DOCSLIB.ORG

Mazama Gouazoubira)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mazama Gouazoubira) UNIVERSIDADE ESTADUAL DO CEARÁ FACULDADE DE VETERINÁRIA PROGRAMA DE PÓS-GRADUAÇÃO EM CIÊNCIAS VETERINÁRIAS MESTRADO ACADÊMICO EM CIÊNCIAS VETERINÁRIAS DUANNY MURINELLY DE SOUZA CUNHA CARACTERIZAÇÃO SEMINAL E ULTRASSONOGRÁFICA TESTICULAR DE VEADOS-CATINGUEIROS (Mazama gouazoubira) FORTALEZA – CEARÁ 2019 1 DUANNY MURINELLY DE SOUZA CUNHA CARACTERIZAÇÃO SEMINAL E ULTRASSONOGRÁFICA TESTICULAR DE VEADOS-CATINGUEIROS (Mazama gouazoubira) Dissertação apresentada ao Curso de Mestrado Acadêmico em Ciências Veterinárias do programa de Pós-Graduação em Ciências Veterinárias da Universidade Estadual do Ceará, como requisito parcial para a obtenção do título de Mestre em Ciências Veterinárias. Área de Concentração: Reprodução e Sanidade Animal. Orientador: Prof. Dr. Dárcio Ítalo Alves Teixeira. FORTALEZA – CEARÁ 2019 2 3 4 Dedico aos meus pais, que sempre me incentivaram aos estudos, meu noivo, pelo apoio de sempre, e aos animais do estudo. 5 AGRADECIMENTOS A meus pais, Genna e Hernani, por sempre me incentivarem a estudar, não medirem esforços para que tivesse a melhor educação fora e dentro de casa e sempre acreditarem em mim. Ao meu noivo Vitor por sempre ouvir minhas reclamações e dúvidas e acreditar em mim. Aos amigos Maressa, Leonardo, Vilemar, Samara e Fabi pelo apoio, pela ajuda durante várias etapas desses 2 anos e pelos momentos de diversão que aliviaram os estresses desse período. À Bruna, especialmente, que me ensinou tudo de análise seminal, me ajudou com a metodologia do projeto, parceira de experimentos, desabafos, caronas e muito mais. À Mírley por me ensinar ultrassonografia, por sempre ajudar e orientar meu trabalho (mesmo de longe, às vezes) e por todo incentivo durante esses 2 anos. Ao professor Dárcio, que me acolheu com um trabalho em animais selvagens, pela ajuda, orientação e a incansável busca por recursos financeiros, cada vez mais escassos. Aos membros do LADIAR pela solicitude no experimento, conversas leves e encorajamento. Ao Leandro e Samuel pela disponibilidade de contribuir para o projeto e boa vontade em realizar os manejos. Às intituições Ecopoint e Haras Claro por contribuírem com os animais e suas dependências. Ao Herlon, Thalles, Vítor pelo apoio e ajuda no trabalho e por tornarem as viagens de carro mais divertidas, sempre com histórias para contar. Ao prof. Nunes (LTSCO) e à profª Lúcia (LRC) por disponibilizarem dependências de seus laboratórios e equipamentos para realização do experimento. Ao PPGCV e à UECE pela oportunidade de realizar o curso. Ao órgão de fomento à pesquisa FUNCAP (Fundação Cearense de Apoio ao Desenvolvimento Científico e Tecnológico), agência financiadora que tornou possível a realização desse trabalho. 6 RESUMO Em diversas espécies, é reconhecida a importância de técnicas de avaliação da saúde reprodutiva dos machos. Na espécie Mazama gouazoubira, há poucos estudos sobre reprodução. Neste contexto, a avaliação seminal e ultrassonográfica aparecem como importantes ferramentas para analisar o potencial fecundante do macho. Portanto, o objetivo do presente trabalho foi caracterizar a ultrassonografia bidimensional e Doppler testicular e os parâmetros de qualidade seminal, morfometria e ultraestrutura espérmaticas em machos adultos de M. gouazoubira. Foi coletado o sêmen de machos adultos de M. gouazoubira por eletroejaculação (n = 8 ejaculados) e avaliado em cor, aspecto, pH, volume, motilidades total e progressiva, turbilhonamento, vigor, viabilidade, morfologia, morfometria, funcionalidade da membrana, atividade mitocondrial e concentração. Uma alíquota foi separada para análise por microscopia eletrônica de transmissão (MET) e varredura (MEV). Foram mensurados circunferência escrotal e volume testicular. Testículos e epidídimos foram avaliados por ultrassonografia modo B e artéria supratesticular por Triplex Doppler. As imagens bidimensionais foram submetidas à análise computadorizada pelo software ImageJ para determinação do valor numérico de pixels (VNP) e heterogeneidade de pixels (desvio padrão do VNP - DPNP). Baseado na qualidade seminal, os animais foram divididos em 2 grupos (F+ com boa qualidade e F- com baixa qualidade). Os parâmetros de sêmen in natura foram comparados entre três animais diferentes (P < 0,05). Circunferência escrotal, volume testicular, VNP, DPNP e parâmetros de Doppler foram comparados entre os grupos F+ e F- (P < 0,05). Parâmetros de tamanho testicular e de ultrassonografia foram correlacionados (P < 0,05). Experimento 1: Houve diferença entre os indivíduos em relação a funcionalidade de membrana, morfologia e morfometria espermáticas. Os defeitos mais frequentes foram cauda enrolada e peça intermediária encurvada. A análise por MEV demonstraram estruturas perceptíveis apenas por esta técnica, como segmento sub-equatorial e banda serrilhada. A análise por MET revelou características das organelas e composição celular, como a presença de 60 espirais mitocondriais. Experimento 2: O grupo F+ obteve maiores valores de circunferência escrotal, volume testicular, VNP e DPNP testiculares (corte transversal). Não houve diferença entre os grupos nos parâmetros dopplervelociméricos. Houve correlações significativas e positivas entre tamanho testicular (circunferência escrotal e volume testicular) e parâmetros ultrassonográficos (VNP e DPNP testiculares). É possível concluir que diferentes tipos de análise seminal carcaterizam o potencial fértil dos machos de M. gouazoubira. Além disso, as diferenças entre 7 os grupos estão possivelmente ligadas a um desequilíbrio na espermatogênese, sem comprometer o fluxo sanguíneo da artéria supratesticular. Palavras-chaves: Reprodução. Cervidae. Ultrassom. Biotécnicas seminais. 8 ABSTRACT In multiple species, male breeding soundness evaluation is acknowledged as important techniques. In Mazama gouazoubira, there are few studies on reproduction. So, considering semen and ultrasound evaluation can be an important tool to analyze male fertility potential. This study aims to evaluate fresh semen and to measure scrotal circumference, testicular volume, B mode, and spectral Doppler ultrasound parameters in M. gouazoubira. Semen from adult males was collected using electroejaculation (n = 8 ejaculates) and evaluated based on color, aspect, pH, volume, total and progressive motility, mass movement, vigor, viability, morphology, morphometry, membrane integrity, mitochondrial activity and concentration. One aliquot was used for scanning (SEM) and transmission electron microscopy (TEM). Scrotal circumference and testicular volume measured. Testes and epididymis were evaluated using B mode ultrasound and testicular artery blood flow, using Triplex Doppler ultrasound. B mode images were subjected to computerized analysis using ImageJ, generating numerical pixel value (NPV) and pixel heterogeneity (NPV standard deviation – PSD). The males were divided in two groups (F+ with good seminal quality and F- with poor seminal quality). Fresh semen parameters were compared amongst three males (P < 0,05). Scrotal circumference, testicular volume, NPV, PSD and Doppler parameters were compared between F+ and F- group (P < 0,05). Testicular size and ultrasound parameters were subjected to correlation test (P < 0,05). Experiment 1: There was difference among males regarding membrane integrity, morphology and morphometry. The most frequent defects were simple bent tail and bowed midpiece. Structures only notable using SEM were observed, such as subequatorial segment and serrated band. TEM revealed organelle characteristics and cell composition, for instance the presence of 60 mitochondria spirals. Experiment 2: F+ group had higher scrotal circumference, testicular volume and testes NPV and PSD (cross-sectional view). No difference between the groups was observed in dopplervelocimetric parameters. There were positive significant correlations between testis size (scrotal circumference and testicular volume) and ultrasound parameters (testes NPV and PSD). Thus, different types of semen analysis help in characterizing fertile potential of M. gouazoubira males. Also, the differences between groups are possibly associated to an imbalance on spermatogenesis that does not compromise supratesticular artery blood flow. Keywords: Reproduction. Cervidae. Ultrasound. Semen analysis. 9 LISTA DE ILUSTRAÇÕES Revisão de literatura Figura 1 - Machos de veados-catingueiros..................................................... 20 Figura 2 - Radiografia contrastada no corte lateral de testículo direito de touro, mostrando a distribuição da artéria testicular. a – cabeça do epidídimo; b – corpo do epidídimo; c – cauda do epidídimo; 6 – Pars marginalis (da a. testicular); 7- ramos laterais da pars marginalis; 9 – túnica arteriosa testicular; 10 – ramos parenquimatosos................................................................. 23 Quadro 1 - Biometria testicular de cervídeos Mazama gouazoubira..................................................................................... 22 Capítulo 1 Figure 1 - Photomicrography of gray brocket deer (Mazama gouazoubira) sperm on eosin-nigrosin smears at 1000X magnification. (A): Normal sperm in morphological evaluation. (B): Narrow at base head with proximal droplet (arrow). (C): Short and broad head with proximal droplet (arrow). (D) Detached acrosome and simple bent tail (arrow). (E): Bowed midpiece (arrow). (F): Broken tail (left) and simple bent tail (right). (G): Strongly coiled tail (arrow). (H): Detached normal head. Scale bar = 10 µm……………………………….……………... 57 Figure 2 - Electron microphotography of gray brocket deer
Load more

Recommended publications
  • Line Transect Surveys Underdetect Terrestrial Mammals: Implications for the Sustainability of Subsistence Hunting
    RESEARCH ARTICLE Line Transect Surveys Underdetect Terrestrial Mammals: Implications for the Sustainability of Subsistence Hunting José M. V. Fragoso1☯¤*, Taal Levi2‡, Luiz F. B. Oliveira3‡, Jeffrey B. Luzar4‡, Han Overman5‡, Jane M. Read6‡, Kirsten M. Silvius7☯ 1 Stanford University, Stanford, CA, 94305–5020, United States of America, 2 Department of Fisheries and Wildlife, Oregon State University, Corvallis, OR, United States of America, 3 Departamento de Vertebrados, Museu Nacional, UFRJ, RJ, 20.940–040, Brazil, 4 Stanford University, Stanford, CA, 94305–5020, United States of America, 5 Environmental and Forest Biology, State University of New York-College of Environmental Science and Forestry, Syracuse, NY, 13210, United States of America, 6 Geography Department, Syracuse University, Syracuse, NY, 13244, United States of America, 7 Department of Forest Resources and Environmental Conservation, Virginia Tech, Blacksburg, VA, United States of America ☯ These authors contributed equally to this work. ¤ Current address: Biodiversity Science and Sustainability, California Academy of Sciences, San Francisco, California, United States of America OPEN ACCESS ‡ These authors contributed subsets of effort equally to this work. * [email protected] Citation: Fragoso JMV, Levi T, Oliveira LFB, Luzar JB, Overman H, Read JM, et al. (2016) Line Transect Surveys Underdetect Terrestrial Mammals: Implications for the Sustainability of Subsistence Abstract Hunting. PLoS ONE 11(4): e0152659. doi:10.1371/ journal.pone.0152659 Conservation of Neotropical game species must take into account the livelihood and food Editor: Mathew S. Crowther, University of Sydney, security needs of local human populations. Hunting management decisions should there- AUSTRALIA fore rely on abundance and distribution data that are as representative as possible of true Received: January 19, 2016 population sizes and dynamics.
    [Show full text]
  • Sexual Selection and Extinction in Deer Saloume Bazyan
    Sexual selection and extinction in deer Saloume Bazyan Degree project in biology, Master of science (2 years), 2013 Examensarbete i biologi 30 hp till masterexamen, 2013 Biology Education Centre and Ecology and Genetics, Uppsala University Supervisor: Jacob Höglund External opponent: Masahito Tsuboi Content Abstract..............................................................................................................................................II Introduction..........................................................................................................................................1 Sexual selection........................................................................................................................1 − Male-male competition...................................................................................................2 − Female choice.................................................................................................................2 − Sexual conflict.................................................................................................................3 Secondary sexual trait and mating system. .............................................................................3 Intensity of sexual selection......................................................................................................5 Goal and scope.....................................................................................................................................6 Methods................................................................................................................................................8
    [Show full text]
  • Online Resources Supplemental Material Supplementary Information
    Hystrix (2019) — online resources Supplemental Material Supplementary Information Phylogeny and diversity of moose (Alces alces, Cervidae, Mammalia) revealed by complete mitochondrial genomes M. Świsłocka, M. Matosiuk, M. Ratkiewicz, A. Borkowska, M. Czajkowska, P. Mackiewicz Table S1: List of primer pairs used for PCR and sequencing of mitogenomes in Alces alces. Primer Primer sequence Position Tm [℃] Product [bp] Genes Primer source 12S-FW GGTAAATCTCGTGCCAGCCA 00295 57.3 712 <12s_rRNA> Fajardo et al., 2007† 12S-REV TCCAGTATGCTTACCTTGTTACGAC 01007 56.2 00871c_F TGCTTAGTTGAATTAGGCAATG 00872 51.3 1176 <12s_rRNA...tRNA-Val...16s_rRNA> Matosiuk et al., 2014‡ 02052c_R AGAGAACAAGTGATTATGCTACC 02048 52.2 01950c_F ACCTCCAGCATAACTAGTATTGG 01945 53.7 1455 <16s_rRNA...tRNA-Leu...ND1> Matosiuk et al., 2014‡ 03402c_R AATGGTCCTGCTGCATACTCTA 03400 55.2 03140c_F CTACGAGCAGTAGCTCAAACA 03138 54.1 1025 <ND1...tRNA-Ile...tRNA-Gln...tRNA-Met...ND2> Matosiuk et al., 2014‡ 04165c_R ACAGTTCATTGGCCTGAAAATA 04163 52.5 3910a_F CCTTCCCGTACTAATAAACC 03894 50.0 1519 <tRNA-Met...ND2...tRNA-Trp...tRNA-Ala...> This study 4300a_F2 TCATCAGGCCTAATTCTACT 04279 - <tRNA-Asn...tRNA-Cys...tRNA-Tyr...COX1> 5430a_R TATGCCTGCTCARGCACCAA 05413 56.0 COX1_F TCAGCCATTTTACCTATGTTCA 05315 51.7 826 <tRNA-Tyr...COX1> GenBank§ COX1_R ATRTAGCCAAARGGTTCTTTTT 06141 48.5 06060a_F TCTTTGGACACCCCGAAGTA 06039 55.2 991 <COX1...tRNA-Ser...tRNA-Asp...COX2> This study 07050a_R ATGGGGTAAGCCATATGAGG 07030 53.8 06090a_F TCGTAACATACTACTCAGGG 06099 50.2 1503 <COX1...tRNA-Ser...tRNA-Asp...COX2> This study
    [Show full text]
  • Canada, Decembre 2008 Library and Bibliotheque Et 1*1 Archives Canada Archives Canada Published Heritage Direction Du Branch Patrimoine De I'edition
    ORGANISATION SOCIALE, DYNAMIQUE DE POPULATION, ET CONSERVATION DU CERF HUEMUL (HIPPOCAMELUS BISULCUS) DANS LA PATAGONIE DU CHILI par Paulo Corti these presente au Departement de biologie en vue de l'obtention du grade de docteur es sciences (Ph.D.) FACULTE DES SCIENCES UNIVERSITE DE SHERBROOKE Sherbrooke, Quebec, Canada, decembre 2008 Library and Bibliotheque et 1*1 Archives Canada Archives Canada Published Heritage Direction du Branch Patrimoine de I'edition 395 Wellington Street 395, rue Wellington Ottawa ON K1A0N4 Ottawa ON K1A0N4 Canada Canada Your file Votre reference ISBN: 978-0-494-48538-5 Our file Notre reference ISBN: 978-0-494-48538-5 NOTICE: AVIS: The author has granted a non­ L'auteur a accorde une licence non exclusive exclusive license allowing Library permettant a la Bibliotheque et Archives and Archives Canada to reproduce, Canada de reproduire, publier, archiver, publish, archive, preserve, conserve, sauvegarder, conserver, transmettre au public communicate to the public by par telecommunication ou par Plntemet, prefer, telecommunication or on the Internet, distribuer et vendre des theses partout dans loan, distribute and sell theses le monde, a des fins commerciales ou autres, worldwide, for commercial or non­ sur support microforme, papier, electronique commercial purposes, in microform, et/ou autres formats. paper, electronic and/or any other formats. The author retains copyright L'auteur conserve la propriete du droit d'auteur ownership and moral rights in et des droits moraux qui protege cette these. this thesis. Neither the thesis Ni la these ni des extraits substantiels de nor substantial extracts from it celle-ci ne doivent etre imprimes ou autrement may be printed or otherwise reproduits sans son autorisation.
    [Show full text]
  • Asymmetry and Karyotypic Relationships of Cervidae (Artiodactyla) Taxa
    Punjab University Journal of Zoology 36(1): 71-79 (2021) https://dx.doi.org/10.17582/journal.pujz/2021.36.1.71.79 Research Article Karyotype Symmetry/ Asymmetry and Karyotypic Relationships of Cervidae (Artiodactyla) Taxa Halil Erhan Eroğlu Department of Biology, Faculty of Science and Art, Yozgat Bozok University, Yozgat, Turkey. Article History Received: February 26, 2019 Abstract | Karyotype asymmetry is one of the most widely used approaches in cytotaxonomic Revised: May 03, 2021 studies. The symmetry/asymmetry index (S/AI) is used to determine karyotype asymmetry in Accepted: May 18, 2021 higher animals and humans. The formula designed by the number of chromosome types is Published: June 13, 2021 S/AI = (1 × M) + (2 × SM) + (3 × A) + (4 × T) / 2n. The S/AI value varies from 1.0000 (full symmetric) to 4.0000 (full asymmetric). After a detailed literature review, the chromosomal Keywords data of 36 female species and 32 male species of family Cervidae were detected, namely (i) Artiodactyla, Cervidae, Kary- karyotype formulae, (ii) symmetry/asymmetry index values (iii) karyotype types. According otype, Phylogeny, Symmetry/ asymmetry index to the chromosomal data, two phylogenetic trees were formed. The phylogenetic trees were showed karyotypic relationships among the taxa. Novelty Statement | This is the first report on karyotype asymmetry of Cervidae. Karyotypic relationships are useful to infer processes of evolution and speciation. Karyotype asymmetry is an important parameter that helps to establish phylogenetic relationships among various species. To cite this article: Eroğlu, H.E., 2021. Karyotype symmetry/ asymmetry and karyotypic relationships of cervidae (Artiodactyla) taxa. Punjab Univ. J. Zool., 36(1): 71-79.
    [Show full text]
  • S1 Appendixtable: the Species, Their Biomass and Number Collected from May 2007 to June 2010 in 23 Villages of the Rupununi
    S1 AppendixTable: The species, their biomass and number collected from May 2007 to June 2010 in 23 villages of the Rupununi, Guyana. Rank Rank % % Total Total Estimated Ind. Ind. Weight No. Source Taxa Biomass Ind. Biomass Ind. Biomass No. Ind. weight (kg) Reference Lowland tapir (Tapirus terrestris) 1 14 28.18 2.04 42,750 171 250 56 White-lipped peccary (Tayassu pecari) 2 3 17.09 10.82 25,927 908 28.5 57 White-tailed deer (Odocoileus virginianus) 3 7 11.71 5.29 17,760 444 40 56 Collared peccary (Pecari tajacu) 4 4 9.02 9.31 13,681 781 17.52 58 Red brocket deer (Mazama americana) 5 8 7.53 5.22 11,426 438 26.1 56 Paca 6 2 6.14 13.48 9,308 1131 8.23 56 (Cuniculus paca) Capybara (Hydrochoerus hydrochaeris) 7 13 3.76 2.16 5,702 181 31.5 56 Rred footed tortoise (Geochelone carbonaria) 8 6 1.85 5.59 2,809 469 5.99 59 Feral pig (Sus scrofa) 9 23 1.68 0.41 2,550 34 75 59 Agouti (Dasyprocta leporina) 10 1 1.59 13.53 2,418 1135 2.13 60 Long nosed armadillo (Dasypus kappleri) 11 10 1.55 2.94 2,346 247 9.5 59 Nine-banded armadillo (Dasypus novemcinctus) 12 5 1.25 6.38 1,896 536 3.54 59 Feral cow (Bos taurus) 13 44 1.19 0.04 1,800 3 600 59 Jaguar (Panthera onca) 14 29 1.09 0.26 1,650 22 75 59 Yellow footed tortoise 15 9 1.06 3.26 1,608 273 5.88 59 (Geochelone denticulate) Spectacled caiman (Caiman crocodilus) 16 24 0.87 0.39 1,320 33 40 59 Amazonian brown brocket deer (Mazama nemorivaga) 17 17 0.80 0.84 1,050 70 18 61 Giant river turtle (Podocnemis expansa) 18 31 0.61 0.24 920 20 46 59 Feral water buffalo (Bubalus bubalis) 19 46 0.59 0.01 900 1 900 59 Dwarf caiman (Paleosuchus spp.) 20 16 0.49 1.28 749 107 7 59 Giant armadillo (Priodontes maximus) 21 30 0.45 0.25 677 21 32.5 59 Black Curassow (Crax alector) 22 11 0.44 2.57 670 216 3.1 59 Anaconda Eunectes sp.
    [Show full text]
  • List of Taxa for Which MIL Has Images
    LIST OF 27 ORDERS, 163 FAMILIES, 887 GENERA, AND 2064 SPECIES IN MAMMAL IMAGES LIBRARY 31 JULY 2021 AFROSORICIDA (9 genera, 12 species) CHRYSOCHLORIDAE - golden moles 1. Amblysomus hottentotus - Hottentot Golden Mole 2. Chrysospalax villosus - Rough-haired Golden Mole 3. Eremitalpa granti - Grant’s Golden Mole TENRECIDAE - tenrecs 1. Echinops telfairi - Lesser Hedgehog Tenrec 2. Hemicentetes semispinosus - Lowland Streaked Tenrec 3. Microgale cf. longicaudata - Lesser Long-tailed Shrew Tenrec 4. Microgale cowani - Cowan’s Shrew Tenrec 5. Microgale mergulus - Web-footed Tenrec 6. Nesogale cf. talazaci - Talazac’s Shrew Tenrec 7. Nesogale dobsoni - Dobson’s Shrew Tenrec 8. Setifer setosus - Greater Hedgehog Tenrec 9. Tenrec ecaudatus - Tailless Tenrec ARTIODACTYLA (127 genera, 308 species) ANTILOCAPRIDAE - pronghorns Antilocapra americana - Pronghorn BALAENIDAE - bowheads and right whales 1. Balaena mysticetus – Bowhead Whale 2. Eubalaena australis - Southern Right Whale 3. Eubalaena glacialis – North Atlantic Right Whale 4. Eubalaena japonica - North Pacific Right Whale BALAENOPTERIDAE -rorqual whales 1. Balaenoptera acutorostrata – Common Minke Whale 2. Balaenoptera borealis - Sei Whale 3. Balaenoptera brydei – Bryde’s Whale 4. Balaenoptera musculus - Blue Whale 5. Balaenoptera physalus - Fin Whale 6. Balaenoptera ricei - Rice’s Whale 7. Eschrichtius robustus - Gray Whale 8. Megaptera novaeangliae - Humpback Whale BOVIDAE (54 genera) - cattle, sheep, goats, and antelopes 1. Addax nasomaculatus - Addax 2. Aepyceros melampus - Common Impala 3. Aepyceros petersi - Black-faced Impala 4. Alcelaphus caama - Red Hartebeest 5. Alcelaphus cokii - Kongoni (Coke’s Hartebeest) 6. Alcelaphus lelwel - Lelwel Hartebeest 7. Alcelaphus swaynei - Swayne’s Hartebeest 8. Ammelaphus australis - Southern Lesser Kudu 9. Ammelaphus imberbis - Northern Lesser Kudu 10. Ammodorcas clarkei - Dibatag 11. Ammotragus lervia - Aoudad (Barbary Sheep) 12.
    [Show full text]
  • Galindohuaman Dj Dr Jabo.Pdf (2.376Mb)
    UNIVERSIDADE ESTADUAL PAULISTA “JÚLIO DE MESQUITA FILHO” FACULDADE DE CIÊNCIAS AGRÁRIAS E VETERINÁRIAS CÂMPUS DE JABOTICABAL SEGREGAÇÃO GAMÉTICA DE CROMOSSOMOS ENVOLVIDOS EM TRANSLOCAÇÕES E SEU PAPEL NO ISOLAMENTO REPRODUTIVO DE ESPÉCIES DO GÊNERO Mazama (MAMMALIA; CERVIDAE) David Javier Galindo Huamán Médico Veterinário 2021 UNIVERSIDADE ESTADUAL PAULISTA “JÚLIO DE MESQUITA FILHO” FACULDADE DE CIÊNCIAS AGRÁRIAS E VETERINÁRIAS CÂMPUS DE JABOTICABAL SEGREGAÇÃO GAMÉTICA DE CROMOSSOMOS ENVOLVIDOS EM TRANSLOCAÇÕES E SEU PAPEL NO ISOLAMENTO REPRODUTIVO DE ESPÉCIES DO GÊNERO Mazama (MAMMALIA; CERVIDAE) David Javier Galindo Huamán Orientador: Prof. Dr. José Maurício Barbanti Duarte Tese apresentada à Faculdade de Ciências Agrárias e Veterinárias – Unesp, Câmpus de Jaboticabal, como parte das exigências para a obtenção do título de Doutor em Medicina Veterinária, área Reprodução Animal. 2021 DADOS CURRICUALRES DO AUTOR DAVID JAVIER GALINDO HUAMÁN – Nascido em 18 de fevereiro de 1989, na cidade de Jesús María, Lima, Lima, Peru. Ingressou no curso de graduação em Medicina Veterinária na Universidade Nacional Maior de São Marcos (FMV-UNMSM), em março de 2007; onde participou em diversos grupo de estudos como o “Taller de Biotecnología Reproductiva” (TBR, 2009-2012) e o “Taller de Etología Animal” (TEA, 2010-2012), além de ser membro de órgãos de representação estudantil como o “Centro Federado de Estudiantes” (CEF) em 2009 e o “Consejo de Facultad” (com direito a bolsa) em 2010; concluiu curso superior em Medicina Veterinária em novembro de 2012.
    [Show full text]
  • Satellite DNA in Neotropical Deer Species
    G C A T T A C G G C A T genes Article Satellite DNA in Neotropical Deer Species Miluse Vozdova 1,* , Svatava Kubickova 1, Natália Martínková 2 , David Javier Galindo 3 , Agda Maria Bernegossi 3 , Halina Cernohorska 1, Dita Kadlcikova 1 , Petra Musilová 1 , Jose Mauricio Duarte 3 and Jiri Rubes 1 1 Department of Genetics and Reproductive Biotechnologies, Central European Institute of Technology—Veterinary Research Institute, Hudcova 70, 621 00 Brno, Czech Republic; [email protected] (S.K.); [email protected] (H.C.); [email protected] (D.K.); [email protected] (P.M.); [email protected] (J.R.) 2 Institute of Vertebrate Biology, Czech Academy of Sciences, Kvetna 8, 603 65 Brno, Czech Republic; [email protected] 3 Deer Research and Conservation Center (NUPECCE), School of Agricultural and Veterinarian Sciences, São Paulo State University (Unesp), 14884-900 Jaboticabal, Brazil; [email protected] (D.J.G.); [email protected] (A.M.B.); [email protected] (J.M.D.) * Correspondence: [email protected]; Tel.: +4205-3333-1422 Abstract: The taxonomy and phylogenetics of Neotropical deer have been mostly based on morpho- logical criteria and needs a critical revision on the basis of new molecular and cytogenetic markers. In this study, we used the variation in the sequence, copy number, and chromosome localization of satellite I-IV DNA to evaluate evolutionary relationships among eight Neotropical deer species. Using FISH with satI-IV probes derived from Mazama gouazoubira, we proved the presence of satellite DNA blocks in peri/centromeric regions of all analyzed deer. Satellite DNA was also detected in the interstitial chromosome regions of species of the genus Mazama with highly reduced chromosome numbers.
    [Show full text]
  • Chile, Bolivia and Peru, 2019
    Tripreport Chile, Bolivia and Peru June 18th till September 18th 2019 Lennart Verheuvel Shutterednature.com Contact: [email protected] Tripreport Chile, Bolivia, Peru (June 18th till September 18th 2019) I always had the plan to go on a big trip when I would finish my studies and after much thinking and planning I decided to go to South-America. I wanted to work on my cat goals but also to work on my Spanish and see some nice birds of course. Mammalwise it was a bit ups and downs. It went very well in the first two weeks but after that things went a bit downhill. Mammalwatching.com was a big help in planning the trip. I will post more photos on my website www.shutterednature.com also with more background stories so for anyone who is interested, go to my website! General comments This section might not interest people so much who already have travelled to South-America, but I just wanted to put some things out there. Language I wouldn’t go do a trip in South-America without knowing a single word of Spanish. Honestly, it’s not that hard and some words are very useful. In all the hostels I’ve slept in only a few of the staff spoke a reasonable amount of English. You will probably be all right, but things will be so much easier if you know just a few words. Also comes in handy when you get arrested in the middle of the night… Transport Planes: I’ve taken about four regular flights in Chile and then another one in Bolivia and one in Peru.
    [Show full text]
  • B Chromosomes in Populations of Mammals Revisited
    G C A T T A C G G C A T genes Review B Chromosomes in Populations of Mammals Revisited Mladen Vujoševi´c* , Marija Rajiˇci´c and Jelena Blagojevi´c Institute for Biological Research “Siniša Stankovi´c”,Department of Genetic Research, University of Belgrade, Bulevar despota Stefana 142, Belgrade 11060, Serbia; [email protected] (M.R.); [email protected] (J.B.) * Correspondence: [email protected] Received: 29 August 2018; Accepted: 3 October 2018; Published: 9 October 2018 Abstract: The study of B chromosomes (Bs) started more than a century ago, while their presence in mammals dates since 1965. As the past two decades have seen huge progress in application of molecular techniques, we decided to throw a glance on new data on Bs in mammals and to review them. We listed 85 mammals with Bs that make 1.94% of karyotypically studied species. Contrary to general view, a typical B chromosome in mammals appears both as sub- or metacentric that is the same size as small chromosomes of standard complement. Both karyotypically stable and unstable species possess Bs. The presence of Bs in certain species influences the cell division, the degree of recombination, the development, a number of quantitative characteristics, the host-parasite interactions and their behaviour. There is at least some data on molecular structure of Bs recorded in nearly a quarter of species. Nevertheless, a more detailed molecular composition of Bs presently known for six mammalian species, confirms the presence of protein coding genes, and the transcriptional activity for some of them.
    [Show full text]
  • When Roads Appear Jaguars Decline: Increased Access to an Amazonian Wilderness Area Reduces Potential for Jaguar Conservation
    RESEARCH ARTICLE When roads appear jaguars decline: Increased access to an Amazonian wilderness area reduces potential for jaguar conservation Santiago Espinosa1,2*, Gerardo Celis3, Lyn C. Branch4* 1 Facultad de Ciencias, Universidad AutoÂnoma de San Luis PotosõÂ, San Luis PotosõÂ, San Luis PotosõÂ, a1111111111 MeÂxico, 2 Escuela de Ciencias BioloÂgicas, Pontificia Universidad CatoÂlica del Ecuador, Quito, Pichincha, Ecuador, 3 Center for Ecosystem Science and Society, Northern Arizona University, Flagstaff, Arizona, a1111111111 United States of America, 4 Department of Wildlife Ecology and Conservation, University of Florida, a1111111111 Gainesville, Florida, United States of America a1111111111 a1111111111 * [email protected] (SE); [email protected] (LCB) Abstract OPEN ACCESS Roads are a main threat to biodiversity conservation in the Amazon, in part, because roads Citation: Espinosa S, Celis G, Branch LC (2018) increase access for hunters. We examine how increased landscape access by hunters may When roads appear jaguars decline: Increased lead to cascading effects that influence the prey community and abundance of the jaguar access to an Amazonian wilderness area reduces (Panthera onca), the top Amazonian terrestrial predator. Understanding such ecological potential for jaguar conservation. PLoS ONE 13(1): e0189740. https://doi.org/10.1371/journal. effects originating from anthropogenic actions is essential for conservation and manage- pone.0189740 ment of wildlife populations in areas undergoing infrastructure development. Our study was Editor: Marco Apollonio, Universita degli Studi di conducted in YasunõÂ Biosphere Reserve, the protected area with highest potential for jaguar Sassari, ITALY conservation in Ecuador, and an area both threatened by road development and inhabited Received: July 7, 2017 by indigenous groups dependent upon bushmeat.
    [Show full text]