When Roads Appear Jaguars Decline: Increased Access to an Amazonian Wilderness Area Reduces Potential for Jaguar Conservation
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Line Transect Surveys Underdetect Terrestrial Mammals: Implications for the Sustainability of Subsistence Hunting
RESEARCH ARTICLE Line Transect Surveys Underdetect Terrestrial Mammals: Implications for the Sustainability of Subsistence Hunting José M. V. Fragoso1☯¤*, Taal Levi2‡, Luiz F. B. Oliveira3‡, Jeffrey B. Luzar4‡, Han Overman5‡, Jane M. Read6‡, Kirsten M. Silvius7☯ 1 Stanford University, Stanford, CA, 94305–5020, United States of America, 2 Department of Fisheries and Wildlife, Oregon State University, Corvallis, OR, United States of America, 3 Departamento de Vertebrados, Museu Nacional, UFRJ, RJ, 20.940–040, Brazil, 4 Stanford University, Stanford, CA, 94305–5020, United States of America, 5 Environmental and Forest Biology, State University of New York-College of Environmental Science and Forestry, Syracuse, NY, 13210, United States of America, 6 Geography Department, Syracuse University, Syracuse, NY, 13244, United States of America, 7 Department of Forest Resources and Environmental Conservation, Virginia Tech, Blacksburg, VA, United States of America ☯ These authors contributed equally to this work. ¤ Current address: Biodiversity Science and Sustainability, California Academy of Sciences, San Francisco, California, United States of America OPEN ACCESS ‡ These authors contributed subsets of effort equally to this work. * [email protected] Citation: Fragoso JMV, Levi T, Oliveira LFB, Luzar JB, Overman H, Read JM, et al. (2016) Line Transect Surveys Underdetect Terrestrial Mammals: Implications for the Sustainability of Subsistence Abstract Hunting. PLoS ONE 11(4): e0152659. doi:10.1371/ journal.pone.0152659 Conservation of Neotropical game species must take into account the livelihood and food Editor: Mathew S. Crowther, University of Sydney, security needs of local human populations. Hunting management decisions should there- AUSTRALIA fore rely on abundance and distribution data that are as representative as possible of true Received: January 19, 2016 population sizes and dynamics. -
Matses Indian Rainforest Habitat Classification and Mammalian Diversity in Amazonian Peru
Journal of Ethnobiology 20(1): 1-36 Summer 2000 MATSES INDIAN RAINFOREST HABITAT CLASSIFICATION AND MAMMALIAN DIVERSITY IN AMAZONIAN PERU DAVID W. FLECK! Department ofEveilltioll, Ecology, alld Organismal Biology Tile Ohio State University Columbus, Ohio 43210-1293 JOHN D. HARDER Oepartmeut ofEvolution, Ecology, and Organismnl Biology Tile Ohio State University Columbus, Ohio 43210-1293 ABSTRACT.- The Matses Indians of northeastern Peru recognize 47 named rainforest habitat types within the G61vez River drainage basin. By combining named vegetative and geomorphological habitat designations, the Matses can distinguish 178 rainforest habitat types. The biological basis of their habitat classification system was evaluated by documenting vegetative ch<lracteristics and mammalian species composition by plot sampling, trapping, and hunting in habitats near the Matses village of Nuevo San Juan. Highly significant (p<:O.OOI) differences in measured vegetation structure parameters were found among 16 sampled Matses-recognized habitat types. Homogeneity of the distribution of palm species (n=20) over the 16 sampled habitat types was rejected. Captures of small mammals in 10 Matses-rc<:ognized habitats revealed a non-random distribution in species of marsupials (n=6) and small rodents (n=13). Mammal sighlings and signs recorded while hunting with the Matses suggest that some species of mammals have a sufficiently strong preference for certain habitat types so as to make hunting more efficient by concentrating search effort for these species in specific habitat types. Differences in vegetation structure, palm species composition, and occurrence of small mammals demonstrate the ecological relevance of Matses-rccognized habitat types. Key words: Amazonia, habitat classification, mammals, Matses, rainforest. RESUMEN.- Los nalivos Matslis del nordeste del Peru reconacen 47 tipos de habitats de bosque lluvioso dentro de la cuenca del rio Galvez. -
Sexual Selection and Extinction in Deer Saloume Bazyan
Sexual selection and extinction in deer Saloume Bazyan Degree project in biology, Master of science (2 years), 2013 Examensarbete i biologi 30 hp till masterexamen, 2013 Biology Education Centre and Ecology and Genetics, Uppsala University Supervisor: Jacob Höglund External opponent: Masahito Tsuboi Content Abstract..............................................................................................................................................II Introduction..........................................................................................................................................1 Sexual selection........................................................................................................................1 − Male-male competition...................................................................................................2 − Female choice.................................................................................................................2 − Sexual conflict.................................................................................................................3 Secondary sexual trait and mating system. .............................................................................3 Intensity of sexual selection......................................................................................................5 Goal and scope.....................................................................................................................................6 Methods................................................................................................................................................8 -
Online Resources Supplemental Material Supplementary Information
Hystrix (2019) — online resources Supplemental Material Supplementary Information Phylogeny and diversity of moose (Alces alces, Cervidae, Mammalia) revealed by complete mitochondrial genomes M. Świsłocka, M. Matosiuk, M. Ratkiewicz, A. Borkowska, M. Czajkowska, P. Mackiewicz Table S1: List of primer pairs used for PCR and sequencing of mitogenomes in Alces alces. Primer Primer sequence Position Tm [℃] Product [bp] Genes Primer source 12S-FW GGTAAATCTCGTGCCAGCCA 00295 57.3 712 <12s_rRNA> Fajardo et al., 2007† 12S-REV TCCAGTATGCTTACCTTGTTACGAC 01007 56.2 00871c_F TGCTTAGTTGAATTAGGCAATG 00872 51.3 1176 <12s_rRNA...tRNA-Val...16s_rRNA> Matosiuk et al., 2014‡ 02052c_R AGAGAACAAGTGATTATGCTACC 02048 52.2 01950c_F ACCTCCAGCATAACTAGTATTGG 01945 53.7 1455 <16s_rRNA...tRNA-Leu...ND1> Matosiuk et al., 2014‡ 03402c_R AATGGTCCTGCTGCATACTCTA 03400 55.2 03140c_F CTACGAGCAGTAGCTCAAACA 03138 54.1 1025 <ND1...tRNA-Ile...tRNA-Gln...tRNA-Met...ND2> Matosiuk et al., 2014‡ 04165c_R ACAGTTCATTGGCCTGAAAATA 04163 52.5 3910a_F CCTTCCCGTACTAATAAACC 03894 50.0 1519 <tRNA-Met...ND2...tRNA-Trp...tRNA-Ala...> This study 4300a_F2 TCATCAGGCCTAATTCTACT 04279 - <tRNA-Asn...tRNA-Cys...tRNA-Tyr...COX1> 5430a_R TATGCCTGCTCARGCACCAA 05413 56.0 COX1_F TCAGCCATTTTACCTATGTTCA 05315 51.7 826 <tRNA-Tyr...COX1> GenBank§ COX1_R ATRTAGCCAAARGGTTCTTTTT 06141 48.5 06060a_F TCTTTGGACACCCCGAAGTA 06039 55.2 991 <COX1...tRNA-Ser...tRNA-Asp...COX2> This study 07050a_R ATGGGGTAAGCCATATGAGG 07030 53.8 06090a_F TCGTAACATACTACTCAGGG 06099 50.2 1503 <COX1...tRNA-Ser...tRNA-Asp...COX2> This study -
Counting on Forests and Accounting for Forest Contributions in National
OCCASIONAL PAPER Agouti on the wedding menu Bushmeat harvest, consumption and trade in a post-frontier region of the Ecuadorian Amazon Ian Cummins Miguel Pinedo-Vasquez Alexander Barnard Robert Nasi OCCASIONAL PAPER 138 Agouti on the wedding menu Bushmeat harvest, consumption and trade in a post-frontier region of the Ecuadorian Amazon Ian Cummins Runa Foundation Miguel Pinedo-Vasquez Center for International Forestry Research (CIFOR) Earth Institute Center for Environmental Sustainability (EICES) Alexander Barnard University of California Robert Nasi Center for International Forestry Research (CIFOR) Center for International Forestry Research (CIFOR) Occasional Paper 138 © 2015 Center for International Forestry Research Content in this publication is licensed under a Creative Commons Attribution 4.0 International (CC BY 4.0), http://creativecommons.org/licenses/by/4.0/ ISBN 978-602-387-009-7 DOI: 10.17528/cifor/005730 Cummins I, Pinedo-Vasquez M, Barnard A and Nasi R. 2015. Agouti on the wedding menu: Bushmeat harvest, consumption and trade in a post-frontier region of the Ecuadorian Amazon. Occasional Paper 138. Bogor, Indonesia: CIFOR. Photo by Alonso Pérez Ojeda Del Arco Buying bushmeat for a wedding CIFOR Jl. CIFOR, Situ Gede Bogor Barat 16115 Indonesia T +62 (251) 8622-622 F +62 (251) 8622-100 E [email protected] cifor.org We would like to thank all donors who supported this research through their contributions to the CGIAR Fund. For a list of Fund donors please see: https://www.cgiarfund.org/FundDonors Any views expressed in this publication are those of the authors. They do not necessarily represent the views of CIFOR, the editors, the authors’ institutions, the financial sponsors or the reviewers. -
Canada, Decembre 2008 Library and Bibliotheque Et 1*1 Archives Canada Archives Canada Published Heritage Direction Du Branch Patrimoine De I'edition
ORGANISATION SOCIALE, DYNAMIQUE DE POPULATION, ET CONSERVATION DU CERF HUEMUL (HIPPOCAMELUS BISULCUS) DANS LA PATAGONIE DU CHILI par Paulo Corti these presente au Departement de biologie en vue de l'obtention du grade de docteur es sciences (Ph.D.) FACULTE DES SCIENCES UNIVERSITE DE SHERBROOKE Sherbrooke, Quebec, Canada, decembre 2008 Library and Bibliotheque et 1*1 Archives Canada Archives Canada Published Heritage Direction du Branch Patrimoine de I'edition 395 Wellington Street 395, rue Wellington Ottawa ON K1A0N4 Ottawa ON K1A0N4 Canada Canada Your file Votre reference ISBN: 978-0-494-48538-5 Our file Notre reference ISBN: 978-0-494-48538-5 NOTICE: AVIS: The author has granted a non L'auteur a accorde une licence non exclusive exclusive license allowing Library permettant a la Bibliotheque et Archives and Archives Canada to reproduce, Canada de reproduire, publier, archiver, publish, archive, preserve, conserve, sauvegarder, conserver, transmettre au public communicate to the public by par telecommunication ou par Plntemet, prefer, telecommunication or on the Internet, distribuer et vendre des theses partout dans loan, distribute and sell theses le monde, a des fins commerciales ou autres, worldwide, for commercial or non sur support microforme, papier, electronique commercial purposes, in microform, et/ou autres formats. paper, electronic and/or any other formats. The author retains copyright L'auteur conserve la propriete du droit d'auteur ownership and moral rights in et des droits moraux qui protege cette these. this thesis. Neither the thesis Ni la these ni des extraits substantiels de nor substantial extracts from it celle-ci ne doivent etre imprimes ou autrement may be printed or otherwise reproduits sans son autorisation. -
Instituto Nacional De Pesquisas Da Amazônia – Inpa Programa De Pós-Graduação Em Ecologia
INSTITUTO NACIONAL DE PESQUISAS DA AMAZÔNIA – INPA PROGRAMA DE PÓS-GRADUAÇÃO EM ECOLOGIA USO DE HABITAT E OCORRÊNCIA DE ROEDORES CAVIOMORFOS NA AMAZÔNIA CENTRAL, BRASIL FERNANDA DE ALMEIDA MEIRELLES Manaus, Amazonas Novembro, 2012 1 FERNANDA DE ALMEIDA MEIRELLES USO DE HABITAT E OCORRÊNCIA DE ROEDORES CAVIOMORFOS NA AMAZÔNIA CENTRAL, BRASIL ORIENTADOR: Dr. EDUARDO MARTINS VENTICINQUE Co-orientador: Dr. Torbjørn Haugaasen Dissertação apresentada ao Instituto Nacional de Pesquisas da Amazônia como parte dos requisitos para obtenção do título de Mestre em Biologia (Ecologia). Manaus, Amazonas Novembro, 2012 ii Banca examinadora não-presencial: Dra. Camila Righetto Cassano – Universidade Estadual de Santa Cruz Parecer: Aprovada com correções Dra. Maria Luisa da Silva Pinto Jorge – Universidade Estadual Paulista Júlio Mesquita Filho Parecer: Aprovada com correções Dr. José Manuel Vieria Fragoso – Universidade de Standfor, Califórnia (EUA) Parecer: Aprovada Banca examinadora presencial em 26 de novembro de 2012: Dr. Marcelo Gordo – Universidade Federal do Amazonas Parecer: Aprovada Dr. Paulo Estefano Dineli Bobrowiec – Instituto Nacional de Pesquisas da Amazônia Parecer: Aprovada Dr. Pedro Ivo Simões – Instituto Nacional de Pesquisas da Amazônia Parecer: Aprovada iii Sinopse: Estudei o uso de habitat e o efeito da distribuição de castanhais sobre a ocorrência de pacas, cotias e cutiaras na Reserva de Desenvolvimento Sustentável Piagaçu - Purus. Para isso distribuímos 107 câmeras-trap em locais com e sem exploração de castanha- do-Brasil. As variáveis ambientais, utilizadas como preditoras da ocorrência das espécies, foram medidas em campo ou extraídas de bases geográficas digitais. Os resultados indicam que as três espécies de roedores ocorrem preferencialmente em áreas com alta densidade de drenagem e distantes de comunidades humanas. -
CRL-Rodent Genetics and Genetic Quality Control for Inbred and F1 Hybrid Strains, Part II
CRL-Rodent Genetics and Genetic Quality Control for Inbred and F1 Hybrid Strains, Part II ASK CHARLES RIVER FREQUENTLY ASKED QUESTIONS ON-LINE LITERATURE WHAT'S NEW Previous | Index | Next WINTER 1992 Rodent Genetics and Genetic Quality Control for Inbred and F1 Hybrid Strains, Part II Genetically defined rodent strains with stable, identifiable phenotypes have played a central role in the advances made in biomedical research. Such strains have been developed by selection and inbreeding, as was discussed in the fall 1991 document (Part I of this two-part series). That Bulletin also defined basic genetic terms, introduced the concept of genetic quality control, and reviewed the role of colony management in detection and prevention of subline divergence. This document addresses the important role of genetic monitoring, especially the monitoring of qualitative biochemical and immunological markers. Routine genetic monitoring is necessary to detect genetic contamination, the most important cause of subline divergence. Ideal markers for monitoring display simple Mendelian inheritance. They have a phenotype that is not altered by environmental factors but corresponds to the genotype. Markers should be monitored on chromosomes or linkage groups found throughout the genome. Alleles should be codominant so homozygotes and heterozygotes can be distinguished. Skin Grafting Skin grafting is a classical and still essential technique for characterizing inbred strains. It was developed in the 1950s by Billingham and others to detect histocompatibility differences. As histocompatibility (H) is determined by several hundred H genes found on virtually every chromosome, skin grafting reveals subline divergence due to mutation as well as to genetic contamination. Acceptance of reciprocal skin grafts, or isohistogenicity, indicates that animals are isogeneic. -
Hystrx It. J. Mamm. (Ns) Supp. (2007) V European Congress of Mammalogy
Hystrx It. J. Mamm . (n.s.) Supp. (2007) V European Congress of Mammalogy RODENTS AND LAGOMORPHS 51 Hystrx It. J. Mamm . (n.s.) Supp. (2007) V European Congress of Mammalogy 52 Hystrx It. J. Mamm . (n.s.) Supp. (2007) V European Congress of Mammalogy A COMPARATIVE GEOMETRIC MORPHOMETRIC ANALYSIS OF NON-GEOGRAPHIC VARIATION IN TWO SPECIES OF MURID RODENTS, AETHOMYS INEPTUS FROM SOUTH AFRICA AND ARVICANTHIS NILOTICUS FROM SUDAN EITIMAD H. ABDEL-RAHMAN 1, CHRISTIAN T. CHIMIMBA, PETER J. TAYLOR, GIANCARLO CONTRAFATTO, JENNIFER M. LAMB 1 Sudan Natural History Museum, Faculty of Science, University of Khartoum P. O. Box 321 Khartoum, Sudan Non-geographic morphometric variation particularly at the level of sexual dimorphism and age variation has been extensively documented in many organisms including rodents, and is useful for establishing whether to analyse sexes separately or together and for selecting adult specimens to consider for subsequent data recording and analysis. However, such studies have largely been based on linear measurement-based traditional morphometric analyses that mainly focus on the partitioning of overall size- rather than shape-related morphological variation. Nevertheless, recent advances in unit-free, landmark/outline-based geometric morphometric analyses offer a new tool to assess shape-related morphological variation. In the present study, we used geometric morphometric analysis to comparatively evaluate non-geographic variation in two geographically disparate murid rodent species, Aethmoys ineptus from South Africa and Arvicanthis niloticus from Sudan , the results of which are also compared with previously published results based on traditional morphometric data. Our results show that while the results of the traditional morphometric analyses of both species were congruent, they were not sensitive enough to detect some signals of non-geographic morphological variation. -
The Purus Project Implementation Report a Tropical Forest Conservation Project in Acre, Brazil
The Purus Project Implementation Report A Tropical Forest Conservation Project in Acre, Brazil Prepared by Brian McFarland from: 3 Bethesda Metro Center, Suite 700 Bethesda, Maryland 20814 (240) 247-0630 With significant contributions from: James Eaton, TerraCarbon Normando Sales and Wanderley Rosa, Moura & Rosa Pedro Freitas, Carbon Securities D E D I C A T Ó R I A "A voz é a única arma que atinge a alma." (Chico Mendes) Ao iniciar sua luta mostrando ao mundo uma nova forma de impedir a devastação da floresta, com seus "empates", surgia um novo líder, questionado e combatido por muitos, compreendido por poucos. Passados trinta anos, verifica-se que aqueles empates não foram em vão. Hoje estamos cientes da necessidade de preservarmos mais e melhor, valorizando os Povos da Floresta, verdadeiros guardiões da mata e sua biodiversidade, estes, verdadeiros tesouros passíveis de remuneração e compensação, em busca de um mundo melhor para enfrentar a necessidade de conter o aquecimento global. Parabéns Chico, você não era um visionário: o Projeto Purus é a materialização deste sonho. Page 2 of 143 A Climate, Community and Biodiversity Standard Project Implementation Report TABLE OF CONTENTS TABLE OF CONTENTS ………………………….………………………………..…………… Page 3 COVER PAGE ................................................................................................................................. Page 6 INTRODUCTION ………………………………………………………….…………………….. Page 7 G1. ORIGINAL CONDITIONS IN THE PROJECT AREA 1. General Information ………………………………………….…………….……………………... Page 9 2. Climate Information …………………………………………..…..………….……..…………… Page 11 3. Community Information ……………………………………..………………..…..……………... Page 12 4. Biodiversity Information ………………………………………..…………….…………………. Page 17 G2. BASELINE PROJECTIONS 1. Land Use without Project …………………………………….……………….…………………. Page 25 2. Carbon Stock Exchanges without Project …………………………………….…..……………... Page 26 3. Local Communities without Project …………………………………………..……………….… Page 27 4. Biodiversity without Project ………………………………………………….….…………….… Page 28 G3. -
List of 28 Orders, 129 Families, 598 Genera and 1121 Species in Mammal Images Library 31 December 2013
What the American Society of Mammalogists has in the images library LIST OF 28 ORDERS, 129 FAMILIES, 598 GENERA AND 1121 SPECIES IN MAMMAL IMAGES LIBRARY 31 DECEMBER 2013 AFROSORICIDA (5 genera, 5 species) – golden moles and tenrecs CHRYSOCHLORIDAE - golden moles Chrysospalax villosus - Rough-haired Golden Mole TENRECIDAE - tenrecs 1. Echinops telfairi - Lesser Hedgehog Tenrec 2. Hemicentetes semispinosus – Lowland Streaked Tenrec 3. Microgale dobsoni - Dobson’s Shrew Tenrec 4. Tenrec ecaudatus – Tailless Tenrec ARTIODACTYLA (83 genera, 142 species) – paraxonic (mostly even-toed) ungulates ANTILOCAPRIDAE - pronghorns Antilocapra americana - Pronghorn BOVIDAE (46 genera) - cattle, sheep, goats, and antelopes 1. Addax nasomaculatus - Addax 2. Aepyceros melampus - Impala 3. Alcelaphus buselaphus - Hartebeest 4. Alcelaphus caama – Red Hartebeest 5. Ammotragus lervia - Barbary Sheep 6. Antidorcas marsupialis - Springbok 7. Antilope cervicapra – Blackbuck 8. Beatragus hunter – Hunter’s Hartebeest 9. Bison bison - American Bison 10. Bison bonasus - European Bison 11. Bos frontalis - Gaur 12. Bos javanicus - Banteng 13. Bos taurus -Auroch 14. Boselaphus tragocamelus - Nilgai 15. Bubalus bubalis - Water Buffalo 16. Bubalus depressicornis - Anoa 17. Bubalus quarlesi - Mountain Anoa 18. Budorcas taxicolor - Takin 19. Capra caucasica - Tur 20. Capra falconeri - Markhor 21. Capra hircus - Goat 22. Capra nubiana – Nubian Ibex 23. Capra pyrenaica – Spanish Ibex 24. Capricornis crispus – Japanese Serow 25. Cephalophus jentinki - Jentink's Duiker 26. Cephalophus natalensis – Red Duiker 1 What the American Society of Mammalogists has in the images library 27. Cephalophus niger – Black Duiker 28. Cephalophus rufilatus – Red-flanked Duiker 29. Cephalophus silvicultor - Yellow-backed Duiker 30. Cephalophus zebra - Zebra Duiker 31. Connochaetes gnou - Black Wildebeest 32. Connochaetes taurinus - Blue Wildebeest 33. Damaliscus korrigum – Topi 34. -
Asymmetry and Karyotypic Relationships of Cervidae (Artiodactyla) Taxa
Punjab University Journal of Zoology 36(1): 71-79 (2021) https://dx.doi.org/10.17582/journal.pujz/2021.36.1.71.79 Research Article Karyotype Symmetry/ Asymmetry and Karyotypic Relationships of Cervidae (Artiodactyla) Taxa Halil Erhan Eroğlu Department of Biology, Faculty of Science and Art, Yozgat Bozok University, Yozgat, Turkey. Article History Received: February 26, 2019 Abstract | Karyotype asymmetry is one of the most widely used approaches in cytotaxonomic Revised: May 03, 2021 studies. The symmetry/asymmetry index (S/AI) is used to determine karyotype asymmetry in Accepted: May 18, 2021 higher animals and humans. The formula designed by the number of chromosome types is Published: June 13, 2021 S/AI = (1 × M) + (2 × SM) + (3 × A) + (4 × T) / 2n. The S/AI value varies from 1.0000 (full symmetric) to 4.0000 (full asymmetric). After a detailed literature review, the chromosomal Keywords data of 36 female species and 32 male species of family Cervidae were detected, namely (i) Artiodactyla, Cervidae, Kary- karyotype formulae, (ii) symmetry/asymmetry index values (iii) karyotype types. According otype, Phylogeny, Symmetry/ asymmetry index to the chromosomal data, two phylogenetic trees were formed. The phylogenetic trees were showed karyotypic relationships among the taxa. Novelty Statement | This is the first report on karyotype asymmetry of Cervidae. Karyotypic relationships are useful to infer processes of evolution and speciation. Karyotype asymmetry is an important parameter that helps to establish phylogenetic relationships among various species. To cite this article: Eroğlu, H.E., 2021. Karyotype symmetry/ asymmetry and karyotypic relationships of cervidae (Artiodactyla) taxa. Punjab Univ. J. Zool., 36(1): 71-79.