(Apicomplexa: Eimeridae) Infecting Iceland Scallop Chlamys Islandica (Müller, 1776) in Icelandic Waters ⇑ Árni Kristmundsson A, , Sigurður Helgason A, Slavko H
Total Page：16
File Type：pdf, Size：1020Kb
Journal of Invertebrate Pathology 108 (2011) 139–146 Contents lists available at SciVerse ScienceDirect Journal of Invertebrate Pathology journal homepage: www.elsevier.com/locate/jip Margolisiella islandica sp. nov. (Apicomplexa: Eimeridae) infecting Iceland scallop Chlamys islandica (Müller, 1776) in Icelandic waters ⇑ Árni Kristmundsson a, , Sigurður Helgason a, Slavko H. Bambir a, Matthías Eydal a, Mark A. Freeman b a Institute for Experimental Pathology at Keldur, University of Iceland, Reykjavik, Iceland b Institute of Biological Sciences & Institute of Ocean and Earth Sciences, University of Malaya, Kuala Lumpur, Malaysia article info abstract Article history: Wild Iceland scallops Chlamys islandica from an Icelandic bay were examined for parasites. Queen scal- Received 14 December 2010 lops Aequipecten opercularis from the Faroe Islands and king scallops Pecten maximus and queen scallops Accepted 5 August 2011 from Scottish waters were also examined. Observations revealed heavy infections of eimeriorine para- Available online 12 August 2011 sites in 95–100% of C. islandica but not the other scallop species. All life stages in the apicomplexan repro- duction phases, i.e. merogony, gametogony and sporogony, were present. Trophozoites and meronts were Keywords: common within endothelial cells of the heart’s auricle and two generations of free merozoites were fre- Chlamys islandica quently seen in great numbers in the haemolymph. Gamonts at various developmental stages were also Aequipecten opercularis abundant, most frequently free in the haemolymph. Macrogamonts were much more numerous than Pecten maximus Iceland scallop microgamonts. Oocysts were exclusively in the haemolymph; live mature oocysts contained numerous Apicomplexa (>500) densely packed pairs of sporozoites forming sporocysts. Parasites Analysis of the 18S ribosomal DNA revealed that the parasite from C. islandica is most similar (97.7% Bivalves identity) to an unidentified apicomplexan isolated from the haemolymph of the giant clam, Tridacna crocea, from Japan. Phylogenetic analyses showed that the novel sequence consistently grouped with the Tridacna sequence which formed a robust sister clade to the rhytidocystid group. We propose the name Margolisiella islandica sp. nov., referring to both type host and type locality. Ó 2011 Elsevier Inc. All rights reserved. 1. Introduction the gastropod Patella vulgaris by Debaisieux (1922). More recently, Merocystis tellinovum was described from the ovary of Tellina tenuis The Iceland scallop, Chlamys islandica (Müller, 1776) (Mollusca: by Buchanan (1979), which later was transferred to the genus Pectinidae), is a sub-arctic species with its main distribution in the Pseudoklossia by Levine (1988). A new genus, Margolisiella, was sub-arctic transitional zone. It occurs in the North Atlantic Ocean established for an apicomplexan of littleneck clams, Protothaca south to Massachusetts, around Iceland, Greenland, the Barents staminae, which was named Margolisiella kabatai by Desser and Sea, the northern part of Norway south to Bergen. It has also been Bower (1997). Both sexual and asexual stages occurred in the same recorded in the Bering Strait and extends into the Pacific Ocean host, confirming a monoxenous life cycle. They proposed this new (Brand, 2006). genus for Pseudoklossia species with known monoxenous life cy- Although apicomplexans infecting bivalve molluscs are poorly cles, but left the remaining, possibly heteroxenous species, within studied, such studies go back to 1897, when Léger (1897) described the genus Pseudoklossia. Subsequently they proposed a transfer of the first species, Hyalloklossia pelsineeri from Donax sp. and Tellina P. patellae, P. chitonis, Pseudoklossia tellinovum as well as Pseudoklos- sp. Before that, bivalves were thought to be free of apicomplexans sia haliotis (described from gastropods of the genus Haliotis) to this (Léger, 1897). Subsequently, Léger and Duboscq (1915) established new genus, Margolisiella. Since then, one species, Pseudoklossia the genus Pseudoklossia to accommodate an apicomplexan species, semiluna, has been described from the bivalve Mytilus spp. Pseudoklossia glomerata, from Tapes floridus and T. virgineus, and (Desser et al., 1998). A P. pectinis-like coccidian was reported from they also transferred H. pelsineeri to this genus. Later Pseudoklossia the scallop Argopecten irridians by Karlsson (1991), and Pseudoklos- pectinis was described from Pecten maximus by Léger and Duboscq sia sp. from A. irridians by Cawthorn et al. (1992) and from the (1917), and Pseudoklossia patellae and Pseudoklossia chitonis from cockle Cerastoderma edule by Carballal et al. (2001). Unidentified apicomplexans have also been reported from other bivalves (Leibo- vitz et al., 1984; Morado et al., 1984; Whyte et al., 1994; Nakayama ⇑ Corresponding author. Address: Institute for Experimental Pathology, Univer- et al., 1998; Hine, 2002). To date, no parasite species have been de- sity of Iceland, Keldur, Vesturlandsvegur, IS-112 Reykjavik, Iceland. Fax: +354 567 3979. scribed from the Iceland scallop and very limited DNA data exists E-mail address: [email protected] (Á. Kristmundsson). for apicomplexan parasites of bivalves. 0022-2011/$ - see front matter Ó 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.jip.2011.08.001 140 Á. Kristmundsson et al. / Journal of Invertebrate Pathology 108 (2011) 139–146 In the year 2002, live Iceland scallops were sent to the Fish dis- histological protocols. Parasite forms detected were measured ease Laboratory at the Institute for Experimental Pathology at Kel- (lm) and photographs taken using Leica DMLB microscope dur, for examination. Observation revealed infection with two equipped with a digital camera (Leica DC300F). previously unknown apicomplexan species. Freshly dissected infected tissue was fixed in 95% ethanol for The aim of the studies that followed was to describe these par- the DNA analysis. Total DNA was extracted using a GeneMATRIX asites, one of which is the subject of the present paper; the second kit (EURx Poland) following the tissue protocol. Small subunit one is described in a separate paper (Kristmundsson et al., 2011). ribosomal DNA (SSU rDNA) was amplified from the parasite using the primer pair SFC-340f 50 agtttctgacctatcagc 30 SFC-1260r 50 tcagccttgcgaccatactc 30 designed from alignments of apicomplexan 2. Materials and methods taxa made in CLUSTAL_X (Thompson et al., 1997). From the initial sequence reads two additional more specific primers were de- In November 2002, live Iceland scallops, C. islandica, were sam- signed for use with universal primers to complete the sequencing pled from the bay of Breidafjördur, western Iceland (n =2Â 60). of the SSU rDNA. SC1-1185f 50 tcacgatttgacactttcagc 30 was used Queen scallops Aequipecten opercularis L. (n = 60) from the east with the reverse primer 18gM (Freeman et al., 2008) and SC1- coast of the Faroe Islands were sampled in February 2005. In Sep- 590r 50 actcgtgtgaagctttacttcc 30 was used with the forward primer tember 2007 queen scallops (n = 10) and king scallops P. maximus 18e (Hillis and Dixon, 1991). The conditions for all PCR reactions L. (n = 10) were sampled from the west coast of Scotland (Fig. 1). were as follows: Initial denaturing 5 min at 95 °C followed by The scallops were either examined immediately after sampling 35 cycles of: 94 °C30s,55°C45s,72°C 1 min, with a terminal or kept for a maximum of one week in 170 L tanks supplied with extension of 72 °C 7 min. PCR bands of the expected sizes were seawater at 9 °C. recovered from the PCR products using a GeneMATRIX pcr prod- The scallops were dissected, shell height measured and samples ucts extraction kit (EURx Poland). PCR reactions were performed from all major organs examined with a compound microscope. in triplicate (three infected scallops). Sequencing reactions were Parasites present were identified and their distribution in organs performed using BigDyeTM Terminator Cycle Sequencing chemis- evaluated, using: (1) fresh mounts; samples from each organ try utilising the same oligonucleotide primers that were used for pressed between a glass slide and a coverslip and (2) histology; the original PCRs. DNA sequencing was performed in both forward all major organs fixed in Davidson’s fixative for 48 h and subse- and reverse directions for all PCR products and nucleotide BLAST quently dehydrated in 70% ethanol, embedded in paraffin wax, searches performed for each sequence to confirm an apicomplexan sectioned (4 lm), and stained with Giemsa according to routine origin. The contiguous sequence was obtained manually using Fig. 1. Sampling sites of scallops from Iceland, Scotland and the Faroe Islands (d). Á. Kristmundsson et al. / Journal of Invertebrate Pathology 108 (2011) 139–146 141 Fig. 4. Live specimens of two generations of Margolisiella islandica merozoites found free in the haemolymph. Scale bar = 4 lm. in was set at 2500 and trees were sampled every 100 generations Fig. 2. Histological section showing Margolisiella islandica trophozoites inside making a total of 7500 trees used to compile the majority rule con- auricular endothelial cells (arrows). Scale bar = 10 lm. sensus trees. Taxa used in phylogenetic analyses: Adelina grylli DQ096836; Ascogregarina taiwanensis DQ462454; Babesia gibsoni AF231350; CLUSTAL_X and BioEdit (Hall, 1999). For phylogenetic analyses, Besnoitia jellisoni AF291426; Colpodella pontica AY078092; Cryptos- taxa were chosen from BLAST searches that had similarities to poridium muris AB089284; C. parvum