DOCSLIB.ORG

Comprehensive Analysis Reveals Novel Gene Signature in Head and Neck Squamous Cell Carcinoma: Predicting Is Associated with Poor Prognosis in Patients

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

5892 Original Article Comprehensive analysis reveals novel gene signature in head and neck squamous cell carcinoma: predicting is associated with poor prognosis in patients Yixin Sun1,2#, Quan Zhang1,2#, Lanlin Yao2#, Shuai Wang3, Zhiming Zhang1,2 1Department of Breast Surgery, The First Affiliated Hospital of Xiamen University, School of Medicine, Xiamen University, Xiamen, China; 2School of Medicine, Xiamen University, Xiamen, China; 3State Key Laboratory of Cellular Stress Biology, School of Life Sciences, Xiamen University, Xiamen, China Contributions: (I) Conception and design: Y Sun, Q Zhang; (II) Administrative support: Z Zhang; (III) Provision of study materials or patients: Y Sun, Q Zhang; (IV) Collection and assembly of data: Y Sun, L Yao; (V) Data analysis and interpretation: Y Sun, S Wang; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors. #These authors contributed equally to this work. Correspondence to: Zhiming Zhang. Department of Surgery, The First Affiliated Hospital of Xiamen University, Xiamen, China. Email: [email protected]. Background: Head and neck squamous cell carcinoma (HNSC) remains an important public health problem, with classic risk factors being smoking and excessive alcohol consumption and usually has a poor prognosis. Therefore, it is important to explore the underlying mechanisms of tumorigenesis and screen the genes and pathways identified from such studies and their role in pathogenesis. The purpose of this study was to identify genes or signal pathways associated with the development of HNSC. Methods: In this study, we downloaded gene expression profiles of GSE53819 from the Gene Expression Omnibus (GEO) database, including 18 HNSC tissues and 18 normal tissues. The differentially expressed genes (DEGs) were identified using the Linear Models for Microarray Data R package. Adjusted P values <0.01 and |log2 fold change (FC)| ≥2 was regarded as the filter condition. Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis of these DEGs were performed on the Database for Annotation, Visualization, and Integrated Discovery (DAVID) online website. Protein-protein interaction (PPI) network was built to visualize the interactions between these DEGs using the STRING online website. Finally, hub genes were identified by The Cancer Genome Atlas (TCGA) database. Results: A total of 604 DEGs consisting of 159 upregulated genes and 445 downregulated genes were selected. From these DEGs, prognostic related genes could serve as potential biomarkers for the molecular diagnosis and therapeutic intervention of HNSC were identified. Including the known genes, GPR18, CNR2, RSPH4A, ULBP2, TEX101, and STC2. And the novel genes, CCR8, CCDC39, CNTN5, MSLN, and CHGB were strongly implicated in HNSC. Conclusions: In summary, we indicated genes associated with prognostic in patients, which improve our understanding of HNSC and could be used as new therapeutic targets for HNSC. Keywords: Bioinformatics analysis; head and neck squamous cell carcinoma (HNSC); microarray data; differentially expressed genes (DEGs); biomarkers Submitted Feb 03, 2020. Accepted for publication Aug 28, 2020. doi: 10.21037/tcr-20-805 View this article at: http://dx.doi.org/10.21037/tcr-20-805 © Translational Cancer Research. All rights reserved. Transl Cancer Res 2020;9(10):5882-5892 | http://dx.doi.org/10.21037/tcr-20-805 Translational Cancer Research, Vol 9, No 10 October 2020 5883 Introduction on the GPL6480 platform (8). GSE53819 contains specimens from 18 patients with HNSC and paired healthy Head and neck squamous cell carcinoma (HNSC) consists of head and neck tissues. All the specimens were collected a group of tumors caused by the squamous epithelium in the before any chemotherapy. oral epithelium, oropharynx, larynx, and hypopharynx (1). HNSC is one of the most common malignancies and the sixth most common in the world (2). The United States Data preprocessing recorded about 50,000 new HNSCC cases and 10,000 We downloaded GSE53819, and then the probe deaths in 2017. Rates are rising about 1 percent a year in identification numbers were converted into Ensembl gene whites, and more than twice as high in men as in women. ID, the ensemble gene ID was converted into gene symbol, Early diagnosis of cancer is one of the most important and then the probe identification numbers correspond factors leading to less widespread and more successful to the gene symbol. For multiple probes identification treatment and better outcomes for patients (3). numbers corresponding to one gene symbol, the significant Tumorigenesis is a complex pathological process that expression value was taken as the gene expression value (9). involves multiple genetic changes, including overexpression of oncogenes and/or inactivation of tumor suppressor genes (4). Despite surgery, radiation, and chemotherapy, about half Identification of DEGs of all patients die from the disease. The risk stratification Bioconductor provides tools for the analysis and of HNSCC depends on the anatomical site, staging, and comprehension of high-throughput genomic data. histological characteristics of the tumor. In addition to the Bioconductor uses the R statistical programming language status of HPV, many molecular and clinical risk factors have and is open source and open development. RStudio is an been studied that limit its clinical usefulness (5). integrated development environment (IDE) for R (10). It In this study, we download the original dataset includes a console, syntax-highlighting editor that supports GSE53819 from Gene Expression Omnibus (GEO) (http:// direct code execution, as well as tools for plotting, history, www.ncbi.nlm.nih.gov/geo/) website, the database is used debugging and workspace management. We downloaded the to archive and store a public database (6). By querying limma package from the Bioconductor and imported it into microarray data, gene expression profiles of HNSC patients Rstudio. We used the Benjamini and Hochberg methods, were compared with normal healthy controls to determine genes with |log2-fold change (FC)| ≥2 and adjusted P values the differentially expressed genes (DEGs). Gene ontology <0.01 were used in the next analysis stage (11). (GO) and pathway enrichment analysis was then performed on the online website DAVID 6.8 (https://david.ncifcrf. gov/). We then constructed a protein-protein interaction GO and pathway enrichment analysis (PPI) network for DEGs and conducted a module analysis DAVID now provides a comprehensive set of functional of this network (7). Finally, we analyzed the survival of the annotation tools for investigators to understand the hub genes. Novel genes related to patient prognosis were biological meaning behind large list of genes. We used screened from hub genes, which had not been previously the DAVID online website to perform GO and Kyoto reported. For example: CCR8, CCDC39, CNTN5, MSLN, Encyclopedia of Genes and Genomes (KEGG) analysis and CHGB. Our study provides new information on the of DEGs. GO analysis includes three major categories: molecular etiology and pathogenesis of HNSC and provides biological process (BP), cellular component (CC), and new potential molecular targets for treatment. molecular function (MF) (12). The KEGG analysis is to find out the signal pathways for these differential expression Methods genes enrichment. P<0.05 as the cutoff criterion was considered statistically significant. Data source GSE53819 is a gene expression profile of HNSC and Integration of PPI network and module analysis belongs to the Agilent-014850 Whole Human Genome Microarray 4x44K G4112F (Probe Name version), which STRING is part of the ELIXIR infrastructure: it is one can be downloaded from the GEO database and executed of ELIXIR’s Core Data (version 11.0; https://string-db. © Translational Cancer Research. All rights reserved. Transl Cancer Res 2020;9(10):5882-5892 | http://dx.doi.org/10.21037/tcr-20-805 5884 Sun and Zhang. Gene signature is associated with prognostic in patients org/). We uploaded the differential expressed genes to the Results STRING website for analysis with a minimum required Identification of DEGs interaction score of 0.7000. We found that 572 genes and 547 edges were present in the PPI network, then we output In this study, we selected a microarray dataset related to the analysis results as a TSV file (13). Cytoscape, a free human HNSC from the GEO database. GSE53819 contains visualization software, is a bioinformatics software platform 18 HNSC tissues and 18 normal tissues. Using both |log2- for integrated models of biomolecular interaction networks fold change (FC)| ≥2 and adjusted P value <0.01 criteria, (version 3.7.2; https://cytoscape.org/). To further analyze a total of 604 genes were identified from GSE53819, the PPI network, we uploaded the TSV file to Cytoscape, including 159 upregulated genes and 445 downregulated and the whole PPI network consisted of 255 genes and 547 genes (Table 1). Whereafter, the volcano map and heatmap edges. Molecular complex detection (MCODE), a plug- were displayed (Figure 1A,B). in of Cytoscape software was used to conducted module analysis of the PPI network. We set K-score =6 and other GO enrichment and pathway analysis parameters were set by default (14). Module genes are considered as hub genes. To further analyze the biological functions of these DEGs, we conducted GO of these DEGs (Table 2). As shown in Figure 2, it respectively demonstrates the top six meaningful Overall survival of
Recommended publications
  • Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis

    Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis

    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Screening and identification of key biomarkers in clear cell renal cell carcinoma based on bioinformatics analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Clear cell renal cell carcinoma (ccRCC) is one of the most common types of malignancy of the urinary system. The pathogenesis and effective diagnosis of ccRCC have become popular topics for research in the previous decade. In the current study, an integrated bioinformatics analysis was performed to identify core genes associated in ccRCC. An expression dataset (GSE105261) was downloaded from the Gene Expression Omnibus database, and included 26 ccRCC and 9 normal kideny samples. Assessment of the microarray dataset led to the recognition of differentially expressed genes (DEGs), which was subsequently used for pathway and gene ontology (GO) enrichment analysis.
  • Whole-Genome Microarray Detects Deletions and Loss of Heterozygosity of Chromosome 3 Occurring Exclusively in Metastasizing Uveal Melanoma

    Whole-Genome Microarray Detects Deletions and Loss of Heterozygosity of Chromosome 3 Occurring Exclusively in Metastasizing Uveal Melanoma

    Anatomy and Pathology Whole-Genome Microarray Detects Deletions and Loss of Heterozygosity of Chromosome 3 Occurring Exclusively in Metastasizing Uveal Melanoma Sarah L. Lake,1 Sarah E. Coupland,1 Azzam F. G. Taktak,2 and Bertil E. Damato3 PURPOSE. To detect deletions and loss of heterozygosity of disease is fatal in 92% of patients within 2 years of diagnosis. chromosome 3 in a rare subset of fatal, disomy 3 uveal mela- Clinical and histopathologic risk factors for UM metastasis noma (UM), undetectable by fluorescence in situ hybridization include large basal tumor diameter (LBD), ciliary body involve- (FISH). ment, epithelioid cytomorphology, extracellular matrix peri- ϩ ETHODS odic acid-Schiff-positive (PAS ) loops, and high mitotic M . Multiplex ligation-dependent probe amplification 3,4 5 (MLPA) with the P027 UM assay was performed on formalin- count. Prescher et al. showed that a nonrandom genetic fixed, paraffin-embedded (FFPE) whole tumor sections from 19 change, monosomy 3, correlates strongly with metastatic death, and the correlation has since been confirmed by several disomy 3 metastasizing UMs. Whole-genome microarray analy- 3,6–10 ses using a single-nucleotide polymorphism microarray (aSNP) groups. Consequently, fluorescence in situ hybridization were performed on frozen tissue samples from four fatal dis- (FISH) detection of chromosome 3 using a centromeric probe omy 3 metastasizing UMs and three disomy 3 tumors with Ͼ5 became routine practice for UM prognostication; however, 5% years’ metastasis-free survival. to 20% of disomy 3 UM patients unexpectedly develop metas- tases.11 Attempts have therefore been made to identify the RESULTS. Two metastasizing UMs that had been classified as minimal region(s) of deletion on chromosome 3.12–15 Despite disomy 3 by FISH analysis of a small tumor sample were found these studies, little progress has been made in defining the key on MLPA analysis to show monosomy 3.
  • Universidad Nacional Autónoma De México Plan De Estudios Combinados En Medicina Instituto Nacional De Medicina Genómica

    Universidad Nacional Autónoma De México Plan De Estudios Combinados En Medicina Instituto Nacional De Medicina Genómica

    UNIVERSIDAD NACIONAL AUTÓNOMA DE MÉXICO PLAN DE ESTUDIOS COMBINADOS EN MEDICINA INSTITUTO NACIONAL DE MEDICINA GENÓMICA ESTUDIO POST-MORTEM DE LAS ALTERACIONES EN LA EXPRESIÓN DE RNA EN EL CEREBRO DE PACIENTES SUICIDAS TESIS QUE PARA OPTAR POR EL GRADO DE DOCTORA EN MEDICINA PRESENTA: BRENDA CABRERA MENDOZA DIRECTOR DE TESIS: DR. JOSÉ HUMBERTO NICOLINI SÁNCHEZ INSTITUTO NACIONAL DE MEDICINA GENÓMICA COMITÉ TUTOR: DRA. MARTHA PATRICIA OSTROSKY-SHEJET INSTITUTO DE INVESTIGACIONES BIOMÉDICAS DR. DAVID COLIN GLAHN ESCUELA DE MEDICINA DE HARVARD Ciudad Universitaria, CD. MX., diciembre de 2020 TABLA DE CONTENIDOS Resumen ........................................................................................................................................................................ 1 Abstract .......................................................................................................................................................................... 2 Definición y epidemiología del suicidio ............................................................................................................ 3 Epidemiología global del suicidio ..................................................................................................................... 5 Epidemiología del suicidio en América ........................................................................................................... 8 Epidemiología del suicidio en México ............................................................................................................10
  • Aquaporin Channels in the Heart—Physiology and Pathophysiology

    Aquaporin Channels in the Heart—Physiology and Pathophysiology

    International Journal of Molecular Sciences Review Aquaporin Channels in the Heart—Physiology and Pathophysiology Arie O. Verkerk 1,2,* , Elisabeth M. Lodder 2 and Ronald Wilders 1 1 Department of Medical Biology, Amsterdam University Medical Centers, University of Amsterdam, 1105 AZ Amsterdam, The Netherlands; [email protected] 2 Department of Experimental Cardiology, Amsterdam University Medical Centers, University of Amsterdam, 1105 AZ Amsterdam, The Netherlands; [email protected] * Correspondence: [email protected]; Tel.: +31-20-5664670 Received: 29 March 2019; Accepted: 23 April 2019; Published: 25 April 2019 Abstract: Mammalian aquaporins (AQPs) are transmembrane channels expressed in a large variety of cells and tissues throughout the body. They are known as water channels, but they also facilitate the transport of small solutes, gasses, and monovalent cations. To date, 13 different AQPs, encoded by the genes AQP0–AQP12, have been identified in mammals, which regulate various important biological functions in kidney, brain, lung, digestive system, eye, and skin. Consequently, dysfunction of AQPs is involved in a wide variety of disorders. AQPs are also present in the heart, even with a specific distribution pattern in cardiomyocytes, but whether their presence is essential for proper (electro)physiological cardiac function has not intensively been studied. This review summarizes recent findings and highlights the involvement of AQPs in normal and pathological cardiac function. We conclude that AQPs are at least implicated in proper cardiac water homeostasis and energy balance as well as heart failure and arsenic cardiotoxicity. However, this review also demonstrates that many effects of cardiac AQPs, especially on excitation-contraction coupling processes, are virtually unexplored.
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Renal Cell Neoplasms Contain Shared Tumor Type–Specific Copy Number Variations

    Renal Cell Neoplasms Contain Shared Tumor Type–Specific Copy Number Variations

    The American Journal of Pathology, Vol. 180, No. 6, June 2012 Copyright © 2012 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.ajpath.2012.01.044 Tumorigenesis and Neoplastic Progression Renal Cell Neoplasms Contain Shared Tumor Type–Specific Copy Number Variations John M. Krill-Burger,* Maureen A. Lyons,*† The annual incidence of renal cell carcinoma (RCC) has Lori A. Kelly,*† Christin M. Sciulli,*† increased steadily in the United States for the past three Patricia Petrosko,*† Uma R. Chandran,†‡ decades, with approximately 58,000 new cases diag- 1,2 Michael D. Kubal,§ Sheldon I. Bastacky,*† nosed in 2010, representing 3% of all malignancies. Anil V. Parwani,*†‡ Rajiv Dhir,*†‡ and Treatment of RCC is complicated by the fact that it is not a single disease but composes multiple tumor types with William A. LaFramboise*†‡ different morphological characteristics, clinical courses, From the Departments of Pathology* and Biomedical and outcomes (ie, clear-cell carcinoma, 82% of RCC ‡ Informatics, University of Pittsburgh, Pittsburgh, Pennsylvania; cases; type 1 or 2 papillary tumors, 11% of RCC cases; † the University of Pittsburgh Cancer Institute, Pittsburgh, chromophobe tumors, 5% of RCC cases; and collecting § Pennsylvania; and Life Technologies, Carlsbad, California duct carcinoma, approximately 1% of RCC cases).2,3 Benign renal neoplasms are subdivided into papillary adenoma, renal oncocytoma, and metanephric ade- Copy number variant (CNV) analysis was performed on noma.2,3 Treatment of RCC often involves surgical resec- renal cell carcinoma (RCC) specimens (chromophobe, tion of a large renal tissue component or removal of the clear cell, oncocytoma, papillary type 1, and papillary entire affected kidney because of the relatively large size of type 2) using high-resolution arrays (1.85 million renal tumors on discovery and the availability of a life-sus- probes).
  • Salivary Alpha Amylase (AMY1C) (NM 001008219) Human Tagged ORF Clone Product Data

    Salivary Alpha Amylase (AMY1C) (NM 001008219) Human Tagged ORF Clone Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG215827 Salivary alpha amylase (AMY1C) (NM_001008219) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Salivary alpha amylase (AMY1C) (NM_001008219) Human Tagged ORF Clone Tag: TurboGFP Symbol: AMY1C Synonyms: AMY1 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 5 Salivary alpha amylase (AMY1C) (NM_001008219) Human Tagged ORF Clone – RG215827 ORF Nucleotide >RG215827 representing NM_001008219 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAGCTCTTTTGGTTGCTTTTCACCATTGGGTTCTGCTGGGCTCAGTATTCCTCAAATACACAACAAG GACGAACATCTATTGTTCATCTGTTTGAATGGCGATGGGTTGATATTGCTCTTGAATGTGAGCGATATTT AGCTCCCAAGGGATTTGGAGGGGTTCAGGTCTCTCCACCAAATGAAAATGTTGCCATTCACAACCCTTTC AGACCTTGGTGGGAAAGATACCAACCAGTTAGCTATAAATTATGCACAAGATCTGGAAATGAAGATGAAT TTAGAAACATGGTGACTAGATGCAACAATGTTGGGGTTCGTATTTATGTGGATGCTGTAATTAATCATAT GTGTGGTAATGCTGTGAGTGCAGGAACAAGCAGTACCTGTGGAAGTTACTTCAACCCTGGAAGTAGGGAC TTTCCAGCAGTCCCATATTCTGGATGGGATTTTAATGATGGTAAATGTAAAACTGGAAGTGGAGATATCG AGAACTATAATGATGCTACTCAGGTCAGAGATTGTCGTCTGTCTGGTCTTCTCGATCTTGCACTGGGGAA
  • Investigation of Candidate Genes and Mechanisms Underlying Obesity

    Investigation of Candidate Genes and Mechanisms Underlying Obesity

    Prashanth et al. BMC Endocrine Disorders (2021) 21:80 https://doi.org/10.1186/s12902-021-00718-5 RESEARCH ARTICLE Open Access Investigation of candidate genes and mechanisms underlying obesity associated type 2 diabetes mellitus using bioinformatics analysis and screening of small drug molecules G. Prashanth1 , Basavaraj Vastrad2 , Anandkumar Tengli3 , Chanabasayya Vastrad4* and Iranna Kotturshetti5 Abstract Background: Obesity associated type 2 diabetes mellitus is a metabolic disorder ; however, the etiology of obesity associated type 2 diabetes mellitus remains largely unknown. There is an urgent need to further broaden the understanding of the molecular mechanism associated in obesity associated type 2 diabetes mellitus. Methods: To screen the differentially expressed genes (DEGs) that might play essential roles in obesity associated type 2 diabetes mellitus, the publicly available expression profiling by high throughput sequencing data (GSE143319) was downloaded and screened for DEGs. Then, Gene Ontology (GO) and REACTOME pathway enrichment analysis were performed. The protein - protein interaction network, miRNA - target genes regulatory network and TF-target gene regulatory network were constructed and analyzed for identification of hub and target genes. The hub genes were validated by receiver operating characteristic (ROC) curve analysis and RT- PCR analysis. Finally, a molecular docking study was performed on over expressed proteins to predict the target small drug molecules. Results: A total of 820 DEGs were identified between
  • Systematic Detection of Divergent Brain Proteins in Human Evolution and Their Roles in Cognition

    Systematic Detection of Divergent Brain Proteins in Human Evolution and Their Roles in Cognition

    bioRxiv preprint doi: https://doi.org/10.1101/658658; this version posted June 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Systematic detection of divergent brain proteins in human evolution and their roles in cognition Guillaume Dumas1,*, Simon Malesys1 and Thomas Bourgeron1 Affiliations: 1 Human Genetics and Cognitive Functions, Institut Pasteur, UMR3571 CNRS, Université de Paris, Paris, (75015) France * Corresponding author: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/658658; this version posted June 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Abstract The human brain differs from that of other primates, but the underlying genetic mechanisms remain unclear. Here we measured the evolutionary pressures acting on all human protein- coding genes (N=17,808) based on their divergence from early hominins such as Neanderthal, and non-human primates. We confirm that genes encoding brain-related proteins are among the most conserved of the human proteome. Conversely, several of the most divergent proteins in humans compared to other primates are associated with brain-associated diseases such as micro/macrocephaly, dyslexia, and autism. We identified specific eXpression profiles of a set of divergent genes in ciliated cells of the cerebellum, that might have contributed to the emergence of fine motor skills and social cognition in humans.
  • Supplemental Table 1. Complete Gene Lists and GO Terms from Figure 3C

    Supplemental Table 1. Complete Gene Lists and GO Terms from Figure 3C

    Supplemental Table 1. Complete gene lists and GO terms from Figure 3C. Path 1 Genes: RP11-34P13.15, RP4-758J18.10, VWA1, CHD5, AZIN2, FOXO6, RP11-403I13.8, ARHGAP30, RGS4, LRRN2, RASSF5, SERTAD4, GJC2, RHOU, REEP1, FOXI3, SH3RF3, COL4A4, ZDHHC23, FGFR3, PPP2R2C, CTD-2031P19.4, RNF182, GRM4, PRR15, DGKI, CHMP4C, CALB1, SPAG1, KLF4, ENG, RET, GDF10, ADAMTS14, SPOCK2, MBL1P, ADAM8, LRP4-AS1, CARNS1, DGAT2, CRYAB, AP000783.1, OPCML, PLEKHG6, GDF3, EMP1, RASSF9, FAM101A, STON2, GREM1, ACTC1, CORO2B, FURIN, WFIKKN1, BAIAP3, TMC5, HS3ST4, ZFHX3, NLRP1, RASD1, CACNG4, EMILIN2, L3MBTL4, KLHL14, HMSD, RP11-849I19.1, SALL3, GADD45B, KANK3, CTC- 526N19.1, ZNF888, MMP9, BMP7, PIK3IP1, MCHR1, SYTL5, CAMK2N1, PINK1, ID3, PTPRU, MANEAL, MCOLN3, LRRC8C, NTNG1, KCNC4, RP11, 430C7.5, C1orf95, ID2-AS1, ID2, GDF7, KCNG3, RGPD8, PSD4, CCDC74B, BMPR2, KAT2B, LINC00693, ZNF654, FILIP1L, SH3TC1, CPEB2, NPFFR2, TRPC3, RP11-752L20.3, FAM198B, TLL1, CDH9, PDZD2, CHSY3, GALNT10, FOXQ1, ATXN1, ID4, COL11A2, CNR1, GTF2IP4, FZD1, PAX5, RP11-35N6.1, UNC5B, NKX1-2, FAM196A, EBF3, PRRG4, LRP4, SYT7, PLBD1, GRASP, ALX1, HIP1R, LPAR6, SLITRK6, C16orf89, RP11-491F9.1, MMP2, B3GNT9, NXPH3, TNRC6C-AS1, LDLRAD4, NOL4, SMAD7, HCN2, PDE4A, KANK2, SAMD1, EXOC3L2, IL11, EMILIN3, KCNB1, DOK5, EEF1A2, A4GALT, ADGRG2, ELF4, ABCD1 Term Count % PValue Genes regulation of pathway-restricted GDF3, SMAD7, GDF7, BMPR2, GDF10, GREM1, BMP7, LDLRAD4, SMAD protein phosphorylation 9 6.34 1.31E-08 ENG pathway-restricted SMAD protein GDF3, SMAD7, GDF7, BMPR2, GDF10, GREM1, BMP7, LDLRAD4, phosphorylation
  • Patient-Based Cross-Platform Comparison of Oligonucleotide Microarray Expression Profiles

    Patient-Based Cross-Platform Comparison of Oligonucleotide Microarray Expression Profiles

    Laboratory Investigation (2005) 85, 1024–1039 & 2005 USCAP, Inc All rights reserved 0023-6837/05 $30.00 www.laboratoryinvestigation.org Patient-based cross-platform comparison of oligonucleotide microarray expression profiles Joerg Schlingemann1,*, Negusse Habtemichael2,*, Carina Ittrich3, Grischa Toedt1, Heidi Kramer1, Markus Hambek4, Rainald Knecht4, Peter Lichter1, Roland Stauber2 and Meinhard Hahn1 1Division of Molecular Genetics, Deutsches Krebsforschungszentrum, Heidelberg, Germany; 2Chemotherapeutisches Forschungsinstitut Georg-Speyer-Haus, Frankfurt am Main, Germany; 3Central Unit Biostatistics, Deutsches Krebsforschungszentrum, Heidelberg, Germany and 4Department of Otorhinolaryngology, Universita¨tsklinik, Johann-Wolfgang-Goethe-Universita¨t Frankfurt, Frankfurt, Germany The comparison of gene expression measurements obtained with different technical approaches is of substantial interest in order to clarify whether interplatform differences may conceal biologically significant information. To address this concern, we analyzed gene expression in a set of head and neck squamous cell carcinoma patients, using both spotted oligonucleotide microarrays made from a large collection of 70-mer probes and commercial arrays produced by in situ synthesis of sets of multiple 25-mer oligonucleotides per gene. Expression measurements were compared for 4425 genes represented on both platforms, which revealed strong correlations between the corresponding data sets. Of note, a global tendency towards smaller absolute ratios was observed when
  • Chuanxiong Rhizoma Compound on HIF-VEGF Pathway and Cerebral Ischemia-Reperfusion Injury’S Biological Network Based on Systematic Pharmacology

    Chuanxiong Rhizoma Compound on HIF-VEGF Pathway and Cerebral Ischemia-Reperfusion Injury’S Biological Network Based on Systematic Pharmacology

    ORIGINAL RESEARCH published: 25 June 2021 doi: 10.3389/fphar.2021.601846 Exploring the Regulatory Mechanism of Hedysarum Multijugum Maxim.-Chuanxiong Rhizoma Compound on HIF-VEGF Pathway and Cerebral Ischemia-Reperfusion Injury’s Biological Network Based on Systematic Pharmacology Kailin Yang 1†, Liuting Zeng 1†, Anqi Ge 2†, Yi Chen 1†, Shanshan Wang 1†, Xiaofei Zhu 1,3† and Jinwen Ge 1,4* Edited by: 1 Takashi Sato, Key Laboratory of Hunan Province for Integrated Traditional Chinese and Western Medicine on Prevention and Treatment of 2 Tokyo University of Pharmacy and Life Cardio-Cerebral Diseases, Hunan University of Chinese Medicine, Changsha, China, Galactophore Department, The First 3 Sciences, Japan Hospital of Hunan University of Chinese Medicine, Changsha, China, School of Graduate, Central South University, Changsha, China, 4Shaoyang University, Shaoyang, China Reviewed by: Hui Zhao, Capital Medical University, China Background: Clinical research found that Hedysarum Multijugum Maxim.-Chuanxiong Maria Luisa Del Moral, fi University of Jaén, Spain Rhizoma Compound (HCC) has de nite curative effect on cerebral ischemic diseases, *Correspondence: such as ischemic stroke and cerebral ischemia-reperfusion injury (CIR). However, its Jinwen Ge mechanism for treating cerebral ischemia is still not fully explained. [email protected] †These authors share first authorship Methods: The traditional Chinese medicine related database were utilized to obtain the components of HCC. The Pharmmapper were used to predict HCC’s potential targets. Specialty section: The CIR genes were obtained from Genecards and OMIM and the protein-protein This article was submitted to interaction (PPI) data of HCC’s targets and IS genes were obtained from String Ethnopharmacology, a section of the journal database.