Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors

University of Cincinnati

Date: 12/20/2010

I, Arturo R Maldonado , hereby submit this original work as part of the requirements for the degree of Doctor of Philosophy in Developmental Biology.

It is entitled: Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors

Student's name: Arturo R Maldonado

This work and its defense approved by:

Committee chair: Jeffrey Whitsett

Committee member: Timothy Crombleholme, MD

Committee member: Dan Wiginton, PhD

Committee member: Rhonda Cardin, PhD

Committee member: Tim Cripe

1297

Last Printed:1/11/2011 Document Of Defense Form Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1

to Midkine Expressing Tumors

A dissertation submitted to the

Graduate School of the University of Cincinnati College of Medicine

in partial fulfillment of the requirements for the degree of

DOCTORATE OF PHILOSOPHY (PH.D.)

in the Division of Molecular & Developmental Biology

2010

Arturo Rafael Maldonado

B.A., University of Miami, Coral Gables, Florida June 1993

M.D., New Jersey Medical School, Newark, New Jersey June 1999

Committee Chair: Jeffrey A. Whitsett, M.D. Advisor: Timothy M. Crombleholme, M.D. Timothy P. Cripe, M.D. Ph.D. Dan Wiginton, Ph.D. Rhonda D. Cardin, Ph.D. ABSTRACT

Since 1999, cancer has surpassed heart disease as the number one cause of death in the

US for people under the age of 85. Malignant Peripheral Nerve Sheath Tumor (MPNST), a common malignancy in patients with Neurofibromatosis, and colorectal cancer are midkine- producing tumors with high mortality rates. In vitro and preclinical xenograft models of MPNST were utilized in this dissertation to study the role of midkine (MDK), a tumor-specific gene overexpressed in these tumors and to test the efficacy of a MDK-transcriptionally targeted oncolytic

HSV-1 (oHSV). The overall goals of this dissertation were to 1) discover mechanistic insights into the role of MDK in cancer using a feature-enabled bioinformatics approach and to 2) exploit MDK biology to increase the efficacy of oncolytic HSV-1 towards MPNST tumors without compromising safety.

To search for mechanistic insights into the role of MDK in cancer, A Pearson correlation of genes that co-express with MDK in 121 microarrays of MPNST and colorectal cancers was performed. A cluster of 348 genes that were co-regulated with MDK were identified. MDK co- expressed genes significantly enriched in functional categories such as DNA replication and cell cycle regulation. Out of 348 genes, 66 are transcription complex genes, many of which have been associated with cancer or shown to be cancer causal genes, such as HMGB1, CREB1, and

YY1. To assess upstream regulation of MDK co-expressed genes, a cis-element promoter analysis was performed and predicted enrichment of 4 elements: HLF, NFIL3, MEF2A, and FOXD3, a possible cis-regulatory module. Validation and functional studies are needed to confirm these hypotheses.

oHSV has been engineered to be safe by deletion of viral genes necessary for virus replication and killing in normal cells. To target midkine-producing tumors, oHSV-MDK-34.5 iii

was engineered for this dissertation which contains the HSV-1 neurovirulence γ134.5 transgene driven by the MDK promoter. The HSV neurovirulence protein ICP34.5 has been shown to increase virus replication and infectivity by preventing the shutdown of host cell protein translation. oHSV-MDK-34.5 targeted MDK-producing MPNST with increased replication and oncolysis yet retains attenuation in normal non-MDK producing tissues. MDK promoter activity and transgene biological activity was confirmed in human MPNST (S462, STS26T) and Ewing sarcoma cells (A673). In vitro replication and cytotoxicity in human fibroblasts and STS26T cells by plaque and MTT assays showed that oHSV-MDK-34.5 increased replication and cytotoxicity compared to the Luciferase-containing control virus, oHSV-MDK-Luc. In contrast, no significant difference in cytotoxicity was detected between these viruses in normal human fibroblasts. oHSV-MDK-34.5 impaired in vivo STS26T tumor growth and increased median survival of tumor-bearing nude mice. No evidence of extratumoral spread of oHSV-MDK-34.5 was found in nude mouse organs 14 days after tumor injection. The novel MDK-targeted oncolytic virus engineered in this dissertation, oHSV-MDK-34.5, successfully impaired human

MPNST tumor growth and prolonged the survival of MPNST tumor-bearing mice without compromising tumor-specificity and safety. This oHSV is a new addition to the armamentarium of oncolytic viruses being studied for personalized anti-cancer therapy.

RESEARCH GRANTS & AWARDS

The work in this dissertation was supported by a research award from the National

Cancer Institute, grants from the NIH, and a grant from the Shriners Hospitals for Children.

NIH NCI National Research Service Award F31 CA132613-01 (Arturo Maldonado PI)

R01 DK074055 (Timothy Crombleholme PI)

R01 DK072446 (Timothy Crombleholme PI)

R01 CA114004 (Timothy Cripe PI)

R21 CA133663 (Timothy Cripe PI)

Shriners Hospitals for Children Grant 8901 (Timothy Crombleholme PI)

ACKNOWLEDGEMENTS

Most special thanks to my thesis committee members and mentors Drs. Timothy

Crombleholme, Timothy Cripe, Jeffrey Whitsett, Dan Wiginton, Rhonda Cardin, Bruce Aronow,

Anil Jegga and Punam Malik for your insight, instruction and leadership. Thanks to the students of the University of Cincinnati Graduate Programs in Molecular and Developmental Biology,

Cell and Cancer Biology, and Neuroscience: especially Hongyan Zhu, Karunyakanth (KK)

Mandapaka, David Hahn, Diva Jonatan and Tom Lu for friendship, scientific discussion and support.

Thanks to the members of the Crombleholme, Cripe and Malik laboratories. Special thanks to the Crombleholme laboratory: Chuck Klanke, Jose Fernando Solis Vuletin, Shuichi

Katayama, Sundeep Keswani, Foong Lim, Mounira Habli, Louis Le and Stephanie Lang. Also thanks to the Cripe laboratory: Mark Currier, Pin-Yi Wang, William Baird and Jennifer Leddon.

Also special thanks to the Malik laboratory: Drs. Tomoyasu Higashimoto and Ping Xia.

Very special thanks to Drs. Helen Jones and Yoni Mahller, for the excellent scientific discussions, encouragement, guidance, and friendship. My warmest and deepest gratitude goes to

Drs. Timothy Crombleholme and Timothy Cripe for their unbridled support, enthusiasm and mentorship. Without their assistance, this work would not have been possible.

Thanks to Paul Steele, M.D., director of the Cincinnati Children’s clinical laboratory for advice and technical assistance. Very special thanks to Jessica and Betsy Honig for scientific discussions and manuscript assistance. Also, thanks to my collaborators Drs. Yoshinaga Saeki,

E. Antonio Chiocca, Balveen Kaur (The Ohio State University), Robert Cohen (University of

Cincinnati), Ian Mohr (SUNY at Stony Brook). Thanks to Michael Burhans, John Shannon

vii

(Cincinnati Children’s Research Foundation), and Kazunari Yokoyama (RIKEN Institute,

Ibaraki, Japan) for kindly providing advice and reagents.

My warmest and special thanks to Katrina and my family for unwavering love and support.

viii

TABLE OF CONTENTS

ABSTRACT ...... iii

RESEARCH GRANTS & AWARDS ...... vi

ACKNOWLEDGEMENTS ...... vii

LIST OF FIGURES AND TABLES ...... xii

CHAPTER 1: General Introduction ...... 1

Overall background and clinical significance ...... 1 A brief history of chemotherapy and the advent of molecular therapy for cancer ...... 2 Oncolytic Viruses: Cancer killing viruses as an emerging treatment for cancer ...... 4 The era of recombinant viral oncolytics: increasing oncolytic efficacy and biosafety ...... 6 Virus-mediated cancer cell lysis ...... 7 Transcriptional targeting: an approach to increasing oncolytic efficacy and to personalized predictive oncologic medicine ...... 7 Advantages of Oncolytic HSV (oHSV) for cancer treatment ...... 8 The research problem: improving oncolytic HSV-1 efficacy without compromising biosafety ...... 9 The oHSV constructed for transcriptional targeting: oHSV-MDK-34.5 ...... 9 The role of the HSV-1 protein ICP34.5 in evading viral host defense ...... 10 Developmental and cancer-specific MDK expression ...... 11 Transcriptional regulation and systems biological analyses of the MDK promoter in cancer ...... 12 Transcriptional targeting using the MDK promoter ...... 12 Generalizability of transcriptional targeting and personalized predictive medicine ...... 13 The feasibility of oHSV-MDK-34.5 as an anti-cancer therapeutic in humans ...... 13 The overall goals of this dissertation ...... 17

References ...... 19 ix

CHAPTER 2: Mechanistic Insights into The Role of MDK Over-Expression in Cancer .... 25

Abstract ...... 25 Introduction ...... 26 Materials & Methods ...... 31 Results ...... 35 Discussion ...... 52

References ...... 63

CHAPTER 3: Molecular Engineering, Efficacy, and Safety of an Oncolytic HSV-1 Transcriptionally Targeted to Midkine-Positive Tumors ...... 69

Abstract ...... 69 Introduction ...... 70 Materials & Methods ...... 73 Results ...... 83 Discussion ...... 122

References ...... 129

CHAPTER 4: General Conclusions and Discussion ...... 134

Summary ...... 134 Novel Findings, Implications and Future Studies ...... 138 Conclusion ...... 143

References ...... 145

APPENDIX A: Systems Biology, Biomedical Informatics & Computational Analyses ..... 148

Like-Midkine co-regulated genes ...... 148

APPENDIX B: MDK Promoter Response Element Maps ...... 149

Hypoxia response element consensus sequences ...... 149

APPENDIX C: Journal of Gene Medicine Publication ...... 150

Abstract ...... 151 Introduction ...... 152 x

Materials & Methods ...... 154 Results ...... 160 Discussion ...... 166

References ...... 177

LIST OF FIGURES AND TABLES

` Figure 1-1: Kaplan-Meier analysis of human survival after MPNST diagnosis categorized by tumor location. (Adapted from Leroy, Arch Dermatol 2001 (Leroy, Dumas et al. 2001)) ...... 3 Table 1-1: Early oncolytic virus clinical trials and reported outcomes ...... 6 Figure 1-2: Host cell defense and HSV ICP34.5 ...... 15 Table 1-2: List of MDK-expressing pediatric and adult cancers (Pubmed and Novartis cancer database) ...... 16 Figure 1-3: MDK expression is higher in cancer than normal tissues (NCI Cancer Genome Anatomy Project database) ...... 17 Figure 2-1: Bioinformatics-enabled approach to analyzing the MDK gene signature in adult and pediatric tumors...... 30 Figure 2-2: 348 genes are co-regulated with MDK expression in MPNST and colorectal cancers...... 37 Table 2-1: The 348 MDK co-expressed genes enrich in stem cell and proliferation genes...... 38 Figure 2-3: mRNA heatmap of 66 transcription complex proteins co-expressed with MDK in MPNST and colorectal cancers...... 40 Figure 2-4: Protein-protein interaction network among 66 transcription complex genes in the cancer MDK signature...... 42 Table 2-2: 10 out of 348 MDK co-expressed genes are cancer causal genes...... 43 Table 2-3: cis-Elements enriched in 348 like MDK genes...... 45 Figure 2-5: MDK interconnectivity with 4 enriched cis-elements...... 47 Figure 2-6: Venn diagram of shared downstream targets of the enriched cis-elements in 348 MDK co- regulated genes...... 49 Table 2-4: 67 genes which share all 4 predicted cis-elements enrich for renal cancer genes and stem cell gene signatures...... 49 Table 2-5: Genome-wide prediction of potential cis-element cassettes containing the 4 predicted cis- elements in the MDK signature...... 51 Figure 2-7: Proposed molecular mechanism for MDK modulation of gene signature in tumorigenic and chemoresistant cell...... 59 Supplemental Figure 2-1: Transcription complex proteins in the MDK gene signature...... 61 Supplemental Figure 2-2: Enriched cis-elements in 66 like MDK transcription complex proteins...... 62 Figure 3-1: Affymetrix© MDK Probeset 38124_at ...... 85 Figure 3-2: MDK shows variable over-expression in primary human cancers in the Novartis U95 cancer database ...... 86 Figure 3-3: Confirmation of MDK expression in cell lines derived from human tumors...... 87 Figure 3-4: Confirmation of activity of the MDK promoter luciferase plasmid in S462 MPNST cells . 88 Figure 3-5: Viral Schema ...... 90

xii

Figure 3-6: Bacterial artificial chromosome recombination system (Terada, Wakimoto et al. 2006) ... 92 Figure 3-7: Successful recombination was verified by restriction digest using HindIII...... 94 Figure 3-8: Viral clones were screened for GFP-positive and RFP-negative plaque formation on a monolayer of Vero cells ...... 95 Figure 3-9: The MDK promoter can transcribe functional transgenes preferentially in S462 tumor cells ...... 98 Figure 3-10: The MDK promoter can drive transgene transcription in MDK-expressing MPNST cells ...... 100

Figure 3-11: Viral replication efficiency and cytotoxicity increases with and is dependent on γ134.5 transgene activity in STS26T cells...... 103 Figure 3-12: Quantity of viral genomes as an indirect measure of replication are dependent on the

γ134.5 transgene in STS26T cells...... 105

Figure 3-13: The γ134.5 transgene increases cytotoxicity in STS26T cells...... 106

Figure 3-14: The γ134.5 transgene increases the viral replication efficiency and cytotoxicity in STS26T cells, but not in fibroblasts...... 109 Figure 3-15a-d (STS26T): Transcriptional targeting of oHSV-MDK-34.5 is generalizable and the promoter activity of MDK is comparable to nestin in transcriptional targeting, but both attenuated viruses show lower tumor cytotoxicity compared to wild type HSV-1...... 111 Figure 3-15e-h (A673): Transcriptional targeting of oHSV-MDK-34.5 is generalizable and the promoter activity of MDK is comparable to nestin in transcriptional targeting, but both attenuated viruses show lower tumor cytotoxicity compared to wild type HSV-1...... 112 Figure 3-16: oHSV-MDK-34.5 impairs the growth of STS26T tumors in nude mice and increases the survival of tumor-bearing mice ...... 115 Figure 3-17: oHSV-MDK-34.5 in vivo replication in MPNST is more efficient than oHSV-MDK-Luc ...... 117 Figure 3-18: There are no detectable viral genomes at Day 14 post-IT injection in nude mouse organs ...... 118 Figure 3-19: oHSV-MDK-34.5 infection is tumor-specific and does not result in any clinically significant impairment in bone marrow, hepatic, or renal function in nude mice ...... 121 Supplemental Figure 3-1: Nestin shows variable over-expression in cancers in the Novartis NCI60 cancer database ...... 128 Figure 4-1: Proposed molecular mechanism for MDK modulation of gene signature in tumorigenic and chemoresistant cell...... 137 Figure C-1: MDK over-expression is variable in primary human cancers in the Novartis cancer database ...... 171 Figure C-2: MDK expression in cell lines derived from human tumors ...... 172 Figure C-3: Viral Schema ...... 173 Figure C-4: The MDK promoter can drive functional transgenes preferentially in tumor cells ...... 174

Figure C-5: The γ134.5 transgene increases the viral replication efficiency and cytotoxicity in tumor cells, but not in normal cells ...... 175

xiii

Figure C-6: oHSV-MDK-34.5 impairs the growth of STS26T tumors in nude mice and increases the survival of tumor-bearing mice ...... 176

xiv

CHAPTER 1: General Introduction

Overall background and clinical significance

Cancer is the most common cause of death for those under age 85 in the United States

(Jemal, Murray et al. 2005; Twombly 2005). Despite advances in chemotherapy since the introduction of nitrogen mustards and folate antagonists in the 1940’s, cancer related death is still a significant problem worldwide. Advances have been made in some cancers, but in others, little progress has been made. Malignant peripheral nerve sheath tumor (MPNST), studied in this thesis, has an overall mortality of approximately 85% at 5 years (Leroy, Dumas et al. 2001;

Gatta, Capocaccia et al. 2002). With current surgical, chemotherapy and radiation treatments the overall median survival of MPNST is 21 months after diagnosis (Figure 1-1) (Leroy, Dumas et al. 2001).

Novel advances in the development of gene therapy for the treatment of cancer have arisen from the implementation of personalized and predictive genomic medicine (Fackler and

McGuire 2009; Madhavan, Zenklusen et al. 2009; Tanaka 2010). Oncolytic viruses, such as recombinant oncolytic HSV-1 (oHSV), are targeted therapeutics that are being developed for personalized cancer virotherapy (Kaur and Chiocca 2007; Guo, Thorne et al. 2008). The gene used in this dissertation to increase the anti-cancer efficacy of oHSV is midkine (MDK), a gene that is expressed at high levels in MPNST and other cancers, but expressed at low levels postnataly in non-tumor tissue (Iwasaki, Nagata et al. 1997; Mashour, Ratner et al. 2001;

Muramatsu 2002; Stoica, Kuo et al. 2002; Sumi, Muramatsu et al. 2002; Reynolds, Mucenski et al. 2004; Watson, Perry et al. 2004; Miller, Rangwala et al. 2006). The goals of this dissertation were to understand the role of MDK in cancer biology and to exploit MDK tumor biology by

designing, engineering and testing the first MDK-targeted oncolytic herpes simplex virus type 1

(HSV-1) for the treatment of MPNST.

A brief history of chemotherapy and the advent of molecular therapy for cancer

The first chemotherapeutics discovered where nitrogen mustards and folate antagonists, which were found to successfully treat Hodgkin’s lymphoma and other blood cancers in the

1940’s (Goodman, Wintrobe et al. 1946). These compounds decreased lymphopoiesis by inhibiting DNA replication through nucleic acid alkylation and inhibition of nucleic acid synthesis (Farber and Diamond 1948; Bertino 1963). Later, in the 1950’s, came the vinca alkaloids which were found to inhibit cell proliferation by interfering with microtubule polymerization and mitotic spindle metabolism (Armstrong, Dyke et al. 1962; Johnson,

Armstrong et al. 1963). In 1965, Holland and colleagues published a large multi-center trial in which multi-drug regimens were used to induce and maintain remission of acute leukemia in children (Frei, Karon et al. 1965). In the 1970’s, adjuvant chemotherapy, therapy after surgical resection of a solid tumor, was found to be more effective because of the reduction in micro- metastatic disease and resulted in prolonged survival of patients with cancer (Frei 1967; Jaffe,

Frei et al. 1974; Frei, Jaffe et al. 1978). In the 1990’s, molecular-targeted cancer therapy was realized with imatinib, an inhibitor that acts on the tyrosine kinases Bcr-Abl and c-kit. Imatinib was found to selectively inhibit the progression of chronic myelogenous leukemia (CML)

(Druker, Tamura et al. 1996; Heinrich, Griffith et al. 2000) and gastrointestinal stromal tumors

(GIST) (Demetri, von Mehren et al. 2002) with minimal toxicity to normal tissues. During this period, recombinant monoclonal antibodies were humanized and became effective for anti- cancer therapy, the first being anti-CD20 (rituximab) for non-Hodgkin lymphoma (Coiffier 2

2007). Despite these innovative approaches, the majority of chemotherapeutics used today are poisons that cause normal tissue toxicity leading to poor tolerance among patients (Krischer,

Epstein et al. 1997; Muschel, Soto et al. 1998). Poor tolerance, severe sequelae to treatment, chemotherapy resistance, and radiation resistance have driven research into new therapies that are tumor specific and non-toxic to normal tissues. The latest technological advancements in chemotherapy such as tyrosine kinase small molecule inhibitors, humanized monoclonal antibodies, and oncolytic viruses have been possible in part because of breakthroughs in molecular biology. These molecular targeted approaches exploit specific molecular signatures of cancer cells in order to increase treatment efficacy while decreasing toxicity and side effects

(Cattaneo, Miest et al. 2008; Hait and Hambley 2009; Horn and Sandler 2009).

100

Peripheral MPNST 50 % Survival

Axial MPNST 0 25 50 75 100 Months

Figure 1-1: Kaplan-Meier analysis of human survival after MPNST diagnosis categorized by tumor location. (Adapted from Leroy, Arch Dermatol 2001 (Leroy, Dumas et al. 2001))

Graph represents a Kaplan-Meier survival analysis of 17 patients with histologically proven

MPNST. Survival was subcategorized for tumor location close to the spine (Axial) and away from the spine (Peripheral).

Oncolytic Viruses: Cancer killing viruses as an emerging treatment for cancer

The ability of viruses to kill cancer was known and studied for over 100 years before the world’s first oncolytic virus, a genetically modified adenovirus, was approved in China for the treatment of head and neck cancer in 2005 (Frew, Sammut et al. 2008). Since the mid-1800’s, case reports of cancer remission during viral illnesses were published, even before viruses were discovered by Ivanovsky and Beijerinck in the 1890’s (Lustig and Levine 1992; Bos 1999). One of the most referenced case reports was published in 1904 by George Dock, M.D (Dock 1904). A

48 year old woman presented to him in 1896 with a diagnosis of myelogenous leukemia for which he treated her with Fowler’s solution (Antman 2001), a 1% arsenic solution, and discharged her from the hospital. A few months later, she was readmitted to the hospital with a severe case of influenza. During the second hospitalization, Dr. Dock documented that her splenomegaly and hepatomegaly progressively diminished in size until her physical exam was normal. Also, her complete blood count showed a normalization of her leukocytosis during this period of cancer remission. When she was discharged from the hospital, there was no clinical or laboratory evidence of her leukemia. Approximately six months after her discharge from the hospital, her leukemia recurred and she succumbed to her disease.

There are other reports of cancer remissions after viral illness including a 4 year old boy who went in to remission of his leukemia after a bout of chickenpox. The leukemia recurred a month later and he subsequently expired (Bierman, Crile et al. 1953; Kelly and Russell 2007).

These case reports, the discovery of viruses in the 1890’s (Lustig and Levine 1992; Bos 1999), the development of plaque assays for viral quantification in 1917 (d'Herelle 1917) and the studying of oncolytic viruses in animal xenograft models in the 1940’s (Moore 1949) led to clinical trials for the treatment of cancer with a variety of wild-type viruses such as hepatitis B virus (Hoster, Zanes et al. 1949), West Nile virus, adenovirus, and mumps virus (Table 1-1)

(Kelly and Russell 2007). In these early studies, patients were infected with unpurified wild-type viruses from human serum, tissue extracts or tissue culture supernatants. Viruses were administered via different routes such as intravenous (IV), intramuscular (IM), intratumoral (IT), intra-arterial (IA), orally (PO, rectally (PR) and inhalational (Inh). Tumor response rates for various cancers such as Hodgkin’s lymphoma, cervical carcinoma, and other solid tumors ranged from 11.8% (West Nile virus) to 87.8% (mumps virus). Severe adverse events ranged from 5.9% of patients (West Nile virus) to 63.6% (hepatitis B virus). Other viruses tested in animal models and humans for anti-tumor activity include Russian encephalitis, influenza, Respiratory RI-67,

Coxsackie B, Newcastle disease, poliomyelitis, reovirus, mumps, measles, rabies, vaccinia, pox, parvovirus and vesicular stomatitis viruses (Kelly and Russell 2007).

# of Tumor Adverse Year Virus Disease Patients Route Outcome Response Rate Adverse Events Events Rate 1949 Hepatitis B virus Hodgkin's disease 22 IV 14/22 developed hepatitis 31.8% Fever, malaise 63.6% 7/22 had a clinical response 1/22 death 4/22 tumor size reduction

1952 Egypt 101 virus Advanced & unresponsive 34 IV, IM 27/34 patients infected 11.8% Fever, malaise 5.9% (West Nile virus) neoplastic disease 14/34 oncotropism 2/34 mild encephalitis 4/34 tumor size reduction

1956 APC Virus Cervical carcinoma 30 IV, IT, IA 26/40 tumor necrosis 65.0% Vaginal hemorrhage 10.0% (Adenovirus) 3/30 fever, malaise

1974 Mumps virus Advanced & unresponsive 90 IV, IT, PO, 37/90 >50% regression 87.8% 7/90 bleeding, fever 7.8% (wild-type) gastric, pulmonary, and PR, Inh 42/90 <50% regression uterine cancers 11/90 no response IV - Intravenous, IM - Intramuscular, IT - Intratumoral, IA - Intra-arterial, PO - Oral, PR - Rectum, Inh - Inhalational

Table 1-1: Early oncolytic virus clinical trials and reported outcomes (Hoster, Zanes et al.

1949; Southam and Moore 1952; Georgiades, Zielinski et al. 1959; Asada 1974) (Adapted from

Kelly, Mol Ther, 2007 (Kelly and Russell 2007)).

The era of recombinant viral oncolytics: increasing oncolytic efficacy and biosafety

With the advent of molecular cloning techniques, genetic engineering, and understanding of cellular and viral genetics, oncolytic viruses have been altered to increase their ability to target and kill cancer cells while sparing normal cells. To increase oncolytic efficacy, viral tropism, evasion of host cell defenses, intracellular replication kinetics, payload, and transgenes have been altered or inserted into viruses (Conner, Braidwood et al. 2008; Liu, Hwang et al. 2008;

Menotti, Nicoletti et al. 2009). These “smart” viruses have an increased capacity to target cancer cells, recruit the immune system via payload cytokines, express suicide genes, and improve safety in normal tissues. To increase safety, oncolytic viruses are commonly mutated to attenuate their ability to replicate in normal tissues (Guo, Thorne et al. 2008). Oncolytic viruses have been mutated in pathways that are essential to viral replication and that are activated specifically in certain cancers (Liu, Hwang et al. 2008). Vaccinia and myxoma viruses have been mutated in

EGFR and Akt dependent pathways, respectively, and show tumor-specific viral replication kinetics in tumors that over-express these pathways. Thus, wild-type viruses that exhibited significant toxicities in humans during clinical trials, have now been attenuated to cause at most, fever and flu-like symptoms for a short period after viral administration. This vast improvement in side effect profiles for these targeted cancer therapies is in stark contrast to the toxic and poisonous chemotherapeutics and radiation therapies used today which often cause organ failure and chronic inflammatory sequelae.

HSV-1 mediated cancer cell lysis

HSV-1 is an enveloped, dsDNA virus with a 152kb linear genome and 90 different genes that can cause lytic or latent infections. Glycoproteins on the viral envelope (gB, gD, gL, and gH) mediate entry through interaction with host cell membrane proteins (nectin-1, the herpes virus entry mediator (HVEM) and heparin sulfate glycosaminoglycans) (Knipe and Howley

2007). After glycoprotein binding, membrane fusion occurs and the nucleocapsid is released into the cytoplasm. Viral nucleocapsids then transfer viral DNA through nuclear pores. Transcription of viral immediate early (IE) genes begins when the viral genome enters the nucleus. The IE genes lead to activation of a cascade of viral gene programs that initiate viral protein synthesis and viral DNA replication. Production of viral progeny is followed by release and lysis of the host cell (Knipe and Howley 2007).

Transcriptional targeting: an approach to increasing oncolytic efficacy and to personalized predictive oncologic medicine

One method of increasing the efficacy of oncolytic viruses is through transcriptional targeting. Transcriptional targeting is the use of tumor-specific promoters to activate transgenes only in the tumor microenvironment. The feasibility of transcriptional targeting has been shown through viral and non-viral therapeutics. Transgenes that have been employed with tumor- specific promoters include suicide transgenes and genes that increase viral replication, such as the HSV-1 genes thymidine kinase (TK), and γ134.5, respectively (Hart and Vile 1995; Chung,

Saeki et al. 1999). Other strategies have been used to increase oncolytic viral efficacy and safety such as altering viral tropism to specific epitopes by modifying capsid proteins with antibody fragment protein sequences (Menotti, Cerretani et al. 2008; Menotti, Nicoletti et al. 2009).

Advantages of Oncolytic HSV (oHSV) for cancer treatment

There are several theoretical advantages to using oHSV for cancer treatment in addition to its ability to kill cancer cells in tumor types that have been traditionally unresponsive to chemotherapy and radiation (Pulkkanen and Yla-Herttuala 2005). oHSV can be attenuated significantly and made safe in normal cells and tissues while maintaining replication competency in tumors (Kambara, Okano et al. 2005). Replication competency provides the potential for completely eradicating injected tumors while other viruses used to treat tumors such as adenovirus are generally replication incompetent and fail to completely eradicate the tumor.

Another advantage of oHSV versus smaller DNA viruses like adenovirus is its large payload which can be used for large transgene or multiple transgene insertion (Pulkkanen and Yla-

Herttuala 2005; Kasuya and Nakao 2006). In addition, due to ubiquitous HSV receptors and anti- host defense viral mechanisms, attenuated HSV-1 mutants tend to have very high infectious potency in many cells types compared to other viral vectors. Adenoviral vectors tend to require 8

high Multiplicity of Infection (“MOI”) (MOI=plaque forming units (PFU) per cell); however,

HSV-1 can efficiently infect cells at low MOI such as 0.01 or 1 plaque forming unit per 100 cells.

Improving oncolytic HSV-1 efficacy without compromising biosafety

Since the initial clinical trials in 1949 with wild-type viruses, developments in the oncolytic virus field have progressed and produced anti-cancer viruses that are far safer than most cancer therapies in use today. This level of safety has been made possible by engineering viral strains that are attenuated by mutation or deletion of virulence genes. However, attenuation of virulence has not helped with the most significant problem that all oncolytic viral research faces today: mild to modest efficacy. Past and current clinical trials studying the effects of oHSV-1 have shown that there is usually an improvement in tumor response when the viral treatment is combined with chemotherapy and radiation (Yoon, Shichinohe et al. 2001; Donahue,

Mullen et al. 2002; Freytag, Stricker et al. 2003; Kasuya, Takeda et al. 2005; Kumar, Gao et al.

2008). Indeed, there appears to be synergy in combining viral therapy with chemotherapy and radiation. There is evidence that when chemotherapy and radiation inhibit the immune response to viral therapy, oncolytic viruses are at least partially protected from the host anti-viral response and more virions can interact with the tumor cells (Wakimoto, Fulci et al. 2004; Fulci, Breymann et al. 2006; Fukuhara and Todo 2007). Various strategies have been used to increase efficacy, but caution must be exercised because increasing virulence can lead to impaired safety of the virus and toxicity in normal tissues.

The oHSV constructed for transcriptional targeting: oHSV-MDK-34.5 9

Several attenuated HSV-1 recombinant viruses have been characterized. The parent oHSV used to construct our virus lacks γ134.5 gene, a gene which plays a critical role in HSV-1 neurovirulence and pathogenesis (Perng, Ghiasi et al. 1996). This vector is also attenuated for

ICP6, the large subunit of viral ribonucleotide reductase. ICP6 promotes viral DNA synthesis in non-dividing cells so its deletion improves vector safety in non-tumor cells (Bacchetti, Evelegh et al. 1984; Aghi, Visted et al. 2008).

The oHSV constructed for this dissertation conditionally expresses ICP34.5 under the control of the tumor-specific MDK promoter. Thus, the virus should be attenuated and safe in normal tissues while increasing replication and lysis ability in MDK-expressing tumors. In addition, conditionally expressing ICP34.5 protein may improve tumor-killing efficiency by improving the virus’ ability to evade the anti-viral defense responses of the tumor cell. Molecular targeting of the HSV-1 virion to MDK expressing tumor cells will occur because the transgene transcription will occur when complexes of transcription enhancer proteins that bind the MDK promoter are present in the nucleus.

The role of the HSV-1 protein ICP34.5 in evading viral host defense

When host cells are infected by virus, a host defense mechanism involving protein kinase

R (PKR) is activated. Activated PKR then leads to the phosphorylation of eukaryotic initiation factor 2 alpha (eIF2α) which halts protein translation (Figure 1-2A). ICP34.5 overcomes this host defense mechanism by recruiting protein phosphatase 1 (PP1) to dephosphorylate eIF2α

(Figure 1-2B) (Tan and Katze 2000). One group successfully utilized the γ134.5 transgene driven by the nestin promoter to conditionally target oHSV to malignant glioma (Kambara, Okano et al.

2005). Infection of glioma cells with oHSV-Nestin-ICP34.5 led to decreased 10

eIF2α phosphorylation, increased virus replication, and significantly enhanced overall mouse survival of tumor-bearing mice. The construct developed in this proposal utilizes the MDK promoter to drive γ134.5.

Developmental and cancer-specific MDK expression

MDK is a secreted protein normally expressed during development and expression decreases to very low levels after birth (Iwasaki, Nagata et al. 1997; Muramatsu 2002; Stoica,

Kuo et al. 2002; Sumi, Muramatsu et al. 2002; Reynolds, Mucenski et al. 2004). The MDK gene encodes a two-domain protein with each domain composed of three anti-parallel beta-sheets cross-linked with disulfide bonds (Muramatsu 2002). This heparin-binding protein promotes cellular proliferation and epithelial to mesenchymal cell signaling through the following receptors: anaplastic lymphoma kinase (ALK), lipoprotein-like receptor protein (LRP), and protein tyrosine phosphatase z (PTPz). The expression of MDK begins in mid-gestation in various organs, especially in differentiating and remodeling mesenchymal cells. The protein is mitogenic and has pleiotropic effects such as increasing proliferation, survival, migration, and angiogenesis depending on the cell type and tissue location. The survival modulation occurs when the MDK protein binds the LRP receptor, is endocytosed, and translocated to the nucleus

(Shibata, Muramatsu et al. 2002).

As expression of MDK is reactivated in many tumors (Table 1-2), it has been used to target anti-tumor therapy (Adachi, Reynolds et al. 2001; Adachi, Matsubara et al. 2002; Takei,

Kadomatsu et al. 2002; Takei, Kadomatsu et al. 2006). The differential upregulation in cancer compared to normal tissues can be readily displayed by performing a query for the MDK gene in the Cancer Genome Anatomy Project (CGAP) database at the National Cancer Institute (NCI). 11

This database allows anatomically organized visualization of relative expression among cancer and non-cancer cells and tissues (Figure 1-3). Similar to its functions during development, MDK also promotes proliferation, survival, and angiogenesis in various tumors (Chen, McKenzie et al.

1996; Choudhuri, Zhang et al. 1997; Ratovitski and Burrow 1997; Rha, Noh et al. 1997). This has led to anti-MDK therapeutic approaches and the study of serum MDK levels as a tumor marker for diagnosis, prognosis, and detection of recurrence (Aridome, Takao et al. 1998;

Ikematsu, Yano et al. 2000; Ikematsu, Nakagawara et al. 2003; Shimada, Nabeya et al. 2003;

Obata, Kikuchi et al. 2005; Jia, Ye et al. 2007; Kaifi, Fiegel et al. 2007; Ota, Fujimori et al.

2008; Ibusuki, Fujimori et al. 2009).

Transcriptional regulation of the MDK promoter in cancer

Transcriptomic analysis of different types of primary human tumors shows that MDK is commonly upregulated and that there is a trend for a more aggressive tumor with higher levels of

MDK expression (Watson, Perry et al. 2004). Clues into the transcriptional regulation are present in certain types of tumors. MDK is over-expressed in all Wilms’ tumors that are deficient in expression of the tumor-suppressor WT1 expression (Tsutsui, Kadomatsu et al. 1993). This observation suggested that WT1 is involved in transcriptional suppression of the MDK promoter, which was subsequently verified experimentally (Adachi, Matsubara et al. 1996). In addition,

100% of MPNST that have the neurofibromatosis 1 (NF1) neurofibromin mutation over-express

MDK, suggesting that neurofibromin may also plays a role in negative regulation of MDK

(Mashour, Wang et al. 1999; Mashour, Ratner et al. 2001; Mashour, Driever et al. 2004).

Transcriptional targeting using the MDK promoter 12

The strategy of using the tumor-specific promoter MDK to drive a suicide transgene has been used successfully in adenoviral treatment of Wilms’ tumor xenografts (Adachi, Matsubara et al. 2002). Adachi et al. created an adenovirus with the thymidine kinase (TK) transgene driven by the MDK promoter. Infection of MDK-expressing tumor cells with this virus leads to TK protein expression. Upon exposure of the host to ganciclovir, TK drove the cells into apoptosis.

For control virus, an adenovirus with the TK transgene driven by the CMV promoter was created. Injection of tumors with either virus in addition to ganciclovir resulted in a significant decrease in tumor size. The study by Adachi, et al. suggests that in MDK-expressing tumor cells, the MDK promoter is as efficient as the CMV promoter at driving transcription of adenoviral transgenes.

Generalizability of transcriptional targeting and personalized predictive medicine

Due to the unpredictable nature of and rapid resistance development in many tumors, most of these promising transcriptional-targeted therapies are not applicable to a range of tumor types. Thus, studying every patient’s tumor for its unique characteristics will need to be part of the future of personalized predictive medicine. In addition, despite many studies showing that transcriptional targeting is feasible, further exploration is needed to discover more tumor-specific promoters and a variety of transgene combinations so that patient-tailored oncolytic virus libraries can be a reality (Personal Communication, Richard Vile Ph.D.). Furthermore, the relative ease of viral genetic engineering makes it an attractive alternative to the challenges, costs, and barriers of anti-cancer drug discovery (Liu, Hwang et al. 2008).

The feasibility of oHSV-MDK-34.5 as an anti-cancer therapeutic in humans

Attenuated oHSVs are currently in clinical trials for the treatment of colon cancer metastatic to liver, brain tumors (Pulkkanen and Yla-Herttuala 2005; Kemeny, Brown et al.

2006; US-FDA and Health-Authority 2006) and non-CNS solid tumors in adolescents and young adults (US-FDA and Health-Authority 2010). As described above, to make the virus safe in humans and non-toxic to normal tissues, the wild-type virus has been attenuated by either removing the HSV-1 neurovirulence gene ICP34.5 and/or the HSV-1 ribonucleotide reductase gene ICP6 (Kooby, Carew et al. 1999; Markert, Medlock et al. 2000; Rampling, Cruickshank et al. 2000; MacKie, Stewart et al. 2001; Saeki, Breakefield et al. 2003; Kasuya, Takeda et al.

2005; Gutermann, Mayer et al. 2006; Kemeny, Brown et al. 2006; Varghese, Rabkin et al. 2006).

HSV-1 attenuated for both ICP34.5 and ICP6 can still replicate in tumors that are actively replicating while unable to replicate in most non-replicating cells. The parent virus of the construct proposed in this thesis is rHSVQ1, an ICP34.5-/-, ICP6-/- HSV-1 based vector. This viral backbone is similar to G207, an attenuated oHSV in clinical trials for the treatment of glioma brain tumors and human colorectal cancer (Kooby, Carew et al. 1999; Markert, Medlock et al. 2000; US-FDA and Health-Authority 2006; US-FDA and Health-Authority 2006).

A phase I clinical trial testing the ICP34.5-/-, ICP6-/- oHSV, G207 showed that malignant glioma can be safely injected directly with no signs of encephalitis or other significant clinical toxicities in 21 patients up to the maximal dose of 3 x 109. However, most patients in the trial continued to have increased tumor size by MRI as far as 90 days after tumor injection (Markert,

Medlock et al. 2000). The phase II clinical trial for G207 and malignant glioma treatment was completed in 2003, but no results have been published (US-FDA and Health-Authority 2006). A second phase I clinical trial combining G207 and radiation therapy for the treatment of malignant

glioma was started in 2005 to assess safety and efficacy of combination therapy. This trial is still recruiting and no data are yet available (US-FDA and Health-Authority 2006).

Another phase I clinical trial was conducted evaluating an ICP34.5+/- HSV, NV1020 in combination with chemotherapy via hepatic artery infusion for colorectal cancer metastatic to the liver. This mutant strain is also attenuated for ICP0, a latency re-activation gene and ICP4, a transcriptional regulatory protein which enhances viral transcription initiation. There were no severe dose-related adverse effects up to the maximal dose of 1 x 108, though up to 50% of patients had tolerable fever, headache, or rigors within 12 hours of viral injection regardless of dose (Kemeny, Brown et al. 2006). A phase II clinical trial is currently recruiting patients for evaluating the efficacy of NV1020 alone and in combination with chemotherapy via hepatic artery infusion for the treatment of colorectal cancer metastatic to the liver (US-FDA and Health-

Authority 2006).

A B

Viral Infection HSV-1 Infection ICP34.5

PKR PKR

eIF2α p-eIF2α eIF2α p-eIF2α

Protein Shut Down Protein Translation Protein Shut Down

Figure 1-2: Host cell defense and HSV ICP34.5 A. The infected host cell shuts down protein translation by phosphorylating eIF2α. B. HSV ICP34.5 protein reverses phosphorylation and resumes protein synthesis which leads to increased HSV replication and propagation.

MDK-Expressing Tumors Pediatric Adult Wilms' Tumor Lung Neuroblastoma Brain MPNST Liver Rhabdosarcoma Esophageal Ewing's Sarcoma Gastric Nephroblastoma Colorectal Pancreatic Thyroid Breast Bladder Prostate Uterine Ovarian

Table 1-2: List of MDK-expressing pediatric and adult cancers (Pubmed and Novartis

cancer database)

Figure 1-3: MDK expression is higher in cancer than normal tissues (NCI Cancer Genome

Anatomy Project database) A digital northern for MDK mRNA expression is color coded by number of cDNA tags per cell or tissue array. Normal tissues expressed 4-7 MDK tags per

200,000 while cancers express upwards of 128-255 tags per 200,000.

The overall goals of this dissertation are to 1) explore mechanistic insights into the role of MDK in cancer using a feature-enabled bioinformatics approach and to 2) exploit

MDK biology to increase the efficacy of oncolytic HSV-1 towards MPNST tumors without 17

compromising safety. Specific gaps that this research has attempted to fill are that (i) little is known of the systems biology in upstream, or downstream signaling of MDK in cancer, (ii) there are no transcriptional targeted viruses to MPNST and (iii) there is no MDK targeted HSV-1.

Future research in MDK biology and MDK targeted oncolytic viruses may lead to a more thorough understanding of cancer biology in addition to novel and successful anti-tumor therapeutics.

The general hypothesis of this dissertation is that the tumor-specific transcriptional profile of a cancer cell can be exploited to drive tumor-enhanced viral replication and oncolysis. Aims that have been designed to test this hypothesis are the evaluation of (i) a MDK signature in cancer cells using computational analyses, (ii) specificity of oHSV-MDK-34.5 in tumor cells versus non-tumor cells, and (iii) anti-tumor effects and biosafety of a novel oHSV-

MDK-34.5 vector in xenograft models of MPNST.

REFERENCES

Adachi, Y., S. Matsubara, et al. (2002). "Midkine promoter-based adenoviral suicide gene therapy to midkine-positive pediatric tumor." J Pediatr Surg 37(4): 588-592. Adachi, Y., S. Matsubara, et al. (1996). "Midkine as a novel target gene for the Wilms' tumor suppressor gene (WT1)." Oncogene 13(10): 2197-2203. Adachi, Y., P. N. Reynolds, et al. (2001). "A midkine promoter-based conditionally replicative adenovirus for treatment of pediatric solid tumors and bone marrow tumor purging." Cancer Res 61(21): 7882-7888. Aghi, M., T. Visted, et al. (2008). "Oncolytic herpes virus with defective ICP6 specifically replicates in quiescent cells with homozygous genetic mutations in p16." Oncogene 27(30): 4249-4254. Antman, K. H. (2001). "Introduction: the history of arsenic trioxide in cancer therapy." Oncologist 6 Suppl 2: 1-2. Aridome, K., S. Takao, et al. (1998). "Truncated midkine as a marker of diagnosis and detection of nodal metastases in gastrointestinal carcinomas." Br J Cancer 78(4): 472-477. Armstrong, J. G., R. W. Dyke, et al. (1962). "Hodgkin's disease, carcinoma of the breast, and other tumors treated with vinblastine sulfate." Cancer Chemother Rep 18: 49-71. Asada, T. (1974). "Treatment of human cancer with mumps virus." Cancer 34(6): 1907-1928. Bacchetti, S., M. J. Evelegh, et al. (1984). "Immunological characterization of herpes simplex virus type 1 and 2 polypeptide(s) involved in viral ribonucleotide reductase activity." J Virol 49(2): 591-593. Bertino, J. R. (1963). "The Mechanism of Action of the Folate Antagonists in Man." Cancer Res 23: 1286-1306. Bierman, H. R., D. M. Crile, et al. (1953). "Remissions in leukemia of childhood following acute infectious disease: staphylococcus and streptococcus, varicella, and feline panleukopenia." Cancer 6(3): 591-605. Bos, L. (1999). "Beijerinck's work on tobacco mosaic virus: historical context and legacy." Philos Trans R Soc Lond B Biol Sci 354(1383): 675-685. Cattaneo, R., T. Miest, et al. (2008). "Reprogrammed viruses as cancer therapeutics: targeted, armed and shielded." Nat Rev Microbiol 6(7): 529-540. Chen, Y., K. E. McKenzie, et al. (1996). "Midkine in the progression of rat N-nitroso-N- methylurea-induced mammary tumors." Mol Carcinog 17(3): 112-116. Choudhuri, R., H. T. Zhang, et al. (1997). "An angiogenic role for the neurokines midkine and pleiotrophin in tumorigenesis." Cancer Res 57(9): 1814-1819. Chung, R. Y., Y. Saeki, et al. (1999). "B-myb promoter retargeting of herpes simplex virus gamma34.5 gene-mediated virulence toward tumor and cycling cells." J Virol 73(9): 7556-7564. Coiffier, B. (2007). "Rituximab therapy in malignant lymphoma." Oncogene 26(25): 3603-3613. Conner, J., L. Braidwood, et al. (2008). "A strategy for systemic delivery of the oncolytic herpes virus HSV1716: redirected tropism by antibody-binding sites incorporated on the virion surface as a glycoprotein D fusion protein." Gene Ther 15(24): 1579-1592. 19

d'Herelle, F. (1917). "Sur un microbe invisible antagoniste des bacilles dysentkriques." Cozpzesrendus Acad. Sciences 165: 373-375. Demetri, G. D., M. von Mehren, et al. (2002). "Efficacy and safety of imatinib mesylate in advanced gastrointestinal stromal tumors." N Engl J Med 347(7): 472-480. Dock, G. (1904). "The influence of complicating diseases upon leukemia." Am J Med Sci 127: 563-592. Donahue, J. M., J. T. Mullen, et al. (2002). "Viral oncolysis." Surg Oncol Clin N Am 11(3): 661- 680. Druker, B. J., S. Tamura, et al. (1996). "Effects of a selective inhibitor of the Abl tyrosine kinase on the growth of Bcr-Abl positive cells." Nat Med 2(5): 561-566. Fackler, J. L. and A. L. McGuire (2009). "Paving the Way to Personalized Genomic Medicine: Steps to Successful Implementation." Curr Pharmacogenomics Person Med 7(2): 125- 132. Farber, S. and L. K. Diamond (1948). "Temporary remissions in acute leukemia in children produced by folic acid antagonist, 4-aminopteroyl-glutamic acid." N Engl J Med 238(23): 787-793. Frei, E. (1967). "Some thoughts on adjuvant cancer chemotherapy." CA Cancer J Clin 17(5): 226-229. Frei, E., 3rd, N. Jaffe, et al. (1978). "Adjuvant chemotherapy of osteogenic sarcoma: progress and perspectives." J Natl Cancer Inst 60(1): 3-10. Frei, E., 3rd, M. Karon, et al. (1965). "The effectiveness of combinations of antileukemic agents in inducing and maintaining remission in children with acute leukemia." Blood 26(5): 642-656. Frew, S. E., S. M. Sammut, et al. (2008). "Chinese health biotech and the billion-patient market." Nat Biotech 26(1): 37-53. Freytag, S. O., H. Stricker, et al. (2003). "Phase I study of replication-competent adenovirus- mediated double-suicide gene therapy in combination with conventional-dose three- dimensional conformal radiation therapy for the treatment of newly diagnosed, intermediate- to high-risk prostate cancer." Cancer Res 63(21): 7497-7506. Fukuhara, H. and T. Todo (2007). "Oncolytic herpes simplex virus type 1 and host immune responses." Curr Cancer Drug Targets 7(2): 149-155. Fulci, G., L. Breymann, et al. (2006). "Cyclophosphamide enhances glioma virotherapy by inhibiting innate immune responses." Proc Natl Acad Sci U S A 103(34): 12873-12878. Gatta, G., R. Capocaccia, et al. (2002). "Childhood cancer survival in Europe and the United States." Cancer 95(8): 1767-1772. Georgiades, J., T. Zielinski, et al. (1959). "Research on the oncolytic effect of APC viruses in cancer of the cervix uteri; preliminary report." Biul Inst Med Morsk Gdansk 10: 49-57. Goodman, L. S., M. M. Wintrobe, et al. (1946). "NITROGEN MUSTARD THERAPY: Use of Methyl-Bis(Beta-Chloroethyl)amine Hydrochloride and Tris(Beta-Chloroethyl)amine Hydrochloride for Hodgkin's Disease, Lymphosarcoma, Leukemia and Certain Allied and Miscellaneous Disorders." J Am Med Assoc 132(3): 126-132. Guo, Z. S., S. H. Thorne, et al. (2008). "Oncolytic virotherapy: molecular targets in tumor- selective replication and carrier cell-mediated delivery of oncolytic viruses." Biochim Biophys Acta 1785(2): 217-231.

Gutermann, A., E. Mayer, et al. (2006). "Efficacy of Oncolytic Herpesvirus NV1020 Can Be Enhanced by Combination with Chemotherapeutics in Colon Carcinoma Cells." Hum Gene Ther. Hait, W. N. and T. W. Hambley (2009). "Targeted cancer therapeutics." Cancer Res 69(4): 1263- 1267; discussion 1267. Hart, I. R. and R. G. Vile (1995). "Targeted gene therapy." Br Med Bull 51(3): 647-655. Heinrich, M. C., D. J. Griffith, et al. (2000). "Inhibition of c-kit receptor tyrosine kinase activity by STI 571, a selective tyrosine kinase inhibitor." Blood 96(3): 925-932. Horn, L. and A. Sandler (2009). "Epidermal growth factor receptor inhibitors and antiangiogenic agents for the treatment of non-small cell lung cancer." Clin Cancer Res 15(16): 5040- 5048. Hoster, H. A., R. P. Zanes, Jr., et al. (1949). "Studies in Hodgkin's syndrome; the association of viral hepatitis and Hodgkin's disease; a preliminary report." Cancer Res 9(8): 473-480. Ibusuki, M., H. Fujimori, et al. (2009). "Midkine in plasma as a novel breast cancer marker." Cancer Sci 100(9): 1735-1739. Ikematsu, S., A. Nakagawara, et al. (2003). "Correlation of elevated level of blood midkine with poor prognostic factors of human neuroblastomas." Br J Cancer 88(10): 1522-1526. Ikematsu, S., A. Yano, et al. (2000). "Serum midkine levels are increased in patients with various types of carcinomas." Br J Cancer 83(6): 701-706. Iwasaki, W., K. Nagata, et al. (1997). "Solution structure of midkine, a new heparin-binding growth factor." Embo J 16(23): 6936-6946. Jaffe, N., E. Frei, 3rd, et al. (1974). "Adjuvant methotrexate and citrovorum-factor treatment of osteogenic sarcoma." N Engl J Med 291(19): 994-997. Jemal, A., T. Murray, et al. (2005). "Cancer Statistics, 2005." CA Cancer J Clin 55(1): 10-30. Jia, H. L., Q. H. Ye, et al. (2007). "Gene expression profiling reveals potential biomarkers of human hepatocellular carcinoma." Clin Cancer Res 13(4): 1133-1139. Johnson, I. S., J. G. Armstrong, et al. (1963). "The Vinca Alkaloids: A New Class of Oncolytic Agents." Cancer Res 23: 1390-1427. Kaifi, J. T., H. C. Fiegel, et al. (2007). "Midkine as a prognostic marker for gastrointestinal stromal tumors." J Cancer Res Clin Oncol 133(7): 431-435. Kambara, H., H. Okano, et al. (2005). "An oncolytic HSV-1 mutant expressing ICP34.5 under control of a nestin promoter increases survival of animals even when symptomatic from a brain tumor." Cancer Res 65(7): 2832-2839. Kasuya, H. and A. Nakao (2006). "[Clinical application of replication competent mutant HSV in cancer therapy]." Nippon Rinsho 64 Suppl 3: 335-339. Kasuya, H., S. Takeda, et al. (2005). "The potential of oncolytic virus therapy for pancreatic cancer." Cancer Gene Ther 12(9): 725-736. Kaur, B. and E. A. Chiocca (2007). "Personalizing oncolytic virotherapy?" Mol Ther 15(1): 6-7. Kelly, E. and S. J. Russell (2007). "History of oncolytic viruses: genesis to genetic engineering." Mol Ther 15(4): 651-659. Kemeny, N., K. Brown, et al. (2006). "Phase I, open-label, dose-escalating study of a genetically engineered herpes simplex virus, NV1020, in subjects with metastatic colorectal carcinoma to the liver." Hum Gene Ther 17(12): 1214-1224. Knipe, D. M. and P. M. Howley, Eds. (2007). Fields Virology. Philadelphia, LWW.

Kooby, D. A., J. F. Carew, et al. (1999). "Oncolytic viral therapy for human colorectal cancer and liver metastases using a multi-mutated herpes simplex virus type-1 (G207)." Faseb J 13(11): 1325-1334. Krischer, J., S. Epstein, et al. (1997). "Clinical cardiotoxicity following anthracycline treatment for childhood cancer: the Pediatric Oncology Group experience." J Clin Oncol 15(4): 1544-1552. Kumar, S., L. Gao, et al. (2008). "Virus combinations and chemotherapy for the treatment of human cancers." Curr Opin Mol Ther 10(4): 371-379. Leroy, K., V. Dumas, et al. (2001). "Malignant Peripheral Nerve Sheath Tumors Associated With Neurofibromatosis Type 1: A Clinicopathologic and Molecular Study of 17 Patients." Arch Dermatol 137(7): 908-913. Liu, T. C., T. H. Hwang, et al. (2008). "Translation of targeted oncolytic virotherapeutics from the lab into the clinic, and back again: a high-value iterative loop." Mol Ther 16(6): 1006- 1008. Lustig, A. and A. J. Levine (1992). "One hundred years of virology." J Virol 66(8): 4629-4631. MacKie, R. M., B. Stewart, et al. (2001). "Intralesional injection of herpes simplex virus 1716 in metastatic melanoma." Lancet 357(9255): 525-526. Madhavan, S., J. C. Zenklusen, et al. (2009). "Rembrandt: helping personalized medicine become a reality through integrative translational research." Mol Cancer Res 7(2): 157- 167. Markert, J. M., M. D. Medlock, et al. (2000). "Conditionally replicating herpes simplex virus mutant, G207 for the treatment of malignant glioma: results of a phase I trial." Gene Ther 7(10): 867-874. Mashour, G. A., P. H. Driever, et al. (2004). "Circulating growth factor levels are associated with tumorigenesis in neurofibromatosis type 1." Clin Cancer Res 10(17): 5677-5683. Mashour, G. A., N. Ratner, et al. (2001). "The angiogenic factor midkine is aberrantly expressed in NF1-deficient Schwann cells and is a mitogen for neurofibroma-derived cells." Oncogene 20(1): 97-105. Mashour, G. A., H. L. Wang, et al. (1999). "Aberrant cutaneous expression of the angiogenic factor midkine is associated with neurofibromatosis type-1." J Invest Dermatol 113(3): 398-402. Menotti, L., A. Cerretani, et al. (2008). "Construction of a fully retargeted herpes simplex virus 1 recombinant capable of entering cells solely via human epidermal growth factor receptor 2." J Virol 82(20): 10153-10161. Menotti, L., G. Nicoletti, et al. (2009). "Inhibition of human tumor growth in mice by an oncolytic herpes simplex virus designed to target solely HER-2-positive cells." Proc Natl Acad Sci U S A 106(22): 9039-9044. Miller, S. J., F. Rangwala, et al. (2006). "Large-scale molecular comparison of human schwann cells to malignant peripheral nerve sheath tumor cell lines and tissues." Cancer Res 66(5): 2584-2591. Moore, A. E. (1949). "Effect of inoculation of the viruses of influenza A and herpes simplex on the growth of transplantable tumors in mice." Cancer 2(3): 516-524. Muramatsu, T. (2002). "Midkine and pleiotrophin: two related proteins involved in development, survival, inflammation and tumorigenesis." J Biochem (Tokyo) 132(3): 359-371.

Muschel, R. J., D. E. Soto, et al. (1998). "Radiosensitization and apoptosis." Oncogene 17(25): 3359-3363. Obata, Y., S. Kikuchi, et al. (2005). "Serum midkine concentrations and gastric cancer." Cancer Sci 96(1): 54-56. Ota, K., H. Fujimori, et al. (2008). "Midkine as a prognostic biomarker in oral squamous cell carcinoma." Br J Cancer 99(4): 655-662. Perng, G. C., H. Ghiasi, et al. (1996). "High-dose ocular infection with a herpes simplex virus type 1 ICP34.5 deletion mutant produces no corneal disease or neurovirulence yet results in wild-type levels of spontaneous reactivation." J Virol 70(5): 2883-2893. Pulkkanen, K. J. and S. Yla-Herttuala (2005). "Gene therapy for malignant glioma: current clinical status." Mol Ther 12(4): 585-598. Rampling, R., G. Cruickshank, et al. (2000). "Toxicity evaluation of replication-competent herpes simplex virus (ICP 34.5 null mutant 1716) in patients with recurrent malignant glioma." Gene Ther 7(10): 859-866. Ratovitski, E. A. and C. R. Burrow (1997). "Midkine stimulates Wilms' tumor cell proliferation via its signaling receptor." Cell Mol Biol (Noisy-le-grand) 43(3): 425-431. Reynolds, P. R., M. L. Mucenski, et al. (2004). "Midkine is regulated by hypoxia and causes pulmonary vascular remodeling." J Biol Chem 279(35): 37124-37132. Rha, S. Y., S. H. Noh, et al. (1997). "Comparison of biological phenotypes according to midkine expression in gastric cancer cells and their autocrine activities could be modulated by pentosan polysulfate." Cancer Lett 118(1): 37-46. Saeki, Y., X. O. Breakefield, et al. (2003). "Improved HSV-1 amplicon packaging system using ICP27-deleted, oversized HSV-1 BAC DNA." Methods Mol Med 76: 51-60. Shibata, Y., T. Muramatsu, et al. (2002). "Nuclear targeting by the growth factor midkine." Mol Cell Biol 22(19): 6788-6796. Shimada, H., Y. Nabeya, et al. (2003). "Increased serum midkine concentration as a possible tumor marker in patients with superficial esophageal cancer." Oncol Rep 10(2): 411-414. Southam, C. M. and A. E. Moore (1952). "Clinical studies of viruses as antineoplastic agents with particular reference to Egypt 101 virus." Cancer 5(5): 1025-1034. Stoica, G. E., A. Kuo, et al. (2002). "Midkine binds to anaplastic lymphoma kinase (ALK) and acts as a growth factor for different cell types." J Biol Chem 277(39): 35990-35998. Sumi, Y., H. Muramatsu, et al. (2002). "Midkine, a heparin-binding growth factor, promotes growth and glycosaminoglycan synthesis of endothelial cells through its action on smooth muscle cells in an artificial blood vessel model." J Cell Sci 115(Pt 13): 2659- 2667. Takei, Y., K. Kadomatsu, et al. (2006). "Combinational antitumor effect of siRNA against midkine and paclitaxel on growth of human prostate cancer xenografts." Cancer 107(4): 864-873. Takei, Y., K. Kadomatsu, et al. (2002). "5'-,3'-inverted thymidine-modified antisense oligodeoxynucleotide targeting midkine. Its design and application for cancer therapy." J Biol Chem 277(26): 23800-23806. Tan, S. L. and M. G. Katze (2000). "HSV.com: maneuvering the internetworks of viral neuropathogenesis and evasion of the host defense." Proc Natl Acad Sci U S A 97(11): 5684-5686.

Tanaka, H. (2010). "Omics-based medicine and systems pathology. A new perspective for personalized and predictive medicine." Methods Inf Med 49(2): 173-185. Tsutsui, J., K. Kadomatsu, et al. (1993). "A new family of heparin-binding growth/differentiation factors: increased midkine expression in Wilms' tumor and other human carcinomas." Cancer Res 53(6): 1281-1285. Twombly, R. (2005). "Cancer surpasses heart disease as leading cause of death for all but the very elderly." J Natl Cancer Inst 97(5): 330-331. US-FDA and Health-Authority (2006). G207 Followed by Radiation Therapy in Malignant Glioma, NIH. US-FDA and Health-Authority (2006). Safety and Effectiveness Study of G207, a Tumor-Killing Virus, in Patients With Recurrent Brain Cancer, NIH. US-FDA and Health-Authority (2006). Safety and Efficacy of a Genetically Engineered Herpes Simplex Virus NV1020 to Treat Colorectal Cancer Metastatic to Liver, NIH. Varghese, S., S. D. Rabkin, et al. (2006). "Systemic oncolytic herpes virus therapy of poorly immunogenic prostate cancer metastatic to lung." Clin Cancer Res 12(9): 2919-2927. Wakimoto, H., G. Fulci, et al. (2004). "Altered expression of antiviral cytokine mRNAs associated with cyclophosphamide's enhancement of viral oncolysis." Gene Ther 11(2): 214-223. Watson, M. A., A. Perry, et al. (2004). "Gene expression profiling reveals unique molecular subtypes of Neurofibromatosis Type I-associated and sporadic malignant peripheral nerve sheath tumors." Brain Pathol 14(3): 297-303. Yoon, T. K., T. Shichinohe, et al. (2001). "Selectively replicating adenoviruses for oncolytic therapy." Curr Cancer Drug Targets 1(2): 85-107.

CHAPTER 2: Mechanistic Insights Into The Role Of MDK Over-Expression In Cancer

Abstract

Some cancers that over-express midkine (MDK) carry a high mortality because of chemotherapy and radiation resistance. Gaining insights into molecular mechanisms involving

MDK over-expression in tumors by using computational analyses may: (1) provide insights into predicting clinical outcomes in cancer patients; (2) inform clinical decision making for choice of chemotherapeutics or radiation therapy to improve survival; and (3) predict molecular targets for novel cancer therapeutics. Our initial computational analyses suggested that MDK is co-regulated with a cluster of genes, particularly across a variety of pediatric and adult tumors such as malignant peripheral nerve sheath tumors (MPNST) and colorectal cancers. In order to test the hypothesis that MDK and/or MDK co-regulated genes might influence tumorigenesis and chemotherapy resistance in cancer cells, we sought to identify the underlying critical pathways and regulatory mechanisms associated with this cluster of genes. A Pearson correlation of genes that co-express with MDK in 121 microarrays of MPNST and colorectal cancers resulted in a cluster of 348 genes co-regulated with MDK by filtering r>0.4. These MDK co-expressed genes significantly enriched in embryonic and neural stem cell gene signatures compared to random genomic sampling (p<0.000001). In addition, the MDK co-expressed genes significantly enriched in functional categories such as DNA replication (p=0.000410) and cell cycle regulation

(p=0.000876). Out of 348 genes, 66 are transcription complex genes (p<0.000001), many of which have been associated with cancer or shown to be cancer causal genes, such as HMGB1,

CREB1, and YY1. To assess upstream regulation of MDK co-expressed genes, a cis-element promoter analysis was performed and predicted enrichment of 4 elements: HLF, NFIL3, 25

MEF2A, and FOXD3. A cis-regulatory module analysis suggests that all 4 cis-elements may represent a regulatory module in 67 out of 348 MDK co-expressed genes. Protein-protein interaction network analyses suggest that MDK may be upstream of transcription complex proteins that are highly interconnected such as HMGB1, CREB1, and YY1. This may represent a molecular mechanism for MDK regulation of a cluster of genes in the MDK signature in cancer cells. Additional experimental studies are needed to test these computational-derived hypotheses.

Introduction

Clinical significance and evidence

The MDK gene is over-expressed in many tumors including malignant peripheral nerve sheath tumors (MPNST) and advanced colorectal cancers, which have a median survival of 21 months and 16 months, respectively (Aridome, Tsutsui et al. 1995; de Gramont, Figer et al.

2000; Leroy, Dumas et al. 2001; Watson, Perry et al. 2004; Goldberg, Sargent et al. 2006). MDK over-expression in bladder cancer has been correlated with tumor invasion, cancer recurrence, and death (O'Brien, Cranston et al. 1996). Furthermore, MDK over-expression in pancreatic head carcinoma has been associated with a higher incidence of venous invasion, liver metastasis, and increased vascular density (Maeda, Shinchi et al. 2007). Increased levels of urinary MDK have been found in patients with early stage gastric, colon, hepatocellular, bile duct, pancreatic, breast, urinary bladder, renal, and thyroid carcinomas (Ikematsu, Okamoto et al. 2003). When serum

MDK was tested as a biomarker, increased MDK was predictive of mortality in patients with advanced lung cancers, gastric cancers, pediatric embryonal tumors, oral squamous cell carcinoma, and esophageal squamous carcinoma (Ikematsu, Yano et al. 2000; Shimada, Nabeya et al. 2003; Krzystek-Korpacka, Matusiewicz et al. 2007; Ota, Fujimori et al. 2008; Lucas, 26

Reindl et al. 2009). In addition, MDK has been implicated in gastric cancer resistance to the chemotherapy drugs cisplatin, doxorubicin, and 5-fluorouracil (5-FU) (Kang, Kim et al. 2007).

Epigenetically, the degree of MDK methylation and gene silencing has been inversely correlated with poorly-differentiated compared to well-differentiated non-small cell lung cancer (Cortese,

Hartmann et al. 2008).

Evidence of MDK’s influence on tumorigenesis and chemotherapy resistance

Experimental evidence also supports the hypothesis that MDK plays an important role in carcinogenesis and chemotherapy resistance (Dai 2009). When MCF-7 breast carcinoma cells were stably electroporated with MDK cDNA driven by the cytomegalovirus (CMV) promoter, the MDK over-expressing tumor cells showed faster tumor growth in estrogen-treated BALB/c nude mice compared to tumor cells transfected with empty vector (Choudhuri, Zhang et al.

1997). Histological evaluation of the breast cancer xenografts revealed greater vascular density in the MDK-transfected tumor cells. These results suggest that MDK over-expression enhances tumorigenesis and neovascularization. To assess the potential of chemotherapy resistance induced by MDK in G401 Wilms’ tumor cells, MDK protein was added to cultured tumor cells prior to treatment with Cisplatin. Exogenous MDK inhibited Cisplatin-induced apoptosis in

Wilms’ tumor cells and MDK-treated cells had greater levels of the anti-apoptotic protein B-cell lymphoma 2 (Bcl2) (Qi, Ikematsu et al. 2000). Morpholino knockdown of MDK expression in

SW620 colon carcinoma cells resulted in impaired tumor growth in nude mouse xenografts

(Takei, Kadomatsu et al. 2005). To determine if MDK conferred chemotherapy resistance between cells, cell culture media was extracted from doxorubicin-sensitive and resistant neuroblastoma cells and purified using heparin affinity chromatography. Culture media from doxorubicin-resistant cells conferred increased survival of doxorubicin-sensitive cells. After 27

identifying MDK as the drug resistance-conferring protein, neuroblastoma and osteosarcoma cells were transfected with MDK cDNA and tested for doxorubicin-resistance. MDK transfected neuroblastoma and osteosarcoma cells showed increased doxorubicin-resistance compared to wild-type cells (Mirkin, Clark et al. 2005). However, the genetic regulation and molecular mechanisms modulated by MDK over-expression in cancer are currently unknown.

The overall rationale, aim, approach, and findings of this study

Insights into the molecular mechanisms and effects of MDK over-expression in cancer may lead to improved clinical predictions of cancer outcomes, assist in personalizing chemotherapy and radiation therapy to the biology of the patient’s tumor, and suggest molecular targets for novel therapeutics. The overall aim of the present study was to identify potential molecular mechanisms modulated by MDK to promote carcinogenesis and chemotherapy resistance. To achieve this aim, a tumor MDK signature was investigated using a bioinformatics- enabled feature analysis of genes co-regulated with MDK in MPNST and colorectal cancers, two types of cancers, which over-express MDK and have readily available transcriptomic datasets.

We demonstrate a MDK gene signature in tumors that consists of 348 correlating transcripts in human tumors. Furthermore, this MDK signature enriched for genes that are associated with stem cell function, proliferation, and anti-apoptosis, and the signature includes 10 genes implicated to have a causal role in cancer. We also show that the MDK signature contains 66 transcription complex proteins, such as high-mobility group box 1 (HMGB1), cAMP responsive element binding protein 1 (CREB1) and Yin and Yang 1 (YY1), most of which have been individually implicated to play a role in cancer biology. A computational analysis of cis-elements enriched in the 348 genes predicts an over-abundance of forkhead box D3 (FoxD3), myocyte enhancer factor

2A (MEF2A), hepatic leukemia factor (HLF), and Interleukin-3 nuclear factor (NFIL3) 28

consensus sequences and phylogenetic footprinting analyses suggest that these 4 cis-elements may represent a cis-regulatory module. Based on these computational analyses, we propose a molecular model for modulation of MDK co-regulated genes in tumors through Janus

Kinase/Signal Transducer and Activator of Transcription 1 (JAK/STAT1) signaling, the highly interconnected transcription complex proteins HMGB1, CREB1, and YY1, and the 4 cis- elements as a regulatory cassette. Finally, experimental studies are needed to validate the transcriptomics, computational analyses, and hypothetical predictions reported in this manuscript.

Hypothesis 1: MDK regulates a subset of genes that lead to oncogenic mechanisms

Hypothesis 2: Genes co-regulated with MDK regulate MDK and other genes in the signature Bioinformatics Approach 348 ToppFun Like ConCisE Scanner MDK Genes Functional Enrichments Cis-Regulatory Module ToppGenenet, Prediction oPossum: shared cis- Cytoscape, and element prediction Gephi

4 cis-elements shared by 66/348 genes Gene Interaction Networks

Figure 2-1: Bioinformatics-enabled approach to analyzing the MDK gene signature in adult and pediatric tumors. ToppFun server of ToppGene Suite (Chen, Bardes et al. 2009) identified functional enrichments in the MDK signature gene list using an annotation-based statistical analysis. ToppGenenet of ToppGene Suite, Cytoscape, and Gephi revealed protein- protein interaction networks among MDK co-regulated genes and intermediary neighboring proteins. Using a philogenetic footprinting approach, oPossum predicted 4 shared cis-elements in many of the MDK signature genes. The BlastZ alignment database and Conserved Cis-

Element (ConCisE) Scanner of the UC/CHMC TraFac Homology Server Suite shows that the 4 predicted cis-element consensus sequences commonly occur in proximity in many genes, suggesting a cis-regulatory module.

Materials & Methods

Gene Array Correlation Cluster Algorithm and like-MDK Gene Set Signature

RMA Express 0.2 was used to normalize microarrays of human colorectal cancers (n=100),

MPNST (n=6), normal Schwann cells (n=10), and normal colon mucosa (n=5). Under IRB approved protocols and informed patient consent, tumors were obtained from patients undergoing biopsy or resection, snap frozen immediately after harvest and subsequently processed using Human Genome U133 Plus 2.0 Arrays (Affymetrix, Santa Clara, CA) which analyze over 47,000 transcripts. MPNST were obtained from Massachusetts General Hospital

(Miller, Jessen et al. 2009) and colorectal cancer samples were obtained from the H. Lee Moffitt

Cancer Center (Kaiser, Park et al. 2007). All data files are available at the Gene Expression

Omnibus Profiles website at the National Center for Biotechnology Information. Affymetrix raw data in CEL format was analyzed using GeneSpring 7.0 (Agilent Technologies). To control for chip-wide variations in intensity, optical noise and non-specific probe binding, raw probe signals were background corrected, normalized, and converted to probeset signals using Robust Multi- array Analysis (RMA) (Irizarry, Hobbs et al. 2003). The RMA algorithm is composed of per chip subtraction of probe noise, quantile normalization of probe intensity to total chip intensity and probe signals summarized into an expression measure per probeset, per chip. To identify a set of co-regulated genes, the MDK probeset (209035_at) was correlated to probesets with RMA expression values greater than 6.0 in at least 5 samples using the Pearson correlation coefficient

(range 0.400 to 0.611). A list of 348 genes (462 probesets) with expression across the tumor series that correlate with MDK expression was generated. To control for multiple testing effects, a Benjamini and Hochberg false discovery rate (FDR) threshold of 0.001 was used. 31

Functional Enrichment Analysis

ToppFun (Transcriptome, ontology, phenotype, proteome, and pharmacome annotations based gene list functional enrichment analysis) (Chen, Bardes et al. 2009) was used to identify enriched biological processes, pathways, phenotype, literature co-citation, etc. The database queried is compiled from a collection of publically available gene and protein annotation databases such as

Gene Ontology (www.geneontology.org), Human Phenotype Ontology (www.human-phenotype- ontology.org/index.php/hpo_home.html) Entrez Gene (www.ncbi.nlm.nih.gov/sites/entrez? db=gene), European Molecular Biology Laboratory (www.embl.org), Mouse Genome

Informatics (www.informatics.jax.org), and others. Enrichment in a functional category was considered significant with a one-tailed Fisher exact test p value of 0.01 and 10 gene hits with

FDR correction.

Gene Interaction Network Analysis

To analyze whether the MDK-like genes interact and form potential functional sub-networks,

ToppGenenet was used to generate genetic interaction networks preferentially enriched for the

348 MDK co-regulated input genes based on their connectivity to neighboring genes.

ToppGenenet utilizes the Biomolecular Interaction Network Database (BIND) (Bader, Betel et al. 2003), the Biological General Repository for Interaction Datasets (BioGRID) (Breitkreutz,

Stark et al. 2008), and the Human Protein Reference Database (HPRD) (Keshava Prasad, Goel et al. 2009) which contain gene annotation and protein-protein interactions from published data that were analyzed and interpreted by expert biologists (Chen, Bardes et al. 2009). To identify candidate genes in the immediate interactome of the input gene list, direct and indirect (one-seed 32

neighbor distance) protein-protein interactions were included in the analysis. A K-step Markov method of graph prioritization was performed using a step size of six. Network interaction data in excel format were imported into Cytoscape (Shannon, Markiel et al. 2003) and a spring- embedded layout algorithm based on the force-directed layout originally implemented by

Kamada and Kawai was applied (Kamada and Kawai 1989). The network was then imported into

Gephi (Bastian, Heymann et al. 2009) for the final graphical clustering, layout generation and representation of nodal density based on number of interactants.

Shared cis-Element and cis-Regulatory Module Prediction Analysis oPossum (Ho Sui, Mortimer et al. 2005) was used to identify over-represented transcription factor binding sites (TFBS) in the co-expressed gene list using human-mouse philogenetic footprinting and TFBS detection algorithms. The gene input list was analyzed using the vertebrate taxonomic supergroup of the JASPAR CORE database (Bryne, Valen et al. 2008) of transcription factor consensus sequences, with a minimum of 70% sequence conservation, matrix match threshold of 80%, and distance of 10,000 bases upstream and downstream of the gene coding sequence. A one-tailed Fisher exact test p<0.05 and a Z score >5 was used to identify over-represented sites in the input gene list compared to the proportion of genes in the human genome that contain the TFBS.

To search for cis-regulatory modules, the BlastZ alignment database and Conserved Cis-

Element (ConCisE) Scanner of the UC/CHMC TraFac Homology Server Suite (Jegga, Chen et al. 2007) were used to search the human and mouse genomes for >70% phylogenetically conserved cis-element modules up to 10kb from the transcription start site. Mouse and human non-coding DNA sequences were aligned and transcription factor binding sites were identified in 33

conserved regions. TraFac utilizes MatBase, the transcription factor binding site library and its sequence identification engine, MatInspector (Cartharius, Frech et al. 2005). MatInspector identifies conserved transcription sites by recognizing nucleotide sequence patterns that meet a minimum sequence length and similarity between species to minimize false positives. The minimum similarity is optimized for each sequence to detect a maximum of 3 false positives per

1.5 million base pairs of non-regulatory coding sequence, excluding first exons and genomic repeats.

Statistical Tests Used in the Bioinformatics Analyses

To identify genes that express at levels that correlate with MDK expression in various tumors, a

Pearson correlation coefficient was used, which is calculated by dividing the covariance

(products of two variables minus their respective means) by the product of their standard deviations (square root of their variance). Because of the large number of gene comparisons, a

Benjamini and Hochberg FDR correction was performed to minimize multiple testing effects.

The Benjamini and Hochberg FDR is a Bonferroni-based correction that reduces the false positive rate by calculating the fraction of false positives in all tests deemed significant. The

FDR corrected p value is equal to the sample size multiplied by the significance level and divided by the rank order from the lowest p value (Benjamini and Hochberg 1995). The lowest p value in the gene list will be Bonferroni corrected since the significance level is multiplied by the sample size and divided by 1, but the largest p value will be uncorrected because the sample size and rank order cancel out of the equation.

To determine the probability of gene associations to functional categories in ToppFun, a hypergeometric probability distribution was used to compare the proportion of test genes which 34

enrich in a functional category compared to the proportion of genes in the genome that fit the category. The probability of random sampling of genes compared to genes associated to specific classifications or categories was calculated using a one-tailed Fisher exact test with FDR correction (Chen, Bardes et al. 2009).

In ToppGenenet, graph prioritization of the input gene list and 1 seed neighbor protein- protein interactants was performed using the K-step Markov chains method. A Markov chain or directed graph of nodes and edges is created by calculating probabilities of an interactant node moving from one space to the next. The number of K-steps represents the number of transition probabilities calculated from the node of interest and is graphically represented by the distance between two nodes. Proteins with multiple interactants in the gene list and neighboring protein list form clusters based on K-step transition probabilities (Jarvis and Shier 2000; Gross and

Yellen 2006). Protein-protein interactions obtained from the BIND, BioGRID, and HPRD databases provide the conditional interaction state for each protein which represents a node in the

Markov chain (Chen, Bardes et al. 2009).

For a stringent prediction of cis-elements enriched in the input gene list, oPossum utilizes two statistical methods: the hypergeometric probability distribution with the one-tailed Fisher exact test and continuous probability distribution with a standard deviation Z score (Ho Sui,

Mortimer et al. 2005).

Results

MDK over-expression in tumors correlates with genes involved in cell cycle regulation and stem cell function.

Human colorectal cancer and MPNST were chosen for these analyses because they over- express MDK, patients with these cancers have short median survivals, and microarray data are readily available. To identify mRNA’s co-regulated with MDK expression, Affymetrix gene array data from a total of 121 samples comprised of human colorectal cancers (n=100), MPNST

(n=6), normal Schwann cells (n=10), and normal colon mucosa (n=5) were analyzed using a

Pearson correlation coefficient for each gene pair. To mitigate multiple testing effects, a

Benjamini and Hochberg FDR p-value threshold of 0.001 was used in the analysis. With filtering r>0.4, we found that 348 genes correlate with MDK expression in the various tumor types and their expression intensity is shown in Figure 2-2.

Figure 2-2: 348 genes are co-

regulated with MDK expression in

MPNST and colorectal cancers. A

Pearson correlation cluster analysis was

performed on a total of 121 microarrays Normal Diverse MPNST & composed of human MPNST, Tissues Colorectal Cancers MDK colorectal cancers, normal Schwann

Co-regulated cells, and normal colon mucosa on the Genes r>0.4 x-axis using GeneSpring. 462 array

probesets (348 genes) that correlated

with MDK expression are on the y-

axis. Fisher exact test with Benjamini

and Hochberg False Discovery Rate

(FDR) correction threshold of 0.001

was used in the analysis. Red

represents high gene expression and

blue represents low expression.

To gain insights into the functional role of these MDK co-regulated genes, an enrichment analysis was performed using the ToppFun application from the ToppGene Suite. MDK co- regulated genes were enriched in embryonic and neural stem cell expression profiles and in categories associated with tumorigenesis such as primitive/stem cell-associated growth, metabolism, DNA replication, and cell cycle control (Table 2-1). Taken together, these findings

suggest that MDK expression is associated with genetic programs that are important for tumor initiation and propagation.

Functional Enrichments and Regulome of 348 MDK Co-regulated Genes Corrected Category GO ID Name No. of % of p-value Genes Total (FDR) Coexpression neural stem cells 86 18.6 0.000000 Coexpression embryonic stem cells 60 13.0 0.000000 GO: Biological Process GO:0008152 metabolic process 156 33.8 0.000729 GO: Biological Process GO:0065007 biological regulation 95 20.6 0.003589 GO: Biological Process GO:0016043 cellular component organization and biogenesis 48 10.4 0.002432 GO: Biological Process GO:0006464 protein modification process 45 9.7 0.000213 GO: Biological Process GO:0015031 protein transport 29 6.3 0.000002 GO: Biological Process GO:0007049 cell cycle 25 5.4 0.000410 GO: Biological Process GO:0065009 regulation of molecular function 18 3.9 0.003686 GO: Biological Process GO:0006260 DNA replication 11 2.4 0.000876 GO: Molecular Function GO:0005488 molecule binding 220 47.6 0.000051 GO: Molecular Function GO:0003723 RNA binding 24 5.2 0.000215 Table 2-1: The 348 MDK co-expressed genes enrich in stem cell and proliferation genes.

The co-expression gene set was analyzed for enrichment using the ToppFun application from

the ToppGene Suite. Percent of the total number of genes in the MDK signature was

calculated out of the 348-gene list. Categories enriched in the MDK signature if Fisher exact

test p value of 0.01 and 10 gene hits with Benjamini and Hochberg FDR correction.

Several transcription factors and transcription factor binding proteins co-regulated with

MDK have been associated with various cancers.

To identify transcription factors and transcription factor binding proteins co-regulated with MDK, a gene list of known transcription complex proteins was obtained from the Riken database TFdb (Kanamori, Konno et al. 2004). TFdb is a non-redundant whole genome database of mouse transcription factor and transcription factor binding proteins created by analysis of

LocusLink and Gene Ontology annotations. Human orthologs were extracted from the mouse gene list using the ToppFun gene query engine and intersected with the 348 MDK co-regulated 38

gene list. Out of 348 genes, 66 genes encode for transcription complex proteins (p<0.0001)

(Figure 2-3). MDK is unlikely to be a direct, downstream target of the gene signature because no transcriptional activators of MDK were identified such as hypoxia inducible factor (HIF1α)

(Reynolds, Mucenski et al. 2004), transcription termination factor 1 (TTF1) (Reynolds,

Mucenski et al. 2003), retinoic acid receptors (RAR’s) or retinoid X receptors (RXR’s)

(Matsubara, Take et al. 1994).

Relative Expression

MDK MAD1L1 CBFB HMGB1 ZKSCAN1 ZFR CREB1 ZC3H11A NFYB ZMYM2 GTF2D CBFB PRIM2 ZFAND5 FUS ZNF92 ZNF143 NEK2

66 transcription factors co-expressed with MDK with co-expressed factors transcription 66 YY1 ZNF267 AHR PHTF2 ZHF680 ZNF26 MPNST & Colorectal Cancers Normal Tissues

Figure 2-3: mRNA heatmap of 66 transcription complex proteins co-expressed with

MDK in MPNST and colorectal cancers.

The heatmap represents 66 genes that encode transcription factors and transcription factor binding proteins that correlate with MDK expression. Transcription complex proteins are enriched in the MDK signature compared to the background frequency in the human genome (2x2 cross-tabulation, Fisher exact test, p<0.0001). Red represents high gene expression and blue represents low expression. No transcriptional activators of MDK were found in the gene list such as HIF1α, TTF1, RAR’s or RXR’s.

Transcription complex genes co-regulated with MDK are highly interconnected and a subset of these has been implicated as cancer causal genes.

To gain insights into the interactivity among MDK co-expressed genes involved in transcriptional regulation, a computational analysis of gene interaction networks was performed using ToppGenenet of ToppGene Suite, Cytoscape and Gephi. The gene list was analyzed for direct and indirect protein-protein interactions up to 1 seed neighbor. Nodal size was used as a measure of interconnectivity with a larger node size representing a greater number of protein- protein interactions and the largest three nodes were analyzed in the cancer literature. The network analysis showed that the majority of MDK co-expressed transcription complex genes are highly interconnected (Figure 2-4). In addition, many of the transcription complex genes such as high-mobility group box 1 (HMGB1), cAMP responsive element binding protein 1 (CREB1) and

Yin and Yang 1 (YY1) have been associated with cancer gene expression (Gordon, Akopyan et al.

2006; Chhabra, Fernando et al. 2007; Moriwaka, Luo et al. 2010). Though HMGB1, CREB1, and YY1 do not have direct protein-protein interactions with MDK, they all interact indirectly with MDK within 1 seed neighbor distance. These results suggest that MDK co-regulated transcriptional complex genes are highly interconnected and possibly contribute to the tumorigenicity of the cancer cells.

CREB1 over-expression has been shown to increase chemotherapy resistance by impairing apoptosis in gastric cancer cells (Belkhiri, Dar et al. 2008). CREB1 impairs apoptosis by increasing Bcl2 expression through direct enhancement of the Bcl2 promoter which leads to inhibition of cytochrome c release from the mitochondria and impaired activation of caspase

proteins (Kluck, Bossy-Wetzel et al. 1997; Pugazhenthi, Miller et al. 1999; Belkhiri, Dar et al.

2008).

PPP1CA

CLEC4C PPP1R2 NEK11

CEP250 MAPK1 NEK2

AMOTL2 TUBGCP4 MLX

NDC80 TEX11 NONO COIL FAM131C NINL SNIP1 SUMO2 MAX MAD2L1 TRIM29 SIN3B Z SMAD4 ZMYM4 HSPA4 MAD1L1 SKIL ING1 RBP1 ING2 UBTF HIST2H4A HNRNPA2B1SMAD3 UBE2A RCOR1 CIR1 RPAP1 PHF12 SAP30BP MXD1 CEBPE BRMS1L NCOR1 HNRNPH3 TUBA1B SRSF2 HNRNPA1 BRMS1 GRIN2D HTT USP45 RBBP7 SIN3A USP33 HDAC1 ILF3 HIST1H2AL PTBP1 ZMYM2 RXRA ZFR SRRM1 HIST2H2BE HBP1 ZBTB17 RNPS1 SAP30 TUBB1 HDAC2 KDM1A SRSF4 USF2 USF1 PRMT1 OTUB1 PRRX1 SMAD2 E2F1 ZBTB7A MEPCE PHF21A SRSF10 MTA2 TNFSF10 SFPQ TRIM28 ARL5A RBBP4 SF1 DSN1 OTUB2 STX7 NFKB2 SENP1 SUMO1 CBX5 FUS POLR2A HIST3H3 NCOR2 SREBF1 PIAS1 SARNP CBX1 PIM1 GTF2I NAA38 GRIN1 L3MBTL2 PIAS2 SUZ12 SPI1 PTBP2 ATF7 SP3 EIF6 SP100 ZRANB2 SP4 STK19 MKI67 PTP4A3 KDM5C STAT3 USP7 UBE2I THRA RPS6KA5 CDKN2A FOSL1 HNF1B CBX3 HDAC3 VIM TRIM24 GABPA YBX1 CREBBP BAP1 MAPK3 STAT1 ATF6 BRCA1 NR4A2 PDX1 PRKACA PCGF6 L3MBTL ABL1 EED E2F2 YY1 HIST1H1E YAF2 SRF BTK DNAJB4 ESR1 GLI2 MIS12 RING1 FKBP1A DYRK1A CRTC1 MDM2 AKT1 LBR E2F6 ATF2 NOTCH1 SP1 CREM FHL5 DNMT3B TAF4 KAT2B ATXN7L2 FKBP3 KCNIP3 SOX9 PRKG1 RYBP E2F3 CREB1 JAK2 FHL2 SUPT5H EZH2 RPS6KA2 EDF1 MYC NCOA2 EP300 CHD3 CD99 RPS6KA1 SRC KAT5 S100A8 CYP19A1 CAMK2A PTGES3 CCNT1 PRSS23 AHR RB1 GTF2F2 RPS6KA4 SESN2 PPIA RECQL5 ATM MAPK14 E2F4 MAPKAPK2 TAF6 FHL3 CUL4B IRF3 NEDD8 SMARCA4 RELA GSK3B RAB1A CCND1 TP53 PRDX1 PPP3CA ARNTL SGK1 BSG HSP90AA1 ATF1 TAF7 GTF2F1 RPS6KA3 SMARCA5 PRDX4 STUB1 DAP3 HPS6 ITK NRIP1 PPP2R1B PRR13 CEBPB TSSK4 SESN1 PPP3R1 XPO1 NCOA1 NR2F1 C14orf1 PTPRN NR3C1 ARNT NFYB PPP2R1A RAG1 SOX18 GAPDH PRLR AIP NFYA CSDA RFX1 NFYC UBC HMGB1 MNT ELF1 TBP AR HOXD11 CIITA CNTN2 SIX5 TGIF1 C1orf103 AGER C1QBP DRAP1 TP73 PRKDC CSNK1A1 CEBPZ HOXD10 HES1 PRKCA NCAN DNMT1 PTPRZ1 CTCF TFE3 RUNX2 HOXD9 CBFB HOXB3 TLR2 PGR CDK1 IRF2 RBPJ PLG RASSF4 HOXC6 TAF1 RUNX1 MYOD1 NFKB1 CHGB PLAT CASP3 TLE2 MECP2 HOXD8 ZNF143 HR CUX1 HOXD3 HNRNPK TLR4 RUNX3 CBFA2T2 GTF2A1 CHD8 CRMP1 FOXA3 ATOH1 UNC119 ZFP36 HOXB1 POU5F1 AES PPP2R3A ERF PHLDA3 TLE1

FOXC1 RARS2 NEUROD6 Figure 2-4: Protein-protein interaction network among 66 transcription complex

genes in the cancer MDK signature.

A gene interaction network of transcriptional complex proteins co-regulated with MDK

was created using ToppGenenet of ToppGene Suite, Cytoscape, and Gephi. Green nodes

represent co-regulated transcription factors and pink represents indirect connectivity

through 1 seed distance neighbors. Node size reflects the degree or number of edges

(number of protein-protein interactions). The majority of hubs in the network have been

associated with cancer in the literature. The largest three nodes, HMGB1, CREB1, and

YY1, have been associated with various cancers.

To determine if there are any known cancer causal genes in the MDK co-expressed gene list, we intersected the 348 MDK co-regulated genes with the Cancer Gene Census database

(Futreal, Coin et al. 2004; Santarius, Shipley et al. 2010), a catalogue of genes implicated in oncogenesis in humans, and found an overlap of 10 genes approaching significance (p=0.12). Six genes out of the 10 are transcription complex proteins (TCP’s), either transcription factors or transcription factor binding proteins (TFBP’s) (Table 2-2).

10 Cancer causal genes co-expressed with MDK

Entrez ID Gene Symbol Gene Name Tumor Types

833 CARS cysteinyl-tRNA synthetase ALCL 865 CBFB * core-binding factor, beta subunit AML 1021 CDK6 cyclin-dependent kinase 6 ALL 1385 CREB1 * cAMP responsive element binding protein 1 clear cell sarcoma, angiomatoid fibrous histiocytoma

7913 DEK * DEK oncogene (DNA binding) AML 2521 FUS * fusion, derived from t(12;16) malignant liposarcoma liposarcoma, AML, Ewing sarcoma, angiomatoid fibrous histiocytoma, fibromyxoid sarcoma 84376 HOOK3 hook homolog 3 papillary thyroid 10499 NCOA2 * nuclear receptor coactivator 2 (TIF2) AML 4928 NUP98 nucleoporin 98kDa AML 6917 TCEA1 * transcription elongation factor A (SII), 1 salivary adenoma

* Transcription complex proteins

Table 2-2: 10 out of 348 MDK co-expressed genes are cancer causal genes.

6 out of 10 cancer causal genes are transcription complex proteins (asterisk). The cancer

causal gene list was obtained from the Cancer Gene Census (www.sanger.ac.uk/genetics/

CGP/Census). A 2x2 cross-tabulation, Fisher’s one-tailed exact test approached significance

above background hits (p=0.12).

Computational analyses of MDK co-expressed genes in tumors predict a cis-regulatory module composed of 4 transcription factor response elements in 67 out of 348 MDK co- regulated genes.

To predict gene regulatory mechanisms potentially involved in the MDK gene signature, oPossum was used to identify candidate response elements enriched in the MDK co-expressed genes. The cis-elements statistically over-represented among 348 MDK co-expressed genes are forkhead box D3 (FoxD3), myocyte enhancer factor 2A (MEF2A), hepatic leukemia factor

(HLF), and Interleukin-3 nuclear factor (NFIL3) (Table 2-3). Interestingly, FoxD3 and MEF2A are primitive genes involved in fate determination of stem cells and are expressed in embryonal carcinoma cells (Hidaka, Morisaki et al. 1995; Molkentin, Black et al. 1995; Sutton, Costa et al.

1996). HLF is a proto-oncogene associated with acute lymphocytic leukemia (ALL) (Hunger,

Ohyashiki et al. 1992; Inaba, Roberts et al. 1992). NFIL3 is a transcription factor that competes with HLF for the same response elements and enhances anti-apoptotic pathways in B- lymphocytes (Ikushima, Inukai et al. 1997).

Enriched cis-elements in 348 like MDK genes No. of No. of Target cis-element Type Target % of Binding Z-score Fisher score Genes Total Sites Foxd3 FORKHEAD 195 42.2 987 14.950 4.17E-02 MEF2A MADS 148 32.0 343 10.540 1.41E-03 HLF bZIP 138 29.9 292 12.200 1.38E-02 NFIL3 bZIP 113 24.5 204 6.626 1.58E-02

Table 2-3: cis-Elements enriched in 348 like MDK genes.

oPossum was used to predict transcription factor response elements over-represented in the

MDK signature genes using mouse-human philogenetic footprinting and transcription

factor binding site identification algorithms. Non-coding DNA was analyzed 10,000 base

pairs upstream and downstream of gene coding sequences with a minimum of 70%

sequence conservation, a matrix threshold of 80%, and one-tailed Fisher exact test p<0.05

and Z score >5.

ToppGenet was then used to predict potential protein-protein interactions between signal transduction through activation of the MDK receptors (Low Density Lipoprotein Receptor-

Related Protein (LRP1), Anaplastic Leukemia Kinase Receptor (ALK) and Protein Tyrosine

Phosphase Z (PTPRZ1)) and the 4 enriched cis-elements in the 348 gene signature (Figure 2-5).

MDK has potential indirect protein-protein interaction with MEF2A through three transcription complex protein (TCP) neighbors: Signal Transducer and Activator of Transcription 1 (STAT1)

(Ratovitski, Kotzbauer et al. 1998), E1A binding protein p300 (EP300), and Myogenic

Differentiation Antigen 1 (MYOD1). Molecular perturbations in MEF2A, STAT1, EP300, and

MYOD1 have been associated with hepatocellular carcinoma, colorectal cancer, breast cancer, melanoma, pancreatic cancer, cervical cancer, and rhabdomyosarcoma (Hiranuma, Kawakami et

al. 2004; Bai, Wu et al. 2008; Cao, Yu et al. 2010; Fermento, Gandini et al. 2010; Mees, Mardin et al. 2010; Schultz, Koczan et al. 2010; Simpson, Al-Attar et al. 2010; Syrjanen, Naud et al.

2010; Yau, Esserman et al. 2010).

Figure 2-5: MDK interconnectivity with 4 enriched cis-elements.

A gene interaction network of transcriptional complex proteins co-regulated with MDK

was created using ToppGenenet in ToppGene Suite with indirect connectivity through 1

seed distance neighbors. The network data is derived from a protein-protein interaction

database. In blue: MDK, MEF2A, HLF, FOXD3. Red represents a 1 seed neighbor with

connectivity to the next blue node.

MDK also has potential indirect protein-protein interactions with HLF through 2 or 3

TCP neighbors: 1) STAT1 and CREB Binding Protein (CREBBP); 2) STAT1, EP300 and

albumin D-element Binding Protein (DBP); or 3) STAT1, EP300 and Aryl hydrocarbon

Receptor Nuclear Translocator-Like protein 1 (ARNTL). ARNTL regulates p53 and ARNTL perturbations have been associated with human breast cancers (Mullenders, Fabius et al. 2009).

As a potential indirect protein interactant with MDK, CREBBP is compelling because it is a transcriptional co-activator of CREB1, one the most interconnected transcription factors in the

MDK signature.

FoxD3 interconnects with octamer-binding protein 4 (OCT4, also known as POU domain class 5, transcription factor 1, POU5F1) which has sumoylation in common with MEF2 by

SMT3 suppressor of mif two 3 homolog 1 (SUMO1). FoxD3 has been implicated in embryonal carcinoma and cancer stem cells (Sutton, Costa et al. 1996; Dansranjavin, Krehl et al. 2009).

Because of the large number of target genes predicted to contain one of the 4 cis- elements, a Venn diagram was created to check for overlap of gene lists. Interestingly, 67 out of

348 genes that co-express with MDK are predicted to contain all 4 cis-elements – FoxD3,

MEF2A, HLF, and NFIL3 (Figure 2-6). To assess for enrichments in this cluster of MDK co- regulated genes, they were analyzed using ToppFun of ToppGene Suite. Eleven genes enriched for a renal carcinoma signature and six genes enriched for a stem cell gene signature (Table 2-4).

Figure 2-6: Venn diagram of shared

downstream targets of the enriched

cis-elements in 348 MDK co-regulated

genes.

Of 348 MDK co-regulated genes, 67 are

predicted to contain all 4 over-

represented cis elements – FoxD3,

MEF2A, HLF, and NFIL3.

Corrected Category Name No. of % of p-value Genes Total (FDR) Coexpression Renal Carcinoma Genes 11 2.4 0.00002 Coexpression Stem Cell Genes 6 1.3 0.00017 Table 2-4: 67 genes which share all 4 predicted cis-elements enrich for renal cancer

genes and stem cell gene signatures.

Enrichment analysis using ToppFun Server. One-tailed Fisher exact test with FDR

correction.

To determine if the 4 cis-elements shared by 67 genes in the MDK signature form a cis- regulatory module, the 4 cis-elements were analyzed by ConCisE Scanner. The genome was searched 10,000 base pairs upstream of coding sequence for >70% phylogenetically conserved elements between mouse and human that were within 200bp of each other. Genome-wide, 64 cis- regulatory modules were predicted in 40 genes. Out of 40 genes, there were 7 genes in the genome that contained the 4 cis-elements in close proximity to each other and conserved in order

at less than 2,000 base pair distance from the transcription start site (Table 2-5). The first gene in the table, Bcl2, is not included in the 348 MDK co-regulated gene list, but MDK over-expression has been shown to increase Bcl2 expression in Wilms tumor cells, inhibit apoptosis, and confer chemotherapy resistance to cisplatin (Qi, Ikematsu et al. 2000). Only 2 out of 67 genes that share all 4 predicted cis-elements in the MDK signature were found in the TraFac database. These computational results suggest that the predicted cis-elements may form a cis-regulatory module.

Gene Symbol Gene Name Sequence Start Sites HLF/NFIL3 MEF2 FoxD3 BCL2 B-cell CLL/lymphoma 2 -292 -493 -297 CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) -4 -39 -43 CXCR4 chemokine (C-X-C motif) receptor 4 -787 -798 -800 FGB fibrinogen beta chain -629 -765 -770 FOXC1 forkhead box C1 -470 -567 -565 PAX3 paired box 3 -1288 -1351 -1351 TGFB3 transforming growth factor, beta 3 -111 -119 -122 * DEK DEK oncogene -75 -1143 -511 * TNNC1 troponin C type 1 (slow) -644 -322 -688

* One of 67 predicted target genes in MDK signature Table 2-5: Genome-wide prediction of potential cis-element cassettes containing the 4 predicted cis-elements in the MDK signature.

UC/CHMC TraFac Homology Server Suite was used to locate clusters of cis-elements in 7 genes in the human genome and in 2 MDK signature genes. The top gene, BCL2, is not included in the 348 MDK co-regulated gene list, but MDK over-expression has been shown to increase BCL2 expression, inhibit apoptosis, and confer chemotherapy resistance. Two of 67 predicted target genes (DEK and TNNC1) were found in the cis-clusters within the

BlastZ alignment/TraFac database and results are shown above (asterisk). All the genes in the table contain the 4 cis-elements <2kb from the transcription start site. ConCisE Scanner was used to search the human and mouse genomes for >70% phylogenetically conserved cis-element modules up to 10kb from the transcription start site. DEK and TNNC1 did not appear in the ConCisE scanner analysis because of >200bp distance among elements.

Discussion

MDK is normally expressed during development and aberrantly expressed in tumors postnataly (Iwasaki, Nagata et al. 1997; Mashour, Ratner et al. 2001; Muramatsu 2002; Stoica,

Kuo et al. 2002; Sumi, Muramatsu et al. 2002; Reynolds, Mucenski et al. 2004). However,

MDK’s complex molecular role in the biology of cancer and chemotherapy resistance requires further study. We have identified a MDK cancer signature composed of 348 co-regulated genes enriched in primitive genes involved in tumorigenesis, stem cell genetic regulation, proliferation, cell cycle regulation, and cell survival. Out of 348 genes, 10 have been implicated as cancer causal genes in the Cancer Census database. In addition, 66 out of 348 MDK co-regulated genes are transcription complex proteins that are highly interconnected by protein-protein analyses. A cis-element analysis predicts 4 cis-elements, FoxD3, MEF2A, HLF, and NFIL3, as over- represented in the 348 MDK co-regulated genes, each of which have DNA-binding proteins implicated in various cancers. Because all four cis-elements are predicted to be present in 67 out of 348 MDK co-regulated genes, a cis-regulatory module analysis was performed. The analysis suggests that these four cis-elements may represent an important upstream regulatory module of the MDK cancer signature. Recurring themes in the MDK signature analyses suggest that genetic programs preserve an undifferentiated state or stem cell-like characteristics and chemotherapy resistance, both of which are important features in cancer stem cells. No known transcriptional activators of MDK were found in the co-regulated gene list, suggesting that MDK is not a direct, downstream target of the signature genes. Additional studies are needed to validate the computational analyses, to test MDK regulation of the gene signature, and to test tumorigenicity and chemotherapy resistance hypotheses.

There are 348 genes that co-express with MDK in cancer. Transcriptomic analysis of MPNST primary tumors from patients have been reported to show MDK being expressed in varying intensities (Watson, Perry et al. 2004; Miller, Rangwala et al. 2006). Furthermore, treatment with exogenous MDK has increased chemotherapy resistance and inhibited cancer cell apoptotic pathways in Wilms’ tumor, neuroblastoma, osteosarcoma, and MPNST cells in vitro (Qi,

Ikematsu et al. 2000; Friedrich, Holtkamp et al. 2005; Mirkin, Clark et al. 2005). The MDK gene signature of 348 co-regulated transcripts suggests that MDK plays a complex role in the biology of many different cancers. The functional enrichments identified among these 348 transcripts suggest that MDK over-expression in cancer is associated with lack of differentiation and potentially more aggressive disease, a hypothesis that is supported by previous transcriptomic and pathological analyses (Watson, Perry et al. 2004). Intersection of the MDK co-regulated genes with the Cancer Census database reveals that 10 out of 348 genes have been implicated as cancer causal genes. Further analyses and validation experiments of this signature are needed to better define the role of MDK over-expression in these tumors.

There are 66 transcription complex proteins that are co-expressed with MDK in cancer.

The three most interconnected transcription complex proteins in the MDK signature were

HMGB1, CREB1, and YY1. HMGB1 is a non-histone chromosomal protein that can promote transcriptional complexes and enhance gene transcription through DNA bending (Lotze and

DeMarco 2003). Over-expression of HMGB1 promotes uncontrolled replication, enhanced angiogenesis and promotion of metastasis (Tang, Kang et al. 2010). In addition, HMGB1 over- expression in lymph node macrophage has been associated with impaired anti-cancer immunity against advanced colorectal cancer (Moriwaka, Luo et al. 2010). As seen in our protein interaction network, HMGB1 exhibits the greatest number of protein-protein interactions of all 53

the MDK signature transcription complex proteins. Because of the association of HMGB1 and cancer, and the potential to influence the greatest number of correlated transcription factors and transcription factor binding proteins, HMGB1 is a candidate for upstream regulation of MDK co- expressed genes.

CREB1 over-expression has the ability to affect tumorigenesis through potentiation of proliferation signals and chemotherapy resistance through Bcl2-mediated anti-apoptosis pathways. CREB1 is a cAMP transcriptional complex binding partner that has been associated with cAMP-mediated transduction of proliferation signals such as somatostatin and gonadotropin

(Barton, Muthusamy et al. 1996). In mesothelioma cells, loss of CREB1 function leads to lower

Bcl2 levels and increased apoptosis in response to Doxorubicin (Shukla, Bosenberg et al. 2009).

In gastric cancer cells, CREB1 over-expression has been shown to increase Bcl2 protein, impair cytochrome c release from mitochondria, and inhibit caspase activation (Kluck, Bossy-Wetzel et al. 1997; Pugazhenthi, Miller et al. 1999; Belkhiri, Dar et al. 2008). Clinically, breast cancers that over-express CREB1 have been shown to predict shorter disease-free survival than low

CREB1-expressing tumors (Chhabra, Fernando et al. 2007). Like HMGB1, CREB1 showed a large number of protein-protein interactions with other MDK co-regulated transcription complex proteins and is also a candidate for upstream regulation of MDK co-expressed genes.

YY1, a transcriptional complex protein that is co-expressed with MDK, has been shown to be involved in cell cycle deregulation in various cancers through several different molecular mechanisms (Gordon, Akopyan et al. 2006). Over-expression of YY1 has been shown to activate the proto-oncogene c-myc and lead to progression through the G1/S checkpoint of the cell cycle

(Riggs, Saleque et al. 1993; Shrivastava, Yu et al. 1996). Also, YY1 can dimerize with retinoblastoma (Rb) protein to enhance entry into S phase of the cell cycle (Petkova, 54

Romanowski et al. 2001). YY1 over-expression leads to cell cycle deregulation by inhibiting p53 cell cycle control functions at the G1/S checkpoint through human double minute 2 (HDM2)- mediated p53 ubiquitination (Sui, Affar el et al. 2004). Thus, the network connectivity of YY1 to other transcription factors in the MDK signature is compelling evidence that this protein may be playing an important role in the enhancement of replication in tumors.

There are 4 cis-elements over-represented in 348 MDK co-regulated genes. The FoxD3 response element is one of the cis-elements over-represented in the 348 MDK co-regulated genes. The FoxD3 protein is a primitive transcription factor that is essential for epigenetic preservation of undifferentiated embryonic stem cells and has been found to be expressed in embryonal carcinoma and cancer stem cells (Sutton, Costa et al. 1996; Dansranjavin, Krehl et al.

2009). Our analysis predicts that the FoxD3 protein may be an important upstream regulator of several genes in the MDK signature and may be important for the stem cell-like behavior of cancer.

The cis-element for MEF2A was also over-represented in the MDK signature genes.

MEF2A protein is an enhancer transcription factor that is involved in the fate-determination of mesodermal precursor cells and is involved in myocyte lineage differentiation (Molkentin, Black et al. 1995; Liu, Williams et al. 2007). In addition, increased expression has been associated with embryonal carcinoma cells (Hidaka, Morisaki et al. 1995). MEF2A over-expression and histone hyperacetylation have been associated in hepatocellular carcinoma (Bai, Wu et al. 2008).

Because of the large number of over-represented binding sites in MDK co-regulated genes,

MEF2A is also likely an upstream regulator of multiple MDK signature genes.

Another of the transcription factor binding sites over-represented in the 348 MDK co- regulated genes is HLF, a proto-oncogene involved in the development of ALL. HLF is a basic 55

region-leucine zipper that complexes with the basic helix-loop-helix transcription factor 3(TCF3, also known as E2A). The HLF/TCF3 complex has been shown to control primitive, cell-fate determination during embryogenesis (Hunger, Brown et al. 1994; Hitzler, Soares et al. 1999) and the HLF/TCF3 fusion from translocation t(17;19) leads to malignant transformation of lymphocytes (Inaba, Roberts et al. 1992; Smith, Rhee et al. 1999). Our cis-element analysis predicts that HLF is playing an important regulatory role in the MDK signature and contributing to the preservation of an undifferentiated state of the tumor cell. NFIL3 is another over- represented response element in the 348 MDK co-expressed genes. The NFIL3 binding protein competes with HLF for the same response elements and enhances survival of B-lymphocytes

(Ikushima, Inukai et al. 1997). The enhancement in survival promoted by NFIL3 is reminiscent of the survival enhancement or anti-apoptotic effects seen with MDK over-expression and chemotherapy resistance.

Because the 4 cis-elements were all present in 67 out of 348 genes, a cis-regulatory module analysis was performed. Genome-wide, 64 cis-element cassettes in 40 genes were identified as possible regulatory modules. Furthermore, Bcl2 shows a possible cis-regulatory module, which is compelling because MDK has been shown to induce Bcl2 and chemotherapy resistance in Wilms tumor cells (Qi, Ikematsu et al. 2000). The 4 predicted cis-elements may represent a novel cis-regulatory module and further validation studies are needed.

MDK has potential indirect protein-protein interaction with MEF2A through three TFBP neighbors STAT1, EP300 and MYOD1. Molecular perturbations in MEF2A, STAT1, EP300, and MYOD1 have been associated with hepatocellular carcinoma, colorectal cancer, breast cancer, melanoma, pancreatic cancer, cervical cancer, and rhabdomyosarcoma (Hiranuma,

Kawakami et al. 2004; Bai, Wu et al. 2008; Cao, Yu et al. 2010; Fermento, Gandini et al. 2010; 56

Mees, Mardin et al. 2010; Schultz, Koczan et al. 2010; Simpson, Al-Attar et al. 2010; Syrjanen,

Naud et al. 2010; Yau, Esserman et al. 2010). Because perturbation of these genes is recapitulated in various cancers, the computational enrichment of these cis-elements and their protein-protein partners in the MDK signature is compelling for an important molecular mechanism for regulating genetic programs in cancer biology. Further experiments needed to validate the inter-relationship of these proteins and MDK signaling in tumors.

MDK also has potential indirect protein-protein interactions with HLF through 2 or 3

TCP neighbors: 1) STAT1 and CREBBP; 2) STAT1, EP300 and DBP; or 3) STAT1, EP300, and

ARNTL. There is experimental evidence that ARNTL, a circadian regulation protein, regulates p53 and ARNTL perturbation has been associated with breast cancer (Mullenders, Fabius et al.

2009). The protein-protein interaction analysis suggestion of the neighbor CREBBP is very compelling because it is a known transcriptional co-activator of CREB1, one of our most interconnected transcription factors in our MDK signature. CREB1 perturbation has been associated with worse prognosis in breast cancer patients (Chhabra, Fernando et al. 2007) and impaired apoptosis through increased Bcl2 levels in gastric cancer cells (Kluck, Bossy-Wetzel et al. 1997; Pugazhenthi, Miller et al. 1999; Belkhiri, Dar et al. 2008).

A computational analyses-based molecular model of MDK signaling. A molecular model of

MDK signaling and gene signature modulation in tumor cells can be derived from the computational analyses (Figure 2-7). The protein-protein interaction network reflects experimental evidence that MDK activates CREBBP and EP300 through JAK/STAT1 signaling

(Ratovitski, Kotzbauer et al. 1998). CREBBP and EP300 are co-activators of many transcription complex proteins such as CREB, MEF2A, YY1, BRCA1 and HMGB1(Goldman, Tran et al.

1997; Miska, Karlsson et al. 1999; Pasheva, Sarov et al. 2004; Oishi, Kitagawa et al. 2006). 57

CREBBP and EP300 increase gene expression through histone acetyltransferase (HAT) activity, recruitment of RNA polymerase components and act as transcriptional complex adapter molecules (Goodman and Smolik 2000). HMGB1 modulates Oct-4 and FoxD3, which along with enriched cis-elements NFIL3, HLF, and MEF2A may lead to activation of stem cell and cancer genes through a cis-regulatory module. CREB1, a known binding partner of CREBBP and EP300, is highly interconnected and potentially upstream of other gene products in the MDK signature involved in anti-apoptosis, which is a known mechanism for chemoresistance. JAK-

STAT signaling may also lead to activation of YY1-mediated gene pathways.

MDK Tumor Cell

P P JAK1 JAK2 YY1 CREB1 HMGB1 P STAT1 K Oct-4 Bcl-2 mediated anti-apoptosis EP300 CREBBP chemo resistance Proliferation

FOXD3 MEF2A HLF NFIL3

67 Genes

Figure 2-7: Proposed molecular mechanism for MDK modulation of gene signature in

tumorigenic and chemoresistant cell.

Transcription factors in the MDK signature with a large number of protein-protein

interactions are in black. MDK activates CREBBP and EP300 through JAK/STAT1

signaling. CREBBP and EP300 are co-activators of the CREB, MEF2A, YY1, and

HMGB1 transcription complex proteins. HMGB1 modulates Oct-4 and FoxD3, which

along with enriched cis-elements NFIL3, HLF, and MEF2A may lead to activation of stem

cell and cancer genes. CREB1 is highly interconnected and upstream of other gene

products in the MDK signature involved in anti-apoptosis, which is a known mechanism

for chemoresistance. Solid arrows represent experimental evidence for connectivity.

Hashed arrows represent hypothetical relationships.

The potential roles of 348 MDK co-regulated genes in tumorigenesis and chemotherapy resistance. This study has identified many genes co-regulated with MDK that are cancer causal genes or show perturbed expression in cancer cells, multiple enriched cis-elements that have been implicated in cancer signatures, genes enriched in primitive stem cell signatures, and genes involved in enhancement of anti-apoptosis. Anti-apoptosis has been shown to be a mechanism for chemotherapy resistance to various agents such as cisplatin, doxorubicin, and 5-FU (Kang,

Kim et al. 2007). A cluster of 67 genes is predicted to share 4 cis-elements over-represented in the MDK gene signature. Furthermore, 11 of these enrich for a carcinoma signature while 6 enrich for a primitive stem cell signature. The significance of these results is accentuated by the experimental evidence showing that tumor-initiating cells or cancer stem cells (CSC) are critical for tumor propagation, recurrence, and metastases (Bomken, Fiser et al. 2010; Singh and

Settleman 2010). There seems to be great overlap in the MDK gene signature involving primitive stem cell genes and cancer-associated or cancer-causal genes. Previous studies have shown that

CSC not only lead to cancer recurrence, but characteristically, are chemotherapy resistant (Singh and Settleman 2010). MDK has been shown to potentiate chemotherapy resistance in several different cancer models (Qi, Ikematsu et al. 2000; Mirkin, Clark et al. 2005). Interestingly, the cis-regulatory module analysis shows that the Bcl2 promoter is predicted to contain a cis-element cassette. This is compelling because Bcl2 has previously been shown to be induced by exogenous MDK and cause chemotherapy resistance in Wilms tumor cells (Qi, Ikematsu et al.

2000). Thus, it is possible that the MDK co-expressed genes play a role in cancer by contributing to malignant transformation, to altered cell fate-determination to preserve the undifferentiated state, and to chemotherapy resistance, three important characteristics of the CSC.

In conclusion, we have identified a MDK gene signature present in multiple different tumor types. The MDK signature contains 10 cancer causal genes and others that have been associated with perturbations in cancer cell expression. The MDK signature shows enrichment in tumorigenesis and chemotherapy resistance categories. Also, 66 out of 348 genes are transcription complex proteins and the majority show high interconnectivity. A cis-element analysis showed 4 over-represented response elements that may be involved in upstream genetic regulation of the MDK signature as a cis-regulatory module and upstream of Bcl2. Additional studies are needed for validation of computational predictions.

66 transcription factors in the MDK signature

Entrez ID Gene Symbol Gene Name

25909 AHCTF1 zinc finger protein 143 196 AHR transcription elongation factor A (SII), 1 23141 ANKLE2 aryl hydrocarbon receptor 11176 BAZ2A primase, DNA, polypeptide 2 (58kDa) 54880 BCOR zinc finger, CCHC domain containing 17 10438 C1D polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa 865 CBFB putative homeodomain transcription factor 2 11335 CBX3 nuclear transcription factor Y, beta 1385 CREB1 NIMA (never in mitosis gene a)-related kinase 2 7913 DEK grainyhead-like 1 (Drosophila) 85403 EAF1 zinc finger, DHHC-type containing 20 2521 FUS YY1 transcription factor 8087 FXR1 general transcription factor IIi 2738 GLI4 zinc finger, AN1-type domain 5 29841 GRHL1 ELL associated factor 1 2969 GTF2I GLI family zinc finger 4 3146 HMGB1 zinc finger, AN1-type domain 1 3621 ING1 zinc finger protein 267 51088 KLHL5 fragile X mental retardation, autosomal homolog 1 55975 KLHL7 inhibitor of growth family, member 1 8379 MAD1L1 zinc finger protein 680 4176 MCM7 Sin3A-associated protein, 30kDa 90390 MED30 ankyrin repeat and LEM domain containing 2 136319 MTPN MAD1 mitotic arrest deficient-like 1 (yeast) 4664 NAB1 arginyl-tRNA synthetase 2, mitochondrial 10499 NCOA2 thymopoietin 4751 NEK2 high-mobility group box 1 4801 NFYB C1D nuclear receptor corepressor 10914 PAPOLA ring finger protein 141 57157 PHTF2 serine/arginine-rich splicing factor 10 10464 PIBF1 zinc finger with KRAB and SCAN domains 1 5440 POLR2K peptidylprolyl isomerase A (cyclophilin A) 5478 PPIA zinc finger, MYM-type 2 5052 PRDX1 Sp3 transcription factor 5558 PRIM2 peroxiredoxin 1 5862 RAB2A RAB2A, member RAS oncogene family 57038 RARS2 poly(A) polymerase alpha 5991 RFX3 zinc finger protein 92 50862 RNF141 suppressor of Ty 16 homolog (S. cerevisiae) 10284 SAP18 regulatory factor X, 3 (influences HLA class II expression) 8819 SAP30 zinc finger protein 638 6670 SP3 BCL6 corepressor 10772 SRSF10 nuclear receptor coactivator 2 11198 SUPT16H bromodomain adjacent to zinc finger domain, 2A 6917 TCEA1 ubiquitin-conjugating enzyme E2W (putative) 7112 TMPO AT hook containing transcription factor 1 9878 TOX4 progesterone immunomodulatory binding factor 1 55284 UBE2W chromobox homolog 3 7528 YY1 TOX high mobility group box family member 4 221527 ZBTB12 zinc finger protein 26 9877 ZC3H11A DEK oncogene 29066 ZC3H7A zinc finger RNA binding protein 51538 ZCCHC17 mediator complex subunit 30 253832 ZDHHC20 zinc finger CCCH-type containing 7A 79752 ZFAND1 kelch-like 5 (Drosophila) 7763 ZFAND5 cAMP responsive element binding protein 1 51663 ZFR fused in sarcoma 7586 ZKSCAN1 myotrophin 7750 ZMYM2 kelch-like 7 (Drosophila) 7702 ZNF143 zinc finger and BTB domain containing 12 7574 ZNF26 zinc finger CCCH-type containing 11A 10308 ZNF267 NGFI-A binding protein 1 (EGR1 binding protein 1) 27332 ZNF638 zinc finger protein 706 340252 ZNF680 Sin3A-associated protein, 18kDa 51123 ZNF706 core-binding factor, beta subunit 168374 ZNF92 minichromosome maintenance complex component 7 Supplemental Figure 2-1: Transcription complex proteins in the MDK gene signature.

The 348 MDK co-regulated gene list was intersected with the Riken transcription factor

database. The MDK signature is significantly enriched with transcription complex proteins (2x2

cross-tabulation, one-tailed Fisher exact test p<0.0001.

No. of No. of Target cis-element Type Target % of Binding Z-score Fisher score Genes Total Sites Prrx2 HOMEO 45 67.2 846 15.89 2.72E-02 Cebpa bZIP 40 59.7 171 7.059 4.86E-03 FOXI1 FORKHEAD 39 58.2 234 13.11 1.64E-02 Foxa2 FORKHEAD 39 58.2 237 13.77 1.78E-02 SOX9 HMG 39 58.2 235 13.56 3.46E-02 Foxd3 FORKHEAD 38 56.7 297 22.06 4.33E-02 NKX3-1 HOMEO 37 55.2 223 12.58 3.05E-02 MEF2A MADS 34 50.7 92 8.909 2.89E-04 Foxq1 FORKHEAD 30 44.8 112 12.4 2.81E-02 NFIL3 bZIP 29 43.3 65 11.45 3.05E-04 HLF bZIP 29 43.3 72 6.906 1.63E-02 Lhx3 HOMEO 26 38.8 73 6.916 1.96E-02 E2F1 E2F_TDP 21 31.3 47 9.441 2.53E-02 MIZF ZN-FINGER, C2H2 14 20.9 28 16.43 6.12E-03 Pax4 PAIRED-HOMEO 4 6.0 4 15.73 8.73E-03 Supplemental Figure 2-2: Enriched cis-elements in 66 like MDK transcription

complex proteins.

oPossum was used to predict transcription factor response elements over-represented in the

MDK signature genes using mouse-human philogenetic footprinting and transcription

factor binding site identification algorithms. Non-coding DNA was analyzed 10,000 base

pairs upstream and downstream of gene coding sequences with a minimum of 70%

sequence conservation, a matrix threshold of 80%, and one-tailed Fisher exact test p<0.05

and Z score >5.

REFERENCES

Aridome, K., J. Tsutsui, et al. (1995). "Increased midkine gene expression in human gastrointestinal cancers." Jpn J Cancer Res 86(7): 655-661. Bader, G. D., D. Betel, et al. (2003). "BIND: the Biomolecular Interaction Network Database." Nucleic Acids Res 31(1): 248-250. Bai, X., L. Wu, et al. (2008). "Overexpression of myocyte enhancer factor 2 and histone hyperacetylation in hepatocellular carcinoma." J Cancer Res Clin Oncol 134(1): 83- 91. Barton, K., N. Muthusamy, et al. (1996). "Defective thymocyte proliferation and IL-2 production in transgenic mice expressing a dominant-negative form of CREB." Nature 379(6560): 81-85. Bastian, M., S. Heymann, et al. (2009). "Gephi: An Open Source Software for Exploring and Manipulating Networks." International AAAI Conference on Weblogs and Social Media. Belkhiri, A., A. A. Dar, et al. (2008). "t-Darpp promotes cancer cell survival by upregulation of Bcl2 through Akt-dependent mechanism." Cancer Res 68(2): 395-403. Benjamini, Y. and Y. Hochberg (1995). "Controlling the false discovery rate: a practical and powerful approach to multiple testing." J. Roy. Statist. Soc. 1: 289–300. Bomken, S., K. Fiser, et al. (2010). "Understanding the cancer stem cell." Br J Cancer 103(4): 439-445. Breitkreutz, B. J., C. Stark, et al. (2008). "The BioGRID Interaction Database: 2008 update." Nucleic Acids Res 36(Database issue): D637-640. Bryne, J. C., E. Valen, et al. (2008). "JASPAR, the open access database of transcription factor-binding profiles: new content and tools in the 2008 update." Nucleic Acids Res 36(Database issue): D102-106. Cao, L., Y. Yu, et al. (2010). "Genome-wide identification of PAX3-FKHR binding sites in rhabdomyosarcoma reveals candidate target genes important for development and cancer." Cancer Res 70(16): 6497-6508. Cartharius, K., K. Frech, et al. (2005). "MatInspector and beyond: promoter analysis based on transcription factor binding sites." Bioinformatics 21(13): 2933-2942. Chen, J., E. E. Bardes, et al. (2009). "ToppGene Suite for gene list enrichment analysis and candidate gene prioritization." Nucleic Acids Res 37(Web Server issue): W305-311. Chhabra, A., H. Fernando, et al. (2007). "Expression of transcription factor CREB1 in human breast cancer and its correlation with prognosis." Oncol Rep 18(4): 953-958. Choudhuri, R., H. T. Zhang, et al. (1997). "An angiogenic role for the neurokines midkine and pleiotrophin in tumorigenesis." Cancer Res 57(9): 1814-1819. Cortese, R., O. Hartmann, et al. (2008). "Correlative gene expression and DNA methylation profiling in lung development nominate new biomarkers in lung cancer." Int J Biochem Cell Biol 40(8): 1494-1508. Dai, L. C. (2009). "Midkine translocated to nucleoli and involved in carcinogenesis." World J Gastroenterol 15(4): 412-416.

Dansranjavin, T., S. Krehl, et al. (2009). "The role of promoter CpG methylation in the epigenetic control of stem cell related genes during differentiation." Cell Cycle 8(6): 916-924. de Gramont, A., A. Figer, et al. (2000). "Leucovorin and fluorouracil with or without oxaliplatin as first-line treatment in advanced colorectal cancer." J Clin Oncol 18(16): 2938-2947. Fermento, M. E., N. A. Gandini, et al. (2010). "Intracellular distribution of p300 and its differential recruitment to aggresomes in breast cancer." Exp Mol Pathol 88(2): 256-264. Friedrich, C., N. Holtkamp, et al. (2005). "Overexpression of Midkine in malignant peripheral nerve sheath tumor cells inhibits apoptosis and increases angiogenic potency." Int J Oncol 27(5): 1433-1440. Futreal, P. A., L. Coin, et al. (2004). "A census of human cancer genes." Nat Rev Cancer 4(3): 177-183. Goldberg, R. M., D. J. Sargent, et al. (2006). "Randomized controlled trial of reduced-dose bolus fluorouracil plus leucovorin and irinotecan or infused fluorouracil plus leucovorin and oxaliplatin in patients with previously untreated metastatic colorectal cancer: a North American Intergroup Trial." J Clin Oncol 24(21): 3347- 3353. Goldman, P. S., V. K. Tran, et al. (1997). "The multifunctional role of the co-activator CBP in transcriptional regulation." Recent Prog Horm Res 52: 103-119; discussion 119- 120. Goodman, R. H. and S. Smolik (2000). "CBP/p300 in cell growth, transformation, and development." Genes Dev 14(13): 1553-1577. Gordon, S., G. Akopyan, et al. (2006). "Transcription factor YY1: structure, function, and therapeutic implications in cancer biology." Oncogene 25(8): 1125-1142. Gross, J. L. and J. Yellen, Eds. (2006). Graph Theory and Its Applications. Discrete Mathematics and Its Applications. Hidaka, K., T. Morisaki, et al. (1995). "The MEF2B homologue differentially expressed in mouse embryonal carcinoma cells." Biochem Biophys Res Commun 213(2): 555- 560. Hiranuma, C., K. Kawakami, et al. (2004). "Hypermethylation of the MYOD1 gene is a novel prognostic factor in patients with colorectal cancer." Int J Mol Med 13(3): 413-417. Hitzler, J. K., H. D. Soares, et al. (1999). "Expression patterns of the hepatic leukemia factor gene in the nervous system of developing and adult mice." Brain Res 820(1- 2): 1-11. Ho Sui, S. J., J. R. Mortimer, et al. (2005). "oPOSSUM: identification of over-represented transcription factor binding sites in co-expressed genes." Nucleic Acids Res 33(10): 3154-3164. Hunger, S. P., R. Brown, et al. (1994). "DNA-binding and transcriptional regulatory properties of hepatic leukemia factor (HLF) and the t(17;19) acute lymphoblastic leukemia chimera E2A-HLF." Mol Cell Biol 14(9): 5986-5996.

Hunger, S. P., K. Ohyashiki, et al. (1992). "Hlf, a novel hepatic bZIP protein, shows altered DNA-binding properties following fusion to E2A in t(17;19) acute lymphoblastic leukemia." Genes Dev 6(9): 1608-1620. Ikematsu, S., K. Okamoto, et al. (2003). "High levels of urinary midkine in various cancer patients." Biochem Biophys Res Commun 306(2): 329-332. Ikematsu, S., A. Yano, et al. (2000). "Serum midkine levels are increased in patients with various types of carcinomas." Br J Cancer 83(6): 701-706. Ikushima, S., T. Inukai, et al. (1997). "Pivotal role for the NFIL3/E4BP4 transcription factor in interleukin 3-mediated survival of pro-B lymphocytes." Proc Natl Acad Sci U S A 94(6): 2609-2614. Inaba, T., W. M. Roberts, et al. (1992). "Fusion of the leucine zipper gene HLF to the E2A gene in human acute B-lineage leukemia." Science 257(5069): 531-534. Irizarry, R. A., B. Hobbs, et al. (2003). "Exploration, normalization, and summaries of high density oligonucleotide array probe level data." Biostatistics 4(2): 249-264. Iwasaki, W., K. Nagata, et al. (1997). "Solution structure of midkine, a new heparin- binding growth factor." Embo J 16(23): 6936-6946. Jarvis, J. P. and D. R. Shier (2000). Graph-Theoretic Analysis of Finite Markov Chains. Applied Mathematical Modeling: A Multidisciplinary Approach. D. R. Shier and K. T. Wallenius. Jegga, A. G., J. Chen, et al. (2007). "GenomeTrafac: a whole genome resource for the detection of transcription factor binding site clusters associated with conventional and microRNA encoding genes conserved between mouse and human gene orthologs." Nucleic Acids Res 35(Database issue): D116-121. Kaiser, S., Y. K. Park, et al. (2007). "Transcriptional recapitulation and subversion of embryonic colon development by mouse colon tumor models and human colon cancer." Genome Biol 8(7): R131. Kamada, T. and S. Kawai (1989). "An algorithm for drawing general undirected graphs." Information Processing Letters 31(1): 7-15. Kanamori, M., H. Konno, et al. (2004). "A genome-wide and nonredundant mouse transcription factor database." Biochem Biophys Res Commun 322(3): 787-793. Kang, H. C., I. J. Kim, et al. (2007). "Regulation of MDK expression in human cancer cells modulates sensitivities to various anticancer drugs: MDK overexpression confers to a multi-drug resistance." Cancer Lett 247(1): 40-47. Keshava Prasad, T. S., R. Goel, et al. (2009). "Human Protein Reference Database--2009 update." Nucleic Acids Res 37(Database issue): D767-772. Kluck, R. M., E. Bossy-Wetzel, et al. (1997). "The release of cytochrome c from mitochondria: a primary site for Bcl-2 regulation of apoptosis." Science 275(5303): 1132-1136. Krzystek-Korpacka, M., M. Matusiewicz, et al. (2007). "Serum midkine depends on lymph node involvement and correlates with circulating VEGF-C in oesophageal squamous cell carcinoma." Biomarkers 12(4): 403-413. Leroy, K., V. Dumas, et al. (2001). "Malignant Peripheral Nerve Sheath Tumors Associated With Neurofibromatosis Type 1: A Clinicopathologic and Molecular Study of 17 Patients." Arch Dermatol 137(7): 908-913.

Liu, N., A. H. Williams, et al. (2007). "An intragenic MEF2-dependent enhancer directs muscle-specific expression of microRNAs 1 and 133." Proc Natl Acad Sci U S A 104(52): 20844-20849. Lotze, M. T. and R. A. DeMarco (2003). "Dealing with death: HMGB1 as a novel target for cancer therapy." Curr Opin Investig Drugs 4(12): 1405-1409. Lucas, S., T. Reindl, et al. (2009). "Increased midkine serum levels in pediatric embryonal tumor patients." J Pediatr Hematol Oncol 31(10): 713-717. Maeda, S., H. Shinchi, et al. (2007). "Clinical significance of midkine expression in pancreatic head carcinoma." Br J Cancer 97(3): 405-411. Mashour, G. A., N. Ratner, et al. (2001). "The angiogenic factor midkine is aberrantly expressed in NF1-deficient Schwann cells and is a mitogen for neurofibroma- derived cells." Oncogene 20(1): 97-105. Matsubara, S., M. Take, et al. (1994). "Mapping and characterization of a retinoic acid- responsive enhancer of midkine, a novel heparin-binding growth/differentiation factor with neurotrophic activity." J Biochem 115(6): 1088-1096. Mees, S. T., W. A. Mardin, et al. (2010). "EP300--a miRNA-regulated metastasis suppressor gene in ductal adenocarcinomas of the pancreas." Int J Cancer 126(1): 114-124. Miller, S. J., W. J. Jessen, et al. (2009). "Integrative genomic analyses of neurofibromatosis tumours identify SOX9 as a biomarker and survival gene." EMBO Mol Med 1(4): 236-248. Miller, S. J., F. Rangwala, et al. (2006). "Large-scale molecular comparison of human schwann cells to malignant peripheral nerve sheath tumor cell lines and tissues." Cancer Res 66(5): 2584-2591. Mirkin, B. L., S. Clark, et al. (2005). "Identification of midkine as a mediator for intercellular transfer of drug resistance." Oncogene 24(31): 4965-4974. Miska, E. A., C. Karlsson, et al. (1999). "HDAC4 deacetylase associates with and represses the MEF2 transcription factor." EMBO J 18(18): 5099-5107. Molkentin, J. D., B. L. Black, et al. (1995). "Cooperative activation of muscle gene expression by MEF2 and myogenic bHLH proteins." Cell 83(7): 1125-1136. Moriwaka, Y., Y. Luo, et al. (2010). "HMGB1 attenuates anti-metastatic defense of the lymph nodes in colorectal cancer." Pathobiology 77(1): 17-23. Mullenders, J., A. W. Fabius, et al. (2009). "A large scale shRNA barcode screen identifies the circadian clock component ARNTL as putative regulator of the p53 tumor suppressor pathway." PLoS One 4(3): e4798. Muramatsu, T. (2002). "Midkine and pleiotrophin: two related proteins involved in development, survival, inflammation and tumorigenesis." J Biochem (Tokyo) 132(3): 359-371. O'Brien, T., D. Cranston, et al. (1996). "The angiogenic factor midkine is expressed in bladder cancer, and overexpression correlates with a poor outcome in patients with invasive cancers." Cancer Res 56(11): 2515-2518. Oishi, H., H. Kitagawa, et al. (2006). "An hGCN5/TRRAP histone acetyltransferase complex co-activates BRCA1 transactivation function through histone modification." J Biol Chem 281(1): 20-26.

Ota, K., H. Fujimori, et al. (2008). "Midkine as a prognostic biomarker in oral squamous cell carcinoma." Br J Cancer 99(4): 655-662. Pasheva, E., M. Sarov, et al. (2004). "In vitro acetylation of HMGB-1 and -2 proteins by CBP: the role of the acidic tail." Biochemistry 43(10): 2935-2940. Petkova, V., M. J. Romanowski, et al. (2001). "Interaction between YY1 and the retinoblastoma protein. Regulation of cell cycle progression in differentiated cells." J Biol Chem 276(11): 7932-7936. Pugazhenthi, S., E. Miller, et al. (1999). "Insulin-like growth factor-I induces bcl-2 promoter through the transcription factor cAMP-response element-binding protein." J Biol Chem 274(39): 27529-27535. Qi, M., S. Ikematsu, et al. (2000). "Midkine rescues Wilms' tumor cells from cisplatin- induced apoptosis: regulation of Bcl-2 expression by Midkine." J Biochem 127(2): 269-277. Ratovitski, E. A., P. T. Kotzbauer, et al. (1998). "Midkine induces tumor cell proliferation and binds to a high affinity signaling receptor associated with JAK tyrosine kinases." J Biol Chem 273(6): 3654-3660. Reynolds, P. R., M. L. Mucenski, et al. (2004). "Midkine is regulated by hypoxia and causes pulmonary vascular remodeling." J Biol Chem 279(35): 37124-37132. Reynolds, P. R., M. L. Mucenski, et al. (2003). "Thyroid transcription factor (TTF) -1 regulates the expression of midkine (MK) during lung morphogenesis." Dev Dyn 227(2): 227-237. Riggs, K. J., S. Saleque, et al. (1993). "Yin-yang 1 activates the c-myc promoter." Mol Cell Biol 13(12): 7487-7495. Santarius, T., J. Shipley, et al. (2010). "A census of amplified and overexpressed human cancer genes." Nat Rev Cancer 10(1): 59-64. Schultz, J., D. Koczan, et al. (2010). "Tumor-promoting role of signal transducer and activator of transcription (Stat)1 in late-stage melanoma growth." Clin Exp Metastasis 27(3): 133-140. Shannon, P., A. Markiel, et al. (2003). "Cytoscape: a software environment for integrated models of biomolecular interaction networks." Genome Res 13(11): 2498-2504. Shimada, H., Y. Nabeya, et al. (2003). "Preoperative serum midkine concentration is a prognostic marker for esophageal squamous cell carcinoma." Cancer Sci 94(7): 628- 632. Shrivastava, A., J. Yu, et al. (1996). "YY1 and c-Myc associate in vivo in a manner that depends on c-Myc levels." Proc Natl Acad Sci U S A 93(20): 10638-10641. Shukla, A., M. W. Bosenberg, et al. (2009). "Activated cAMP response element binding protein is overexpressed in human mesotheliomas and inhibits apoptosis." Am J Pathol 175(5): 2197-2206. Simpson, J. A., A. Al-Attar, et al. (2010). "Intratumoral T cell infiltration, MHC class I and STAT1 as biomarkers of good prognosis in colorectal cancer." Gut 59(7): 926-933. Singh, A. and J. Settleman (2010). "EMT, cancer stem cells and drug resistance: an emerging axis of evil in the war on cancer." Oncogene 29(34): 4741-4751. Smith, K. S., J. W. Rhee, et al. (1999). "Disrupted differentiation and oncogenic transformation of lymphoid progenitors in E2A-HLF transgenic mice." Mol Cell Biol 19(6): 4443-4451. 67

Stoica, G. E., A. Kuo, et al. (2002). "Midkine binds to anaplastic lymphoma kinase (ALK) and acts as a growth factor for different cell types." J Biol Chem 277(39): 35990- 35998. Sui, G., B. Affar el, et al. (2004). "Yin Yang 1 is a negative regulator of p53." Cell 117(7): 859-872. Sumi, Y., H. Muramatsu, et al. (2002). "Midkine, a heparin-binding growth factor, promotes growth and glycosaminoglycan synthesis of endothelial cells through its action on smooth muscle cells in an artificial blood vessel model." J Cell Sci 115(Pt 13): 2659-2667. Sutton, J., R. Costa, et al. (1996). "Genesis, a winged helix transcriptional repressor with expression restricted to embryonic stem cells." J Biol Chem 271(38): 23126-23133. Syrjanen, S., P. Naud, et al. (2010). "p300 expression is related to high-risk human papillomavirus infections and severity of cervical intraepithelial neoplasia but not to viral or disease outcomes in a longitudinal setting." Int J Gynecol Pathol 29(2): 135- 145. Takei, Y., K. Kadomatsu, et al. (2005). "Morpholino antisense oligomer targeting human midkine: its application for cancer therapy." Int J Cancer 114(3): 490-497. Tang, D., R. Kang, et al. (2010). "High-mobility group box 1 and cancer." Biochim Biophys Acta 1799(1-2): 131-140. Watson, M. A., A. Perry, et al. (2004). "Gene expression profiling reveals unique molecular subtypes of Neurofibromatosis Type I-associated and sporadic malignant peripheral nerve sheath tumors." Brain Pathol 14(3): 297-303. Yau, C., L. Esserman, et al. (2010). "A multigene predictor of metastatic outcome in early stage hormone receptor-negative and triple-negative breast cancer." Breast Cancer Res 12(5): R85.

CHAPTER 3: Molecular Engineering, Efficacy, and Safety of an Oncolytic HSV-1

Transcriptionally Targeted to Midkine-Positive Tumors

See Appendix C for the validation and efficacy portions of this manuscript as published in the

Journal of Gene Medicine July, 2010

Abstract

Expression profile analyses of midkine (MDK), a multifunctional protein important in development but repressed postnataly, indicate that it is highly expressed in ~80% of adult carcinomas and many childhood cancers including malignant peripheral nerve sheath tumors

(MPNST) that overall have a high mortality. Cancer-killing (oncolytic) viruses such as attenuated HSV-1 have been shown in human clinical trials to be safer than current chemotherapy and radiation treatments, however, anti-cancer efficacy needs improvement. One strategy to improve viral oncolytic potency and specificity is transcriptional targeting; the use of tumor-specific promoters to drive critical viral genes or cytotoxic transgenes in cancer cells. In this study, we sought to leverage MDK’s tumor-specific expression to develop a novel oncolytic

Herpes simplex virus (oHSV) capable of transcriptionally targeting developmentally primitive cancers that express MDK (oHSV-MDK-34.5). To increase the oncolytic efficacy of the virus, the human MDK promoter was used to drive the HSV-1 neurovirulence gene, γ134.5, whose protein product increases viral replication. MDK promoter activity and transgene biological activity was confirmed in human MPNST (S462, STS26T) and Ewing sarcoma cells (A673). In vitro replication and cytotoxicity in human fibroblasts and STS26T cells by plaque and MTT assays showed that oHSV-MDK-34.5 increased replication and cytotoxicity compared to oHSV-

MDK-Luc (control virus). In contrast, no significant difference in cytotoxicity was detected between these viruses in normal human fibroblasts. Using the MDK promoter to drive attenuated

HSV-1 showed comparable cytotoxicity to the nestin promoter, and both transcriptionally- targeted viruses showed greater cytotoxicity than oHSV-MDK-Luc in STS26T and A673 cells. oHSV-MDK-34.5 impaired in vivo STS26T tumor growth and increased median survival of tumor-bearing nude mice without compromising safety. In conclusion, the transcriptional targeting of HSV lytic infection to MDK-expressing tumor cells is feasible and oHSV-MDK-

34.5 shows enhanced anti-tumor effects in vitro and in vivo. Further studies are warranted and may lead to its use in human clinical trials.

Introduction

Clinical significance

HSV-1 is one of a variety of viruses being studied and developed for the treatment of cancer (Guo, Thorne et al. 2008). Attenuated oncolytic HSV-1 (oHSV) mutants have been shown to be safe in humans in phase I and phase II clinical trials, but their promise of anti-tumor efficacy has yet to be fully realized (Kasuya, Takeda et al. 2005; Pulkkanen and Yla-Herttuala

2005; Kemeny, Brown et al. 2006). Clinical safety of attenuated oHSVs has been achieved by mutating or deleting viral genes, such as the large unit of ribonucleotide reductase gene, UL39 encoding ICP6, and the neurovirulence factor gene, γ134.5 encoding ICP34.5 (Markert, Medlock et al. 2000; Kelly, Wong et al. 2008; Aghi and Chiocca 2009; Fong, Kim et al. 2009; Markert,

Liechty et al. 2009). Unfortunately, attenuation of viruses to increase safety also reduces tumor lysis capability (Currier, Gillespie et al. 2008; Otsuki, Patel et al. 2008). One strategy to improve viral oncolytic potency and specificity is transcriptional targeting: the use of tumor-specific promoters to drive critical viral genes or cytotoxic transgenes has been shown to increase the anti-tumor efficacy of oncolytic viruses (Varghese and Rabkin 2002; Fu, Meng et al. 2003; 70

Kuroda, Rabkin et al. 2006; Bell 2007; Delgado-Enciso, Cervantes-Garcia et al. 2007; Horst,

Brouwer et al. 2007; Cripe, Wang et al. 2009; Mahller, Williams et al. 2009). Midkine (MDK) is a gene that shows tumor-specific expression and has not been used to increase viral replication and anti-tumor lysis by HSV-1 in MDK over-expressing tumors.

Evidence of MDK over-expression in tumors, biology of attenuated HSV-1, and transcriptional targeting

Midkine (MDK) is a heparin binding growth factor that is normally expressed during mid-gestation but was first described in 1993 as highly expressed in adult and pediatric tumors

(Tsutsui, Kadomatsu et al. 1993). Because of high tumor expression, MDK has been identified as a prognostic marker when measured in serum, urine, and tumors in patients with advanced lung, gastrointestinal, hepatic, biliary, pancreatic, pediatric embryonal, oral squamous cell, breast, urinary bladder, renal, and thyroid carcinomas (Mashour, Ratner et al. 2001; Muramatsu 2002;

Takei, Kadomatsu et al. 2002; Ikematsu, Okamoto et al. 2003; Shimada, Nabeya et al. 2003;

Ikematsu, Nakagawara et al. 2008; Ibusuki, Fujimori et al. 2009; Lucas, Reindl et al. 2009).

There is mounting clinical and experimental evidence that MDK over-expression reflects and may potentially modulate tumor proliferation and chemotherapy resistance mechanisms which are discussed in Chapter 2.

The attenuated HSV-1 used as a parental construct in this study has two viral gene mutations, the ribonucleotide reductase gene UL39/ICP6 and the neurovirulence gene γ134.5 which encodes ICP34.5. ICP6 protein stimulates viral DNA replication and protein translation in growth-arrested cells through two mechanisms: (1) stimulating DNA replication machinery by recruiting deoxynucleotide triphosphates (dNTP) and (2) increasing protein translation by promoting assembly of eukaryotic initiation factor 4F (eIF4F) complexes (Knipe and Howley 71

2007). Because tumors are rapidly dividing and have an abundant supply of dNTP for DNA replication, HSV-1 attenuated for ICP6 can replicate without this protein. However, in growth- arrested cells, ICP6-attenuated HSV-1 cannot promote DNA replication and eIF4F complexes, so viral translation is significantly impaired. ICP34.5 also promotes viral replication by stimulating translation. When host cells are infected, antiviral defense mechanisms activate that lead to shutdown of protein translation to prevent hijacking by the virus. One antiviral mechanism occurs through protein kinase R activation (PKR) which leads to phosphorylation of eIF2α and subsequent translation shutdown. To evade host cell anti-viral defense responses,

ICP34.5 recruits protein phosphatase 1A (PP1A) which dephosphorylates eIF2α to reactivate protein translation machinery and promote viral protein synthesis (He, Chou et al. 1997; Mulvey,

Poppers et al. 2003; Ward, Scheuner et al. 2003). There is also evidence that ICP34.5 promotes

DNA replication by interacting with proliferating cell nuclear antigen (Harland, Dunn et al.

2003).

The overall aim, approach, and findings of this study

The aim of the present study was to determine whether lysis of human tumor cells by oHSV can be improved through the use of the MDK promoter to drive γ134.5-mediated viral replication. To address this question, the MDK promoter was used to drive replication in an

ICP6, γ134.5-deleted, attenuated HSV-1 in MDK-expressing cells by regulating γ134.5 expression. The control vector oHSV-MDK-Luc and oHSV-MDK-34.5 were investigated in validation and cytotoxicity experiments using human MPNST tumor cells and non-tumor, dermal fibroblasts. Replication and cytotoxicity of oHSV-MDK-34.5 was greater than oHSV-MDK-Luc control virus in MDK expressing tumor cells and siRNA knockdown of γ134.5 showed that

replication is dependent on γ134.5 expression. However, oHSV-MDK-34.5 was attenuated in non-MDK expressing, normal fibroblasts. Comparison of transcriptional targeting of attenuated

HSV-1 by MDK and nestin promoters showed comparable in vitro cytotoxicity in STS26T

MPNST and A673 Ewing sarcoma cells. Because not all tumors over-express MDK and nestin, oHSV-MDK-34.5 may be a better choice for oncolytic therapy in select tumors. In vivo, intratumoral oHSV-MDK-34.5 replicated with higher efficiency than control virus in STS26T xenografts. Importantly, there were no detectable extratumoral viral genomes in mouse organs including dorsal root ganglia. Also, there were no clinically significant alterations in renal, hepatic, or bone marrow function in nude athymic mice at three days after intratumoral injection, suggesting that the virus retains the safety profile of the parental virus in immunocompromised, athymic nude mice. Finally, treatment of human MPNST tumor xenografts with oHSV-MDK-

34.5 showed promising anti-tumor effects in vivo and increased survival of tumor-bearing mice.

Materials & Methods

Cell Culture

Human MPNST cells (S462, STS26T) were provided by Nancy Ratner Ph.D. (Cincinnati

Children’s Hospital Medical Center) and human dermal fibroblasts were provided by Dorothy

Supp (Cincinnati Shriners Hospitals for Children). Human Ewing sarcoma cells (A673) and

African green monkey kidney (Vero) cells were obtained from American Type Culture

Collections (ATCC, Manassas, VA). Normal human foreskin keratinocytes were provided by

Susanne Wells Ph.D. (Cincinnati Children’s Hospital Medical Center). All cells were grown in

DMEM with 10% fetal bovine serum (Invitrogen, Carlsbad, CA) and antibiotics as previously described (Mahller, Rangwala et al. 2006). 73

Novartis Tumor Database Analysis

To analyze for MDK over-expression over a diverse group of tumors, the Novartis primary human tumor Affymetrix U95 microarray collection of primary human tumor samples was analyzed (Su, Welsh et al. 2001). The 181 primary human tumor samples analyzed were obtained from the University of Virginia after approval from their Human Investigation

Committee. Neoplastic cell-rich areas were identified by frozen section hematoxylin and eosin

(H&E) prior to tissue sampling for mRNA extraction. Affymetrix probeset data was normalized using GeneChip Robust Multi-array Average (GC-RMA) which incorporates mismatch probe data to improve signal to noise ratio compared to RMA alone. The database was queried for the

MDK probeset (38124_at) using the web client of BioGPS server at biogps.gnf.org (Wu, Orozco et al. 2009). The Affymetrix probeset (38124_at) is composed of 16 intron-spanning probes that cover base pairs 382-813 of exons 3 & 4 of the MDK transcript. Probes 3-16 hybridize to exon 4 which is present in all 5 splice isoforms of MDK. Results were downloaded in excel format and converted to log base two (Su, Welsh et al. 2001). MDK expression values were categorized by tumor type in descending order of expression.

Real-Time Quantitative Polymerase Chain Reaction (qPCR)

Cells were trypsinized and pelleted by centrifugation. RNA was extracted from cells using an

RNeasy kit (Qiagen Inc, Valencia, CA) and converted into cDNA using Superscript II

(Invitrogen, Carlsbad, CA). Quantitative real-time PCR was done using an ABI Prism 7900HT

SD system (Applied Biosystems, Bedford, MA) with a TaqMan Universal PCR Master Mix

(Applied Biosystems). Each reaction was done in triplicate. The forward and reverse primers 74

used were: MDK 5’-CCTGCAACTGGAAGAAGGAG-3’ and 5’-

CTTTCCCTTCCCTTTCTTGG-3’; ICP34.5 5’-GGTCCCAACCGCACAGT-3’ and 5’-

CTCCTGACCACGGGTTCC-3’, respectively. For the ICP34.5 transcription dose response and time course, cells were plated into 6-well plates, then infected with oHSV-MDK-34.5 at a multiplicity of infection (MOI) of 0.01 and 0.1 for the dose response and MOI of 0.1 for the time course. The RNA was harvested after 48 hours of infection for the dose response analysis.

HSV-1 genome absolute quantitation was performed using qPCR. At three days and at 14 days after tumors were intratumorally treated with either PBS, oHSV-MDK-Luc, or oHSV-

MDK-34.5, animals were euthanized by carbon dioxide inhalation and cervical dislocation.

Tumors and mouse organs were harvested and homogenized. DNA from the cell pellets, mouse organs and tumors was harvested using a Gentra Puregene Genomic DNA Purification Kit

(Qiagen, Valencia, CA). qPCR was then performed on 50ng of genomic DNA using thymidine kinase primers (TK 290-F: 5’ TCG CGA ACA TCT ACA CCA CAC AAC; TK 400-R: 5’ CGG

CAT AAG GCA TGC CCA TTG TTA), SYBR Premix Ex Taq II Kit (TaKaRa Bio, Shiga,

Japan). Serial dilution of HSV-1 genomic DNA was performed to create a standard curve.

Human TATA-binding protein (TBP) primers were used for positive and loading controls.

Quantitative real-time PCR was performed using an ABI Prism 7900HT SD system (Applied

Biosystems, Bedford, MA).

Luciferase Assay

The plasmid containing the human MDK promoter driving Renilla luciferase, RIKEN RDB

#5514 clone pKM2L-phMK, was purchased from the RIKEN Institute (Ibaraki, Japan; www2.brc.riken.jp/lab/dna/detail.cgi?rdbno=5514). For the MDK promoter plasmid dose- 75

response assay, pKM2L-phMK was transfected into S462 cells plated in 24-well plates at a concentration range of 0-300ng of plasmid per well. To control for cryptic expression of the luciferase transgene, a promoter-less plasmid driving luciferase (pNull-Luc) was added as an

o additional negative control. After 24 hours of incubation at 37 C and 5% CO2, the media was removed and cells harvested using the Renilla Luciferase Assay System (Promega Corporation,

Madison, WI) per the manufacturer’s instructions and processed in a Luminoskan Ascent

Luminometer with Ascent Software v2.5 (Thermo Fisher Scientific Inc., Waltham, MA).

For the oHSV-MDK-Luc clone bioactivity assay, human MPNST cells (S462) were plated in 24-well plates for 100% confluence the following day. Cells were then infected with

o oHSV-MDK-Luc at an MOI of 0.008. After 6 days of incubation at 37 C and 5% CO2, the media was removed and cells harvested using the Renilla Luciferase Assay System and processed with a luminometer.

Recombinant HSV-1 Construction

The viral constructs in this study were created using HSVQuik as previously described (Terada,

Wakimoto et al. 2006). The transgene cassette plasmid containing the ICP34.5 (pTransfer-34.5) and the HSVQuik bacterial artificial chromosome (BAC) were gifts from Yoshinaga Saeki (The

Ohio State University, Columbus, OH) (Chung, Saeki et al. 1999). The parental virus is MGH1, a double-attenuated, F strain-based HSV-1 with deleted copies of γ134.5 and truncated ICP6 with

EGFP knock-in. The BAC has a prokaryotic backbone with a chloramphenical resistance gene for antibiotic selection, a Flippase recognition target (FRT) site for shuttle recombination, and a

RFP reporter to assess presence or absence of the backbone. The BAC prokaryotic backbone is flanked by loxP sites after shuttle plasmid recombination occurs with the BAC. 76

To create the MDK-34.5 shuttle plasmid pTransfer-M3, the MDK promoter fragment was isolated from pKM2L-phMK by BclI and SpeI sites and directionally subcloned into AvrII and

BclI sites of the pTransfer-34.5 shuttle plasmid backbone upstream of the γ134.5 transgene. To create the MDK-Luc shuttle plasmid pTransfer-ML, the MDK-Luciferase fragment was isolated from pKM2L-phMK by SwaI and SpeI sites and directionally subcloned into AvrII and HincII sites of the shuttle plasmid backbone, completely replacing γ134.5 transgene cassette. pTransfer-

ML and pTransfer-M3 were sequenced by the Genetic Variation and Gene Discovery Core

Facility (Cincinnati Children’s Computational Medicine Center) to confirm their identity. After confirmation that the genes of interest were inserted into the ampicillin-resistant pTransfer plasmids, 50ng of Flippase helper plasmid pFTP-T was co-electroporated with 50ng of pTransfer-ML or pTransfer-M3 into E. coli that contain the chloramphenical-resistant fHSVQuik-1 BAC using an Electroporator 2510 (Eppendorf, Hauppauge, NY) with 25μF,

1.8kV, and 200Ω. Ampicillin and chloramphenical-resistant clones were selected at 43oC to prevent propagation of the temperature sensitive helper plasmid, propagated in LB medium with antibiotics overnight at 37oC, and purified using a QIAfilter Plasmid Midi Kit (Qiagen, Valencia,

CA). Successful recombination was verified by restriction digest using HindIII. 0.5μg of the Cre- recombinase helper plasmid pc-nCre and 2μg of the recombined BAC were co-transfected into

5x105 of African green monkey kidney (Vero) cells in 60mm dishes to splice out the prokaryotic backbone in the BAC which causes loss of RFP expression and virion production. Three days after transfection, four viral clones of each construct were isolated from plaques if they only showed GFP expression. Viral titers were obtained by performing plaque assays. The oncolytic

HSV-1 with the nestin promoter driving γ134.5 (rQNestin34.5) was provided by Yoshinaga Saeki

M.D. Ph.D. and E. Antonio Chiocca M.D. Ph.D. (Ohio State University) (Kambara, Okano et al.

2005).

Viral Titering/Plaque Assay

Confluent monolayers of Vero cells were prepared in 24-well plates followed by serial 10-fold dilutions (10-0 to 10-8) of harvested virus in chilled maintenance medium (1X MEM (Invitrogen,

Carlsbad, CA), with antibiotics). Serial 10-fold dilutions were done by sequential addition of

100μl of the last dilution to 900μl of sterile medium. Cell culture media was removed and 200μl of each dilution was plated in quadruplicate. The plates were then incubated at 37oC for 2 hours and 0.5ml of carboxymethylcellulose (CMC, Sigma-Aldrich, St. Louis, MO) overlay medium

(1% CMC and 10% MEM) was added. After 48 hours of incubation at 37oC, the overlay was removed and wells were fixed and stained with 0.1% crystal violet in 10% ethanol solution for

15 minutes. Plates were dried and plaques counted. The viral titer in pfu/ml was calculated by multiplying the average number of plaques at the target dilution by the dilution factor (Ravi,

Desai et al. 2004).

Western Blot

After removal of cell culture media and washing twice with cold PBS, cell lysates were collected using protein lysis buffer (150mM NaCl, 5mM EDTA (pH 8), 5mM EGTA, 20mM Tris-Cl (pH

7.5), 10%Glycerol, 1%Triton) mixed fresh with 1X protease inhibitor cocktail (BD Pharmingen,

San Diego, CA). Lysates were placed on ice followed by ultra-centrifugation. Protein concentrations were determined using a micro BCA Protein Assay Kit (Pierce, Rockford, IL), followed by electrophoresis separation in running buffer (3g Tris base, 14.4g Glycine, 1g SDS), 78

and electro-transfer to PVDF membranes (Bio-Rad, Hercules, Ca) using transfer buffer (3g Tris base, 14.4g Glycine, 20% Methanol). Blots were then incubated with the primary antibody overnight at 4oC. The rabbit ICP34.5 antibody was a gift from Ian Mohr (State University of

New York at Stony Brook). The mouse beta-actin antibody (Sigma-Aldrich, St. Louis, MO) was used as a loading control. After washing, secondary anti-rabbit IgG, HRP conjugated antibodies

(Amersham Biosciences, Piscataway, NJ) were incubated with blots on a rocker for 30 minutes.

Protein was detected by incubating the ECL-Plus kit (GE Healthcare Life Sciences, Piscataway,

NJ) reagent with the blots for 1 minute while shaken. Blots were exposed on Blue Lite film

(ISCBioExpress, Kaysville, UT) and imaged at various exposures (Mahller, Rangwala et al.

2006).

Viral Replication Assay

Human fibroblasts and STS26T cells were plated at 1x105 in 12-well plates 2 hours prior to infection with 1x104pfu/ml (MOI 0.1) of each virus. After incubation, cells were washed with

PBS and media added. Wells for the three-hour time point were harvested to serve as viral loading controls and the remaining wells were placed in the incubator until 72 hours post- infection. Virus was harvested from cells and supernatant by scraping and freeze-thawing three times. Viral titers were obtained using serial 10-fold dilution plaque assays.

siRNA Creation and Transfection

Human STS26 MPNST cells were cultured in 24-well plates with growth medium at 80% confluence. Twenty-four hours after plating, cells were transfected with γ134.5 siRNA duplexes created with the Silencer siRNA Construction Kit (Ambion, Austin, TX) using the 79

oligonucleotides (Antisense 5'- AACCGCACAGTCCCAGGTAACCCTGTCTC -3', Sense 5'-

AAGTTACCTGGGACTGTGCGGCCTGTCTC -3') or scramble siRNA. The siRNA was mixed with Lipofectamine 2000 (Invitrogen) in OPTI-MEM and transfected per manufacturer’s instructions. After twenty-four hours of incubation, cells were infected with oHSV-MDK-34.5 and γ134.5 knockdown was verified by qPCR.

Transduction Assay

Cells were plated and infected in the same fashion as the cytotoxicity assay described above. A

Zeiss Axiovert 200M inverted microscope (Carl Zeiss Microimaging Inc., Thornwood, NY) was used to capture the images of GFP expressing plaques at 48 hours (Kambara, Okano et al. 2005).

Images were processed for qualitative assessment using Openlab 3 software (Improvision Inc.,

Waltham, MA).

In vitro Viral Potency and Cytotoxicity Assay

STS26T cells were plated at 3,000 cells/well in 50μl in a 96-well plate. After two hours, cells were infected with virus at an MOI of 0.1. For fibroblasts, cells were plated for maximal confluence to create contact inhibition prior to infection at an MOI of 0.1. Plates were incubated for four days and MTT assay performed (dimethylthiazol diphenyltetrazolium bromide, ATCC,

Manassas, VA). For the MTT assay, 10μl of MTT dye was added to each well and incubated for

2 hours at 37oC. After the blue dye was visually confirmed, 100μl of detergent reagent was added. The plate was incubated at room temperature for 2 hours in the dark. After the second incubation, the MTT to formazan signal was measured at 570nm absorbance using a Bio-tek

ELX 808 plate reader (Bio-tek, Winooski, VT). 80

Animal Studies

Animal studies were approved by the Cincinnati Children’s Hospital Institutional Animal Care and Use Committee. For in vivo efficacy experiments, 5x106 STS26T MPNST cells in 33% matrigel were injected subcutaneously into the flanks of 5-6 week old, female nude mice (Harlan

Sprague Dawley, Indianapolis, IN). After the tumors reached 120-200mm3 in size, PBS + 33% matrigel, oHSV-MDK-Luc (1x107pfu), or oHSV-MDK-34.5 (1x107pfu) were injected intratumorally. Serial measurements of tumor size and mouse survival were taken and mice were euthanized when tumors reached >1500mm3.

Tumor Harvesting and Processing

Tumors for nucleic acid and protein analysis were excised and snap frozen in liquid nitrogen.

Tumors for immunohistochemistry were excised and placed in 10% neutral buffered formalin at

4oC overnight. Fixed tissue were processed in a Leica 240 Tissue Processor (Leica, Heidelberg,

Germany). After processing, the tumors were embedded in paraffin.

Histology, Immunohistochemistry, and Immunofluorescence

Using a RM 2035 microtome (Leica, Heidelberg, Germany), serial 5μm sections of paraffin embedded tumors were collected on Superfrost Plus slides (Fisher Scientific, Pittsburgh, PA).

Sections were stained with hematoxylin and eosin (H&E) as previously described (Prophet, Mills et al. 1992).

For immunohistochemistry, 5μm sections of the tumors were washed in xylenes and rehydrated in a series of ethanols and PBS. To block non-specific antibody binding, sections 81

were placed in a protein block (DACO Co., Carpinteria, CA) or 5%goat serum in PBS for 5 minutes. To stain viral GFP protein, slides were stained with goat anti-rabbit GFP antibody

(Invitrogen, Carlsbad, CA) 1:50 at 4oC overnight. Sections were washed and incubated for 30 minutes at room temperature with 1:200 of fluorophore-conjugated secondary antibody (Vector

Laboratories, Burlingame, CA). For darkfield visualization, samples were washed in PBS, then mounted with Fluorescence Mounting Medium with DAPI (DAKO Co., Carpinteria, CA).

Brightfield and darkfield microscopy was performed with a Nikon-80i-Eclipse microscope

(Nikon Instruments Inc., Melville, N.Y.) and sections were analyzed with NIS-Elements imaging software version 3.1 (Nikon Instruments Inc., Melville, N.Y.).

Renal, Hepatic, and Bone Marrow Function

Three days after intratumoral injection, the mice were anesthetized with isofluorane and blood was harvested into EDTA pediatric tubes for a complete blood count analysis (CBC), and into serum tubes for renal and liver function tests (LFTs). Non-EDTA samples were spun at 4000

RPM at 4oC for 5 minutes. The serum was then transferred to clean tubes. Samples were kept on wet ice until assayed. CBC analyses were performed on a Hemavet 950 (Drew Scientific,

Oxford, CT) and the chemistry was performed using a VITROS Fusion 5.1 Chemistry System

(Ortho-Clinical Diagnostics Inc., Rochester, N.Y.).

Statistics

Statistical analyses were performed using SPSS v15.0 (SPSS Inc., Chicago, IL). All group comparisons were tested with Levene’s Test to assess equality of variance between the groups.

Student’s and Welch’s t-tests were used for parametric and non-parametric comparisons between 82

two groups. For ANOVA, Tukey and Games-Howell post-hoc tests were used for parametric and non-parametric multi-group analysis, respectively. A Kaplan-Meier analysis was used to assess mouse survival and evaluated statistically with log rank test and Bonferroni correction. A significance p-value of <0.05 was used in all the assays.

Results

MDK shows variable over-expression in primary human cancers and in cell lines derived from human tumors.

To examine MDK expression in primary human tumors, we analyzed the Novartis U95

Primary Tumor Database for MDK expression using the Affymetrix probeset 38124_at (Su,

Welsh et al. 2001). This MDK probeset is intron-spanning with 14 out of 16 probes detecting all splice isoforms of MDK in the Alternative Splicing and Transcript Diversity (ASTD) database

(Koscielny, Le Texier et al. 2009) except for splice isoforms 7 (SP7) by hybridizing to exon 4

(Figure 3-1). We found that many tumors including breast, gastric, prostate, ovarian, lung, and colon cancers expressed high levels of MDK (Figure 3-2). Gastric, lung, ovarian, and prostate cancers over-express MDK greater than three times the median of all tumors tested while half of the renal cancers do not over-express MDK.

To validate that MDK expression is increased in our in vitro model, qPCR was performed in various cell lines derived from patients with MPNST, neuroblastoma, osteosarcoma, and

Ewing sarcoma. We observed that all the tumor lines tested expressed higher MDK than untransformed cells including fibroblasts, keratinocytes, and Schwann cells (Figure 3-3). These results confirm that our in vitro models recapitulate tumor-specific overexpression of MDK.

Interestingly, we have not found a tumor cell line that (1) does not over-express MDK and (2) is permissive to oHSV replication.

Exons ^ = Intron = Coding Sequence A ExUn 1a·1b ·1c ·1d ·1e·1f^2a·2b^ 3 ^ 4 ^5a·5b^6a·6b^7a·7b·7c ·7d ·7e ·7f s: ------SP1:

- - - - - SP2:

- - SP3:

- SP4:

- - - - - SP5:

- SP6:

- - - Splice Isoforms Splice SP7:

SP8:

MDK - SP9:

- - - SP10: B MDK coding sequence present in NM_001012334 Exon 2 Exon 3 Exon 4 50 220 0 bp 38124_at Probeset 997 bp Probe 1 2 4 6 8 10 11 13 15 3 79 12 14 16 5

Figure 3-1: Affymetrix© MDK Probeset 38124_at. A. Dark blue boxes represent exon segments fragmented by a corresponding splice isoform. Light blue boxes represent exonic segments present in various splice isoforms and the vertical red arrow indicates an intron

(^). B. Red boxes represent exons 2-4 of the MDK transcript and the horizontal red arrow points to individual probes in the probeset. The 38124_at probeset is composed of 16 probes that hybridize to MDK between base pairs 328-813 of the coding sequence. All

MDK splice isoforms in the Alternative Splicing and Transcript Diversity (ASTD) database except for SP7 contain exon 4 which is hybridized by probes 3-16. Splice isoforms, exon and probeset data obtained from ASTD database (Koscielny, Le Texier et al. 2009),

UC/CCHMC TraFac Homology Server (Jegga, Chen et al. 2007), and A Database of

Affymetrix Probesets and Transcripts (ADAPT) (Leong, Yates et al. 2005). 85

Kidney Colon Liver Gastric Breast

Lung

Prostate Ovarian

024681012 N=181 MDK Expression (RMA, log2) Non-Tumor Median Tumor Median

Figure 3-2: MDK shows variable over-expression in primary human cancers in the

Novartis U95 cancer database. The Novartis primary human tumor database was analyzed

for the hybridization intensity (x-axis) of the MDK probeset 38124_at across cancer samples

(y-axis). The log2 median MDK probe hybridization signal of all the cancer samples is 9.0

and log2 three-fold median is 10.6 (n=181 patient samples). The green vertical bar represents

the non-tumor median and the red bar represents tumor median expression of MDK from the

Novartis U133A dataset_1_gene_4192. Non-tumor median obtained from 84 GCRMA-

normalized samples in Novartis GeneAtlas U133A dataset.

* 300

250

200 *

150 * * 100 * * 50 * * QPCR Fold Expression Over Keratinocytes/TBP MPNST Neuroblastoma 0 Osteo & Ewings MDK Ă Non-Tumors

Figure 3-3: Confirmation of MDK expression in cell lines derived from human tumors.

RNA was harvested from (left to right) human MPNST (S462, STS8814, T265, STS26T), neuroblastoma (CHLA20, LA-N-5), Ewing sarcoma (5838), osteosarcoma (U2OS), primary replicating microdermal fibroblasts, primary human Schwann cells, contact-inhibited fibroblasts, and primary human keratinocytes. Relative expression of MDK by qPCR was normalized to TATA-binding protein (TBP). Relative expression is shown as fold expression over keratinocyte MDK expression, as those cells showed the lowest MDK expression. N=3, the asterisks indicate p<0.05.

After confirmation that MPNST cells over-express MDK, we tested the activity of the

MDK promoter plasmid that would be used to create the MDK-targeted oncolytic HSV-1. We observed that luciferase activity increased in response to increasing doses of MDK-Luciferase plasmid transfected into S462 MPNST cells. In addition, cryptic expression was not detected with the promoter-less luciferase reporter plasmid, pNull-Luc (Figure 3-4).

250000

200000

150000 p=0.006

100000 RLU/Protein (OD)

50000 *

0 null 0 10 30 100 300 ng/well

Figure 3-4: Confirmation of activity of the MDK promoter luciferase plasmid in S462

MPNST cells. The plasmid containing the human MDK promoter driving Renilla luciferase,

RIKEN Institute RDB #5514 clone pKM2L-phMK (Ibaraki, Japan) was transfected into S462

cells plated in 24-well plates from 0-300ng of plasmid per well. To control for cryptic

expression of the luciferase transgene, 300ng of pNull-Luc, a promoter-less plasmid driving

luciferase was added as an additional negative control (null, first column). After 24 hours of

o incubation at 37 C and 5%CO2, the media was removed and cells harvested, processed, and

luminescence measured using a luminometer. N=3.

MDK targeted HSV-1 viruses were constructed.

In 1997, the efficiency of creating recombinant herpes viruses was greatly improved when Messerle et al. cloned the 235kb genome of cytomegalovirus (CMV) into a bacterial artificial chromosome (BAC) in E. coli (Messerle, Crnkovic et al. 1997). This simplified the process of genetic engineering of the viral genome by removing viral production from the process until genetic manipulations were completed. Two MDK-targeted HSV-1 viruses, oHSV-

MDK-Luc and oHSV-MDK-34.5 (Figure 3-5) were constructed with the BAC-based HSVQuik1 recombination system that uses antibiotic selection and fluorescence reporters to make the recombination events more efficient (Figure 3-6) (Terada, Wakimoto et al. 2006). oHSV-MDK-

Luc and oHSV-MDK-34.5 both contain the MDK promoter driving expression of either the

Renilla luciferase or the γ134.5 transgene, respectively. The luciferase transgene was used in oHSV-MDK-Luc to serve as a control vector similar to parent virus. In addition, these viruses are doubly attenuated for replication in normal cells by deletions of both copies of endogenous

γ134.5 and a truncation knock-in with EGFP into the gene encoding ICP6, the large subunit of viral ribonucleotide reductase.

a b b’ a’ c’ c UL US A Wild Type F1 γ γ 134.5 134.5

B rHSVQ1 (MGH1) X ICP6-GFP X

C oHSV-MDK-Luc X ICP6-GFP MDK-Luc X

D oHSV-MDK-34.5 X ICP6-GFP MDK-34.5 X

Figure 3-5: Viral Schema. A. The wild-type HSV-1 F strain is shown for reference (drawings are not to scale). B. The parent virus rHSVQ1 is double attenuated for ICP6 and γ134.5 to impair viral replication in normal tissues. C. The control virus oHSV-MDK-Luc has the MDK promoter driving a Renilla luciferase transgene inserted into the ICP6 locus. D. oHSV-MDK-

34.5 virus has the MDK promoter driving the γ134.5 transgene, also in the ICP6 locus. All viral constructs have the GFP gene under the control of the ICP6 viral promoter.

A Δγ34.5 Δγ34.5 fHsvQuik-1 160 kb ΔUL39(ICP6) loxP FRT RFP F ori CMVp Cmr ICP6-GFP fusion

TetR Ptet Flp Amp Tc r pir Flp FRT r

pFTP-T pTransfer-X (2+x) kb loxP R6Kγ ori Ts ori

B Δγ34.5 Δγ34.5 fHsvQ1-X ΔUL39 (162 + x) kb loxP RFP loxP GFP + RFP expression X ICP6-GFP fusion Cre-recombinase

rHsvQ1-X (152 + x) kb FRTICP6-GFP fusion Loss of RFP expression loxPX

Figure 3-6

Figure 3-6: Bacterial artificial chromosome recombination system (Terada, Wakimoto et

al. 2006). A. After the genes of interest were inserted into the ampicillin-resistant shuttle

plasmid pTransfer (blue line, A. lower right), Flippase helper plasmid pFTP-T (A. lower left)

was co-electroporated with pTransfer plasmids into E. coli that contain chloramphenical-

resistant fHSVQuik-1 BAC (A. upper middle). Ampicillin and chloramphenical-resistant clones

were isolated and purified. Successful recombination was verified by restriction digest using

HindIII. B. The Cre-recombinase helper plasmid pc-nCre and the recombined BAC were co-

transfected into Vero cells to splice out the prokaryotic backbone in the BAC which causes loss

of RFP expression and virion production.

To create the MDK-34.5 shuttle plasmid, the MDK promoter fragment was isolated from pKM2L-phMK and directionally subcloned into the shuttle plasmid backbone upstream of the

γ134.5 transgene (see methods for details). To create the MDK-Luc shuttle plasmid, the MDK-

Luciferase fragment was isolated from pKM2L-phMK and directionally subcloned into the shuttle plasmid backbone, completely replacing γ134.5 transgene cassette. Prior to recombination into the HSV-1 BAC, shuttle plasmids were sequenced by the Genetic Variation and Gene

Discovery Core Facility (Cincinnati Children’s Computational Medicine Center) to confirm their identity. After confirmation that the genes were inserted into the ampicillin-resistant shuttle plasmids, Flippase helper plasmid was co-electroporated with either shuttle plasmid into E. coli that contain the chloramphenical-resistant fHSVQuik-1 BAC. After ampicillin and chloramphenical-resistant clones were selected, the clones were propagated in LB medium with antibiotics and purified by plasmid midi prep. After restriction digest using HindIII, successful

recombination into the BAC was verified by loss of the 18.5kb band (intact prokaryotic backbone) and addition of a 4.5kb band for the MDK-Luciferase gene cassette or a 4.1kb band for the MDK-34.5 gene cassette (red arrows, Figure 3-7).

AB3: Empty BAC RFP FRT ICP6-GFP

H 18.5 kb H 4: BAC + MDK-Luc Shuttle Cassette

H 12.2 kb H 4.5 kb H 5: BAC + MDK-34.5 Shuttle Cassette -- 48.5 kb H 12.2 kb H 4.1 kb H -- 18.5 kb Prokaryotic elements in UL39 Locus: 18.5 kb -- 12.0 kb

-- 9.0 kb -- 8.0 kb

-- 5.0 kb MDK-Luc cassette in UL39 Locus: 4.5 kb -- 4.5 kb MDK-34.5 cassette in UL39 Locus: 4.1 kb -- 4.0 kb

-- 3.0 kb

Figure 3-7: Successful recombination was verified by restriction digest using HindIII.

A. Predicted HindIII fragments around UL39 locus of the HSV-1 BAC. Pink and green arrows indicate RFP and GFP reporters, respectively. Maroon arrowhead indicates an FRT site.

Flippase-mediated recombination of shuttle plasmid gene cassette leads to addition of HindIII site and addition of another FRT site. B. Electrophoresis of HindIII digest run on 0.6% agarose gel. Empty BAC in lane 3 shows an 18.5kb which represents prokaryotic elements in the HSV-

1 UL39 Locus. Loss of 18.5kb fragment and addition of 4.1-4.5kb fragments in lanes 4-8 indicate gene cassette recombination into the HSV-1 UL39 locus. (HMW = high molecular weight)

To remove the prokaryotic backbone and produce recombinant HSV-1 virions, the Cre- recombinase helper plasmid and the recombined BAC were co-transfected into Vero cells which causes GFP-positive and RFP-negative expression (Figure 3-8). As suggested in Figure 3-8, oHSV-MDK-Luc and oHSV-MDK-34.5 replicated at similar levels in Vero cells.

oHSV-MDK-Luc

Brightfield dsRED GFP oHSV-MDK-34.5

Brightfield RFP GFP

Figure 3-8: Viral clones were screened for GFP-positive and RFP-negative plaque

formation on a monolayer of Vero cells. In African green monkey kidney (Vero) cells, the

Cre-recombinase helper plasmid pc-nCre and the recombined BAC were co-transfected to

splice out the prokaryotic backbone in the BAC which causes loss of RFP expression and virion

production. Viral clones were isolated from individual plaques if they showed GFP expression,

but no RFP.

The luciferase transgene in oHSV-MDK-Luc is biologically active and shows tumor- targeted expression.

Luciferase assays, qPCR, Western blot, and replication assays were used to verify that the transgene is functional. Prior to comparing plasmid and viral tumor-specific activity, baseline

MDK expression in MPNST cells was assayed by qPCR. S462 MPNST cells expressed MDK

162-fold higher than fibroblasts by qPCR (Figure 3-9a). To examine the function of the viral construct and specificity of the luciferase transgene in oHSV-MDK-Luc, MPNST cells and fibroblasts were infected at a multiplicity of infection (MOI) of 0.1 and tested for luciferase activity. Following infection of cells, luciferase activity was 164-fold higher in MPNST cells than in fibroblasts (Figure 3-9b). These data show that the luciferase transgene in oHSV-MDK-

Luc is functional in high MDK expressing S462, but not in fibroblasts in vitro. As shown in

Figure 3-14c, HSV infection and non-targeted, early gene (ICP6)-mediated transcription of GFP was equal in fibroblasts and MPNST cells suggesting that differences in transgene activity were not from differences in the ability of HSV-1 to enter the cell and begin viral transcription. oHSV-

MDK-Luc was then used as a control comparison for the oHSV-MDK-34.5 virus in functional and cytotoxicity experiments.

ABMDK qPCR Uninfected oHSV-MDK-Luc Luciferase 250 p=0.0003 * 300 p=0.0007 200 250 * 200 150 150 100 100

50 50

QPCR Relative Expression/TBP Relative QPCR 0 0 Fibroblasts S462 MPNST MDK RLU/Protein(OD) Fold Over Fibroblasts

γ 34.5 qPCR C 1 oHSV-MDK-34.5 Infected 120.0 p=0.02 100.0 * 80.0 60.0 40.0 p=0.01 20.0 * 0.0 qPCR Relative Expression/TBP Relative qPCR 34.5 1 γ

Figure 3-9 97

Figure 3-9: The MDK promoter can transcribe functional transgenes preferentially in

S462 tumor cells. A. RNA was harvested from fibroblasts and MPNST (S462) cells for qPCR

analysis. Results are expressed as fold over fibroblast MDK expression and normalized to

TATA-binding protein (TBP). B. Human S462 cells were plated in 24-well plates and infected

with oHSV-MDK-Luc at an MOI of 0.1. After 1 day of incubation, cells harvested and tested

for Renilla luciferase activity normalized to total protein. The negative control is no virus

infection. C. S462 cells were seeded into 6-well plates and infected with various MOI of

oHSV-MDK-34.5. Error bars indicate SEM. The asterisks indicate p<0.05. N=3 per group.

The ICP34.5 transgene in oHSV-MDK-34.5 is transcribed and translated in a dose responsive manner and increases through the viral replication cycle.

To test the transcriptional activity of the transgene in oHSV-MDK-34.5, γ134.5 qPCR was performed on S462 MPNST cells infected at two different MOI’s. There was a ten-fold increase in transcription with a log increase in viral infection of MPNST cells (Figure 3-9c).

These results show that oHSV-MDK-34.5 transgene expression responds in a dose-dependent manner. To determine whether transgene expression would increase during replication of virus in tumor cells, MPNST cells were infected at an MOI of 0.1 and harvested cells in a time series.

There was a significant increase in transcription as early as 12 hours and that transcription increased through 72 hours (Figure 3-10a). After 72 hours, all S462 cells lysed after undergoing cytopathic effect, viral foci, and plaque formation. These results suggest that transgene expression increases with viral replication. Because the replication life cycle of HSV-1 is around

18 hours, γ134.5 expression probably precedes completion of the initial replication cycle

(Randall, Newman et al. 1985).

γ134.5 qPCR A oHSV-MDK-34.5 Infected B ICP34.5 Western Blot Virus Infected S462 MPNST Cells p=0.01 800 oHSV-MDK-34.5 MOI * ML 0.01 0.03 0.1 0.3 1.0 700 ICP34.5 (35 kDa) 600

500 β-actin 400 300 200 p=0.02 100 * 0

ICP34.5 QPCR Relative Expression/TBP 1 12244872 Hours Post-Infection γ 34.5 1 qPCR γ134.5 qPCR in STS26T Cells C oHSV-MDK-34.5 Infected D Attenuated HSV-1 vs. Wild Type 100.00 7.0 * TBP

/ *p<0.001 6.0 N=3 5.0 ANOVA, Tukey 4.0 Levene=0.23 p=0.017 MOI 0.1 3.0 24 Hrs of Infection

10.00 ative Expression l 2.0 * * Re 1.0 * 34.5 1 γ 0.0

qPCR Relative qPCRExpression/TBP Relative oHSV-MDK-Luc oHSV-MDK-34.5 oHSV-Nestin-34.5 HSV F Strain

34.5 1.00 1 γ S462 STS26T

Figure 3-10

Figure 3-10: The MDK promoter can drive transgene transcription in MDK-expressing

MPNST cells. A. S462 cells were seeded into 6-well plates and infected with oHSV-MDK-

34.5 at an MOI of 0.1 and a timecourse of RNA was harvested for qPCR. Relative γ134.5

expression was normalized to TBP expression. B. S462 cells were infected with oHSV-MDK-

34.5 with MOI 0.01 to 1.0 and protein was harvested for Western blot after 24 hours of

infection. -actin was the loading control and ML (oHSV-MDK-Luc) was the negative control.

C. S462 and STS26T cells were infected with oHSV-MDK-34.5 and mRNA was harvested

after 24 hours of infection to assess relative γ134.5 transgene expression between the two

MPNST cell lines. Because STS26T express lower levels of MDK than S462, there is lower

transgene transcription. D. Relative γ134.5 measured by qPCR in STS26T infected with

attenuated and wild type viruses. Error bars indicate SEM. The asterisks indicate p<0.05. N=3

oHSV-MDK-34.5 ICP34.5 transgene protein increases in a semi-log dose response.

To determine whether oHSV-MDK-34.5 produced detectable ICP34.5 protein, a Western blot dose response series was performed. The ICP34.5 protein signal increased in proportion to the increase in viral dose of oHSV-MDK-34.5 (Figure 3-10b). However, there was no detectable protein signal from the oHSV-MDK-Luc negative control and no change in the β-actin loading control. These data show that oHSV-MDK-34.5 transgene protein increases in a dose-dependent manner. Because S462 is permissive to both oHSV-MDK-Luc and oHSV-MDK-34.5 as measured by plaque assay, γ134.5 transcriptional assays were performed in STS26T, an MPNST that is less permissive to attenuated HSV-1 (Mahller, Rangwala et al. 2006). Prior to comparing the replication function of both viruses in STS26T by plaque assay, relative transgene expression

100

of γ134.5 was measured in infected S462 and STS26T cells. S462 infected with oHSV-MDK-

34.5 expressed the transgene 97-fold higher than infected STS26T (Figure 3-10c). These results are in concordance with the higher expression of MDK and transgene possibly because of greater viral permissiveness in S462 compared to STS26T cells (Mahller, Rangwala et al. 2006).

To assess the transgene activity in comparison to the nestin promoter in another attenuated HSV-1 and to the native γ134.5 viral promoter in wild type HSV-1, γ134.5 transgene activity in STS26T was compared among attenuated and wild type viruses. By microarray,

RMA-normalized, nestin probeset 218678_at hybridization analyses, nestin expression is 3.3- fold greater than MDK probeset 38124_at in STS26T (NCBI microarray GSE14038 (Miller,

Rangwala et al. 2006)). The oHSV-Nestin-34.5 produced 6.6-fold more γ134.5 transcript than oHSV-MDK-34.5 and 3.9-fold more than the wild-type HSV-1, F1 strain (Figure 3-10d). In addition, oHSV-MDK-34.5 made 41% less transcript than F1 strain. These data suggest that transgene activity is dependent on promoter activity which may be higher or lower than the native viral promoter of the wild type virus. To use a more rigorous model to test oHSV-MDK-

34.5, STS26T were chosen for further in vitro and in vivo analyses because both viruses preliminarily showed comparable replication in S462 which supports published data for attenuated HSV-1 (Mahller, Rangwala et al. 2006).

The ICP34.5 protein made by oHSV-MDK-34.5 increases viral replication in STS26T MPNST cells.

Because the biological activity of ICP34.5 is to increase viral replication, virus was quantitated by plaque assay at 48 hours after infecting MPNST STS26T tumor cells and fibroblasts at an MOI of 0.1. There was a marked 3-log increase in oHSV-MDK-34.5 plaque

101

forming units in MPNST cells, which was not seen with control virus (Figure 3-11a). In contrast, a very small increase in pfu was seen in fibroblasts infected with oHSV-MDK-34.5. These results suggest that the ICP34.5 protein produced by oHSV-MDK-34.5 is functional and can dramatically increase viral replication in relatively lower MDK over-expressing STS26T cells, but viral replication is modest in non-MDK expressing normal cells.

102

Figure 3-11: Viral replication efficiency and cytotoxicity increases with and is dependent

on γ134.5 transgene activity in STS26T cells. A. Human fibroblasts (HFB) and STS26T

MPNST (26T) cells were infected at MOI 0.1 with each virus and cells were harvested after 1

hour as loading controls and at 72 hours for assessment of replication. B. STS26T cells

transfected with ICP34.5 siRNA and scramble 24 hours prior to being infected with oHSV-

MDK-34.5 at an MOI of 0.1. RNA was harvested after 24 hours of incubation for qPCR and

ICP34.5 expression was normalized to β2-microglobulin. C. STS26T cells were transfected

with siRNA and imaged 24 hours after infection with oHSV-MDK-34.5 at an MOI 0.1.

Scramble siRNA and no DNA were used as negative controls. Error bars indicate SEM. N=3

per group.

siRNA knockdown of ICP34.5 decreases viral replication.

To examine the extent to which ICP34.5 contributes to viral replication in tumor cells, the consequences of loss of function on viral infection was examined by measuring GFP positive cells. After designing and synthesizing six siRNA constructs, qPCR for γ134.5 was performed to 103

validate knockdown of transgene mRNA in infected tumor cells (see methods for details). Three of the constructs showed robust knock-down, one of which (Figure 3-11b) was chosen for further studies. γ134.5 siRNA was then transfected into STS26T cells followed by infection with oHSV-

MDK-34.5 at an MOI of 0.1. Viral GFP expression was measured 24 hours after infection using fluorescence microscopy as an indicator of viral replication in live cells. oHSV-MDK-34.5 infection after tumor transfection with γ134.5 siRNA showed less viral replication than scramble

(Figure 3-11c). However, there was no difference between scramble and no DNA negative controls. These results are consistent with γ134.5 transgene specifically increasing viral replication. The experiment was then repeated using qPCR to perform absolute quantitation of viral genomes. Similarly to the fluorescence data, knockdown of γ134.5 using siRNA decreased oHSV-MDK-34.5 viral genomes by one log (Figure 3-12b), but there was no effect on oHSV-

MDK-Luc viral replication (Figure 3-12a). A larger knock down in viral genomes was not visualized possibly because exogenous virions were not washed away from the cell surface with a citrate buffer solution shortly after infection.

A B

104

Figure 3-12: Quantity of viral genomes as an indirect measure of replication are

dependent on the γ134.5 transgene in STS26T cells. A. & B. oHSV-MDK-Luc and oHSV-

MDK-34.5 viral genomes were quantitated after STS26T cells were transfected with either

scramble or ICP34.5 siRNA. Absolute viral genomes were assessed by using qPCR, thymidine

kinase primers, and a standard curve of known HSV-1 quantities. Error bars indicate SEM. N=8

oHSV-MDK-34.5 shows more replication, propagation, and cytotoxicity than oHSV-MDK-

Luc virus in tumor cells, but not in non-transformed cells.

To determine whether in vitro transduction and cytotoxicity were increased in oHSV-

MDK-34.5, STS26T cells were infected at various MOI with both vectors and analyzed with fluorescence microscopy to assess viral GFP expression, brightfield microscopy to measure cytopathic effect, and MTT assay to determine cytotoxicity. oHSV-MDK-34.5 showed similar cytopathic effect, viral foci, plaque formation and GFP expression at an MOI of 0.1 compared to oHSV-MDK-Luc virus at an MOI of 10 in our brightfield and fluorescence microscopy analysis

(Figure 3-13). These findings suggest that γ134.5 increases the viral replication, propagation, and cytotoxicity of oncolytic HSV-1 in STS26T cells.

105

Figure 3-13: The γ134.5 transgene increases cytotoxicity in STS26T cells. Brightfield and

viral GFP fluorescence images were obtained 48 hours post-infection at a dose series of oHSV-

MDK-Luc and oHSV-MDK-34.5. Differences in cytopathic effect, viral foci, and plaque

formation were visible under brightfield. Green fluorescence reflects GFP expression driven by

the ICP6 early viral promoter. oHSV-MDK-34.5 at an MOI of 0.1 showed comparable viral

effects to oHSV-MDK-Luc at an MOI of 10. Error bars indicate SEM. N=8 per group.

Next, the cytotoxicity of both viruses was analyzed quantitatively in STS26T cells and human fibroblasts using an MTT assay. oHSV-MDK-34.5 showed a 10-fold greater cytotoxicity than control virus in STS26T cells (Figure 3-14a). However, there was no significant difference 106

in cytotoxicity between the two viruses in human fibroblasts (Figure 3-14b). These findings confirm that oHSV-MDK-34.5 is more cytotoxic than oHSV-MDK-Luc in STS26T cells, but retains its attenuation in fibroblasts. The differences in cytotoxicity between the two viruses were not because of differences in viral transduction of fibroblasts and STS26T cells, as oHSV-MDK-

Luc infected both types of cells equally well (Figure 3-14c).

107

A B Cytotoxicity in STS26T Cytotoxicity in HFB 100 100 90 90 p=0.91 80 80 70 70 60 60 50 50 40 40 30 30 p<0.001 20 * 20

% Survival (MTT Assay) Survival % 10 10 0 0 oHSV-MDK-LucoHSV-MDK-34.5 Assay) (MTT Survival % oHSV-MDK-Luc oHSV-MDK-34.5

Figure 3-14

108

Figure 3-14: The γ134.5 transgene increases the viral replication efficiency and

cytotoxicity in STS26T cells, but not in fibroblasts. A & B. STS26T and fibroblasts (HFB)

were infected with oHSV-MDK-Luc and oHSV-MDK-34.5 at an MOI 0.1 and MTT assay

performed at 4 days post-infection. The percent survival was calculated using non-infected cell

controls. C. Human fibroblasts and STS26T cells were infected with oHSV-MDK-Luc at MOI

0.01 and cells were imaged after 72 hours to assess viral transduction. Error bars indicate SEM.

TranscriptionalN=8 per group. targeting of oHSV-MDK-34.5 is generalizable and the promoter activity of

MDK is comparable to nestin in transcriptional targeting, but both attenuated viruses show lower tumor cytotoxicity compared to wild type HSV-1.

To compare the promoter activity of MDK to (1) another promoter in a virus derived from the same attenuated parental strain, (2) F strain wild type HSV-1, and (3) in a different tumor type, a cytotoxicity assay was performed in STS26T MPNST and A673 Ewing sarcoma cells at a dose response series (MOI 0.001 to 1.0). The wild-type HSV-1 F strain was significantly more cytotoxic than the attenuated viruses oHSV-MDK-Luc, oHSV-MDK-34.5 and oHSV-Nestin-34.5 in MPNST and Ewing tumor cells (Figure 3-15). oHSV-MDK-34.5 and oHSV-Nestin-34.5 showed similar cytotoxicity in both tumor types at most MOI. In addition, oHSV-MDK-34.5 and oHSV-Nestin-34.5 were significantly more cytotoxic than oHSV-MDK-

Luc at an MOI of 1.0 in both tumor types. Taken together, the results suggest that both transcriptionally targeted viruses retain attenuation compared to wild-type with improved cytotoxic activity in both MPNST and Ewing tumor cells. Because MDK and nestin are not overexpressed in all tumors (Supplemental Figure 3-1), there may be advantages to either oHSV-

109

MDK-34.5 or oHSV-Nestin-34.5 depending on the gene expression profile of the target tumor.

Further comparisons of both viruses in vivo in a variety of tumors are needed.

110

oHSV-MDK-Luc oHSV-MDK-34.5 100 100 D2 D2 50 D4 50 D4 STS26T D6 STS26T * D6 % Survival (MTT) % Survival (MTT) % Survival 0 0 0 0.001 0.01 0.1 1 0 0.001 0.01 0.1 1 CD

oHSV-Nestin-34.5 HSV-1 F Strain 100 100 D2 D2 * 50 D4 50 * D4 STS26T * D6 STS26T D6 % Survival (MTT) % Survival (MTT) % Survival 0 0 * 0 0.001 0.01 0.1 1 0 0.001 0.01 0.1 1

Figure 3-15a-d (STS26T): Transcriptional targeting of oHSV-MDK-34.5 is generalizable and the promoter activity of MDK is comparable to nestin in transcriptional targeting, but both attenuated viruses show lower tumor cytotoxicity compared to wild type HSV-1.

A-D. To compare 4 different viral cytotoxicities in two different tumor models, MTT assays were performed at day 2, 4, and 6 after a dose-response infection of MOI 0.001-1.0 with attenuated and wild type HSV-1 (F strain) in STS26T MPNST cells. The asterisks indicate

ANOVA non-parametric posthoc Games-Howell p<0.05 for day 2, 4, and 6 for all viruses. F strain was significantly more cytotoxic than the other viruses in both tumor types. oM3 and oN3 were not statistically different at most MOI and time points in either tumor type. oM3 and oN3 were more cytotoxic than oML at MOI 1.0 in both tumor types. N=6 per group, per time- point.

111

EF oHSV-MDK-Luc oHSV-MDK-34.5 100 100 D2 D2 50 D4 50 D4 A673 D6 A673 D6 % Survival (MTT) % Survival (MTT) % Survival 0 0 * 0 0.001 0.01 0.1 1 0 0.001 0.01 0.1 1 GH oHSV-Nestin-34.5 HSV-1 F Strain 100 100 D2 D2 50 D4 50 * D4 A673 D6 A673 D6 % Survival (MTT) % Survival (MTT) 0 * 0 * * 0 0.001 0.01 0.1 1 0 0.001 0.01 0.1 1

Figure 3-15e-h (A673): Transcriptional targeting of oHSV-MDK-34.5 is generalizable and the promoter activity of MDK is comparable to nestin in transcriptional targeting, but both attenuated viruses show lower tumor cytotoxicity compared to wild type HSV-1.

E-H. To compare 4 different viral cytotoxicities in a second different tumor model, MTT assays were performed at day 2, 4, and 6 after a dose-response infection of MOI 0.001-1.0 with attenuated and wild type HSV-1 (F strain) in A673 Ewing sarcoma cells. The asterisks indicate

112

oHSV-MDK-34.5 impairs the growth of STS26T tumors in nude mice and increases the survival of tumor-bearing mice.

To study the efficacy of oHSV-MDK-34.5 in vivo, human MPNST xenografts were created in the flanks of nude mice. To be most stringent, we chose to use STS26T, the cell line that has the least MDK over-expression and is less permissive to viral replication compared to the other cell lines. After the tumors reached a volume between 120-200mm3, PBS, oHSV-

MDK-Luc (1x107pfu), or oHSV-MDK-34.5 (1x107pfu) were injected intratumorally. As early as

11 days post-injection, oHSV-MDK-34.5 treated tumors were significantly smaller than control tumors (Figure 3-16a). These size differences continued and resulted in mostly partial responses, two cures, one tumor with stable disease that later progressed, and one non-responder. These data suggest that oHSV-MDK-34.5 significantly impaired MPNST growth and progression in the

STS26T mouse tumor model. A Kaplan-Meier analysis of mouse survival and log rank test with

Bonferroni correction were performed on the three treatment groups and oHSV-MDK-34.5 significantly increased the median survival compared to PBS and viral control groups (Figure 3-

16b). The median survival of oHSV-MDK-34.5 treated mice increased 33% compared to untreated mice.

113

2500.0 A PBS

) oHSV-MDK-Luc 3 2000.0 oHSV-MDK-34.5 1500.0 * p<0.05 PBS vs M3 ML vs M3 * 1000.0 *

Tumor Volume (mm 500.0 *

0.0 02468101214 Days

100 Log Rank Test B p<0.001 for PBS vs oM3 p<0.001 for oML vs oM3 80 oHSV-MDK-34.5 60

oHSV-MDK-Luc 40 % Survival

0 PBS // // 12 14 16 18 20 22 24 26 215 PBS N=5 Days oHSV-MDK-Luc N=18 PBS oML oM3 oHSV-MDK-34.5 N=16 Median Survival 15 16 20 (Days)

Figure 3-16

114

Figure 3-16: oHSV-MDK-34.5 impairs the growth of STS26T tumors in nude mice and

increases the survival of tumor-bearing mice. A. Human STS26T MPNST tumor cells were

injected subcutaneously in the flanks of nude mice and tumor volumes were serially measured.

Tumors were intratumoral injected with PBS, oHSV-MDK-Luc, or oHSV-MDK-34.5, 1x107

pfu and differences in tumor size were analyzed by time point. B. A Kaplan-Meier analysis of

mouse survival for the three treatment groups was performed and statistically analyzed with

log-rank test and Bonferroni correction. Error bars indicate SEM. The asterisks indicate p<0.05.

oHSV-MDK-34.5 replicates in STS26T tumor xenografts more efficiently than oHSV-

MDK-Luc.

To study the replication of the virus in vivo, MPNST tumor xenografts in nude mice were injected intratumorally with PBS, 1x107pfu oHSV-MDK-Luc, and 1x107pfu oHSV-MDK-34.5 and harvested three days after injection. Absolute quantification of oHSV viral genomes was performed by qPCR using thymidine kinase primers. oHSV-MDK-34.5 treated tumors yield 3- logs more viral genomes than oHSV-MDK-Luc treated tumors (Figure 3-17a). To visualize viral replication in the tumors by immunofluorescence, the GFP reporter driven by the viral ICP6 promoter was used as a marker of viral protein production. We observed GFP signal in the oHSV-MDK-34.5 treated tumors (Figure 3-17c), but not in oHSV-MDK-Luc treated tumors

(Figure 3-17b). These results suggest that oHSV-MDK-34.5 replication occurred in MPNST xenografts and that oHSV-MDK-34.5 showed greater replication than control virus, oHSV-

MDK-Luc.

115

A STS26T HSV-1 TK qPCR Day 3 Post-Intratumoral Injection p=0.04 100000 *

10000

1000

100

Viral GenomesViral 10

1 PBS oHSV-MDK-Luc oHSV-MDK-34.5

Day 3 Post-Intratumoral Injection B oHSV-MDK-Luc C oHSV-MDK-34.5

DAPI and GFP, STS26T Mouse Tumors

Figure 3-17

116

Figure 3-17: oHSV-MDK-34.5 in vivo replication in MPNST is more efficient than oHSV-

MDK-Luc. A. oHSV-MDK-Luc and oHSV-MDK-34.5 viral genomes were quantitated in

STS26T MPNST xenograft tumors 3 days after injection. Absolute viral genomes were

assessed by using qPCR, thymidine kinase primers, and a standard curve of known HSV-1

quantities. B & C. Fluorescence images (40X) from MPNST tumors harvested three days after

injection with 1x107pfu of oHSV-MDK-Luc (B) and oHSV-MDK-34.5 (C). Green (GFP)

represents oHSV infected cells and blue (DAPI) represents nuclei. The asterisks indicate

statistical significance. Error bars indicate SEM. N=3 per group.

oHSV-MDK-34.5 infection is STS26T tumor-specific and there are no detectable viral genomes in nude mouse organs.

To determine whether intratumoral injection of HSV-MDK-34.5 into MPNST tumors resulted in tumor specific viral infection and replication, nude mouse dorsal root ganglia, brain, heart, liver, lung, and spleens were harvested 14 days after tumors were injected and oHSV viral genomes were quantified by qPCR which has a limit of detection of 10 viral genomes per 50 ng of genomic DNA. There were no detectable oHSV viral genomes in the organs tested in nude mice (Figure 3-18). These results suggest either that the virus outside the tumor is in quantities too low to detect by qPCR or that direct tumor infection with oHSV-MDK-34.5 remains specific to the tumor at 14 days after tumor infection.

117

Figure 3-18: There are no detectable viral genomes at Day 14 post-IT injection in nude

mouse organs. oHSV-MDK-34.5 viral genomes were quantitated in nude mouse organs 14

days after injection. The limit of detection of the qPCR assay is 10 copies of HSV genomes per

50ng mouse genomic DNA (5th column). Absolute viral genomes were assessed by using

qPCR, thymidine kinase primers, and a standard curve of known HSV-1 quantities (first 4

columns). Error bar indicates SEM.

oHSV-MDK-34.5 intratumoral injection does not result in any clinically significant impairment in bone marrow, hepatic, or renal function in nude mice.

To assess if there were any significant systemic sequelae from intratumoral injection of oHSV-MDK-34.5 in nude mouse MPNST xenografts, peripheral blood was harvested from mice three days after tumors were injected. Non-tumor bearing, healthy mice were used as a control

118

comparison to provide normal reference values for all the assays. Complete blood counts, liver function tests, and creatinine were measured and compared to analyses from normal, non-tumor bearing nude mice. Interestingly there was a mild, but statistically significant decrease in total white blood cell (WBC) count which was predominantly in the lymphocytic lineage, 3 days after tumor injection with oHSV-MDK-34.5 (Figure 3-19a). There was also an increase in the platelet count in oHSV-MDK-34.5 treated animals (Figure 3-19b), but no significant changes in hemoglobin (Figure 3-19c), liver function tests (Figure 3-19d), or creatinine (Figure 3-19e).

Because the mice were asymptomatic and their lymphocyte and platelet counts were in the normal reference ranges (Hedrick and Bullock 2004), these hematologic changes are unlikely to represent clinically significant perturbations in bone marrow function.

119

A 10000 9000 p=0.01 8000 7000 6000 p=0.03 5000 4000 * Cells/uL 3000 * 2000 1000 0 White Blood Abs Abs Cells Neutrophil Lymphocyte Count Count

BC 3000 20.0 18.0 2500 16.0 14.0 2000 12.0 1500 p=0.02 10.0 * 8.0 1000 6.0 Hemoglobin (g/dL) Hemoglobin Platelets/uL (x1000) 4.0 500 2.0 0 0.0

D E 800.00 4.00 700.00 3.50 600.00 3.00 500.00 2.50 400.00 2.00 300.00 1.50 Units/Liter 200.00 1.00

100.00 (mg/dL) Creatinine 0.50 0.00 0.00 U Bili C Bili AST ALT Figure 3-19 120

Figure 3-19: oHSV-MDK-34.5 infection is tumor-specific and does not result in any clinically significant impairment in bone marrow, hepatic, or renal function in nude mice.

Blood was harvested from normal age-matched nude mice (black) and tumor bearing mice three days after MPNST IT injection with 1x107pfu oHSV-MDK-Luc (white) and 1x107pfu oHSV-MDK-34.5 (gray). A. Total white blood cells, absolute neutrophil, and absolute lymphocyte analyses. B. Platelets. C. Hemoglobin. D. Liver function tests: U Bili

(unconjugated bilirubin), C Bili (conjugated bilirubin), AST (aspartate aminotransferase), ALT

(alanine aminotransferase). E. Renal function was assessed by measuring serum creatinine. The asterisks indicate statistical significance. Error bars indicate SDM. N=3, ANOVA, Tukey.

121

Discussion

Several oncolytic viruses are being developed and studied for the treatment of MPNST

(Liu, Zhang et al. 2006; Liu, Zhang et al. 2006; Mahller, Rangwala et al. 2006; Messerli,

Prabhakar et al. 2006; Mahller, Vaikunth et al. 2007; Prabhakar, Messerli et al. 2007; Farassati,

Pan et al. 2008; Mahller, Sakthivel et al. 2008; Mahller, Vaikunth et al. 2008). However, no oncolytic HSV-1 have been designed specifically to transcriptionally target MDK-expressing tumors. The efficacy of attenuated oncolytic vectors may be improved by engineering the vector to drive replication in a tumor-selective manner. We have engineered a novel HSV-1 recombinant oHSV-MDK-34.5 that utilizes the MDK promoter to drive γ134.5, which because of high levels of MDK in MPNST, increases in vitro cytotoxicity and in vivo efficacy. We have demonstrated the increase in tumor-specific cytotoxicity in several ways: 1) oHSV-MDK-34.5 is more cytotoxic than oHSV-MDK-Luc in MPNST cells; 2) oHSV-MDK-34.5 replicates more in

MPNST cells than in fibroblasts; 3) replication is dependent on the γ134.5 transgene; 4) because of the lack of MDK expression, the effects of oHSV-MDK-34.5 are attenuated in human fibroblasts; and oHSV-MDK-34.5 impairs tumor growth and prolongs MPNST bearing mice survival; 5) oHSV-MDK-34.5 replication occurs in MPNST tumor xenografts; 6) oHSV-MDK-

34.5 infection is tumor specific and not found in mouse organs by 14 days after tumor injection; and 7) though there are mild changes in bone marrow cell counts, there are no clinically significant sequelae to the bone marrow, liver, and renal organ systems of the nude mouse at 3 days after tumor injection.

The MDK promoter can be used to transcriptionally target attenuated HSV-1. The observation that MDK is normally expressed during fetal development but is down-regulated postnatally, makes MDK an attractive transcriptional target for recombinant oncolytic viruses in 122

tumors known to over-express MDK. The Novartis database suggests that lung, ovarian, and prostate cancers robustly express high levels of MDK and may be potential candidates for oHSV-MDK-34.5 therapy. In addition, our gene expression data in the MPNST cell lines validate MDK overexpression in our experimental models and support previous transcriptomic analyses by Watson et al. that showed variability in MDK expression among MPNSTs (Watson,

Perry et al. 2004). Adachi et al. have already shown that MDK can be used to target adenovirus to pediatric solid tumor cells and prevent hepatic toxicity (Adachi, Reynolds et al. 2001; Adachi,

Matsubara et al. 2002).

We demonstrate that oHSV-MDK-34.5 shows greater cytotoxicity in MPNST in vitro and in vivo. To our knowledge, this is the first report of the MDK promoter used to transcriptionally target oHSV-1. Advantages of HSV-1 over adenovirus include its greater payload size for accommodating large transgenes, lower toxicity profile in humans, and greater range of cellular tropism. The use of the MDK promoter is another example of how differential gene expression in a tumor can be exploited to increase specificity and efficacy of oncolytic therapy (Chung, Saeki et al. 1999; Mullen, Kasuya et al. 2002; Kambara, Okano et al. 2005;

Hardcastle, Kurozumi et al. 2007). oHSV-MDK-34.5 shows comparable anti-tumor cytotoxicity as the oHSV-Nestin-34.5 virus, an attenuated virus derived from the same parental strain.

Because not all tumors over-express MDK and nestin, the advantage of each virus is likely to be apparent depending on the gene expression profile of the tumor being treated. Further tumor studies are needed to assess the advantages of each vector in various gene expression scenarios.

γ134.5 transgene knockdown with siRNA impairs oHSV-MDK-34.5 replication. The γ134.5 transgene has been used to increase HSV-1 replication. To show that THE γ134.5 transgene function mediates the increase in replication seen with oHSV-MDK-34.5, we designed siRNA to 123

the transgene and studied the loss of function effects using GFP microscopy as an indicator of viral replication. We showed that γ134.5 transgene inhibition reduced the number of viral GFP expressing cells and viral genomes by qPCR. We also showed that knockdown of γ134.5 using siRNA does not impair replication of the control virus. oHSV-MDK-34.5 impairs STS26T tumor growth and improves tumor-bearing mouse survival possibly through improved tumor-specific replication in vivo. The impaired tumor growth and increase in survival of tumor-bearing mice has important clinical implications.

Humans with MPNST have an overall mortality of 85% and an overall median survival of 21 months (Leroy, Dumas et al. 2001). If our results were translated to humans, prolonging life by

33% could potentially increase survival by 7 months. In addition, we used the MPNST cell line with the lowest MDK over-expression and that is only semi-permissive to replication, so the results might be even more dramatic in other tumor models. Recent clinical trials have been encouraging in that improved tumor response rates were seen when oncolytic viruses were added to chemotherapy and radiation combination therapy (Petrowsky, Roberts et al. 2001; Bennett,

Adusumilli et al. 2004; Aghi, Rabkin et al. 2006). There is great potential for finding synergistic combinations between transcriptionally-targeted oncolytic viruses, tumor type, and chemotherapeutic options that could improve current cancer mortality rates.

Human clinical trials of oncolytic virotherapy have been shown that attenuated HSV-1 can replicate in tumors in vivo such as G207 (ICP6 and γ134.5-deleted) and HSV1716 (γ134.5- deleted) in malignant glioma (Markert, Medlock et al. 2000; Papanastassiou, Rampling et al.

2002). Furthermore, the transcriptionally targeted expression of the γ134.5 transgene has been shown to increase the replication of attenuated γ134.5-deleted oncolytic HSV-1 in tumor-bearing

124

mice (Chung, Saeki et al. 1999; Mullen, Kasuya et al. 2002; Kambara, Okano et al. 2005;

Hardcastle, Kurozumi et al. 2007). We sought to determine if our MDK-targeted oHSV showed increased replication efficiency in MPNST tumors. STS26T MPNST tumor xenografts infected with oHSV-MDK-34.5 show a significant increase in viral genomes detected by qPCR three days after intratumoral injection compared to the control virus oHSV-MDK-Luc which is attenuated for γ134.5 function. In addition, viral protein synthesis as determined by GFP expression was evident on immunofluorescence analyses. Because of greater viral genomes and

GFP signal from oHSV-MDK-34.5 in tumors in vivo, our findings suggest that the impairment in growth of STS26T MPNST tumor xenografts and the increase in mouse survival are related to increased oncolytic viral replication in the tumors.

Intratumoral injection of oHSV-MDK-34.5 does not appear to propagate to mouse organs.

Previous studies have documented that intratumoral injection of tumor with attenuated

HSV-1 such as mtHSV (γ134.5-deleted) and OncSyn (γ134.5, α0, and α4-deleted) lead to replication in the mouse sarcomas, human hepatoma, and human breast carcinoma xenografts, but not in mouse organs (Lan, Dong et al. 2003; Xue, Dong et al. 2005; Israyelyan, Melancon et al. 2007). Because none of the oHSV previously studied have been targeted to the MDK gene, we sought to determine if using this promoter to drive viral replication would drive extratumoral replication. Similar to previously reported targeted oHSVs, intratumoral injected oHSV-MDK-

34.5 did not lead to detectable copies of viral genomes by qPCR in nude mouse organs 14 days after tumor injection. This was true even for the dorsal root ganglia which we assessed to determine the risk of latent viral infection as a result of intratumoral viral administration. These results suggest that tumor targeting specificity is preserved despite utilizing the MDK promoter to transcriptionally increase oHSV replication in human MPNST tumor xenografts. 125

Intratumorally-injected oHSV-MDK-34.5 appears to be safe in immunocompromised athymic nude mice. Transient hematologic changes such as lymphopenia and thrombocytosis after oncolytic viral therapy have been recognized to occur in human clinical trials (Freytag,

Movsas et al. 2007; Li, Liu et al. 2009). Despite these changes, oncolytic viruses have been deemed safe and well-tolerated in humans (Kasuya, Takeda et al. 2005; Kemeny, Brown et al.

2006). Thus, the mild changes seen in the lymphocytic lineage of the nude mouse are unlikely to be clinically important. This conclusion is supported by this study because there were no infectious complications including disseminated herpes infection identified in any of the treatment groups. One possible explanation for the reduction in lymphocyte count is that viral infection in the tumor led to temporary recruitment, margination, and extravasation of immature lymphocytes from the systemic circulation into the tumors. However, further analysis of tumor vasculature and stroma would be needed to provide supportive evidence for this hypothesis. In addition, this finding has not been found in other immunocompromised or competent mouse models treated with oncolytic HSV-1. Thus, this decrease in lymphocyte count may represent a mild transient change shortly after tumor infection with oncolytic HSV in a mouse model that is deficient in mature lymphocytes.

Potential limitations and pitfalls of oncolytic therapy and oHSV-MDK-34.5. Potential limitations of oncolytic vectors may range from good efficacy associated with poor safety to poor efficacy associated with good safety. Attenuated oHSV-1 mutants tested to date mostly fall closer to the latter category and the purpose of the current study is to improve oHSV-1 efficacy in MDK expressing tumor cells without compromising safety. In addition, some critics of oncolytic viruses fear risk of oncogenic transformation from chromosomal integration. However, there are no reported cases of HSV-1 chromosomal integration and viral-related tumorigenesis as 126

has occurred with Epstein-Barr Virus (Thorley-Lawson and Allday 2008). Others pose the scenario that an oncolytic HSV-1 can revert to wild-type due to in vivo recombination. However, wild-type HSV-1 is not toxic in immunocompetent individuals. If toxicity were to develop in immunocompromised cancer patients, viral thymidine kinase inhibitors are available as antiviral therapy. Multiple phase I and II studies have been performed with similarly attenuated HSV-1 vectors and their safety is widely accepted (Markert, Medlock et al. 2000; Kasuya, Takeda et al.

2005; Pulkkanen and Yla-Herttuala 2005; Kemeny, Brown et al. 2006; Kelly, Wong et al. 2008;

Aghi and Chiocca 2009; Fong, Kim et al. 2009; Markert, Liechty et al. 2009). Another potential limitation of oncolytic vectors is insufficient spread through the tumor because collagen and other extracellular matrix components act as barriers (Jain 1987; Netti, Berk et al. 2000; McKee,

Grandi et al. 2006). This barrier has been overcome by expressing collagenase and other enzymes, modifications that could be incorporated into oHSV-MDK-34.5 in future iterations

(Kim, Lee et al. 2006; McKee, Grandi et al. 2006; Kolodkin-Gal, Zamir et al. 2008).

In conclusion, we have engineered a novel oncolytic HSV mutant, oHSV-MDK-34.5, which exhibits increased cytotoxicity against MDK expressing tumor cells in vitro and in vivo without compromising biosafety. This oncolytic HSV-1 appears to be a new addition to the armamentarium of oncolytic viruses being studied for personalized anti-tumor therapy (Kaur and

Chiocca 2007).

127

ZR75_1 U87 U118 SW620 SN12C SKMEL2 SF295 RS11846 OVCAR8 NCVADR RES NCI 460 MCF7 LNCAP JURKAT HT29 HOP92 HELA HCT15 GM2493 GM133 COLO205 ALVA31 A498 786 024681012 Nestin 218678_at Supplemental Figure 3-1: Nestin shows variable over-expression in cancers in the

Novartis NCI60 cancer database. The Novartis primary human tumor database was analyzed for the hybridization intensity (x-axis) of the nestin probeset 218678_at across cancer samples

(y-axis). Probe data was normalized using GCRMA and presented as log2 (n=93). Novartis

U95 cancer dataset.

128

REFERENCES

Adachi, Y., S. Matsubara, et al. (2002). "Midkine promoter-based adenoviral suicide gene therapy to midkine-positive pediatric tumor." J Pediatr Surg 37(4): 588-592. Adachi, Y., P. N. Reynolds, et al. (2001). "A midkine promoter-based conditionally replicative adenovirus for treatment of pediatric solid tumors and bone marrow tumor purging." Cancer Res 61(21): 7882-7888. Aghi, M., S. Rabkin, et al. (2006). "Effect of chemotherapy-induced DNA repair on oncolytic herpes simplex viral replication." J Natl Cancer Inst 98(1): 38-50. Aghi, M. K. and E. A. Chiocca (2009). "Phase ib trial of oncolytic herpes virus G207 shows safety of multiple injections and documents viral replication." Mol Ther 17(1): 8-9. Bell, J. C. (2007). "Oncolytic viruses: what's next?" Curr Cancer Drug Targets 7(2): 127- 131. Bennett, J. J., P. Adusumilli, et al. (2004). "Up-regulation of GADD34 mediates the synergistic anticancer activity of mitomycin C and a gamma134.5 deleted oncolytic herpes virus (G207)." Faseb J 18(9): 1001-1003. Chung, R. Y., Y. Saeki, et al. (1999). "B-myb promoter retargeting of herpes simplex virus gamma34.5 gene-mediated virulence toward tumor and cycling cells." J Virol 73(9): 7556-7564. Cripe, T. P., P. Y. Wang, et al. (2009). "Targeting cancer-initiating cells with oncolytic viruses." Mol Ther 17(10): 1677-1682. Currier, M. A., R. A. Gillespie, et al. (2008). "Efficacy and safety of the oncolytic herpes simplex virus rRp450 alone and combined with cyclophosphamide." Mol Ther 16(5): 879-885. Delgado-Enciso, I., D. Cervantes-Garcia, et al. (2007). "A potent replicative delta-24 adenoviral vector driven by the promoter of human papillomavirus 16 that is highly selective for associated neoplasms." J Gene Med 9(10): 852-861. Farassati, F., W. Pan, et al. (2008). "Ras signaling influences permissiveness of malignant peripheral nerve sheath tumor cells to oncolytic herpes." Am J Pathol 173(6): 1861- 1872. Fong, Y., T. Kim, et al. (2009). "A herpes oncolytic virus can be delivered via the vasculature to produce biologic changes in human colorectal cancer." Mol Ther 17(2): 389-394. Freytag, S. O., B. Movsas, et al. (2007). "Phase I trial of replication-competent adenovirus- mediated suicide gene therapy combined with IMRT for prostate cancer." Mol Ther 15(5): 1016-1023. Fu, X., F. Meng, et al. (2003). "A strict-late viral promoter is a strong tumor-specific promoter in the context of an oncolytic herpes simplex virus." Gene Ther 10(17): 1458-1464. Guo, Z. S., S. H. Thorne, et al. (2008). "Oncolytic virotherapy: molecular targets in tumor- selective replication and carrier cell-mediated delivery of oncolytic viruses." Biochim Biophys Acta 1785(2): 217-231.

129

Hardcastle, J., K. Kurozumi, et al. (2007). "Oncolytic viruses driven by tumor-specific promoters." Curr Cancer Drug Targets 7(2): 181-189. Harland, J., P. Dunn, et al. (2003). "The herpes simplex virus (HSV) protein ICP34.5 is a virion component that forms a DNA-binding complex with proliferating cell nuclear antigen and HSV replication proteins." J Neurovirol 9(4): 477-488. He, B., J. Chou, et al. (1997). "Suppression of the phenotype of gamma(1)34.5- herpes simplex virus 1: failure of activated RNA-dependent protein kinase to shut off protein synthesis is associated with a deletion in the domain of the alpha47 gene." J Virol 71(8): 6049-6054. Hedrick, H. J. and G. R. Bullock (2004). The laboratory mouse. Horst, M., E. Brouwer, et al. (2007). "Targeting malignant gliomas with a glial fibrillary acidic protein (GFAP)-selective oncolytic adenovirus." J Gene Med 9(12): 1071- 1079. Ibusuki, M., H. Fujimori, et al. (2009). "Midkine in plasma as a novel breast cancer marker." Cancer Sci 100(9): 1735-1739. Ikematsu, S., A. Nakagawara, et al. (2008). "Plasma midkine level is a prognostic factor for human neuroblastoma." Cancer Sci 99(10): 2070-2074. Ikematsu, S., K. Okamoto, et al. (2003). "High levels of urinary midkine in various cancer patients." Biochem Biophys Res Commun 306(2): 329-332. Israyelyan, A. H., J. M. Melancon, et al. (2007). "Effective treatment of human breast tumor in a mouse xenograft model with herpes simplex virus type 1 specifying the NV1020 genomic deletion and the gBsyn3 syncytial mutation enabling high viral replication and spread in breast cancer cells." Hum Gene Ther 18(5): 457-473. Jain, R. K. (1987). "Transport of molecules in the tumor interstitium: a review." Cancer Res 47(12): 3039-3051. Jegga, A. G., J. Chen, et al. (2007). "GenomeTrafac: a whole genome resource for the detection of transcription factor binding site clusters associated with conventional and microRNA encoding genes conserved between mouse and human gene orthologs." Nucleic Acids Res 35(Database issue): D116-121. Kambara, H., H. Okano, et al. (2005). "An oncolytic HSV-1 mutant expressing ICP34.5 under control of a nestin promoter increases survival of animals even when symptomatic from a brain tumor." Cancer Res 65(7): 2832-2839. Kasuya, H., S. Takeda, et al. (2005). "The potential of oncolytic virus therapy for pancreatic cancer." Cancer Gene Ther 12(9): 725-736. Kaur, B. and E. A. Chiocca (2007). "Personalizing oncolytic virotherapy?" Mol Ther 15(1): 6-7. Kelly, K. J., J. Wong, et al. (2008). "Herpes simplex virus NV1020 as a novel and promising therapy for hepatic malignancy." Expert Opin Investig Drugs 17(7): 1105-1113. Kemeny, N., K. Brown, et al. (2006). "Phase I, open-label, dose-escalating study of a genetically engineered herpes simplex virus, NV1020, in subjects with metastatic colorectal carcinoma to the liver." Hum Gene Ther 17(12): 1214-1224. Kim, J. H., Y. S. Lee, et al. (2006). "Relaxin expression from tumor-targeting adenoviruses and its intratumoral spread, apoptosis induction, and efficacy." J Natl Cancer Inst 98(20): 1482-1493. Knipe, D. M. and P. M. Howley, Eds. (2007). Fields Virology. Philadelphia, LWW. 130

Kolodkin-Gal, D., G. Zamir, et al. (2008). "Herpes simplex virus type 1 preferentially targets human colon carcinoma: role of extracellular matrix." J Virol 82(2): 999- 1010. Koscielny, G., V. Le Texier, et al. (2009). "ASTD: The Alternative Splicing and Transcript Diversity database." Genomics 93(3): 213-220. Kuroda, T., S. D. Rabkin, et al. (2006). "Effective treatment of tumors with strong beta- catenin/T-cell factor activity by transcriptionally targeted oncolytic herpes simplex virus vector." Cancer Res 66(20): 10127-10135. Lan, P., C. Dong, et al. (2003). "Gene therapy for mice sarcoma with oncolytic herpes simplex virus-1 lacking the apoptosis-inhibiting gene, icp34.5." J Biochem Mol Biol 36(4): 379-386. Leong, H. S., T. Yates, et al. (2005). "ADAPT: a database of affymetrix probesets and transcripts." Bioinformatics 21(10): 2552-2553. Leroy, K., V. Dumas, et al. (2001). "Malignant Peripheral Nerve Sheath Tumors Associated With Neurofibromatosis Type 1: A Clinicopathologic and Molecular Study of 17 Patients." Arch Dermatol 137(7): 908-913. Li, J. L., H. L. Liu, et al. (2009). "A phase I trial of intratumoral administration of recombinant oncolytic adenovirus overexpressing HSP70 in advanced solid tumor patients." Gene Ther 16(3): 376-382. Liu, T. C., T. Zhang, et al. (2006). "Dominant-negative fibroblast growth factor receptor expression enhances antitumoral potency of oncolytic herpes simplex virus in neural tumors." Clin Cancer Res 12(22): 6791-6799. Liu, T. C., T. Zhang, et al. (2006). "Oncolytic HSV armed with platelet factor 4, an antiangiogenic agent, shows enhanced efficacy." Mol Ther 14(6): 789-797. Lucas, S., T. Reindl, et al. (2009). "Increased Midkine Serum Levels in Pediatric Embryonal Tumor Patients." J Pediatr Hematol Oncol. Mahller, Y. Y., F. Rangwala, et al. (2006). "Malignant peripheral nerve sheath tumors with high and low Ras-GTP are permissive for oncolytic herpes simplex virus mutants." Pediatr Blood Cancer 46(7): 745-754. Mahller, Y. Y., B. Sakthivel, et al. (2008). "Molecular analysis of human cancer cells infected by an oncolytic HSV-1 reveals multiple upregulated cellular genes and a role for SOCS1 in virus replication." Cancer Gene Ther 15(11): 733-741. Mahller, Y. Y., S. S. Vaikunth, et al. (2007). "Oncolytic HSV and erlotinib inhibit tumor growth and angiogenesis in a novel malignant peripheral nerve sheath tumor xenograft model." Mol Ther 15(2): 279-286. Mahller, Y. Y., S. S. Vaikunth, et al. (2008). "Tissue inhibitor of metalloproteinase-3 via oncolytic herpesvirus inhibits tumor growth and vascular progenitors." Cancer Res 68(4): 1170-1179. Mahller, Y. Y., J. P. Williams, et al. (2009). "Neuroblastoma cell lines contain pluripotent tumor initiating cells that are susceptible to a targeted oncolytic virus." PLoS One 4(1): e4235. Markert, J. M., P. G. Liechty, et al. (2009). "Phase Ib trial of mutant herpes simplex virus G207 inoculated pre-and post-tumor resection for recurrent GBM." Mol Ther 17(1): 199-207.

131

Markert, J. M., M. D. Medlock, et al. (2000). "Conditionally replicating herpes simplex virus mutant, G207 for the treatment of malignant glioma: results of a phase I trial." Gene Ther 7(10): 867-874. Mashour, G. A., N. Ratner, et al. (2001). "The angiogenic factor midkine is aberrantly expressed in NF1-deficient Schwann cells and is a mitogen for neurofibroma- derived cells." Oncogene 20(1): 97-105. McKee, T. D., P. Grandi, et al. (2006). "Degradation of fibrillar collagen in a human melanoma xenograft improves the efficacy of an oncolytic herpes simplex virus vector." Cancer Res 66(5): 2509-2513. Messerle, M., I. Crnkovic, et al. (1997). "Cloning and mutagenesis of a herpesvirus genome as an infectious bacterial artificial chromosome." Proc Natl Acad Sci U S A 94(26): 14759-14763. Messerli, S. M., S. Prabhakar, et al. (2006). "Treatment of schwannomas with an oncolytic recombinant herpes simplex virus in murine models of neurofibromatosis type 2." Hum Gene Ther 17(1): 20-30. Miller, S. J., F. Rangwala, et al. (2006). "Large-scale molecular comparison of human schwann cells to malignant peripheral nerve sheath tumor cell lines and tissues." Cancer Res 66(5): 2584-2591. Mullen, J. T., H. Kasuya, et al. (2002). "Regulation of herpes simplex virus 1 replication using tumor-associated promoters." Ann Surg 236(4): 502-512; discussion 512-503. Mulvey, M., J. Poppers, et al. (2003). "Regulation of eIF2alpha phosphorylation by different functions that act during discrete phases in the herpes simplex virus type 1 life cycle." J Virol 77(20): 10917-10928. Muramatsu, T. (2002). "Midkine and pleiotrophin: two related proteins involved in development, survival, inflammation and tumorigenesis." J Biochem (Tokyo) 132(3): 359-371. Netti, P. A., D. A. Berk, et al. (2000). "Role of extracellular matrix assembly in interstitial transport in solid tumors." Cancer Res 60(9): 2497-2503. Otsuki, A., A. Patel, et al. (2008). "Histone deacetylase inhibitors augment antitumor efficacy of herpes-based oncolytic viruses." Mol Ther 16(9): 1546-1555. Papanastassiou, V., R. Rampling, et al. (2002). "The potential for efficacy of the modified (ICP 34.5(-)) herpes simplex virus HSV1716 following intratumoural injection into human malignant glioma: a proof of principle study." Gene Ther 9(6): 398-406. Petrowsky, H., G. D. Roberts, et al. (2001). "Functional interaction between fluorodeoxyuridine-induced cellular alterations and replication of a ribonucleotide reductase-negative herpes simplex virus." J Virol 75(15): 7050-7058. Prabhakar, S., S. M. Messerli, et al. (2007). "Treatment of implantable NF2 schwannoma tumor models with oncolytic herpes simplex virus G47Delta." Cancer Gene Ther 14(5): 460-467. Prophet, E. B., B. Mills, et al. (1992). Armed Forces Institute of Pathology Laboratory Methods in Histotechnology. Washington, D.C. Pulkkanen, K. J. and S. Yla-Herttuala (2005). "Gene therapy for malignant glioma: current clinical status." Mol Ther 12(4): 585-598.

132

Randall, R. E., C. Newman, et al. (1985). "Asynchronous expression of the immediate-early protein of herpesvirus saimiri in populations of productively infected cells." J Gen Virol 66 ( Pt 10): 2199-2213. Ravi, V., A. Desai, et al. (2004). Virology Manual Of The Department Of Neurovirology. Bangalore, National Institute of Mental Health and Neurosciences (NIMHANS). Shimada, H., Y. Nabeya, et al. (2003). "Preoperative serum midkine concentration is a prognostic marker for esophageal squamous cell carcinoma." Cancer Sci 94(7): 628- 632. Su, A. I., J. B. Welsh, et al. (2001). "Molecular classification of human carcinomas by use of gene expression signatures." Cancer Res 61(20): 7388-7393. Takei, Y., K. Kadomatsu, et al. (2002). "5'-,3'-inverted thymidine-modified antisense oligodeoxynucleotide targeting midkine. Its design and application for cancer therapy." J Biol Chem 277(26): 23800-23806. Terada, K., H. Wakimoto, et al. (2006). "Development of a rapid method to generate multiple oncolytic HSV vectors and their in vivo evaluation using syngeneic mouse tumor models." Gene Ther 13(8): 705. Thorley-Lawson, D. A. and M. J. Allday (2008). "The curious case of the tumour virus: 50 years of Burkitt's lymphoma." Nat Rev Microbiol 6(12): 913-924. Tsutsui, J., K. Kadomatsu, et al. (1993). "A new family of heparin-binding growth/differentiation factors: increased midkine expression in Wilms' tumor and other human carcinomas." Cancer Res 53(6): 1281-1285. Varghese, S. and S. D. Rabkin (2002). "Oncolytic herpes simplex virus vectors for cancer virotherapy." Cancer Gene Ther 9(12): 967-978. Ward, S. L., D. Scheuner, et al. (2003). "In vivo replication of an ICP34.5 second-site suppressor mutant following corneal infection correlates with in vitro regulation of eIF2 alpha phosphorylation." J Virol 77(8): 4626-4634. Watson, M. A., A. Perry, et al. (2004). "Gene expression profiling reveals unique molecular subtypes of Neurofibromatosis Type I-associated and sporadic malignant peripheral nerve sheath tumors." Brain Pathol 14(3): 297-303. Wu, C., C. Orozco, et al. (2009). "BioGPS: an extensible and customizable portal for querying and organizing gene annotation resources." Genome Biol 10(11): R130. Xue, F., C. Y. Dong, et al. (2005). "Tumor-targeted therapy with a conditionally replicating mutant of HSV-1 induces regression of xenografted human hepatomas." Cancer Biol Ther 4(11): 1234-1239.

133

CHAPTER 4: General Conclusions and Discussion

Summary

Clinical significance

Despite advances in science and medicine, cancer remains as the number one cause of death in the United States for persons under the age of 85 (Jemal, Murray et al. 2005; Twombly

2005). The cancer studied in this dissertation, MPNST, has an overall mortality of 85% at 5 years after diagnosis (Leroy, Dumas et al. 2001; Gatta, Capocaccia et al. 2002). Unfortunately, one of the major limitations of chemotherapy and radiation is the toxic nature of these therapies to normal tissues. Because of toxicity, these cancer treatments are generally poorly tolerated

(Krischer, Epstein et al. 1997; Muschel, Soto et al. 1998). Thus, new targeted therapies are being studied and developed to supplant older modalities of cancer therapy, if not to improve their efficacy with synergy so that lower and less-toxic doses can be given (Cattaneo, Miest et al.

2008; Hait and Hambley 2009; Horn and Sandler 2009). In this dissertation, oncolytic attenuated

HSV-1 were explored as an anti-cancer therapeutic because of its safety profile shown in humans through phase I clinical trials, its generous payload capable of handling large transgenes and its broad tropism (Markert, Medlock et al. 2000; Guo, Thorne et al. 2008; Kelly, Wong et al. 2008;

Aghi and Chiocca 2009; Fong, Kim et al. 2009; Markert, Liechty et al. 2009). Most humans have already been exposed to the virion and any toxicity from the virus can be readily treated with orally bioavailable viral thymidine kinase inhibitors such as ganciclovir. Furthermore, pre- existing antibodies against HSV-1 do not impair the oncolytic effects in vivo when the virus is

134

injected intratumorally or intraperitoneally (Lambright, Kang et al. 2000; Hu, Coffin et al. 2006;

Nomura, Kasuya et al. 2009).

Overall goals of this dissertation

The main hypothesis of this proposal was that a targeted therapeutic, like an oncolytic

HSV-1 that is mutated to be safe in normal tissue, can be enhanced in efficacy towards MPNST using molecular engineering. The strategy that was used to target MPNST, transcriptional targeting, required a tumor-specific gene and MDK was chosen. The overall goals of this dissertation were to identify mechanistic insights into the role of midkine (MDK) in cancer biology and to exploit MDK to increase the efficacy of oncolytic HSV-1 towards MPNST tumors without compromising safety.

Mechanistic insights into the role of midkine in the molecular and genetic regulation of cancer

The first goal, to discover mechanistic insights into the biology of MDK in cancer using a feature-enabled bioinformatics approach, was achieved in Chapter 2. Using computational analyses to study the MDK-correlated transcriptomics of various cancers, a MDK gene signature of 348 transcripts was identified and studied for functional, annotation, protein-protein interaction, cis-element and cis-regulatory module enrichments. The results from these analyses using computational systems biological approaches suggest that MDK is not a downstream target of genes in the signature. Instead, a compelling and hypothetical model was created with MDK as an upstream regulator of many genes in the MDK signature (Figure 4-1, see Chapter 2 for details). There is experimental evidence that MDK leads to JAK/STAT1 activation and signaling in cancer cells. STAT1 could potentially lead to orchestration of transcriptional scaffold proteins 135

such as EP300 and CREBBP. These proteins can complex with cis-element proteins FoxD3,

MEF2A, HLF and NFIL3, the binding sites for which were enriched in the MDK gene signature.

HMGB1, CREB1, and YY1 also have protein interaction partners with this proposed set of transcriptional complex proteins which are upstream of gene targets that could influence tumorigenesis, anti-apoptosis and chemotherapy resistance.

MDK Tumor Cell

P P JAK1 JAK2 YY1 CREB1 HMGB1 P STAT1 K Oct-4 Bcl-2 mediated anti-apoptosis EP300 CREBBP chemo resistance Proliferation

FOXD3 MEF2A HLF NFIL3

67 Genes

136

Figure 4-1: Proposed molecular mechanism for MDK modulation of gene signature in