DOCSLIB.ORG

Plk4 Regulates Cell Motility Through Arhgef1 and Rho Gtpase Activation

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Plk4 Regulates Cell Motility Through Arhgef1 and Rho Gtpase Activation Plk4 Regulates Cell Motility through Arhgef1 and Rho GTPase Activation by Olga Brashavitskaya A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Department of Laboratory Medicine and Pathobiology University of Toronto © Copyright by Olga Brashavitskaya 2019 Plk4 Regulates Cell Motility through Arhgef1 and Rho GTPase Activation Olga Brashavitskaya Doctor of Philosophy Department of Laboratory Medicine and Pathobiology University of Toronto 2019 Abstract Cell migration is a fundamental process essential for embryogenesis, immune cell function and maintenance of homeostasis. It is driven primarily by polymerization of the actin cytoskeleton, which is regulated by a family of small Rho GTPases. Rho GTPases Rac1 and Cdc42 are known as the major regulators of actin polymerization and RhoA is mostly thought of as the regulator of actin stress fiber formation and actomyosin contraction. Rho GTPases are activated by GEFs and deactivated by GAPs. Polo-like kinase 4 (Plk4) is well-acknowledged as the master regulator of centriole duplication. Nevertheless, our laboratory has shown that Plk4 activates RhoA during cytokinesis to ensure proper cleavage furrow positioning. We also identified a novel role for Plk4 in regulation of spreading, migration and invasion of normal and cancer cells. However, the mechanisms through which Plk4 regulates these processes are not completely understood. I hypothesized that Plk4 regulates the activation of RhoA and possibly other Rho GTPases to indice cell migration and spreading. In support of this hypothesis, I show here that Plk4 acts as an activator of Rho GTPases RhoA and Rac1 in cycling cells. I also identify 12 GEFs that possess Plk4 consensus phosphorylation motif and show that Plk4 physically interacts with the GEFs Arhgef1 and P-Rex2. Plk4 functionally interacted with Arhgef1 to affect cell migration, showing at least partial dependence of Plk4 migration phenotype on Arhgef1. Further delineation of their interaction showed that Plk4 binds the DH/PH domains and phosphorylates the L- ii DH/PH fragment of Arhgef1, and that Plk4 enhances Arhgef1 GEF activity. Finally, I show that Plk4 is not likely to activate Arhgef1-RhoA pathway to enhance cell spreading but may act through P-Rex2-Rac1. These results identify a novel mechanism through which Plk4 regulates cell migration. Plk4 has emerged as a potential oncogene, promoter of tumour progression and metastasis formation, prompting the creation of Plk4 inhibitors for therapeutic purposes. The data presented here deepen our understanding of the pathways that may be affected by the Plk4- targeted therapy. iii Acknowledgments I would like to thank my supervisor Dr. Carol Swallow, for her continuous support, guidance, patience and for taking a chance on me when I first applied to the lab as a fourth-year undergraduate student. Carol, your high expectations and encouragement have made me strive for and achieve my best in the lab and in life. Your kindness, sense of humour and compassion has created a truly wonderful and supportive environment in the lab. Throughout my future career I will aim to achieve the highest level of professionalism, integrity and scientific curiosity that you have always demonstrated. I will measure my work by your standards and always ask myself: “Would Carol approve?” before finalizing a draft. I am honoured to have you as my role model and you are the best mentor that anyone could ask for. A sincere thank you for guiding me, believing in me and supporting me all these years. A special thank you to Dr. Jim Dennis for thought-provoking scientific discussions and providing direction and support throughout my studies. Your love for science is truly inspiring and admirable. I would also like to extend my sincere gratitude to the members of my advisory committee, Dr. Katalin Szaszi and Dr. Jim Rutka. Thank you for always finding the time in your busy schedules to give me guidance, timely and valuable advice, continued encouragement and support. Thank you to Dr. Szaszi and her lab for sharing your technical expertise that has been invaluable in my studies. My experience in the lab would have never been the same, without the wonderful past and present members of the Swallow and Dennis labs, who have become my teachers and friends. In particular, I would like to thank Dr. Rosario for teaching me and supporting my scientific endeavours from the very beginning. Thank you to Dr. Karineh Kazazian, Dr. Wendy Johnston, Dr. Yosr Haffani, Dr. Anita Johswich, Dr. Ryan Williams, Dr. Francis Zih, Dr. David Berger- Richardson, Karina Pacholczyk, Judy Pawling, Aldis Krizus, Dr. Shelly Luu, Roland Xu, Michelle Lee and Alexandra Chirila, your support and encouragement mean the world to me. I would like to express my profound gratitude to my family, who have always been there for me, without you none of this would ever be possible. Mama and papa thank you for sacrificing so much to give me the best opportunities in life and for supporting me in all my decisions. Lena, you are more than my big sister, you are my best friend for life. Through thin and thick, I know you’ll always have my back and it gives me the strength and courage to shoot for the stars. A huge thank you to my boyfriend, Alex (a.k.a. Dr. Falkenhagen) for your care, understanding, humour and unconditional love and support. I have this degree to thank for meeting you and you to thank for getting to the end of this degree. I could not have dreamed of a better person to share this journey with, I love you. Finally, I would like to thank my friends, especially Polina, Maria and Sasha who kept me sane throughout the years and brought the life into my life/study/work balance. iv Contributions The author performed all experiments described in this thesis with the following contributions: Dr. Karineh Kazazian: made the shPlk4, shLuciferase and U2OS T-REx YFP-Plk4 stable cell lines used in the experiments in this thesis; made the Plk4 truncation fragments used in the experiments described in figure 4.7 and 4.8a. Created figure 6.1 from the author’s data. Qinghong Dan (under supervision of Dr. Katalin Szaszi): performed the active Arhgef1 pulldowns described in figure 4.9. v Table of Contents Table of Contents Acknowledgments.......................................................................................................................... iv Contributions....................................................................................................................................v Table of Contents ........................................................................................................................... vi List of Tables ................................................................................................................................. xi List of Figures ............................................................................................................................... xii List of Abbreviations ................................................................................................................... xiv Chapter 1 ..........................................................................................................................................1 Introduction .................................................................................................................................1 1.1 Family of Polo-like kinases .................................................................................................1 1.1.1 Plk1 ..........................................................................................................................3 1.1.2 Plk2, 3 and 5 ............................................................................................................4 1.1.3 Plk4 regulation and structure ...................................................................................5 1.1.4 Plk4 in cell cycle ......................................................................................................8 1.1.5 Plk4 in centrosome duplication ................................................................................8 1.1.6 Plk4 in cell motility, invasion and spreading .........................................................12 1.1.7 Plk4 in carcinogenesis and cancer progression ......................................................13 1.2 Cell Migration ....................................................................................................................21 1.2.1 Individual cell migration ........................................................................................22 1.2.2 Collective cell migration ........................................................................................32 1.3 Rho GTPases ......................................................................................................................35 1.3.1 Rho GTPase structure and guanine nucleotide switch regulation .........................38 1.3.2 Rho GTPase signaling in cell motility ...................................................................40 1.3.3 Rho GTPases in cell spreading and cell shape.......................................................50 vi 1.3.4 Rho GTPases in cancer ..........................................................................................54 1.4 GEFs for Rho GTPases ......................................................................................................57 1.4.1 GEFs structure .......................................................................................................57
Load more

Recommended publications
  • Deregulated Gene Expression Pathways in Myelodysplastic Syndrome Hematopoietic Stem Cells
    Leukemia (2010) 24, 756–764 & 2010 Macmillan Publishers Limited All rights reserved 0887-6924/10 $32.00 www.nature.com/leu ORIGINAL ARTICLE Deregulated gene expression pathways in myelodysplastic syndrome hematopoietic stem cells A Pellagatti1, M Cazzola2, A Giagounidis3, J Perry1, L Malcovati2, MG Della Porta2,MJa¨dersten4, S Killick5, A Verma6, CJ Norbury7, E Hellstro¨m-Lindberg4, JS Wainscoat1 and J Boultwood1 1LRF Molecular Haematology Unit, NDCLS, John Radcliffe Hospital, Oxford, UK; 2Department of Hematology Oncology, University of Pavia Medical School, Fondazione IRCCS Policlinico San Matteo, Pavia, Italy; 3Medizinische Klinik II, St Johannes Hospital, Duisburg, Germany; 4Division of Hematology, Department of Medicine, Karolinska Institutet, Stockholm, Sweden; 5Department of Haematology, Royal Bournemouth Hospital, Bournemouth, UK; 6Albert Einstein College of Medicine, Bronx, NY, USA and 7Sir William Dunn School of Pathology, University of Oxford, Oxford, UK To gain insight into the molecular pathogenesis of the the World Health Organization.6,7 Patients with refractory myelodysplastic syndromes (MDS), we performed global gene anemia (RA) with or without ringed sideroblasts, according to expression profiling and pathway analysis on the hemato- poietic stem cells (HSC) of 183 MDS patients as compared with the the French–American–British classification, were subdivided HSC of 17 healthy controls. The most significantly deregulated based on the presence or absence of multilineage dysplasia. In pathways in MDS include interferon signaling, thrombopoietin addition, patients with RA with excess blasts (RAEB) were signaling and the Wnt pathways. Among the most signifi- subdivided into two categories, RAEB1 and RAEB2, based on the cantly deregulated gene pathways in early MDS are immuno- percentage of bone marrow blasts.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Use of the Polo-Like Kinase 4 (PLK4) Inhibitor Centrinone to Investigate Intracellular Signaling Networks Using SILAC-Based Phos
    bioRxiv preprint doi: https://doi.org/10.1101/2020.05.22.110767; this version posted May 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Use of the Polo-like kinase 4 (PLK4) inhibitor centrinone to 2 investigate intracellular signaling networks using SILAC-based 3 phosphoproteomics 4 Dominic P Byrne1#, Christopher J Clarke1,2#, Philip J Brownridge2, Anton Kalyuzhnyy1, 5 3, Simon Perkins1, 3, Amy Campbell1,2, David Mason4, Andrew R Jones1, 3, Patrick A 6 Eyers1* and Claire E Eyers1,2* 7 1 Department of Biochemistry and Systems Biology, Institute of Systems, Molecular & 8 Integrative Biology, University of Liverpool, L69 7ZB, UK. 9 2 Centre for Proteome Research, Department of Biochemistry and Systems Biology, 10 Institute of Systems, Molecular & Integrative Biology, University of Liverpool, L69 7ZB, 11 UK. 12 13 3 Computational Biology Facility, Department of Biochemistry and Systems Biology, 14 Institute of Systems, Molecular & Integrative Biology, University of Liverpool, L69 7ZB, 15 UK. 16 17 4 Centre for Cell Imaging, Department of Biochemistry and Systems Biology, Institute 18 of Systems, Molecular & Integrative Biology, University of Liverpool, L69 7ZB, UK. 19 20 # Equal contribution 21 *Correspondence to CEE ([email protected]) and PAE 22 ([email protected]) 23 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.05.22.110767; this version posted May 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • PLK4, Active (SRP5315)
    PLK4, active, GST-tagged, human Ò PRECISIO Kinase recombinant, expressed in Sf9 cells Catalog Number SRP5315 Storage Temperature –70 °C Synonyms: SAK, STK18 Figure 1. SDS-PAGE Gel of Typical Lot: Product Description ³70% (SDS-PAGE, densitometry) PLK4 or polo-like kinase 4 is a member of the polo family of serine/threonine protein kinases, which localizes to centrioles, the complex microtubule-based structures found in centrosomes, and regulates centriole duplication during the cell cycle. The overexpression of PLK4 triggered the simultaneous formation of multiple procentrioles around each preexisting centriole, which results in centriole amplification and thus, PLK4-induced centriole biogenesis in human cells.1 The reduced PLK4 gene dosage increases the probability of mitotic errors and cancer development.2 Figure 2. Specific Activity of Typical Lot: Recombinant human PLK4 (1-836) was expressed by 4.5–6.7 nmole/min/mg baculovirus in Sf9 insect cells using an N-terminal GST-tag. The PLK4 gene accession number is NM_014264. It is supplied in 50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 10 mM glutathione, 0.1 mM EDTA, 0.25 mM DTT, 0.1 mM PMSF, and 25% glycerol. Molecular mass: ~140 kDa Precautions and Disclaimer This product is for R&D use only, not for drug, household, or other uses. Please consult the Material Safety Data Sheet for information regarding hazards Procedure and safe handling practices. Preparation Instructions Kinase Assay Buffer – 25 mM MOPS, pH 7. 2, 12.5 mM Storage/Stability glycerol 2-phosphate, 25 mM MgC12, 5 mM EGTA, and The product ships on dry ice and storage at –70 °C is 2 mM EDTA.
    [Show full text]
  • Synthesis, Biological Evaluation and in Silico Studies of Certain Oxindole–Indole Conjugates As Anticancer CDK Inhibitors
    molecules Article Synthesis, Biological Evaluation and In Silico Studies of Certain Oxindole–Indole Conjugates as Anticancer CDK Inhibitors Tarfah Al-Warhi 1, Ahmed M. El Kerdawy 2,3 , Nada Aljaeed 1, Omnia E. Ismael 4, Rezk R. Ayyad 5, Wagdy M. Eldehna 6,* , Hatem A. Abdel-Aziz 7 and Ghada H. Al-Ansary 8,9,* 1 Department of Chemistry, College of Science, Princess Nourah bint Abdulrahman University, Riyadh 12271, Saudi Arabia; [email protected] (T.A.-W.); [email protected] (N.A.) 2 Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Cairo University, Kasr El-Aini Street, Cairo 11562, Egypt; [email protected] 3 Department of Pharmaceutical Chemistry, Faculty of Pharmacy, New Giza University, Newgiza, km 22 Cairo–Alexandria Desert Road, Cairo 12577, Egypt 4 Department of Biochemistry, Faculty of Pharmacy, Egyptian Russian University, Badr City, Cairo 11829, Egypt; [email protected] 5 Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Al-Azhar University, Cairo 11651, Egypt; [email protected] 6 Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Kafrelsheikh University, Kafrelsheikh 33516, Egypt 7 Department of Applied Organic Chemistry, National Research Center, Dokki, Giza 12622, Egypt; [email protected] 8 Department of Pharmaceutical Chemistry, Pharmacy Program, Batterejee Medical College, Jeddah 6231, Saudi Arabia 9 Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Ain Shams University, Abbassia, Cairo 11566, Egypt * Correspondence: [email protected] (W.M.E.); [email protected] (G.H.A.) Academic Editor: Sandra Gemma Received: 3 April 2020; Accepted: 23 April 2020; Published: 27 April 2020 Abstract: On account of their overexpression in a wide range of human malignancies, cyclin-dependent kinases (CDKs) are among the most validated cancer targets, and their inhibition has been featured as a valuable strategy for anticancer drug discovery.
    [Show full text]
  • Centrosome Impairment Causes DNA Replication Stress Through MLK3
    bioRxiv preprint doi: https://doi.org/10.1101/2020.01.09.898684; this version posted January 10, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Centrosome impairment causes DNA replication stress through MLK3/MK2 signaling and R-loop formation Zainab Tayeh 1, Kim Stegmann 1, Antonia Kleeberg 1, Mascha Friedrich 1, Josephine Ann Mun Yee Choo 1, Bernd Wollnik 2, and Matthias Dobbelstein 1* 1) Institute of Molecular Oncology, Göttingen Center of Molecular Biosciences (GZMB), University Medical Center Göttingen, Göttingen, Germany 2) Institute of Human Genetics, University Medical Center Göttingen, Göttingen, Germany *Lead Contact. Correspondence and requests for materials should be addressed to M. D. (e-mail: [email protected]; ORCID 0000-0001-5052-3967) Running title: Centrosome integrity supports DNA replication Key words: Centrosome, CEP152, CCP110, SASS6, CEP152, Polo-like kinase 4 (PLK4), DNA replication, DNA fiber assays, R-loops, MLK3, MK2 alias MAPKAPK2, Seckel syndrome, microcephaly. Highlights: • Centrosome defects cause replication stress independent of mitosis. • MLK3, p38 and MK2 (alias MAPKAPK2) are signalling between centrosome defects and DNA replication stress through R-loop formation. • Patient-derived cells with defective centrosomes display replication stress, whereas inhibition of MK2 restores their DNA replication fork progression and proliferation. 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.01.09.898684; this version posted January 10, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Plk4 Is Required for Cytokinesis and Maintenance of Chromosomal Stability
    Plk4 is required for cytokinesis and maintenance of chromosomal stability Carla O. Rosarioa,b, Michael A. Koa,c,d,1, Yosr Z. Haffania,1, Rebecca A. Gladdya,c,d, Jana Paderovae, Aaron Pollettb, Jeremy A. Squiree, James W. Dennisa,b,f, and Carol J. Swallowa,b,c,d,2 aSamuel Lunenfeld Research Institute, Mount Sinai Hospital, Toronto, ON M5G 1X5, Canada; bDepartment of Laboratory Medicine and Pathobiology, cDepartment of Surgery, dInstitute of Medical Science, and fDepartment of Molecular Genetics, University of Toronto, Toronto, ON M5S 1A1, Canada; and eDepartment of Pathology and Molecular Medicine, Queen’s University, Kingston, ON K7L 3N6, Canada Edited by David Pellman, Dana-Farber Cancer Institute, Boston, MA, and accepted by the Editorial Board February 16, 2010 (received for review September 25, 2009) Aneuploidy is a characteristic feature of established cancers and dumbbell-shaped cells with anaphase bridges, indicating that can promote tumor development. Aneuploidy may arise directly, Plk4 is also required in late mitosis, possibly at telophase (8). − through unequal distribution of chromosomes into daughter cells, Plk4+/ embryos develop normally, but adult mice display a 16- or indirectly, through a tetraploid intermediate. The polo family fold increase in the incidence of spontaneous hepatomas com- kinase Plk4/Sak is required for late mitotic progression and is pared with Plk4+/+ littermates. The wild-type Plk4 allele was haploinsufficient for tumor suppression in mice. Here we show retained in the liver tumors, indicating that Plk4 is a hap- that loss of heterozygosity (LOH) occurs at the Plk4 locus in 50% of loinsufficient tumor suppressor (9). Cell cycle progression was − human hepatocellular carcinomas (HCC) and is present even in impaired in regenerating Plk4+/ liver with a ≈6-h delay in M preneoplastic cirrhotic liver nodules.
    [Show full text]
  • Centriole Overduplication Is the Predominant Mechanism Leading to Centrosome Amplification in Melanoma
    Published OnlineFirst January 12, 2018; DOI: 10.1158/1541-7786.MCR-17-0197 Oncogenes and Tumor Suppressors Molecular Cancer Research Centriole Overduplication is the Predominant Mechanism Leading to Centrosome Amplification in Melanoma Ryan A. Denu1,2, Maria Shabbir3, Minakshi Nihal3, Chandra K. Singh3, B. Jack Longley3,4,5, Mark E. Burkard2,4, and Nihal Ahmad3,4,5 Abstract Centrosome amplification (CA) is common in cancer and can evaluated. PLK4 is significantly overexpressed in melanoma com- arise by centriole overduplication or by cell doubling events, pared with benign nevi and in a panel of human melanoma cell including the failure of cell division and cell–cell fusion. To assess lines (A375, Hs294T, G361, WM35, WM115, 451Lu, and SK-MEL- the relative contributions of these two mechanisms, the number of 28) compared with normal human melanocytes. Interestingly, centrosomes with mature/mother centrioles was examined by although PLK4 expression did not correlate with CA in most cases, immunofluorescence in a tissue microarray of human melanomas treatment of melanoma cells with a selective small-molecule PLK4 and benign nevi (n ¼ 79 and 17, respectively). The centrosomal inhibitor (centrinone B) significantly decreased cell proliferation. protein 170 (CEP170) was used to identify centrosomes with The antiproliferative effects of centrinone B were also accompa- mature centrioles; this is expected to be present in most centro- nied by induction of apoptosis. somes with cell doubling, but on fewer centrosomes with over- duplication. Using this method, it was determined that the major- Implications: This study demonstrates that centriole overdupli- ity of CA in melanoma can be attributed to centriole overduplica- cation is the predominant mechanism leading to centrosome tion rather than cell doubling events.
    [Show full text]
  • The Use of Phosphoproteomic Data to Identify Altered Kinases and Signaling Pathways in Cancer
    The use of phosphoproteomic data to identify altered kinases and signaling pathways in cancer By Sara Renee Savage Thesis Submitted to the Faculty of the Graduate School of Vanderbilt University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE in Biomedical Informatics August 10, 2018 Nashville, Tennessee Approved: Bing Zhang, Ph.D. Carlos Lopez, Ph.D. Qi Liu, Ph.D. ACKNOWLEDGEMENTS The work presented in this thesis would not have been possible without the funding provided by the NLM training grant (T15-LM007450) and the support of the Biomedical Informatics department at Vanderbilt. I am particularly indebted to Rischelle Jenkins, who helped me solve all administrative issues. Furthermore, this work is the result of a collaboration between all members of the Zhang lab and the larger CPTAC consortium. I would like to thank the other CPTAC centers for processing the data, and Chen Huang and Suhas Vasaikar in the Zhang lab for analyzing the colon cancer copy number and proteomic data, respectively. All members of the Zhang lab have been extremely helpful in answering any questions I had and offering suggestions on my work. Finally, I would like to acknowledge my mentor, Bing Zhang. I am extremely grateful for his guidance and for giving me the opportunity to work on these projects. ii TABLE OF CONTENTS Page ACKNOWLEDGEMENTS ................................................................................................ ii LIST OF TABLES............................................................................................................
    [Show full text]
  • PRLR and PLK4 Are Promising Druggable Targets for Treating
    Sequence and Pathway analysis PRLR and PLK4 are promising druggable targets for treating Parkinson Disease that control activity of HSF2, POU2F1 and RAD21 transcription factors on promoters of differentially expressed genes Demo User geneXplain GmbH [email protected] Data received on 02/07/2020 ; Run on 27/10/2020 ; Report generated on 28/10/2020 Genome Enhancer release 2.2 (TRANSFAC®, TRANSPATH® and HumanPSD™ release 2020.3) Abstract In the present study we applied the software package "Genome Enhancer" to a data set that contains transcriptomics data. The study is done in the context of Parkinson Disease. The goal of this pipeline is to identify potential drug targets in the molecular network that governs the studied pathological process. In the first step of analysis pipeline discovers transcription factors (TFs) that regulate genes activities in the pathological state. The activities of these TFs are controlled by so- called master regulators, which are identified in the second step of analysis. After a subsequent druggability checkup, the most promising master regulators are chosen as potential drug targets for the analyzed pathology. At the end the pipeline comes up with (a) a list of known drugs and (b) investigational active chemical compounds with the potential to interact with selected drug targets. From the data set analyzed in this study, we found the following TFs to be potentially involved in the regulation of the differentially expressed genes: HSF2, POU2F1, AR, RAD21 and ESR2. The subsequent network analysis suggested Caspase-8 integrins nek10:Raf-1{pS338}:MEK1{pS218}{pS222} plk4 prlr:tec:Vav Caspase-8 as the most promising molecular targets for further research, drug development and drug repurposing initiatives on the basis of identified molecular mechanism of the studied pathology.
    [Show full text]
  • Androgen Receptor
    RALTITREXED Dihydrofolate reductase BORTEZOMIB IsocitrateCannabinoid dehydrogenase CB1EPIRUBICIN receptor HYDROCHLORIDE [NADP] cytoplasmic VINCRISTINE SULFATE Hypoxia-inducible factor 1 alpha DOXORUBICINAtaxin-2 HYDROCHLORIDENIFENAZONEFOLIC ACID PYRIMETHAMINECellular tumor antigen p53 Muscleblind-likeThyroidVINBURNINEVINBLASTINETRIFLURIDINE protein stimulating 1 DEQUALINIUM SULFATEhormone receptor CHLORIDE Menin/Histone-lysine N-methyltransferasePHENELZINE MLLLANATOSIDE SULFATE C MELATONINDAUNORUBICINBETAMETHASONEGlucagon-like HYDROCHLORIDEEndonuclease peptide 4 1 receptor NICLOSAMIDEDIGITOXINIRINOTECAN HYDROCHLORIDE HYDRATE BISACODYL METHOTREXATEPaired boxAZITHROMYCIN protein Pax-8 ATPase family AAA domain-containing proteinLIPOIC 5 ACID, ALPHA Nuclear receptorCLADRIBINEDIGOXIN ROR-gammaTRIAMTERENE CARMUSTINEEndoplasmic reticulum-associatedFLUOROURACIL amyloid beta-peptide-binding protein OXYPHENBUTAZONEORLISTAT IDARUBICIN HYDROCHLORIDE 6-phospho-1-fructokinaseHeat shockSIMVASTATIN protein beta-1 TOPOTECAN HYDROCHLORIDE AZACITIDINEBloom syndromeNITAZOXANIDE protein Huntingtin Human immunodeficiency virus typeTIPRANAVIR 1 protease VitaminCOLCHICINE D receptorVITAMIN E FLOXURIDINE TAR DNA-binding protein 43 BROMOCRIPTINE MESYLATEPACLITAXEL CARFILZOMIBAnthrax lethalFlap factorendonucleasePrelamin-A/C 1 CYTARABINE Vasopressin V2 receptor AMITRIPTYLINEMicrotubule-associated HYDROCHLORIDERetinoidTRIMETHOPRIM proteinMothers X receptor tau against alpha decapentaplegic homolog 3 Histone-lysine N-methyltransferase-PODOFILOX H3 lysine-9OXYQUINOLINE
    [Show full text]
  • The Curing AI for Precision Medicine
    The Curing AI for Precision Medicine Hoifung Poon 1 Medicine Today Is Imprecise Top 20 drugs 80% non-responders Wasted 1/3 health spending $750 billion / year 2 Disruption 1: Big Data 2009 2013: 40% 93% 3 Disruption 2: Pay-for-Performance Goal: 75% by 2020 4 Vemurafenib on BRAF-V600 Melanoma Before Treatment 15 Weeks 5 Vemurafenib on BRAF-V600 Melanoma Before Treatment 15 Weeks 23 Weeks 6 Why We Haven’t Solved Precision Medicine? … ATTCGGATATTTAAGGC … … ATTCGGGTATTTAAGCC … … ATTCGGATATTTAAGGC … … ATTCGGGTATTTAAGCC … … ATTCGGATATTTAAGGC … … ATTCGGGTATTTAAGCC … High-Throughput Data Discovery Bottleneck #1: Knowledge Bottleneck #2: Reasoning AI is the key to overcome these bottlenecks 7 Use Case: Molecular Tumor Board 8 www.ucsf.edu/news/2014/11/120451/bridging-gap-precision-medicine Use Case: Molecular Tumor Board Problem: Hard to scale U.S. 2015: 1.6 million new cases, 600K deaths 902 cancer hospitals Memorial Sloan Kettering 2016: Sequence: Tens of thousand Board can review: A few hundred Wanted: Decision support for cancer precision medicine 9 First-Generation Molecular Tumor Board Knowledge bottleneck E.g., given a tumor sequence, determine: What genes and mutations are important What drugs might be applicable Can do manually but hard to scale 10 Next-Generation Molecular Tumor Board Reasoning bottleneck E.g., personalize drug combinations Can’t do manually, ever 11 Big Medical Data Decision Support Precision Medicine Machine Predict Reading Drug Combo 12 13 PubMed 26 millions abstracts Two new abstracts every minute Adds over one million every year 14 Machine Reading PMID: 123 … VDR+ binds to SMAD3 to form … PMID: 456 Knowledge … JUN expression Base is induced by SMAD3/4 … …… 15 Machine Reading Involvement of p70(S6)-kinase activation in IL-10 up-regulation in human monocytes by gp41 envelope protein of human immunodeficiency virus type 1 ..
    [Show full text]