Parasite Fauna of Wild Antillean Manatees (Trichechus Manatus

Vélez et al. Parasites Vectors (2019) 12:183 https://doi.org/10.1186/s13071-019-3448-1 Parasites & Vectors

RESEARCH Open Access Parasite fauna of wild Antillean manatees (Trichechus manatus manatus) of the Andean Region, Colombia Juan Vélez1,2* , Jörg Hirzmann1, Katerin Arévalo‑González3,4,5, Malin K. Lange1, Anika Seipp6, Ulrich Gärtner6, Anja Taubert1, Susana Caballero3 and Carlos Hermosilla1

Abstract Background: Antillean manatees (Trichechus manatus manatus) are large herbivorous aquatic mammals living in lim‑ ited areas of South, Central and North America. As with other aquatic mammals, Antillean manatees can be infected by a variety of protozoan and metazoan parasites, some of them with zoonotic potential, which afect not only their welfare but also population health status. Therefore, we conducted the frst epidemiological survey in Colombian free-ranging Antillean manatees to estimate their actual gastrointestinal parasite status. Results: In total, 69 faecal samples were collected from free-ranging individual manatees during ecology feld studies in the rivers Carare and San Juan and in two associated wetlands in the Andean region of Colombia. Parasite diversity encompassed six diferent endoparasite species. The highest prevalence was found for protozoan infections with Eimeria nodulosa (47.8%) and Eimeria manatus-like species (type A, B; 43.4%), followed by Entamoeba sp. (14.49%) and Giardia sp. (1.4%) infections. In addition, infections with the trematode Chiorchis fabaceus were detected at a high prevalence (33.3%). Molecular characterization of sirenian Eimeria species led to the distinction of three species, E. nodulosa and two E. manatus-like species (type A, B). Phylogenetic analyses indicated a host-specifc adaptation of sirenian Eimeria species as previously reported for Eimeria species from other mammalian hosts. Conclusions: This study provides the frst record of Antillean manatee infection with Giardia and Entamoeba species in Colombia, representing two important anthropozoonotic parasite genera. This survey should serve as a baseline investigation for future monitoring on parasitic zoonoses in this mammal and encourage for investigations on their impact on both public health and wild manatee welfare. Keywords: Manatees, Trichechus manatus manatus, Eimeria, Phylogeny, Chiorchis, Entamoeba, Giardia

Background Orinoco and the Caribbean basins with the Magdalena Te Antillean manatee (Trichechus manatus manatus) riparian system representing the largest habitat area with is the only sirenis, which ranges from the northeast of the highest capture [1–4]. Te Antillean manatee is listed South America through the Caribbean Sea up to Mexico. as a seriously endangered species in Colombia experienc- It inhabits costal, freshwater fuvial and wetland environ- ing a threatening population decrease according to the ments in Colombia [1, 2]. In contrast to other aquatic/ International Union for the Conservation of the Nature marine mammals, which all exhibit carnivorous/piscivo- (IUCN) [1, 5]. Te latest assessment referred to a popu- rous diets, sirenians are considered as pure herbivorous lation of approximately 500 animals left in these Colom- species. In Colombia, Antillean manatees reside in the bian regions [6]. Tere are several reports highlighting the devastating *Correspondence: [email protected]‑giessen.de impact of anthropogenic and environmental pressure 1 Institute of Parasitology, Biomedical Research Center Seltersberg (BFS), on wild manatee populations due to hunting activities Justus Liebig University Giessen, Schubertstr. 81, 35392 Giessen, Germany Full list of author information is available at the end of the article [1, 2], watercraft collisions [5, 7–11], sewage pollution,

© The Author(s) 2019. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/ publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Vélez et al. Parasites Vectors (2019) 12:183 Page 2 of 9

brevetoxicosis, [12–15], accidental death in fshing nets Results [16] and loss of natural habitats [1]. Unfortunately, the Parasite infections Colombian wild manatee populations are still exposed Overall, 72% (50/69) of Antillean manatees were infected to all these adverse factors and therefore urgently with at least one parasite species (Table 1). In total, six require ongoing national protection measures. Besides diferent gastrointestinal parasite species belonging to the factors mentioned above, parasitoses also have a protozoan and metazoan taxa were diagnosed. Five dif- critical impact on wildlife population health, including ferent protozoan and one metazoan parasitic stages (i.e. that of aquatic mammals [17–20], and data on actual cysts, oocysts and eggs) were detected. Metazoan para- infections are needed to assess environmental risk fac- sites were represented by one trematode species (Chior- tors for endangered species [21]. As such, monitoring chis fabaceus). No stages of cestodes, nematodes or studies will allow gaining an improved knowledge on acanthocephalans were found in manatee faecal samples. pathogen diversity and relevance for manatee welfare, A list of known parasitic stages and respective preva- on a potential spillover of human parasites and on para- lences from manatees is presented in Additional fle 1: site reservoirs [20]. All these aspects are important, not Table S1. In addition, selected illustrations of parasitic only for conservation purposes, but also for the pres- stages are given in Fig. 1. ervation of important ecological dynamics and human Te most prevalent parasitic stages were oocysts of health protection. Eimeria nodulosa (47.8%; Fig. 1b), followed by Eimeria So far, several reports on metazoan and protozoan manatus-like oocysts (43.4%; Fig. 1a), eggs of C. faba- parasites of manatees from diferent geographical regions ceus (33.3%; Fig. 1d) and cysts of Entamoeba sp. (14.5%; have been published [4, 11, 22–28]. Nonetheless, detailed Fig. 1c). One faecal sample proved positive for Giardia knowledge on manatee parasites, i.e. their biology, epide- antigen (1.4%) in coproantigen-ELISA. None of the miology, pathogenesis and immunity, is still limited and identifed parasites revealed as core species (preva- restricted to studies on captive animals or carcasses [4, lence > 50%) and the diplomonadid protozoan Giardia sp. 11, 29]. Consequently, these parasitological reports may was found as component species (prevalence < 10%). Two not necessarily refect true parasite diversity of mana- parasite genera have anthropozoonotic potential, namely tee populations living within their natural habitats. Few Entamoeba and Giardia. investigations have been performed on South American Referring to parasite genus level, the present fndings wild manatee populations due to the elusive behaviour include one new host record on Entamoeba for Antillean of these animals and the turbid waters they inhabit [21, manatees (T. manatus manatus) in South America. In 30, 31]. Overall, the implementation of ‘non-invasive’ addition, giardiasis has not previously been reported to sampling techniques (e.g. by collecting faeces, vomitus, occur in Colombian manatees. expirations), of photographic records in combination Overall, two water-borne parasitic infections (i.e. giar- with sonar-based manatee tracing [32] and of molecu- diasis and entamoebiasis), one gastropod-borne disease lar approaches [21], may not only contribute to improve (chiorchiosis) and two monoxenous infections (coccidi- sampling efcacy but will also change the scope of future osis) were detected in this epidemiological survey. parasitological studies on manatees within natural eco- Morphometric and morphological analyses of coccid- systems. Whilst there are vast amounts of molecular ian oocysts and trematode eggs revealed the following data available for parasites afecting terrestrial mammals, data: E. nodulosa oocysts had a mean size of 12.55 × 11.72 there is still a lack of molecular analyses on parasites (7.0–14.9 × 7.2–13.97) µm and showed characteristic occurring in wild manatees. Currently, sequences from knob-like structures on the surface (Fig. 1b). Scanning only three helminth species of manatees are available electron microscopy (SEM) analyses illustrated these [21, 33]. Te option to identify and characterize parasite diversity via DNA amplifcation from faeces, nasal/ ocular secretions and tissue samples opens a wide range of future tasks that may help to protect this unique Table 1 Prevalence of parasites in wild Antillean manatees (T. manatus manatus) (n 69) from the Carare River, Santander mammal. = Te present study represents the frst large-scale survey Species Prevalence (%) Technique on gastrointestinal parasites of wild, living and free-rang- Eimeria nodulosa 47.8 SAF/fotation ing Antillean manatees (n = 69) in Colombia and provides frst report of the genus Entamoeba in sirenians in Eimeria sp. A and Eimeria sp. B 43.4 SAF/fotation South America. Furthermore, it adds a novel molecular Entamoeba sp. 14.5 SAF characterization on monoxenous Eimeria species infect- Giardia sp. 1.4 Copro-ELISA ing these endangered aquatic mammals. Chiorchis fabaceus 33.3 SAF/sedimentation Vélez et al. Parasites Vectors (2019) 12:183 Page 3 of 9

(139–157 × 99–133) µm, an ovoid shape, a unipolar operculum and a brownish morula being delimited by a smooth capsule (Fig. 2d). All these morphological characteristics agree with previous descriptions [25].

Molecular analyses of Eimeria species In total, 62% (43/69) of Antillean manatee faecal samples contained Eimeria oocysts, which were diagnosed morphologically as E. nodulosa and E. manatus-like species. A subset of samples (n = 17) with single and mixed Eimeria oocyst specimen was characterized molecu- larly by copro-PCR and consecutive sequencing of the almost entire SSU rDNA. Overall, three diferent Eimeria sequences were identifed with an interspecies identity of 98.3–98.7% (Fig. 3, partial alignment). Te highest homology obtained by BLAST search of the GenBank database was related to Eimeria sequences from rodents showing 96–97% identity. Out of the phylogeny DNA Fig. 1 Illustration of manatee gastrointestinal parasites. a Eimeria sequences, one could directly be assigned to E. nodulosa manatus-like oocyst, b Eimeria nodulosa oocyst, c Entamoeba sp. cyst, based on microscopic diagnostics on samples showing d Chiorchis fabaceus egg. Scale-bars: a, c, d 20 µm; b 10 µm mono-infections with E. nodulosa. Te remaining two sequences corresponded to E. manatus-like oocysts. Tese appear to represent two distinct Eimeria species (designated here as E. manatus-like type A and B) which were indistinguishable on the level of oocyst morphol- ogy. Te partial SSU rRNA gene sequences of E. nodulosa and the two E. manatus-like species were deposited in the GenBank database under the accession numbers MG652357–MG652359. A simplifed phylogenetic tree showing representative Eimeria species from bovines, rodents and chickens was generated based on BLAST search data including manatee Eimeria sequences (Fig. 4). Statistical analyses from series of likelihood-ratio tests obtained in MrModeltest v.2 [34] allowed to select SYM+G as the most appropriate mathematical model for our phylogenetic analysis which was carried out using MrBayes v.3.2 [35]. Te Fig. 2 Scanning electron microscopy (SEM) image of a Eimeria Bayesian maximum posterior probability tree with corre- nodulosa oocyst. Scale-bar: 5 µm sponding clade-credibility values is shown in Fig. 4. Te inferred phylogenetic tree revealed a host-specifc adaptation of the sirenian Eimeria species as also shown for Eimeria species from the other host groups. Te closest knob-like structures in more detail (Fig. 2). E. manatus- neighbour to the cluster of sirenian Eimeria species was like oocysts [9.82 9.24 (8.9–11.95 8.0–11.31) µm] × × represented by the rodent lineage. were slightly smaller than E. nodulosa oocysts and lacked any knob-like structures on oocyst wall. SEM analyses Discussion showed a micropyle-like cap structure in the E. manatus-like oocysts (data not shown). Interestingly, such a Overall, manatees were infected with fve diferent intes- structure was not reported before for manatee-specifc tinal protozoan parasites (i.e. E. nodulosa, E. manatus- oocysts [25, 26]. Entamoeba sp. cysts had a mean size like type A and B, Entamoeba sp. and Giardia sp.) and one intestinal trematode parasite, i. e. C. fabaceus. Tus, of 14.19 × 12.0 (10.45–18.57 × 8.17–15.89) µm and presented at least more than two spherical nuclei (Fig. 1c). manatees were found to be infected with E. nodulosa Chiorchis fabaceus eggs had a mean size of 151 111 (47.8%), E. manatus-like specimens (43.4%), Entamoeba × sp. (14.5%) and C. fabaceus (33.3%). Giardia sp. revealed Vélez et al. Parasites Vectors (2019) 12:183 Page 4 of 9

EspA 644 CTGGACTGCCCTCGGCTTATTTCCGGTAGC-TTCACATGCTTCACTGTGTGTGT-TGTGT 701 EspB 641 CTGGATTGCCCTCGGCTTATTTCCGGTAGC-TTCGCGTGCTTCATTGCTCGCGT-TGTGT 698 Enod 642 CTGGATTGCCCTCGGCTTATTTCCGGTAGCTTTCGCATGCTTCATTGCGTGTGTCTGTGT 701 Etam 657 CTGGTTTGCCCTCGGCTTTCTTCCGGTAGC-CTTCCGCGCTTCACTGCGTGTGTTGGTGT 715 Ewyo 661 CTGGTTTGGCTGCGGCTTTATTCCTGTAGC-CATCCGCGCTTAATTGCGTGTGT-TGTGT 718 **** ** * ****** **** ********** **** ** ****

EspA 1299 CTTAGCCTGCTAAATAGGATCGGGAACTTTCGTCTCCGCATCACTTCTTAGAGGGACTTT1358 EspB 1296 CTTAGCCTGCTAAATAGGATCGGGAACTTCTGTTTCCGCATCACTTCTTAGAGGGACTTT1355 Enod 1299 CTTAGCCTGCTAAATAGGATCGGGAACTTTCGTTTCCGCATCACTTCTTAGAGGGACTTT1358 Etam 1313 CTTAGCCTGCTAAATAGGATCGGGAACCTCGGTTCCCGCATCACTTCTTAGAGGGACTTT1372 Ewyo 1316 CTTAGCCTGCTAAATAGGATCGGGAACTATGGTTCTTGTATCACTTCTTAGAGGGACTTT 1375 *************************** ** **********************

EspA 1633 CTGTGAACTCATCGGACCGATCAACTTTGTGTTTCACATTGTTGGTTGGGAAGTTGCGTA 1692 EspB 1630 CTGTGAACTCATCGGACCGATCAACTTTG---TTTACATTGTTGGCTGGAAAGTTGCGTA 1686 Enod 1633 CTGTGAACTCATCGGACCGATCAGCTTTG--GTCTCCATCGTTGGTTGGAAAGTTGCGTA 1690 Etam 1648 CTGTGAACTCATCGGATTGACCACTCTCG---CTTGCGTCTGTGGTCGAGAAGTTGCGTA 1704 Ewyo 1651 CTGTGAACTCAATGGACTGATCAACTCCT---TTTTGGGTGTTGGTCGGGAAGTTGCGTA 1707 *********** *** ** ** *** *********** Fig. 3 Alignment of Eimeria nodulosa, Eimeria manatus-like type A, Eimeria manatus-like type B, E. tamiasciuri (squirrel) and E. wyomingensis (bovines) SSU rRNA gene sequences. Positions with identical nucleotides in all fve sequences are denoted by a star; positions with more than 50% agreement are highlighted by black shading

Rico (Additional fle 1: Table S1) [25, 36]. DNA sequencing-based analyses identifed three Eimeria species in Colombian manatee samples, i.e. E. nodulosa and two E. manatus-like species. Although microscopic analyses revealed smaller sizes of E. manatus-like oocysts when compared to measures recently reported for E. manatus [25], the present size characteristics almost matched those described elsewhere [37]. Based on oocyst size we could also exclude the presence of E. trichechi, which was described in T. inunguis in Brazil [24]. Interestingly, the Antillean manatee population studied here was found to be infected with only one trematode species, i.e. C. fabaceus, thereby showing a diferent trematode spectrum than Antillean manatees from Cór- doba, Colombia, which had Nudacotyle undicola infec- Fig. 4 Phylogenetic tree showing the three Eimeria species tions [21]. Tis might be due to the relative geographical identifed in Antillean manatees from Colombia. The tree shows separation of the diferent manatee populations. Consist- that Eimeria spp. from manatees also present host-grouping pattern compared with other Eimeria spp. from bovines, rodents and chicken. ently, the Carare River is localized between the Andes Cystoisospora canis was used as the outgroup Mountains of Colombia and therefore far away from shores of the Atlantic Ocean where other wild Antillean manatees reside. Trematodes have indirect life-cycles and need adequate gastropod intermediate hosts to fulfl as a component species (prevalence < 10%), which is in their development. Terefore, the presence or absence of agreement with previous published data [31]. specifc molluscs (snails/slugs) represents a further factor In the present study, Eimeria spp. revealed as the most for trematode diversity in manatees. However, the cur- prevalent parasites and these fndings are in agreement rent lack of knowledge on epidemiology, transmission with data on manatees inhabiting Florida and Puerto and pathogenicity of almost all parasitoses of manatees Vélez et al. Parasites Vectors (2019) 12:183 Page 5 of 9

Fig. 5 Illustration of sampling sites and specimen: a Carare River in the Andean region; b “Cienaga La San Juana”, a wetland ecosystem; c, d manatee faeces in feld; e manatee sighting

impair the establishment of proper international and Terefore, future parasitological research in manatees national conservation politics. Indeed, the pathogenic- requires a broader approach, e.g. incorporating molec- ity of manatee intestinal trematode infections, e.g. nuda- ular analysis [21, 33]. In general, Entamoeba spp. are cotylosis, could be of importance, especially for this water-borne parasites and their transmission commonly studied isolated manatee population which may be naïve occur in developing countries where drinking water for diferent manatee-specifc trematode infections [25]. quality is poor and open water often is contaminated Additionally, the probability of a low genetic diversity in by human faeces, which are still used as a fertilizer [42]. confned and remote manatee populations, a product of Besides some non-pathogenic species, such as E. coli, inbreeding, may impair the host immune system, ren- E. hartmanni and E. polecki [43], the genus Entamoeba dering manatees more susceptible to disease as demon- also includes the worldwide occurring species E. histol- strated for other wild animals [38–40]. ytica which is considered as one of the major causes of Te present parasitological fndings represent the frst human deaths induced by parasitic pathogens [44]. As host record for Entamoeba sp. in T. manatus manatus such, contamination of water and shores with human fae- in South America (prevalence: 14.5%). So far, neither ces might pose a risk on local manatee health. Addition- the species nor the zoonotic potential of this pathogen ally, one Giardia antigen-positive Antillean manatee was is known. To our best knowledge, Entamoeba infections identifed in the present study thereby representing, to in aquatic mammals have so far only been reported in our best knowledge, the frst report for Colombia. Along- certain whale species such as sperm whales, blue whales, side this, there is only one other report on giardiasis in fn whales and sei whales [41], and there is one report manatees from Brazil [31]. Giardia spp. are also consid- for manatees [36]. Nonetheless, the Entamoeba-like ered as water-borne zoonotic parasites which are trans- cysts reported in Florida manatees [36] present a larger mitted by highly resistant cysts which are orally ingested size and difer in the number and form of the nuclei. by hosts [20]. Given that no cyst stages were detected in Vélez et al. Parasites Vectors (2019) 12:183 Page 6 of 9

the antigen-positive animal one may question an active comprised a total of 130 boat trips covering a distance of infection and thereby the zoonotic potential of this posi- 585 km and resulted in 288 h of sampling efort. tive sample. In fact, we cannot exclude that Giardia For parasitological examination, faecal samples of stages were simply representing intestinal passers-by. manatees were submitted and analysed using Sheather’s As also tackled in the present study, water-borne sedimentation, fotation (SSF)-technique [52] and the zoonoses clearly need more attention by public health standard sodium acetate acetic formalin (SAF)-tech- authorities worldwide as suggested elsewhere [45]. A fun- nique modifed with ethyl acetate [53]. Whilst the SSF- damental aspect of entamoebiasis/giardiasis control is to technique was applied for trematode egg diagnosis, the identify reservoirs and routes of transmission in diverse SAF-technique was used for detection of helminth eggs climatic and geographical areas. Tis is highly important and protozoan stages (trophozoites, cysts, sporocysts, in the case of wild Antillean manatees, considering that oocysts). Samples were analysed by light microscopy this species inhabits shallow waters close to populated (BH-52® microscope equipped with a SC30® digital cam- marine shores which renders them highly vulnerable to era, both Olympus, Hamburg, Germany) and CellSens® classical water-borne parasitic infections [23, 30, 46]. imaging software (Olympus) for illustration (Fig. 1) and specimen measurements. Additionally, carbol-fuchsin- Conclusions stained faecal smears were performed for Cryptosporid- Te present study adds novel data on clearly neglected ium spp. oocyst detection [53, 54]. As shown for other anthropozoonotic parasitoses [44, 47] and calls for more marine mammals [41, 55–57], coproantigen-ELISAs integrated investigation to avoid exposure of Antillean (ProSpecTTM, Termo ScientifcTM, Schwerte, Germany) manatees or human beings to these intestinal pathogens. were applied to detect Cryptosporidium and Giardia It is of particular importance to strengthen interdiscipli- antigens in manatee faecal samples. nary health agendas which favour ‘One Health’ concept considering ecosystem, domestic animal, wild animal Molecular analyses and human health as a single unit [47–50]. Tis study Amplifcation of Eimeria-specifc DNA via PCR and emphasizes the relevance of the sentinel role of manatees amplicon sequencing was performed to characterize [51] and the regular manatee monitoring programmes Eimeria oocysts in manatee faecal samples (n = 17) and being supported by both Colombian authorities for pub- to elucidate phylogenetic relationships. lic health issues and biologists/ecologists responsible for conservation programmes. DNA extraction of Eimeria‑oocysts from faecal samples DNA was extracted from faecal samples using a QIAamp Methods DNA Stool Mini kit® (Qiagen, Hilden, Germany) follow- Study area, sample collection and coprological analyses ing glass bead homogenization [58]. First, the ethanol Wild Antillean manatees (T. manatus manatus) inhab- used for sample preservation was removed through evap- iting river-, swamp- and wetland-waters within the oration by opening the collection tubes at room tem- Andean region of the Santander Department of Colom- perature for 30 min. Ten, 6 ml of ASL bufer (Stool lysis bia were sampled. Te study area has an average annual bufer, QIAamp DNA Stool Mini kit®) and 30 sterile glass precipitation of 2955 mm and a temperature range beads (4 mm diameter, Carl Roth, Karlsruhe, Germany) between 26.8 and 30.3 °C. Faecal samples were collected were added to 1 g of faeces. Samples were mixed by during dry and rainy seasons of the years 2015 and 2016. horizontal vortexing (Vortex Genie 2®, Scientifc Indus- In detail, a boat-based line transect survey was conducted tries Inc, New York, USA; equipped with a 13000-V1-15 to search for faecal samples along the banks and foating adapter, MO BIO Labs, Qiagen, Hilden, Germany) and plant patches in the San Juan River, the San Juana swamp incubated at 70 °C for 15 min. Afterwards, samples (2 ml) and in the Carare river basin. In total, 69 individual fae- were transferred to a reaction tube (Eppendorf, Berzdorf, cal samples were collected by tracing individual animals Germany), incubated at 95 °C for 10 min and then pel- during boat excursions according to the Guidelines for leted (14,000× rpm, 1 min). Subsequently, an InhibitEX the Treatment of Marine Mammals in Field Research of Tablet® (Qiagen) was added to 1.2 ml of the superna- the Society for Marine Mammalogy. Whenever defeca- tant. DNA isolation was then performed according to the tion occurred, foating faecal samples were immediately manufacturer’s protocol. collected from water surfaces or from foating vegetation patches using a net (Fig. 5). Tereafter, faecal samples Eimeria‑specifc PCR, cloning and sequencing were transferred into 10-ml plastic tubes (Sarstedt, Nüm- Eimeria-specifc primers were used in a nested PCR, brecht, Germany) containing 70% ethanol for fxation namely, TK2: 5′-GGT TGA TCC TGC CAG TAG and stored at 4 °C until further diagnosis. Tis survey TC-3′ and ETS2: 5′-AAT CCC AAT GAA CGC GAC Vélez et al. Parasites Vectors (2019) 12:183 Page 7 of 9

Scanning electron microscopy (SEM) of sirenian Eimeria TCA-3′ for PCR1 and TK1: 5′-AGT AGT CAT ATG oocysts CTT GTC TC-3′ together with 18S-14R: 5′-ACG GAA ACC GTG TTA CGA CT-3′ for PCR2, according to Droplets of Eimeria spp. oocyst-positive faecal samples [59]. Te nested PCR produced a fragment (~1800 bp) were deposited on circular, poly-L-lysine (Merck, Darm- of the small subunit ribosomal DNA (SSU rDNA). For stadt, Germany) pre-coated glass coverslips (10 mm PCR1, the reaction volume of 50 µl contained 0.2 µM diameter; Nunc). Tereafter, samples were fxed in 2.5% of each primer (TK2, ETS2), 10 µl of 5 HOT FIREPol glutaraldehyde (Merck), post-fxed in 1% osmium tetrox- × ide (Merck), washed in distilled water, dehydrated, dried Blend Master Mix with 7.5 mM MgCl2 (Solis BioDyne, Tartu, Estonia) and 5 µl of copro-DNA template. Te by CO2 treatment and afterwards sputtered with gold cycling programme was: 95 °C for 15 min (initial dena- particles as described for faecal probes of other marine mammals [64]. SEM samples were analysed using an turation) followed by 30 cycles of 95 °C (20 s, denatura- ® tion), 67 °C decreasing 1 °C per cycle until 60 °C (30 s, XL30 scanning electron microscope (Philips, Hillsboro, annealing) and fnally 72 °C for 2 min 30 s. For PCR2, USA) at the Institute of Anatomy and Cell Biology, Justus 2 µl of amplifcate (PCR1) was used as a template using Liebig University Giessen, Germany. the following conditions: 95 °C for 15 min (initial dena- turation), followed by 35 cycles of 95 °C, 20 s (denatur- ation), 56 °C for 30 s (annealing) and 72 °C for 2 min. Additional fle PCR-derived DNA samples were analysed in a 1% agarose gel. Subsequently, DNA-amplicons were purifed from a preparative agarose gel (1%) using HiYield® Gel/ Additional fle 1: Table S1. Prevalence of gastrointestinal and respiratory parasites in wild manatees; present study and literature review. PCR DNA Extraction Kit (Süd-Laborbedarf, Gauting, Germany). Afterwards, the amplicons were cloned into Abbreviations pDrive vector (Qiagen) and the isolated recombinant (SAF)-technique: sodium acetate acetic acid formalin; ELISA: enzyme-linked plasmid DNA with amplicons was sequenced in both immunosorbent assay; SSU rDNA: small-subunit ribosomal RNA gene; IUCN: directions by LGC Genomics (Berlin, Germany). International Union for the Conservation of the Nature; PCR: polymerase chain reaction; DNA: deoxyribonucleic acid; rDNA: ribosomal deoxyribonucleic acid; rRNA: ribosomal ribonucleic acid; SEM: scanning electron microscopy; WCS: Wildlife Conservation Society; CAS: Corporación Autónoma Regional de Phylogenetic analysis on manatee Eimeria spp. Santander.

Te SSU rDNA sequence-based phylogenetic analysis Acknowledgements was conducted using a reduced dataset. Nine Eimeria We are thankful to “Grupo de Guardianes del Manatí de Carare y Riberas del sequences (Fig. 4) from three diferent host groups San Juan”, WCS Colombia, Ecopetrol, “Fundación Julio Mario Santo Domingo” and “Cabildo Verde Sabana de Torres”, which organized the project “Wildlife” (bovines, rodents and chickens) were selected after and have supported the sample collection of the study. We also extend our BLAST search in GenBank. Cystoisospora canis was thanks to Dr Iván Conejeros (Institute of Parasitology, Justus Liebig University chosen as the outgroup-member to prove the mono- Giessen) for his contributions provided in the phylogenetic analysis. phyly of the ingroup-members. Sequences were aligned Funding using ClustalX v.2.1 software [60] and the alignment The sample collection in this research was supported by “Grupo de Guardi‑ was corrected manually. For phylogenetic analyses, anes del Manatí de Carare y Riberas del San Juan”, through the “Proyecto Vida Silvestre”, funded by Ecopetrol, Wildlife Conservation Society, “Fundación the best-ft models of sequence evolution were deter- Mario Santo Domingo” and “Cabildo Verde Sabana de Torres”. The processing mined with JModelTest v.2.1.10 [61, 62] and MrMod- of samples, analysis of results and the publication of the present study did not eltest v.2 [34] software applying Akaike’s criterion. For receive any specifc grant from funding agencies in the public, commercial, or not-for-proft sectors. maximum likelihood (ML) and Bayesian inference (BI) analyses, the following methods were used: ML analysis Availability of data and materials was performed using PhyML v.3.0 software [62] using All relevant data supporting the conclusions of this study are included within the article. the TIM3 + I + G model. BI analysis was conducted using MrBayes v.3.2 software [35] applying a SYM+G Authors’ contributions model for 20,000 generations. Burn-in was deter- Conceived and designed the study: CH and SC. Performed the sample collec‑ tion: KAG. Processed and analysed the samples: JV, JH and MKL. Produced the mined according to the indications implemented in the SEM images: AS and UG. Supervised laboratory work: CH and AT. Wrote the MrBayes software [deviation of split frequencies below paper: JV, CH, MKL, JH, KA-G and AT. All authors read and approved the fnal 0.01, a potential scale reduction factor (PSRF) close manuscript. to 1.0 for all parameters]. Te phylogenetic trees were Ethics approval and consent to participate visualized in FigTree v.1.4.3 software [63] and adjusted This study was conducted according to the Guidelines for the Treatment of using Adobe Illustrator CS5 v.15.0 (Adobe Systems Inc., Marine Mammals in Field Research of the Society for Marine Mammalogy. The feldwork was conducted within the “Wild life” project by “Grupo de San Jose, USA). Vélez et al. Parasites Vectors (2019) 12:183 Page 8 of 9

Guardianes del Manatí de Carare y Riberas del San Juan” funded by Ecopetrol, gross, histologic, and immunohistochemical features. Toxicol Pathol. Wildlife Conservation Society, “Fundación Mario Santo Domingo” and “Cabildo 1998;26:276–82. Verde Sabana de Torres” and Wildlife Conservation Society (WCS). The “Wildlife” 13. O’Shea TJ, Rathbun GB, Bonde RK, Buergelt CD, Odell DK. An epizootic Project was conducted with the permission of the “Corporación Autónoma of Florida manatees associated with a dinofagellate bloom. Mar Mam‑ Regional de Santander - CAS” to access the samples. mal Sci. 1991;7:165–79. 14. Flewelling LJ, Naar JP, Abbott JP, Baden DG, Barros NB, Bossart GD, Consent for publication et al. Brevetoxicosis: red tides and marine mammal mortalities. Nature. Not applicable. 2005;435:755–6. 15. Landsberg J, Flewelling L, Naar J. Karenia brevis red tides, brevetoxins Competing interests in the food web, and impacts on natural resources: decadal advance‑ The authors declare that they have no competing interests. ments. Harmful Algae. 2009;8:598–607. 16. Castelblanco-Martínez DN, Bermúdez-Romero AL, Gómez-Camelo IV, Rosas FCW, Trujillo F, Zerda-Ordoñez E. Seasonality of habitat use, mor‑ Publisher’s Note tality and reproduction of the vulnerable Antillean manatee Trichechus Springer Nature remains neutral with regard to jurisdictional claims in pub‑ manatus manatus in the Orinoco River, Colombia: implications for lished maps and institutional afliations. conservation. Oryx. 2009;43:235–42. 17. Hudson PJ, Dobson AP, Newborn D. Do parasites make prey vulnerable Author details to predation? Red grouse and parasites. J Anim Ecol. 1992;61:681–92. 1 Institute of Parasitology, Biomedical Research Center Seltersberg (BFS), Justus 2 18. Daszak P, Cunningham AA, Hyatt AD. Emerging infectious diseases Liebig University Giessen, Schubertstr. 81, 35392 Giessen, Germany. CIBAV of wildlife–threats to biodiversity and human health. Science. Research Group, Veterinary Medicine School, University of Antioquia, Calle 3 2000;287:443. 70 No. 52‑21, Medellín, Colombia. LEMVA, Laboratory of Molecular Ecology 19. Møller AP, Nielsen JT. Malaria and risk of predation: a comparative study of Aquatic Vertebrates, University of Los Andes, Carrera 1 No. 18A‑12, Bogotá, 4 of birds. Ecology. 2007;88:871–81. Colombia. Universidad Veracruzana, km. 7,5 Carretera Túxpan‑Tampico, 20. Thompson R, Lymbery A, Smith A. Parasites, emerging disease and Túxpan, México. 5 Cabildo Verde Sabana de Torres, Carrera 11 No 14‑75, Sabana 6 wildlife conservation. Int J Parasitol. 2010;40:1163–70. de Torres, Colombia. Institute of Anatomy and Cell Biology, Justus Liebig 21. Vélez J, Hirzmann J, Lange M, Chaparro-Gutiérrez J, Taubert A, Her‑ University Giessen, Aulweg 123, 35392 Giessen, Germany. mosilla C. Occurrence of endoparasites in wild Antillean manatees (Trichechus manatus manatus) in Colombia. Int J Parasitol Parasites Received: 20 January 2019 Accepted: 17 April 2019 Wildl. 2018;7:54–7. 22. Bonde RK, Oʼshea T, Beck C. Manual of procedures for the salvage and necropsy of carcasses of the West Indian manatee (Trichechus manatus). Springfeld, Virginia, USA: National Technical Information Service; 1983. 23. Bossart GD, Mignucci-Giannoni AA, Rivera-Guzman AL, Jimenez-Marrero References NM, Camus AC, Bonde RK, et al. Disseminated toxoplasmosis in Antillean 1. Trujillo F, Gartner A, Caicedo D. Diagnóstico del estado de conocimiento manatees Trichechus manatus manatus from Puerto Rico. Dis Aquat y conservación de los mamíferos acuáticos en Colombia. Bogota: Ministe‑ Organ. 2012;101:139–44. rio de Ambiente y Desarrollo Sostenible FO, Conservación Internacional y 24. Lainson R, Naif R, Best R, Shaw J. Eimeria trichechi n. sp. from the Ama‑ WWF; 2013. zonian manatee, Trichechus inunguis (Mammalia: Sirenia). Syst Parasitol. 2. Montoya-Ospina RA, Caicedo-Herrera D, Millán-Sánchez SL, Mignucci- 1983;5:287–9. Giannoni AA, Lefebvre LW. Status and distribution of the West Indian 25. Bando M, Larkin IV, Wright SD, Greiner EC. Diagnostic stages of the manatee, Trichechus manatus manatus, in Colombia. Biol Conserv. parasites of the Florida manatee, Trichechus manatus latirostris. J Parasitol. 2001;102:117–29. 2014;100:133–8. 3. Bertram G, Bertram CR. The modern Sirenia: their distribution and status. 26. Upton SJ, Odell DK, Bossart GD, Walsh MT. Description of the oocysts Biol J Linn Soc. 1973;5:297–338. of two new species of Eimeria (Apicomplexa: Eimerüdae) from the 4. Beck C, Forrester DJ. Helminths of the Florida manatee, Trichechus mana- Florida manatee, Trichechus manatus (Sirenia: Trichechidae). J Protozool. tus latirostris, with a discussion and summary of the parasites of sirenians. 1989;36:87–90. J Parasitol. 1988;74:628–37. 27. Carvalho V, Meirelles A, Motta M, Maia D, Campello M, Bevilaqua C. Occur‑ 5. Deutsch C, Self-Sullivan C, Mignucci-Giannoni A. Trichechus manatus. The rence of Pulmonicola cochleotrema (syn. Cochleotrema cochleotrema) IUCN Red List of Threatened Species. Version 2014.2. 2008. http://dx.doi. (Digenea: Opisthotrematidae) in Antillean manatees (Trichechus manatus org/10.2305/IUCN.UK.2008.RLTS.T22103A9356917.en. Accessed 3 Nov manatus) in Brazil. Lat Am J Aquat Mamm. 2009;7:47–52. 2018. 28. Hernández-Olascoaga A, Olivera-Gómez LD, Morales-Vela B. Helmintos 6. Quintana-Rizzo E, Reynolds J. Regional management plan for the West parásitos en heces de manatí Antillano Trichechus manatus manatus (Sire‑ Indian manatee (Trichechus manatus). Gosier, Guadeloupe, France: Carib‑ nia: Tricheachidae) en México: Golfo de México y Caribe. Hidrobiológica. bean Environment Programme, United Nations Environment Programme; 2017;27:39–44. 2008. 29. Colón-Llavina MM, Mignucci-Giannoni AA, Mattiucci S, Paoletti M, 7. O’Shea TJ, Beck CA, Bonde RK, Kochman HI, Odell DK. An analysis of Nascetti G, Williams EH. Additional records of metazoan parasites from manatee mortality patterns in Florida, 1976–1981. J Wildlife Manag. Caribbean marine mammals, including genetically identifed anisakid 1985;49:1–11. nematodes. Parasitol Res. 2009;105:1239. 8. Dierauf L, Gulland FM. CRC handbook of marine mammal medicine: 30. Borges JCG, Alves LC, da Gloria Faustino MA, Marmontel M. Occurrence health, disease, and rehabilitation. Boca Raton: CRC Press; 2001. of Cryptosporidium spp. in Antillean manatees (Trichechus manatus) and 9. Gomes Borges JC, Câmara Alves L, Gloria Faustino MAD. Criptosporidi‑ Amazonian manatees (Trichechus inunguis) from Brazil. J Zoo Wildl Med. ose: uma revisão sobre a sua implicação na conservação dos mamíferos 2011;42:593–6. aquáticos. Biota Neotrop. 2007;7:3. 31. Borges JCG, dos Santos Lima D, da Silva EM, de Oliveira Moreira AL, 10. Bossart GD. The Florida manatee: on the verge of extinction? J Am Vet Marmontel M, Carvalho VL, et al. Cryptosporidium spp. and Giardia sp. in Med Assoc. 1999;214:1178–83. aquatic mammals in northern and northeastern Brazil. Dis Aquat Organ. 11. Mignucci-Giannoni AA, Williams EH, Toyos-González GM, Pérez-Padilla J, 2017;126:25–31. Rodrı́guez-López MA, Vega-Guerra MB, et al. Helminths from a stranded 32. Buaka Muanke P, Niezrecki C. Locating manatee position with an acoustic manatee in the Dominican Republic. Vet Parasitol. 1999;81:69–71. array. J Acoust Soc Am. 2006;119:3405. 12. Bossart GD, Baden DG, Ewing RY, Roberts B, Wright SD. Brevetoxicosis 33. Nadler SA, Hudspeth DS. Ribosomal DNA and phylogeny of the Ascari‑ in manatees (Trichechus manatus latirostris) from the 1996 epizootic: doidea (Nemata: Secernentea): implications for morphological evolution and classifcation. Mol Phylogenet Evol. 1998;10:221–36. Vélez et al. Parasites Vectors (2019) 12:183 Page 9 of 9

34. Nylander JAA. MrModeltest 2.3. Program distributed by the author. to health in a globalized world. New York: Wildlife Conservation Society; Evolutionary Biology Centre, Uppsala University. 2004. http://www.abc. 2004. se/~nylander/. Accessed 2 Mar 2018. 50. Schurer J, Mosites E, Li C, Meschke S, Rabinowitz P. Community-based 35. Ronquist F, Huelsenbeck J, Teslenko M. Draft MrBayes version 3.2 manual: surveillance of zoonotic parasites in a ‘One Health’ world: a systematic tutorials and model summaries. 2011. http://evolution.genetics.washi review. One Health. 2016;2:166–74. ngton.edu/phylip/software.old.html Accessed 22 Feb 2018. 51. Bossart GD. Marine mammals as sentinel species for oceans and human 36. Wyrosdick H, Chapman A, Mignucci-Giannoni AA, Rivera-Pérez CI, Bonde health. Oceanography. 2006;19:134–7. RK. Internal parasites of the two subspecies of the West Indian manatee 52. Yang J, Scholten T. A fxative for intestinal parasites permitting the use Trichechus manatus. Dis Aquat Organ. 2018;130:145–52. of concentration and permanent staining procedures. Am J Clin Pathol. 37. Wyrosdick HL. Epidemiology of Toxoplasma gondii and a survey of other 1977;67:300–4. parasites in the West Indian manatee (Trichechus manatus). 2016. https:// 53. Untersuchungsmethoden Bauer C. In: Schnieder T, editor. Veterinär‑ trace.tennessee.edu/utk_gradthes/4274/. Accessed 12 Jan 2018. medizinische parasitologie. 3rd ed. Stuttgart: Parey; 2006. p. 84–104. 38. Hale K, Briskie J. Decreased immunocompetence in a severely bot‑ 54. Heine J. Eine einfache Nachweismethode für Kryptosporidien im Kot. ZBL tlenecked population of an endemic New Zealand bird. Anim Conser. Vet Med B. 1982;29:324–7. 2007;10:2–10. 55. Kleinertz S, Hermosilla C, Ziltener A, Kreicker S, Hirzmann J, Abdel-Ghafar 39. Pedersen AB, Jones KE, Nunn CL, Altizer S. Infectious diseases and extinc‑ F, et al. Gastrointestinal parasites of free-living Indo-Pacifc bottlenose tion risk in wild mammals. Conser Biol. 2007;21:1269–79. dolphins (Tursiops aduncus) in the Northern Red Sea, Egypt. Parasitol Res. 40. Peeler EJ, Oidtmann BC, Midtlyng PJ, Miossec L, Gozlan RE. Non-native 2014;113:1405–15. aquatic animals introductions have driven disease emergence in Europe. 56. de Vos A, Faux CE, Marthick J, Dickinson J, Jarman SN. New determination Biol Invasions. 2011;13:1291–303. of prey and parasite species for northern Indian Ocean Blue Whales. Front 41. Hermosilla C, Silva LM, Kleinertz S, Prieto R, Silva MA, Taubert A. Endo‑ Mar Sci. 2018;5:104. parasite survey of free-swimming baleen whales (Balaenoptera musculus, 57. Hermosilla C, Silva LM, Navarro M, Taubert A. Anthropozoonotic endopar‑ B. physalus, B. borealis) and sperm whales (Physeter macrocephalus) using asites in free-ranging “urban” South American sea lions (Otaria favescens). non/minimally invasive methods. Parasitol Res. 2016;115:889–96. J Vet Med. 2016;2016:1–7. 42. Marshall MM, Naumovitz D, Ortega Y, Sterling CR. Waterborne protozoan 58. Nunes CM, Lima LGF, Manoel CS, Pereira RN, Nakano MM, Garcia JF. Fecal pathogens. Clin Microbiol Rev. 1997;10:67–85. specimens preparation methods for PCR diagnosis of human taeniosis. 43. Matsubayashi M, Kanamori K, Sadahiro M, Tokoro M, Abe N, Haritani Rev Inst Med Trop São Paulo. 2006;48:45–7. M, et al. First molecular identifcation of Entamoeba polecki in a piglet 59. Kokuzawa T, Ichikawa-Seki M, Itagaki T. Determination of phylogenetic in Japan and implications for aggravation of ileitis by coinfection with relationships among Eimeria species, which parasitize cattle, on the basis Lawsonia intracellularis. Parasitol Res. 2015;114:3069–73. of nuclear 18S rDNA sequence. J Vet Med Sci. 2013;75:1427–31. 44. Salles JM, Salles MJ, Moraes LA, Silva MC. Invasive amebiasis: an 60. Larkin M, Blackshields G, Brown N, Chenna R, McGettigan P, McWilliam H. update on diagnosis and management. Expert Rev Anti Infect Ther. Clustal W and Clustal X version 2.0. Bioinformatics. 2007;23:2947–8. 2007;5:893–901. 61. Darriba D, Taboada GL, Doallo R, Posada D. jModelTest 2: more models, 45. Ponce-Gordo F. Jirků-Pomajbíková, K. Balantidium coli. Global water new heuristics and parallel computing. Nat Methods. 2012;9:772. pathogen project part three. specifc excreted pathogens: environmental 62. Guindon S, Gascuel O. A simple, fast, and accurate algorithm to estimate and epidemiology aspects. 2017. https://www.researchgate.net/publi large phylogenies by maximum likelihood. Syst Biol. 2003;52:696–704. cation/325701431_Balantidium_coli. Accessed 16 Aug 2018. 63. Andrew Rambaut. Molecular evolution, phylogenetics and epidemiology. 46. Jones J, Dubey J. Waterborne toxoplasmosis - recent developments. Exp Andrew Rambaut´s research group: FigTree. 2007. http://tree.bio.ed.ac.uk/ Parasitol. 2010;124:10–25. software/fgtree/. Accessed 18 Feb 2019. 47. Thompson RA. Parasite zoonoses and wildlife: one health, spillover and 64. Hermosilla C, Hirzmann J, Silva L, Brotons J, Cerdà M, Prenger-Berninghof human activity. Int J Parasitol. 2013;43:1079–88. E, et al. Occurrence of anthropozoonotic parasitic infections and faecal 48. Schwabe CW. Cattle, priests, and progress in medicine. Minneapolis, Min‑ microbes in free-ranging sperm whales (Physeter macrocephalus) from nesota, USA: University of Minnesota Press; 1978. the Mediterranean Sea. Parasitol Res. 2018;117:2531–41. 49. Cook R, Karesh W, Osofsky S. The Manhattan principles on ‘One World One Health’. One World, One Health: building interdisciplinary bridges

Ready to submit your research ? Choose BMC and benefit from:

• fast, convenient online submission • thorough peer review by experienced researchers in your ﬁeld • rapid publication on acceptance • support for research data, including large and complex data types • gold Open Access which fosters wider collaboration and increased citations • maximum visibility for your research: over 100M website views per year

At BMC, research is always in progress.

Learn more biomedcentral.com/submissions