DOCSLIB.ORG

University of California, San Diego

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
University of California, San Diego UNIVERSITY OF CALIFORNIA, SAN DIEGO Bypass suppression defines critical genomic regulation by the NuA4 acetyltransferase complex A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Biomedical Sciences by Naomi Searle Committee in Charge: Professor Lorraine Pillus, Chair Professor Dong-Er Zhang, Co-Chair Professor Dong Wang Professor Eugene Yeo Professor Huilin Zhou 2017 Copyright Naomi Searle, 2017 All rights reserved. Signature Page The Dissertation of Naomi Searle is approved, and it is acceptable in quality and form for publication on microfilm and electronically: Co-Chair Chair University of California, San Diego 2017 iii DEDICATION Dedication This dissertation is dedicated to my family, for all of the support, love, guidance, and inspiration. iv TABLE OF CONTENTS Table of Contents Signature Page .................................................................................................. iii Dedication ......................................................................................................... iv Table of Contents .............................................................................................. v List of Abbreviations ........................................................................................ viii List of Figures ................................................................................................... ix List of Tables .................................................................................................... xii Acknowledgements ......................................................................................... xiii Vita .................................................................................................................. xv Abstract ........................................................................................................... xvi Chapter 1. Introduction ...................................................................................... 1 Tip60 is the catalytic subunit of the NuA4 acetyltransferase complex. ............ 2 Enhancer of Polycomb is broadly conserved .................................................. 4 Comparative studies between model organisms promote functional definition ........................................................................................................................ 6 From basic function to translational significance ........................................... 12 Bypass suppression is a powerful genetic tool .............................................. 15 Promoting a balanced acetylation state allows for the bypass of ESA1 ........ 16 Bypass suppression to define key functions of chromatin modifying proteins17 Acknowledgements ....................................................................................... 20 References .................................................................................................... 21 Chapter 2. Chromatin regulation by the NuA4 acetyltransferase complex is mediated by essential interactions between Enhancer of Polycomb (Epl1) and Esa1 ................................................................................................................ 30 Abstract ......................................................................................................... 31 Introduction .................................................................................................... 31 Materials and Methods .................................................................................. 32 Yeast Strains and Plasmids ......................................................................... 32 Growth Assays ............................................................................................ 32 Flow Cytometry ............................................................................................ 32 Lysate preparation ....................................................................................... 33 Immunoprecipitation .................................................................................... 33 v Immunoblots ................................................................................................ 33 RNA-seq sample preparation and analysis ................................................. 33 qPCR validation ........................................................................................... 33 Data availability ........................................................................................... 34 Results ........................................................................................................... 34 Bypass and function of essential piccolo-NuA4 subunits ............................ 34 ESA1 and EPL1 bypass strains have nearly identical gene expression profiles ......................................................................................................... 35 Epl1 promotes the chromatin association of Esa1 ...................................... 36 Defining the critical regions of Epl1 in vivo .................................................. 37 Physical association between Esa1 and Epl1 is required for activity .......... 38 Discussion ..................................................................................................... 39 Acknowledgements ....................................................................................... 42 Literature Cited .............................................................................................. 43 Supplemental Materials ................................................................................. 44 Supplemental References ........................................................................... 48 Acknowledgements ....................................................................................... 49 Chapter 3. Bypass suppression defines chromatin dynamics between NuA4 and the Hda1 deacetylase ............................................................................... 50 Introduction .................................................................................................... 51 Class I deacetylases .................................................................................... 51 Class II deacetylases ................................................................................... 54 Class III deacetylases .................................................................................. 55 Opposing activities of NuA4 and the HDACs .............................................. 56 Results ........................................................................................................... 57 NuA4 has distinct interactions with histone deacetylases ........................... 57 Phenotypes of epl1∆ sds3∆ are selectively suppressed by deletion of HDACs. ........................................................................................................ 59 Epl1 is opposed by Hda1 independent of Rpd3L ........................................ 66 Discussion ..................................................................................................... 70 Hos1 and Hos3 may act in opposition to NuA4 at the rDNA locus and spindle pole body, respectively .................................................................... 71 Epl1’s interactions with Hst2 and Sir2 are distinct from Esa1’s genetic Interactions .................................................................................................. 72 Functional antagonism between Rpd3 and Hos2 ........................................ 74 The Hda1-Rpd3-NuA4 functional axis ......................................................... 75 References .................................................................................................... 79 Chapter 4. Defining the Esa1 Transcriptional Regulome ................................ 85 Introduction .................................................................................................... 86 Esa1 is important for global transcription .................................................... 86 Esa1 is involved in regulating the expression of ribosomal protein genes .. 87 Esa1 in ribosome biogenesis ....................................................................... 88 vi Bypass suppression to define the Esa1 transcriptional ‘regulome.’ ............ 89 Results ........................................................................................................... 90 Differential expression analysis of ESA1 bypass mutant to define Esa1- regulated gene expression .......................................................................... 90 Ribosome biogenesis genes are regulated by Esa1 ................................... 94 A transcriptional basis for the hda1∆-mediated rescue of esa1∆ sds3∆ mutant phenotypes .................................................................................... 100 Discussion ................................................................................................... 109 Transcriptome analysis of ESA1 bypass ................................................... 109 Understanding the significance of Esa1 in ribosome biogenesis .............. 110 The role of Hda1 in balancing regulation of ribosome biogenesis ............. 112 References .................................................................................................. 123 Chapter 5. Conclusions and Future Directions .............................................. 127 Epl1 is a critical Esa1-cofactor ...................................................................
Load more

Recommended publications
  • (P -Value<0.05, Fold Change≥1.4), 4 Vs. 0 Gy Irradiation
    Table S1: Significant differentially expressed genes (P -Value<0.05, Fold Change≥1.4), 4 vs. 0 Gy irradiation Genbank Fold Change P -Value Gene Symbol Description Accession Q9F8M7_CARHY (Q9F8M7) DTDP-glucose 4,6-dehydratase (Fragment), partial (9%) 6.70 0.017399678 THC2699065 [THC2719287] 5.53 0.003379195 BC013657 BC013657 Homo sapiens cDNA clone IMAGE:4152983, partial cds. [BC013657] 5.10 0.024641735 THC2750781 Ciliary dynein heavy chain 5 (Axonemal beta dynein heavy chain 5) (HL1). 4.07 0.04353262 DNAH5 [Source:Uniprot/SWISSPROT;Acc:Q8TE73] [ENST00000382416] 3.81 0.002855909 NM_145263 SPATA18 Homo sapiens spermatogenesis associated 18 homolog (rat) (SPATA18), mRNA [NM_145263] AA418814 zw01a02.s1 Soares_NhHMPu_S1 Homo sapiens cDNA clone IMAGE:767978 3', 3.69 0.03203913 AA418814 AA418814 mRNA sequence [AA418814] AL356953 leucine-rich repeat-containing G protein-coupled receptor 6 {Homo sapiens} (exp=0; 3.63 0.0277936 THC2705989 wgp=1; cg=0), partial (4%) [THC2752981] AA484677 ne64a07.s1 NCI_CGAP_Alv1 Homo sapiens cDNA clone IMAGE:909012, mRNA 3.63 0.027098073 AA484677 AA484677 sequence [AA484677] oe06h09.s1 NCI_CGAP_Ov2 Homo sapiens cDNA clone IMAGE:1385153, mRNA sequence 3.48 0.04468495 AA837799 AA837799 [AA837799] Homo sapiens hypothetical protein LOC340109, mRNA (cDNA clone IMAGE:5578073), partial 3.27 0.031178378 BC039509 LOC643401 cds. [BC039509] Homo sapiens Fas (TNF receptor superfamily, member 6) (FAS), transcript variant 1, mRNA 3.24 0.022156298 NM_000043 FAS [NM_000043] 3.20 0.021043295 A_32_P125056 BF803942 CM2-CI0135-021100-477-g08 CI0135 Homo sapiens cDNA, mRNA sequence 3.04 0.043389246 BF803942 BF803942 [BF803942] 3.03 0.002430239 NM_015920 RPS27L Homo sapiens ribosomal protein S27-like (RPS27L), mRNA [NM_015920] Homo sapiens tumor necrosis factor receptor superfamily, member 10c, decoy without an 2.98 0.021202829 NM_003841 TNFRSF10C intracellular domain (TNFRSF10C), mRNA [NM_003841] 2.97 0.03243901 AB002384 C6orf32 Homo sapiens mRNA for KIAA0386 gene, partial cds.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name Snf2-related CREBBP activator protein Gene Symbol SRCAP Organism Human Gene Summary This gene encodes the core catalytic component of the multiprotein chromatin-remodeling SRCAP complex. The encoded protein is an ATPase that is necessary for the incorporation of the histone variant H2A.Z into nucleosomes. It can function as a transcriptional activator in Notch-mediated CREB-mediated and steroid receptor-mediated transcription. Mutations in this gene cause Floating-Harbor syndrome a rare disorder characterized by short stature language deficits and dysmorphic facial features. Gene Aliases DOMO1, EAF1, FLJ44499, KIAA0309, SWR1 RefSeq Accession No. NC_000016.9, NT_010393.16 UniGene ID Hs.647334 Ensembl Gene ID ENSG00000080603 Entrez Gene ID 10847 Assay Information Unique Assay ID qHsaCID0006510 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000262518, ENST00000395059, ENST00000344771 Amplicon Context Sequence TGTGTGTAACATGCGCACCCAGTTCCCTGACTTAAGACTCATCCAGTATGATTGC GGAAAGTTGCAGACGTTGGCAGTGCTGTTGCGGCAGCTCAAGGCAGAGGGCCA CCGAGTGCTCATCTTCACCCAGATGACCCGAATGCTGGATGTATTGGAGCAG Amplicon Length (bp) 130 Chromosome Location 16:30740838-30744704 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 90 R2 0.9977 cDNA Cq 19.2 cDNA Tm (Celsius) 86.5 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report SRCAP, Human
    [Show full text]
  • Dynamics of Transcription Elongation Are Finely Tuned by Dozens of Regulatory Factors
    bioRxiv preprint doi: https://doi.org/10.1101/2021.08.15.456358; this version posted August 15, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Dynamics of transcription elongation are finely tuned by dozens of regulatory factors Mary Couvillion1*, Kevin M. Harlen1*, Kate C. Lachance1*, Kristine L. Trotta1, Erin Smith1, Christian Brion1, Brendan M. Smalec1, L. Stirling Churchman1 1Blavatnik Institute, Department of Genetics, Harvard Medical School, Boston, Massachusetts, USA 02115 *these authors contributed equally 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.08.15.456358; this version posted August 15, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. ABSTRACT Understanding the complex network and dynamics that regulate transcription elongation requires the quantitative analysis of RNA polymerase II (Pol II) activity in a wide variety of regulatory environments. We performed native elongating transcript sequencing (NET-seq) in 41 strains of S. cerevisiae lacking known elongation regulators, including RNA processing factors, transcription elongation factors, chromatin modifiers, and remodelers. We found that the opposing effects of these factors balance transcription elongation dynamics. Different sets of factors tightly regulate Pol II progression across gene bodies so that Pol II density peaks at key points of RNA processing.
    [Show full text]
  • Supporting Information
    Supporting Information Friedman et al. 10.1073/pnas.0812446106 SI Results and Discussion intronic miR genes in these protein-coding genes. Because in General Phenotype of Dicer-PCKO Mice. Dicer-PCKO mice had many many cases the exact borders of the protein-coding genes are defects in additional to inner ear defects. Many of them died unknown, we searched for miR genes up to 10 kb from the around birth, and although they were born at a similar size to hosting-gene ends. Out of the 488 mouse miR genes included in their littermate heterozygote siblings, after a few weeks the miRBase release 12.0, 192 mouse miR genes were found as surviving mutants were smaller than their heterozygote siblings located inside (distance 0) or in the vicinity of the protein-coding (see Fig. 1A) and exhibited typical defects, which enabled their genes that are expressed in the P2 cochlear and vestibular SE identification even before genotyping, including typical alopecia (Table S2). Some coding genes include huge clusters of miRNAs (in particular on the nape of the neck), partially closed eyelids (e.g., Sfmbt2). Other genes listed in Table S2 as coding genes are [supporting information (SI) Fig. S1 A and C], eye defects, and actually predicted, as their transcript was detected in cells, but weakness of the rear legs that were twisted backwards (data not the predicted encoded protein has not been identified yet, and shown). However, while all of the mutant mice tested exhibited some of them may be noncoding RNAs. Only a single protein- similar deafness and stereocilia malformation in inner ear HCs, coding gene that is differentially expressed in the cochlear and other defects were variable in their severity.
    [Show full text]
  • Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors
    University of Cincinnati Date: 12/20/2010 I, Arturo R Maldonado , hereby submit this original work as part of the requirements for the degree of Doctor of Philosophy in Developmental Biology. It is entitled: Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors Student's name: Arturo R Maldonado This work and its defense approved by: Committee chair: Jeffrey Whitsett Committee member: Timothy Crombleholme, MD Committee member: Dan Wiginton, PhD Committee member: Rhonda Cardin, PhD Committee member: Tim Cripe 1297 Last Printed:1/11/2011 Document Of Defense Form Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors A dissertation submitted to the Graduate School of the University of Cincinnati College of Medicine in partial fulfillment of the requirements for the degree of DOCTORATE OF PHILOSOPHY (PH.D.) in the Division of Molecular & Developmental Biology 2010 By Arturo Rafael Maldonado B.A., University of Miami, Coral Gables, Florida June 1993 M.D., New Jersey Medical School, Newark, New Jersey June 1999 Committee Chair: Jeffrey A. Whitsett, M.D. Advisor: Timothy M. Crombleholme, M.D. Timothy P. Cripe, M.D. Ph.D. Dan Wiginton, Ph.D. Rhonda D. Cardin, Ph.D. ABSTRACT Since 1999, cancer has surpassed heart disease as the number one cause of death in the US for people under the age of 85. Malignant Peripheral Nerve Sheath Tumor (MPNST), a common malignancy in patients with Neurofibromatosis, and colorectal cancer are midkine- producing tumors with high mortality rates. In vitro and preclinical xenograft models of MPNST were utilized in this dissertation to study the role of midkine (MDK), a tumor-specific gene over- expressed in these tumors and to test the efficacy of a MDK-transcriptionally targeted oncolytic HSV-1 (oHSV).
    [Show full text]
  • Yeast Genes Illuminate Human Cancer Gene Functions
    Oncogene (2007) 26, 5373–5384 & 2007 Nature Publishing Group All rights reserved 0950-9232/07 $30.00 www.nature.com/onc REVIEW MYST opportunities for growth control: yeast genes illuminate human cancer gene functions A Lafon, CS Chang, EM Scott, SJ Jacobson and L Pillus Section of Molecular Biology, Division of Biological Sciences, UCSD Moores Cancer Center, University of California, San Diego, La Jolla, CA, USA The MYST family of histone acetyltransferases (HATs) genes were identified with potential roles in chromatin- was initially defined by human genes with disease mediated gene control, even modest degrees of similarity connections and by yeast genes identified for their role to the acetyl-CoA-binding regions were viewed with in epigenetic transcriptional silencing. Since then, many special interest as candidate HATs. new MYST genes have been discovered through genetic Such interest was particularly the case when mutants and genomic approaches. Characterization of the com- of SAS2 (something about silencing) were discovered as plexes through which MYST proteins act, regions of enhancers of mutations in the epigenetic transcriptional the genome to which they are targeted and biological silencer factor Sir1 (Reifsnyder et al., 1996) and consequences when they are disrupted, all deepen the suppressors of defects in cis-regulatory sequences for connections of MYST proteins to development, growth silent chromatin (Reifsnyder et al., 1996; Ehrenhofer- control and human cancers. Many of the insights into Murray et al., 1997). The observation that SAS2 and the MYST family function have come from studies in model closely related SAS3 yeast genes shared similarity to organisms. Herein, we review functions of two of the acetyl-CoA-binding domains, and even more significant founding MYST genes, yeast SAS2 and SAS3, and the similarity to two human genes, MOZ (Borrow et al., essential yeast MYST ESA1.
    [Show full text]
  • Identification of a Panel of MYC and Tip60 Co-Regulated Genes Functioning Primarily in Cell Cycle and DNA Replication
    www.Genes&Cancer.com Genes & Cancer, Vol. 9 (3-4), March 2018 Identification of a panel of MYC and Tip60 co-regulated genes functioning primarily in cell cycle and DNA replication Ling-Jun Zhao1, Paul M. Loewenstein1 and Maurice Green1 1 Department of Microbiology and Molecular Immunology, Saint Louis University School of Medicine, Doisy Research Center, St. Louis, Missouri, USA Correspondence to: Paul M. Loewenstein, email: [email protected] Keywords: MYC; NuA4 complex; Tip60; p300; cancer Received: May 16, 2018 Accepted: July 22, 2018 Published: July 29, 2018 Copyright: Zhao et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License 3.0 (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT We recently reported that adenovirus E1A enhances MYC association with the NuA4/Tip60 histone acetyltransferase (HAT) complex to activate a panel of genes enriched for DNA replication and cell cycle. Genes from this panel are highly expressed in examined cancer cell lines when compared to normal fibroblasts. To further understand gene regulation in cancer by MYC and the NuA4 complex, we performed RNA-seq analysis of MD-MB231 breast cancer cells following knockdown of MYC or Tip60 - the HAT enzyme of the NuA4 complex. We identify here a panel of 424 genes, referred to as MYC-Tip60 co-regulated panel (MTcoR), that are dependent on both MYC and Tip60 for expression and likely co-regulated by MYC and the NuA4 complex. The MTcoR panel is most significantly enriched in genes involved in cell cycle and/ or DNA replication.
    [Show full text]
  • Distinct Transcriptomes Define Rostral and Caudal 5Ht Neurons
    DISTINCT TRANSCRIPTOMES DEFINE ROSTRAL AND CAUDAL 5HT NEURONS by CHRISTI JANE WYLIE Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Dissertation Advisor: Dr. Evan S. Deneris Department of Neurosciences CASE WESTERN RESERVE UNIVERSITY May, 2010 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the thesis/dissertation of ______________________________________________________ candidate for the ________________________________degree *. (signed)_______________________________________________ (chair of the committee) ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ (date) _______________________ *We also certify that written approval has been obtained for any proprietary material contained therein. TABLE OF CONTENTS TABLE OF CONTENTS ....................................................................................... iii LIST OF TABLES AND FIGURES ........................................................................ v ABSTRACT ..........................................................................................................vii CHAPTER 1 INTRODUCTION ............................................................................................... 1 I. Serotonin (5-hydroxytryptamine, 5HT) ....................................................... 1 A. Discovery..............................................................................................
    [Show full text]
  • Atlas Journal
    Atlas of Genetics and Cytogenetics in Oncology and Haematology Home Genes Leukemias Solid Tumours Cancer-Prone Deep Insight Portal Teaching X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA Atlas Journal Atlas Journal versus Atlas Database: the accumulation of the issues of the Journal constitutes the body of the Database/Text-Book. TABLE OF CONTENTS Volume 7, Number 2, Apr-Jun 2003 Previous Issue / Next Issue Genes AML1 (acute myeloid leukemia 1); CBFA2; RUNX1 (runt-related transcription factor 1 (acute myeloid leukemia 1; aml1 oncogene)) (21q22.3) - updated. Jean-Loup Huret, Sylvie Senon. Atlas Genet Cytogenet Oncol Haematol 2003; 7 (2): 163-170. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/AML1.html MAPK8 (mitogen-activated protein kinase 8) (10q11.21). Fei Chen. Atlas Genet Cytogenet Oncol Haematol 2003; 7 (2): 171-178. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/JNK1ID196.html MAPK9 (mitogen-activated protein kinase 9) (5q35). Fei Chen. Atlas Genet Cytogenet Oncol Haematol 2003; 7 (2): 179-184. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/JNK2ID426.html MAPK10 (mitogen-activated protein kinase 10) (4q21-q23). Fei Chen. Atlas Genet Cytogenet Oncol Haematol 2003; 7 (2): 185-190. [Full Text] [PDF] Atlas Genet Cytogenet Oncol Haematol 2003; 2 I URL : http://AtlasGeneticsOncology.org/Genes/JNK3ID427.html JUNB (19p13.2). Fei Chen. Atlas Genet Cytogenet Oncol Haematol 2003; 7 (2): 191-195. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/JUNBID178.html JUN-D proto-oncogene (19p13.1-p12). Fei Chen.
    [Show full text]
  • Methyl-Cpg-Binding Domain 9 (MBD9) Is Required for H2A.Z Incorporation Into Chromatin at a Subset of H2A.Z-Enriched Regions in the Arabidopsis Genome
    bioRxiv preprint doi: https://doi.org/10.1101/404152; this version posted August 30, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Methyl-CpG-binding domain 9 (MBD9) is required for H2A.Z incorporation into chromatin at a subset of H2A.Z-enriched regions in the Arabidopsis genome Paja Sijacic1, Dylan H. Holder1,2, Marko Bajic1,2, and Roger B. Deal1* 1Department of Biology 2Graduate Program in Genetics and Molecular Biology Emory University, Atlanta, GA 30322 USA *Correspondence: Roger B. Deal; [email protected] ABSTRACT The SWR1 chromatin remodeling complex, which deposits the histone variant H2A.Z into nucleosomes, has been characterized in yeast and animals but had not been purified from plants. We used the conserved SWR1 subunit ACTIN RELATED PROTEIN 6 (ARP6) as bait in tandem affinity purification experiments to isolate associated proteins from Arabidopsis thaliana. We identified all 11 subunits found in yeast SWR1 and the homologous mammalian SRCAP complexes, demonstrating that this complex is conserved in plants. We also identified several additional proteins not previously associated with SWR1, including Methyl-CpG-BINDING DOMAIN 9 (MBD9). Since mbd9 mutant plants were phenotypically similar to arp6 mutants, we further explored a potential role for MBD9 in H2A.Z deposition. We found that MBD9 is required for proper H2A.Z incorporation at thousands of discrete sites, which represent a subset of the regions normally enriched with H2A.Z.
    [Show full text]
  • Sheet1 Page 1 Gene Symbol Gene Description Entrez Gene ID
    Sheet1 RefSeq ID ProbeSets Gene Symbol Gene Description Entrez Gene ID Sequence annotation Seed matches location(s) Ago-2 binding specific enrichment (replicate 1) Ago-2 binding specific enrichment (replicate 2) OE lysate log2 fold change (replicate 1) OE lysate log2 fold change (replicate 2) Probability Pulled down in Karginov? NM_005646 202813_at TARBP1 Homo sapiens TAR (HIV-1) RNA binding protein 1 (TARBP1), mRNA. 6894 TR(1..5130)CDS(1..4866) 4868..4874,5006..5013 3.73 2.53 -1.54 -0.44 1 Yes NM_001665 203175_at RHOG Homo sapiens ras homolog gene family, member G (rho G) (RHOG), mRNA. 391 TR(1..1332)CDS(159..734) 810..817,782..788,790..796,873..879 3.56 2.78 -1.62 -1 1 Yes NM_002742 205880_at PRKD1 Homo sapiens protein kinase D1 (PRKD1), mRNA. 5587 TR(1..3679)CDS(182..2920) 3538..3544,3202..3208 4.15 1.83 -2.55 -0.42 1 Yes NM_003068 213139_at SNAI2 Homo sapiens snail homolog 2 (Drosophila) (SNAI2), mRNA. 6591 TR(1..2101)CDS(165..971) 1410..1417,1814..1820,1610..1616 3.5 2.79 -1.38 -0.31 1 Yes NM_006270 212647_at RRAS Homo sapiens related RAS viral (r-ras) oncogene homolog (RRAS), mRNA. 6237 TR(1..1013)CDS(46..702) 871..877 3.82 2.27 -1.54 -0.55 1 Yes NM_025188 219923_at,242056_at TRIM45 Homo sapiens tripartite motif-containing 45 (TRIM45), mRNA. 80263 TR(1..3584)CDS(589..2331) 3408..3414,2437..2444,3425..3431,2781..2787 3.87 1.89 -0.62 -0.09 1 Yes NM_024684 221600_s_at,221599_at C11orf67 Homo sapiens chromosome 11 open reading frame 67 (C11orf67), mRNA.
    [Show full text]
  • Datasheet: AHP962 Product Details
    Datasheet: AHP962 Description: RABBIT ANTI HISTONE H4 (Ac5) Specificity: HISTONE H4 Ac5 Format: Serum Product Type: Polyclonal Antibody Isotype: Polyclonal IgG Quantity: 0.1 ml Product Details Applications This product has been reported to work in the following applications. This information is derived from testing within our laboratories, peer-reviewed publications or personal communications from the originators. Please refer to references indicated for further information. For general protocol recommendations, please visit www.bio-rad-antibodies.com/protocols. Yes No Not Determined Suggested Dilution Flow Cytometry Immunohistology - Frozen Immunohistology - Paraffin ELISA 1/1000 Immunoprecipitation Western Blotting 1/600 Immunofluorescence 1/400 Chromatin Immunoprecipitation Where this antibody has not been tested for use in a particular technique this does not necessarily exclude its use in such procedures. Suggested working dilutions are given as a guide only. It is recommended that the user titrates the antibody for use in their own system using appropriate negative/positive controls. Target Species Synthetic Peptide Species Cross Reacts with: Mammals, Drosophila, Amphibia, Yeast, Plants Reactivity N.B. Antibody reactivity and working conditions may vary between species. Product Form Serum - liquid Antiserum Preparation Antisera to acetylated histone H4 were raised by repeated immunisation of rabbits with highly purified antigen. Preservative 0.09% Sodium Azide Stabilisers Immunogen Ovalbumin-conjugated peptide: NSGRGAcKGGKGLCc. External Database Links UniProt: P62805 Related reagents Page 1 of 3 Entrez Gene: 554313 HIST2H4B Related reagents Synonyms H4/A, H4/B, H4/C, H4/D, H4/E, H4/G, H4/H, H4/I, H4/J, H4/K, H4/M, H4/N, H4/O, H4F2, H4FA, H4FB, H4FC, H4FD, H4FE, H4FG, H4FH, H4FI, H4FJ, H4FK, H4FM, H4FN, H4FO, HIST2H4 Specificity Rabbit anti Histone H2 (Ac5) antibody recognizes Histone H4 when acetylated at lysine 5.
    [Show full text]