Molecular & Integrative Biology, University of Liverpool, L69 7ZB, UK. 19 20 # Equal contribution 21 *Correspondence to CEE ([email protected]) and PAE 22 ([email protected]) 23 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.05.22.110767; this version posted May 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Par6c Is at the Mother Centriole and Controls Centrosomal Protein
860 Research Article Par6c is at the mother centriole and controls centrosomal protein composition through a Par6a-dependent pathway Vale´rian Dormoy, Kati Tormanen and Christine Su¨ tterlin* Department of Developmental and Cell Biology, University of California, Irvine, Irvine, CA 92697-2300, USA *Author for correspondence ([email protected]) Accepted 3 December 2012 Journal of Cell Science 126, 860–870 ß 2013. Published by The Company of Biologists Ltd doi: 10.1242/jcs.121186 Summary The centrosome contains two centrioles that differ in age, protein composition and function. This non-membrane bound organelle is known to regulate microtubule organization in dividing cells and ciliogenesis in quiescent cells. These specific roles depend on protein appendages at the older, or mother, centriole. In this study, we identified the polarity protein partitioning defective 6 homolog gamma (Par6c) as a novel component of the mother centriole. This specific localization required the Par6c C-terminus, but was independent of intact microtubules, the dynein/dynactin complex and the components of the PAR polarity complex. Par6c depletion resulted in altered centrosomal protein composition, with the loss of a large number of proteins, including Par6a and p150Glued, from the centrosome. As a consequence, there were defects in ciliogenesis, microtubule organization and centrosome reorientation during migration. Par6c interacted with Par3 and aPKC, but these proteins were not required for the regulation of centrosomal protein composition. Par6c also associated with Par6a, which controls protein recruitment to the centrosome through p150Glued. Our study is the first to identify Par6c as a component of the mother centriole and to report a role of a mother centriole protein in the regulation of centrosomal protein composition. -
Supplemental Information Proximity Interactions Among Centrosome
Current Biology, Volume 24 Supplemental Information Proximity Interactions among Centrosome Components Identify Regulators of Centriole Duplication Elif Nur Firat-Karalar, Navin Rauniyar, John R. Yates III, and Tim Stearns Figure S1 A Myc Streptavidin -tubulin Merge Myc Streptavidin -tubulin Merge BirA*-PLK4 BirA*-CEP63 BirA*- CEP192 BirA*- CEP152 - BirA*-CCDC67 BirA* CEP152 CPAP BirA*- B C Streptavidin PCM1 Merge Myc-BirA* -CEP63 PCM1 -tubulin Merge BirA*- CEP63 DMSO - BirA* CEP63 nocodazole BirA*- CCDC67 Figure S2 A GFP – + – + GFP-CEP152 + – + – Myc-CDK5RAP2 + + + + (225 kDa) Myc-CDK5RAP2 (216 kDa) GFP-CEP152 (27 kDa) GFP Input (5%) IP: GFP B GFP-CEP152 truncation proteins Inputs (5%) IP: GFP kDa 1-7481-10441-1290218-1654749-16541045-16541-7481-10441-1290218-1654749-16541045-1654 250- Myc-CDK5RAP2 150- 150- 100- 75- GFP-CEP152 Figure S3 A B CEP63 – – + – – + GFP CCDC14 KIAA0753 Centrosome + – – + – – GFP-CCDC14 CEP152 binding binding binding targeting – + – – + – GFP-KIAA0753 GFP-KIAA0753 (140 kDa) 1-496 N M C 150- 100- GFP-CCDC14 (115 kDa) 1-424 N M – 136-496 M C – 50- CEP63 (63 kDa) 1-135 N – 37- GFP (27 kDa) 136-424 M – kDa 425-496 C – – Inputs (2%) IP: GFP C GFP-CEP63 truncation proteins D GFP-CEP63 truncation proteins Inputs (5%) IP: GFP Inputs (5%) IP: GFP kDa kDa 1-135136-424425-4961-424136-496FL Ctl 1-135136-424425-4961-424136-496FL Ctl 1-135136-424425-4961-424136-496FL Ctl 1-135136-424425-4961-424136-496FL Ctl Myc- 150- Myc- 100- CCDC14 KIAA0753 100- 100- 75- 75- GFP- GFP- 50- CEP63 50- CEP63 37- 37- Figure S4 A siCtl -
PLK4, Active (SRP5315)
PLK4, active, GST-tagged, human Ò PRECISIO Kinase recombinant, expressed in Sf9 cells Catalog Number SRP5315 Storage Temperature –70 °C Synonyms: SAK, STK18 Figure 1. SDS-PAGE Gel of Typical Lot: Product Description ³70% (SDS-PAGE, densitometry) PLK4 or polo-like kinase 4 is a member of the polo family of serine/threonine protein kinases, which localizes to centrioles, the complex microtubule-based structures found in centrosomes, and regulates centriole duplication during the cell cycle. The overexpression of PLK4 triggered the simultaneous formation of multiple procentrioles around each preexisting centriole, which results in centriole amplification and thus, PLK4-induced centriole biogenesis in human cells.1 The reduced PLK4 gene dosage increases the probability of mitotic errors and cancer development.2 Figure 2. Specific Activity of Typical Lot: Recombinant human PLK4 (1-836) was expressed by 4.5–6.7 nmole/min/mg baculovirus in Sf9 insect cells using an N-terminal GST-tag. The PLK4 gene accession number is NM_014264. It is supplied in 50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 10 mM glutathione, 0.1 mM EDTA, 0.25 mM DTT, 0.1 mM PMSF, and 25% glycerol. Molecular mass: ~140 kDa Precautions and Disclaimer This product is for R&D use only, not for drug, household, or other uses. Please consult the Material Safety Data Sheet for information regarding hazards Procedure and safe handling practices. Preparation Instructions Kinase Assay Buffer – 25 mM MOPS, pH 7. 2, 12.5 mM Storage/Stability glycerol 2-phosphate, 25 mM MgC12, 5 mM EGTA, and The product ships on dry ice and storage at –70 °C is 2 mM EDTA. -
Supplementary Table S1. Prioritization of Candidate FPC Susceptibility Genes by Private Heterozygous Ptvs
Supplementary Table S1. Prioritization of candidate FPC susceptibility genes by private heterozygous PTVs Number of private Number of private Number FPC patient heterozygous PTVs in heterozygous PTVs in tumors with somatic FPC susceptibility Hereditary cancer Hereditary Gene FPC kindred BCCS samples mutation DNA repair gene Cancer driver gene gene gene pancreatitis gene ATM 19 1 - Yes Yes Yes Yes - SSPO 12 8 1 - - - - - DNAH14 10 3 - - - - - - CD36 9 3 - - - - - - TET2 9 1 - - Yes - - - MUC16 8 14 - - - - - - DNHD1 7 4 1 - - - - - DNMT3A 7 1 - - Yes - - - PKHD1L1 7 9 - - - - - - DNAH3 6 5 - - - - - - MYH7B 6 1 - - - - - - PKD1L2 6 6 - - - - - - POLN 6 2 - Yes - - - - POLQ 6 7 - Yes - - - - RP1L1 6 6 - - - - - - TTN 6 5 4 - - - - - WDR87 6 7 - - - - - - ABCA13 5 3 1 - - - - - ASXL1 5 1 - - Yes - - - BBS10 5 0 - - - - - - BRCA2 5 6 1 Yes Yes Yes Yes - CENPJ 5 1 - - - - - - CEP290 5 5 - - - - - - CYP3A5 5 2 - - - - - - DNAH12 5 6 - - - - - - DNAH6 5 1 1 - - - - - EPPK1 5 4 - - - - - - ESYT3 5 1 - - - - - - FRAS1 5 4 - - - - - - HGC6.3 5 0 - - - - - - IGFN1 5 5 - - - - - - KCP 5 4 - - - - - - LRRC43 5 0 - - - - - - MCTP2 5 1 - - - - - - MPO 5 1 - - - - - - MUC4 5 5 - - - - - - OBSCN 5 8 2 - - - - - PALB2 5 0 - Yes - Yes Yes - SLCO1B3 5 2 - - - - - - SYT15 5 3 - - - - - - XIRP2 5 3 1 - - - - - ZNF266 5 2 - - - - - - ZNF530 5 1 - - - - - - ACACB 4 1 1 - - - - - ALS2CL 4 2 - - - - - - AMER3 4 0 2 - - - - - ANKRD35 4 4 - - - - - - ATP10B 4 1 - - - - - - ATP8B3 4 6 - - - - - - C10orf95 4 0 - - - - - - C2orf88 4 0 - - - - - - C5orf42 4 2 - - - - -
Synthesis, Biological Evaluation and in Silico Studies of Certain Oxindole–Indole Conjugates As Anticancer CDK Inhibitors
molecules Article Synthesis, Biological Evaluation and In Silico Studies of Certain Oxindole–Indole Conjugates as Anticancer CDK Inhibitors Tarfah Al-Warhi 1, Ahmed M. El Kerdawy 2,3 , Nada Aljaeed 1, Omnia E. Ismael 4, Rezk R. Ayyad 5, Wagdy M. Eldehna 6,* , Hatem A. Abdel-Aziz 7 and Ghada H. Al-Ansary 8,9,* 1 Department of Chemistry, College of Science, Princess Nourah bint Abdulrahman University, Riyadh 12271, Saudi Arabia; [email protected] (T.A.-W.); [email protected] (N.A.) 2 Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Cairo University, Kasr El-Aini Street, Cairo 11562, Egypt; [email protected] 3 Department of Pharmaceutical Chemistry, Faculty of Pharmacy, New Giza University, Newgiza, km 22 Cairo–Alexandria Desert Road, Cairo 12577, Egypt 4 Department of Biochemistry, Faculty of Pharmacy, Egyptian Russian University, Badr City, Cairo 11829, Egypt; [email protected] 5 Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Al-Azhar University, Cairo 11651, Egypt; [email protected] 6 Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Kafrelsheikh University, Kafrelsheikh 33516, Egypt 7 Department of Applied Organic Chemistry, National Research Center, Dokki, Giza 12622, Egypt; [email protected] 8 Department of Pharmaceutical Chemistry, Pharmacy Program, Batterejee Medical College, Jeddah 6231, Saudi Arabia 9 Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Ain Shams University, Abbassia, Cairo 11566, Egypt * Correspondence: [email protected] (W.M.E.); [email protected] (G.H.A.) Academic Editor: Sandra Gemma Received: 3 April 2020; Accepted: 23 April 2020; Published: 27 April 2020 Abstract: On account of their overexpression in a wide range of human malignancies, cyclin-dependent kinases (CDKs) are among the most validated cancer targets, and their inhibition has been featured as a valuable strategy for anticancer drug discovery. -
Supplementary Data
SUPPLEMENTARY DATA A cyclin D1-dependent transcriptional program predicts clinical outcome in mantle cell lymphoma Santiago Demajo et al. 1 SUPPLEMENTARY DATA INDEX Supplementary Methods p. 3 Supplementary References p. 8 Supplementary Tables (S1 to S5) p. 9 Supplementary Figures (S1 to S15) p. 17 2 SUPPLEMENTARY METHODS Western blot, immunoprecipitation, and qRT-PCR Western blot (WB) analysis was performed as previously described (1), using cyclin D1 (Santa Cruz Biotechnology, sc-753, RRID:AB_2070433) and tubulin (Sigma-Aldrich, T5168, RRID:AB_477579) antibodies. Co-immunoprecipitation assays were performed as described before (2), using cyclin D1 antibody (Santa Cruz Biotechnology, sc-8396, RRID:AB_627344) or control IgG (Santa Cruz Biotechnology, sc-2025, RRID:AB_737182) followed by protein G- magnetic beads (Invitrogen) incubation and elution with Glycine 100mM pH=2.5. Co-IP experiments were performed within five weeks after cell thawing. Cyclin D1 (Santa Cruz Biotechnology, sc-753), E2F4 (Bethyl, A302-134A, RRID:AB_1720353), FOXM1 (Santa Cruz Biotechnology, sc-502, RRID:AB_631523), and CBP (Santa Cruz Biotechnology, sc-7300, RRID:AB_626817) antibodies were used for WB detection. In figure 1A and supplementary figure S2A, the same blot was probed with cyclin D1 and tubulin antibodies by cutting the membrane. In figure 2H, cyclin D1 and CBP blots correspond to the same membrane while E2F4 and FOXM1 blots correspond to an independent membrane. Image acquisition was performed with ImageQuant LAS 4000 mini (GE Healthcare). Image processing and quantification were performed with Multi Gauge software (Fujifilm). For qRT-PCR analysis, cDNA was generated from 1 µg RNA with qScript cDNA Synthesis kit (Quantabio). qRT–PCR reaction was performed using SYBR green (Roche).