DOCSLIB.ORG

Surveillance Mechanisms in Mammalian Meiosis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Surveillance Mechanisms in Mammalian Meiosis ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda condicionat a lʼacceptació de les condicions dʼús establertes per la següent llicència Creative Commons: http://cat.creativecommons.org/?page_id=184 ADVERTENCIA. El acceso a los contenidos de esta tesis queda condicionado a la aceptación de las condiciones de uso establecidas por la siguiente licencia Creative Commons: http://es.creativecommons.org/blog/licencias/ WARNING. The access to the contents of this doctoral thesis it is limited to the acceptance of the use conditions set by the following Creative Commons license: https://creativecommons.org/licenses/?lang=en SURVEILLANCE MECHANISMS IN MAMMALIAN MEIOSIS Thesis submitted by Marina Marcet Ortega To opt for the title of Doctor in Cellular Biology Doctoral thesis directed by Dr. Ignasi Roig Navarro Departament de Biologia Cel·lular, Fisiologia i Immunologia Institut de Biomedicina i Biotecnologia (IBB) Universitat Autònoma de Barcelona Director PhD candidate Dr. Ignasi Roig Navarro Marina Marcet Ortega Bellaterra (Cerdanyola del Vallès), 2016 This work received financial support from: . Ministerio de Ciencia e innovación grant (BFU2010-18965) . FPI program fellowship (BES-2011-045381) . Estancias breves FPI (EEBB-I-13-06647, EEBB-I-14-08517, EEBB-I-15-09556) A la meva família, INDEX ABSTRACT ACCRONYMS AND ABBREVIATIONS 1. INTRODUCTION ....................................................................................................................................... 13 1.1 Gametogenesis .................................................................................................................................. 13 1.1.1 Oogenesis .................................................................................................................................. 14 1.1.2 Spermatogenesis .................................................................................................................... 15 1.1.3 Meiosis ........................................................................................................................................ 16 1.1.4 Meiotic recombination ......................................................................................................... 18 1.2 Control of meiotic recombination............................................................................................. 20 1.2.1 Homologous chromosome synapsis .............................................................................. 21 1.2.2 Checkpoint mechanisms control meiotic progression ........................................... 25 1.3 Pachytene checkpoint 2 protein / TRIP13 ............................................................................ 29 1.3.1 Mammalian TRIP13 .............................................................................................................. 31 1.4 DNA damage response in somatic cells .................................................................................. 33 1.4.2 P53 family members ............................................................................................................. 36 2. OBJECTIVES ................................................................................................................................................ 47 3. MATERIALS AND METHODS .............................................................................................................. 53 3.1 BIOLOGICAL MATERIAL ............................................................................................................... 53 3.1.1 Experimental mutant mice ................................................................................................ 53 3.2 MOLECULAR BIOLOGY .................................................................................................................. 53 3.2.1 Genomic DNA extraction ..................................................................................................... 53 3.2.2 Genotyping................................................................................................................................ 54 1 3.2.3 RNA extraction ........................................................................................................................ 59 3.2.4 RNA sequencing ...................................................................................................................... 60 3.2.5 Real-time PCR .......................................................................................................................... 60 3.2.6 Protein extraction and quantification ........................................................................... 62 3.2.7 Western Blot ............................................................................................................................ 63 3.3 HISTOLOGY TECHNIQUES ........................................................................................................... 65 3.3.1 Fixation, embedding and sectioning .............................................................................. 65 3.3.2 PAS-Hematoxylin staining .................................................................................................. 67 3.3.3 TUNEL test: In situ cell death detection over tissue sections .............................. 67 3.4 CELL BIOLOGY AND CYTOLOGY TECHNIQUES .................................................................. 68 3.4.1 Spermatocyte nuclei spreads from fresh testis ......................................................... 68 3.4.2 Spermatocytes nuclei spreads from frozen testis .................................................... 69 3.4.3 Spermatocytes squashed preparation .......................................................................... 70 3.4.4 Immunofluorescence ............................................................................................................ 70 3.4.5 TUNEL staining over IF-stained slides .......................................................................... 72 3.4.6 RNA FISH and Immunofluorescence on spermatocytes ........................................ 73 3.4.7 EU Imaging on spermatocytes .......................................................................................... 78 3.4.8 Cell Sorting................................................................................................................................ 81 4. RESULTS ....................................................................................................................................................... 89 4.1 Study the pachytene arrest in male mammalian meiosis ............................................... 89 4.1.1 Determine other members of the signaling pathway that activates the pachytene arrest in mouse spermatocytes ..................................................................................... 89 4.1.2 Evaluate the possibility of separating prophase stages through cell sorting technique ...................................................................................................................................................... 91 2 4.1.3 Analysis of p53 role in an unperturbed mouse meiosis and possible implications in the pachytene arrest ................................................................................................ 93 4.2 Study p53 family participation in the pachytene recombination-dependent arrest mechanism ..................................................................................................................................................... 100 4.2.1 Evaluate p53 family members role in the activation of the Recombination- dependent arrest in mouse spermatocytes ................................................................................. 100 4.2.2 Trip13 double mutants still present stage IV arrest ............................................. 104 4.2.3 TRIP13 involvement in the formation of the sex body ....................................... 107 4.2.4 p53 and TAp63 do not activate the sex body-deficient arrest ......................... 112 4.3 Analysis of TRIP13 role in meiotic transcription ............................................................ 114 4.3.1 Transcription levels in Trip13 mutants ..................................................................... 114 4.3.2 Specific RNA expression analysis in Trip13 mutants: RNA sequencing ....... 119 5. DISCUSSION ............................................................................................................................................. 131 5.1 Study the components that activate the pachytene arrest occurring in mammalian spermatocytes ..................................................................................................................... 131 5.2 P53 role in meiosis ....................................................................................................................... 132 5.3 P53 family members p53 and TAp63 participate in the recombination-dependent arrest …………………………………………………………………………………………………………………135 5.4 TRIP13’s new role in meiotic silencing ............................................................................... 141 5.4.1 TRIP13 is required to implement the meiotic sex chromosomes inactivation ……………………………………………………………………………………………………………141 5.4.2 TRIP13 mediates transcriptional silencing of the unsynapsed regions at early meiotic stages ............................................................................................................................... 142 6. CONCLUSIONS .......................................................................................................................................
Load more

Recommended publications
  • Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS
    Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen,
    [Show full text]
  • Integrated Genomic Analysis Identifies ANKRD36 Gene As a Novel and Common Biomarker of Disease Progression in Chronic Myeloid Leukemia
    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 25 August 2021 doi:10.20944/preprints202108.0498.v1 Article Integrated Genomic Analysis Identifies ANKRD36 Gene as a Novel and Common Biomarker of Disease Progression in Chronic Myeloid Leukemia Zafar Iqbal 1,2,3, Muhammad Absar2, Tanveer Akhtar2, Aamer Aleem4, Abid Jameel5, Sulman Basit 6, Anhar Ullah7, Sibtain Afzal8, Khushnooda Ramzan9, Mahmood Rasool10, Sajjad Karim10, Zeenat Mirza10, Mudassar Iqbal11, Mar- yam AlMajed1, Buthinah AlShehab1, Sarah AlMukhaylid1, Nouf AlMutairi1, Nawaf Al-anazi1, 12, Muhammad Farooq Sabar13, Muhammad Arshad14, Muhammad Asif15, Masood Shammas16 and Amer Mehmood15 1: Clinical Laboratory Sciences, College of Applied Medical Sciences (CoAMS-A), King Saud Bin Abdulaziz University for Health Sciences, King Abdulaziz Medical City/Kind Abdullah International Medical Research Centre (KAIMRC)/Saudi Society for Blood and Marrow Transplantation (SSBMT), King Abdulaziz Medical City, National Guard Health Affairs, Al-Ahsa, Saudi Arabia. 2:Hematology, Oncology and Pharmaco-genetic Engineering Sciences (HOPES) Group, Health Sciences Labora- tories (HaSiL), Department of Zoology, University of the Punjab (ZPU), Lahore 54590, Pakistan. 3: Next-Generation Medical Biotechnology & Genomic Medicine Division, Department of Biotechnology, Qarshi University, Lahore, Pakistan. 4Division of Hematology/Oncology, Department of Medicine, KKUH and College of Medicine, King Saud University, Riyadh, Saudi Arabia. 5 Khyber Teaching Hospital and Hayatabad Medical Complex, Peshawar, Pakistan. 6Taibah University Madinah-Center for Genetics and, Inherited Diseases Center for Genetics and Inherited Diseases,, Taibah University Madinah, 30001, Saudi Arabia, Almadinah Almunawarah 30001, Saudi Arabia. 7 National Heart and Lung Institute, Imperial College London, UK. 8Biomedical Research Laboratory, College of Medicine, Alfaisal University, Riyadh, Saudi Arabia. 9Research Centre, King Faisal Specialist Hospital and Research Centre, Riyadh, Saudi Arabia.
    [Show full text]
  • The Nuclear Localization Pattern and Interaction Partners of GTF2IRD1 Demonstrate a Role in Chromatin Regulation
    Hum Genet DOI 10.1007/s00439-015-1591-0 ORIGINAL INVESTIGATION The nuclear localization pattern and interaction partners of GTF2IRD1 demonstrate a role in chromatin regulation Paulina Carmona‑Mora1 · Jocelyn Widagdo2 · Florence Tomasetig1 · Cesar P. Canales1 · Yeojoon Cha1 · Wei Lee1 · Abdullah Alshawaf3 · Mirella Dottori3 · Renee M. Whan4 · Edna C. Hardeman1 · Stephen J. Palmer1 Received: 11 February 2015 / Accepted: 4 August 2015 © Springer-Verlag Berlin Heidelberg 2015 Abstract GTF2IRD1 is one of the three members of the mostly involved in chromatin modification and transcrip- GTF2I gene family, clustered on chromosome 7 within a tional regulation, whilst others indicate an unexpected role 1.8 Mb region that is prone to duplications and deletions in connection with the primary cilium. Mapping of the sites in humans. Hemizygous deletions cause Williams–Beuren of protein interaction also indicates key features regarding syndrome (WBS) and duplications cause WBS duplica- the evolution of the GTF2IRD1 protein. These data provide tion syndrome. These copy number variations disturb a a visual and molecular basis for GTF2IRD1 nuclear func- variety of developmental systems and neurological func- tion that will lead to an understanding of its role in brain, tions. Human mapping data and analyses of knockout mice behaviour and human disease. show that GTF2IRD1 and GTF2I underpin the craniofacial abnormalities, mental retardation, visuospatial deficits and Abbreviations hypersociability of WBS. However, the cellular role of the hESC Human embryonic stem cells GTF2IRD1 protein is poorly understood due to its very PLA Proximity ligation assay low abundance and a paucity of reagents. Here, for the first STED Stimulated emission depletion time, we show that endogenous GTF2IRD1 has a punctate WBS Williams–Beuren syndrome pattern in the nuclei of cultured human cell lines and neu- Y2H Yeast two-hybrid rons.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Placenta-Derived Exosomes Continuously Increase in Maternal
    Sarker et al. Journal of Translational Medicine 2014, 12:204 http://www.translational-medicine.com/content/12/1/204 RESEARCH Open Access Placenta-derived exosomes continuously increase in maternal circulation over the first trimester of pregnancy Suchismita Sarker1, Katherin Scholz-Romero1, Alejandra Perez2, Sebastian E Illanes1,2,3, Murray D Mitchell1, Gregory E Rice1,2 and Carlos Salomon1,2* Abstract Background: Human placenta releases specific nanovesicles (i.e. exosomes) into the maternal circulation during pregnancy, however, the presence of placenta-derived exosomes in maternal blood during early pregnancy remains to be established. The aim of this study was to characterise gestational age related changes in the concentration of placenta-derived exosomes during the first trimester of pregnancy (i.e. from 6 to 12 weeks) in plasma from women with normal pregnancies. Methods: A time-series experimental design was used to establish pregnancy-associated changes in maternal plasma exosome concentrations during the first trimester. A series of plasma were collected from normal healthy women (10 patients) at 6, 7, 8, 9, 10, 11 and 12 weeks of gestation (n = 70). We measured the stability of these vesicles by quantifying and observing their protein and miRNA contents after the freeze/thawing processes. Exosomes were isolated by differential and buoyant density centrifugation using a sucrose continuous gradient and characterised by their size distribution and morphology using the nanoparticles tracking analysis (NTA; Nanosight™) and electron microscopy (EM), respectively. The total number of exosomes and placenta-derived exosomes were determined by quantifying the immunoreactive exosomal marker, CD63 and a placenta-specific marker (Placental Alkaline Phosphatase PLAP).
    [Show full text]
  • Curcumin Alters Gene Expression-Associated DNA Damage, Cell Cycle, Cell Survival and Cell Migration and Invasion in NCI-H460 Human Lung Cancer Cells in Vitro
    ONCOLOGY REPORTS 34: 1853-1874, 2015 Curcumin alters gene expression-associated DNA damage, cell cycle, cell survival and cell migration and invasion in NCI-H460 human lung cancer cells in vitro I-TSANG CHIANG1,2, WEI-SHU WANG3, HSIN-CHUNG LIU4, SU-TSO YANG5, NOU-YING TANG6 and JING-GUNG CHUNG4,7 1Department of Radiation Oncology, National Yang‑Ming University Hospital, Yilan 260; 2Department of Radiological Technology, Central Taiwan University of Science and Technology, Taichung 40601; 3Department of Internal Medicine, National Yang‑Ming University Hospital, Yilan 260; 4Department of Biological Science and Technology, China Medical University, Taichung 404; 5Department of Radiology, China Medical University Hospital, Taichung 404; 6Graduate Institute of Chinese Medicine, China Medical University, Taichung 404; 7Department of Biotechnology, Asia University, Taichung 404, Taiwan, R.O.C. Received March 31, 2015; Accepted June 26, 2015 DOI: 10.3892/or.2015.4159 Abstract. Lung cancer is the most common cause of cancer CARD6, ID1 and ID2 genes, associated with cell survival and mortality and new cases are on the increase worldwide. the BRMS1L, associated with cell migration and invasion. However, the treatment of lung cancer remains unsatisfactory. Additionally, 59 downregulated genes exhibited a >4-fold Curcumin has been shown to induce cell death in many human change, including the DDIT3 gene, associated with DNA cancer cells, including human lung cancer cells. However, the damage; while 97 genes had a >3- to 4-fold change including the effects of curcumin on genetic mechanisms associated with DDIT4 gene, associated with DNA damage; the CCPG1 gene, these actions remain unclear. Curcumin (2 µM) was added associated with cell cycle and 321 genes with a >2- to 3-fold to NCI-H460 human lung cancer cells and the cells were including the GADD45A and CGREF1 genes, associated with incubated for 24 h.
    [Show full text]
  • Looking for Missing Proteins in the Proteome Of
    Looking for Missing Proteins in the Proteome of Human Spermatozoa: An Update Yves Vandenbrouck, Lydie Lane, Christine Carapito, Paula Duek, Karine Rondel, Christophe Bruley, Charlotte Macron, Anne Gonzalez de Peredo, Yohann Coute, Karima Chaoui, et al. To cite this version: Yves Vandenbrouck, Lydie Lane, Christine Carapito, Paula Duek, Karine Rondel, et al.. Looking for Missing Proteins in the Proteome of Human Spermatozoa: An Update. Journal of Proteome Research, American Chemical Society, 2016, 15 (11), pp.3998-4019. 10.1021/acs.jproteome.6b00400. hal-02191502 HAL Id: hal-02191502 https://hal.archives-ouvertes.fr/hal-02191502 Submitted on 19 Mar 2021 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Journal of Proteome Research 1 2 3 Looking for missing proteins in the proteome of human spermatozoa: an 4 update 5 6 Yves Vandenbrouck1,2,3,#,§, Lydie Lane4,5,#, Christine Carapito6, Paula Duek5, Karine Rondel7, 7 Christophe Bruley1,2,3, Charlotte Macron6, Anne Gonzalez de Peredo8, Yohann Couté1,2,3, 8 Karima Chaoui8, Emmanuelle Com7, Alain Gateau5, AnneMarie Hesse1,2,3, Marlene 9 Marcellin8, Loren Méar7, Emmanuelle MoutonBarbosa8, Thibault Robin9, Odile Burlet- 10 Schiltz8, Sarah Cianferani6, Myriam Ferro1,2,3, Thomas Fréour10,11, Cecilia Lindskog12,Jérôme 11 1,2,3 7,§ 12 Garin , Charles Pineau .
    [Show full text]
  • Cell Type-Specific Analysis of Human Interactome and Transcriptome Shahin Mohammadi Purdue University
    Purdue University Purdue e-Pubs Open Access Dissertations Theses and Dissertations January 2016 Cell Type-specific Analysis of Human Interactome and Transcriptome Shahin Mohammadi Purdue University Follow this and additional works at: https://docs.lib.purdue.edu/open_access_dissertations Recommended Citation Mohammadi, Shahin, "Cell Type-specific Analysis of Human Interactome and Transcriptome" (2016). Open Access Dissertations. 1371. https://docs.lib.purdue.edu/open_access_dissertations/1371 This document has been made available through Purdue e-Pubs, a service of the Purdue University Libraries. Please contact [email protected] for additional information. Graduate School Form 30 Updated 12/26/2015 PURDUE UNIVERSITY GRADUATE SCHOOL Thesis/Dissertation Acceptance This is to certify that the thesis/dissertation prepared By Shahin Mohammadi Entitled CELL TYPE-SPECIFIC ANALYSIS OF HUMAN INTERACTOME AND TRANSCRIPTOME For the degree of Doctor of Philosophy Is approved by the final examining committee: Ananth Grama Wojciech Szpankowski Chair David Gleich Jennifer Neville Markus Lill To the best of my knowledge and as understood by the student in the Thesis/Dissertation Agreement, Publication Delay, and Certification Disclaimer (Graduate School Form 32), this thesis/dissertation adheres to the provisions of Purdue University’s “Policy of Integrity in Research” and the use of copyright material. Approved by Major Professor(s): Ananth Grama William Gorman, Assistant to the Department Head 11/1/2016 Approved by: Head of the Departmental Graduate Program Date CELL TYPE-SPECIFIC ANALYSIS OF HUMAN INTERACTOME AND TRANSCRIPTOME A Dissertation Submitted to the Faculty of Purdue University by Shahin Mohammadi In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy December 2016 Purdue University West Lafayette, Indiana ii I dedicate this thesis to my mom, whose role in my life I can not even begin to describe.
    [Show full text]
  • An Ancient Germ Cell-Specific RNA-Binding Protein Protects
    RESEARCH ARTICLE An ancient germ cell-specific RNA-binding protein protects the germline from cryptic splice site poisoning Ingrid Ehrmann1, James H Crichton2, Matthew R Gazzara3,4, Katherine James5, Yilei Liu1,6, Sushma Nagaraja Grellscheid1,7, TomazˇCurk8, Dirk de Rooij9,10, Jannetta S Steyn11, Simon Cockell11, Ian R Adams2, Yoseph Barash3,12*, David J Elliott1* 1Institute of Genetic Medicine, Newcastle University, Newcastle, United Kingdom; 2MRC Human Genetics Unit, MRC Institute of Genetics and Molecular Medicine, University of Edinburgh, Edinburgh, United Kingdom; 3Department of Genetics, Perelman School of Medicine, University of Pennsylvania, Philadelphia, United States; 4Department of Biochemistry and Biophysics, Perelman School of Medicine, University of Pennsylvania, Philadelphia, United States; 5Life Sciences, Natural History Museum, London, United Kingdom; 6Department of Plant and Microbial Biology, University of Zu¨ rich, Zu¨ rich, Switzerland; 7School of Biological and Biomedical Sciences, University of Durham, Durham, United Kingdom; 8Laboratory of Bioinformatics, Faculty of Computer and Information Sciences, University of Ljubljana, Ljubljana, Slovenia; 9Reproductive Biology Group, Division of Developmental Biology, Department of Biology, Faculty of Science, Utrecht University, Utrecht, The Netherlands; 10Center for Reproductive Medicine, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands; 11Bioinformatics Support Unit, Faculty of Medical Sciences, Newcastle University, Newcastle, United Kingdom; 12Department of Computer and Information Science, University of Pennsylvania, Philadelphia, United States *For correspondence: [email protected] (YB); [email protected] (DJE) Competing interests: The Abstract Male germ cells of all placental mammals express an ancient nuclear RNA binding authors declare that no protein of unknown function called RBMXL2. Here we find that deletion of the retrogene encoding competing interests exist.
    [Show full text]
  • LIONS: Analysis Suite for Detecting and Quantifying Transposable Element Initiated
    bioRxiv preprint doi: https://doi.org/10.1101/149864; this version posted June 14, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. LIONS: Analysis Suite for Detecting and Quantifying Transposable Element Initiated Transcription from RNA-seq Artem Babaian1,2, Jake Lever2,3, Liane Gagnier1,2, and Dixie L. Mager1,2 5 1Terry Fox Laboratory, BC Cancer Agency, Vancouver, BC, Canada. 2Dept. of Medical Genetics, University of British Columbia, Vancouver, BC, Canada. 3Canada’s Michael Smith Genome Sciences Centre, Vancouver, BC, Canada. 10 15 Dixie L. Mager Terry Fox Laboratory BC Cancer Agency 20 675 West 10th Avenue Vancouver, BC, V5Z1L3, Canada Email: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/149864; this version posted June 14, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Abstract Transposable Elements (TEs), which comprise almost half of the human genome, can contribute 25 to the evolution of novel transcriptional circuitry. Specific and biologically meaningful interpretation of TE-initiated transcripts has been marred by computational and methodological deficiencies. We developed the software suite LIONS (www.github.com/ababaian/LIONS) to analyze paired-end RNA- seq data for detecting and quantifying significant TE-contributions to a transcriptome.
    [Show full text]
  • Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays
    Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013
    [Show full text]
  • Genomics of Inherited Bone Marrow Failure and Myelodysplasia Michael
    Genomics of inherited bone marrow failure and myelodysplasia Michael Yu Zhang A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Washington 2015 Reading Committee: Mary-Claire King, Chair Akiko Shimamura Marshall Horwitz Program Authorized to Offer Degree: Molecular and Cellular Biology 1 ©Copyright 2015 Michael Yu Zhang 2 University of Washington ABSTRACT Genomics of inherited bone marrow failure and myelodysplasia Michael Yu Zhang Chair of the Supervisory Committee: Professor Mary-Claire King Department of Medicine (Medical Genetics) and Genome Sciences Bone marrow failure and myelodysplastic syndromes (BMF/MDS) are disorders of impaired blood cell production with increased leukemia risk. BMF/MDS may be acquired or inherited, a distinction critical for treatment selection. Currently, diagnosis of these inherited syndromes is based on clinical history, family history, and laboratory studies, which directs the ordering of genetic tests on a gene-by-gene basis. However, despite extensive clinical workup and serial genetic testing, many cases remain unexplained. We sought to define the genetic etiology and pathophysiology of unclassified bone marrow failure and myelodysplastic syndromes. First, to determine the extent to which patients remained undiagnosed due to atypical or cryptic presentations of known inherited BMF/MDS, we developed a massively-parallel, next- generation DNA sequencing assay to simultaneously screen for mutations in 85 BMF/MDS genes. Querying 71 pediatric and adult patients with unclassified BMF/MDS using this assay revealed 8 (11%) patients with constitutional, pathogenic mutations in GATA2 , RUNX1 , DKC1 , or LIG4 . All eight patients lacked classic features or laboratory findings for their syndromes.
    [Show full text]