20th Annual International Meeting of the Institute of Human Virology 1 Contents

CONTENTS

Click on any content title to link to that section.

03 Program Information and Acknowledgements

13 Events Schedule

16 Speaker Index

23 Abstract Index

27 Poster Index

20th Annual International Meeting of the Institute of Human Virology 2 Welcome 20th Annual International Meeting of the Institute of Human Virology at the University of Maryland School of Medicine

Dear Colleagues and Friends,

You are invited to join us on Monday, October 22 through Thursday, October 25 for IHV2018, “Virus Threats and Cancers – A Special Joint International Meeting of the Institute of Human Virology and the Global Virus Network.” Sessions for this year’s meeting will focus on: The 40th Anniversary of the Discovery of the First Human Retrovirus, HTLV, Exosomes in Health and Disease, Cancer Immunology, Cancer Epigenetics, Cancer Microenvironments, Viruses, the Emerging Global Health Challenge, PEPFAR: Towards HIV Epidemic Control, Targeting Early Infections,Approaches to Eliminate Persistent Viruses, Early stage investigators are invited to submit research abstracts for poster presentation – please share this opportunity with your faculty and colleagues.

A special mini-symposium, “The 15th Anniversary of PEPFAR” will honor PEPFAR as the largest public health program in global history, and its sustainable impact on global health priorities. This year’s meeting will honor IHV Lifetime Achievement Awardees: Lifetime Achievement Award for Excellence in Medical Education, Clinical Care and Clinical Research: Henry Masur, MD, Chief of Critical Care Medicine Department, NIH Clinical Center and the Lifetime Achievement Award for Excellence in Clinical Research: Kiyoshi Takatsuki, MD, PhD, Professor Emeritus, Kumamoto University

The Annual Awards Gala will be held Wednesday, October 24 at the Four Seasons Hotel, Baltimore. A gala reception will begin at 6:30 pm followed by dinner at 7:15 pm. We look forward to welcoming you to Baltimore this October as we continue our annual tradition of excellent science and provocative discussion.

Sincerely,

Robert C. Gallo, MD Manhattan Charurat, PhD Homer and Martha Gudelsky Director, Division of Epidemiology and Prevention Distinguished Professor in Medicine Professor of Medicine, Institute of Human Virology Director, Institute of Human Virology Co-Founder and Director, Global Virus Network

20th Annual International Meeting of the Institute of Human Virology 3 Program Information and Acknowledgements

Mission Statement

The Institute was established to create and develop a world-class center of excellence focusing on chronic viral diseases, especially HIV/AIDS, and virally-linked cancers.

The IHV is dedicated to the discovery, research, treatment and prevention of these disease.

Its unique structure seeks to connect cohesive, multi-disciplinary research and clinical programs so that new treatments are streamlined from discovery to patient. The IHV serves patients locally and the scientific community globally.

Robert Gallo, MD Director

Man Charurat, PhD Director, Division of Epidemiology and Prevention

Shyam Kottilil, MBBS, PhD Director, Division of Clinical Care & Research

George Lewis, PhD Director, Division of Vaccine Research

Yang Liu, PhD Director, Divisioni of Immunotherapy

Wuyuan Lu, PhD Co-Director, Division of Basic Science

Eric Sundberg, PhD Co-Director, Division of Basic Science

Anthony Amoroso, MD Associate Director, Division of Clinical Care & Research

Deus Bazira, DrPH, MPH, MBA Director, Center for International Health, Education & Biosecurity (CIHEB)

Dave Wilkins Chief Operating Officer

20th Annual International Meeting of the Institute of Human Virology 4 Program Information and Acknowledgements

Institute of Human Virology (IHV) Board of Advisors

Terry Lierman, Co-Chair Mark H. Kapan, MD, FACP Peter Palese, PhD Summit Global Ventures University of Michigan Health System Mount Sinai School of Medicine

John Evans, Co-Chair John R. Kelly James P. Pinkerton Evans Telecommunications Kelly & Associates Insurance Group RATE Coalition (KELLY) Peter Angelos, Esquire KELLY Benefit Strategies & KELLY The Honorable Catherine E. Pugh The Law Offices of Peter Angelos Advisory Mayor of Baltimore

Joseph Berardino William E. Kirwan, PhD Ellen Ratner Alvarez & Marsal University System of Maryland Talk Radio News Service

William A. Blattner, MD The Honorable Nancy Kopp Guangqi Tian Institute of Human Virology, Retired Maryland State Treasurer Sino Invest Limited

Christian Bréchot, MD, PhD Anna B. Laakmann, Esquire The Honorable Kathleen Kennedy Global Virus Network (GVN) Greenberg Traurig LLP Townsend The Rock Creek Group Robert L. Caret, PhD Thomas G. Lynch University System of Maryland Ireland East Hospital Group Jeff B. Trammell Trammell and Company Barbara Culliton John McHutchison, MD Science Journalist and Policy Gilead Sciences, Inc. Lenny Wilkens Consultant NBA Hall of Fame Coach and Player Charles Modica, JD The Honorable Elijah Cummings St. George’s University Danny Wong US House of Representatives Medisun Timothy Moynahan, Esquire The Honorable Arthur J. Gajarsa The Moynahan Law Firm, LLC Ambassador R. James Woolsey WilmerHale Lux Capital Management Franco Nuschese Michael Greenebaum Georgetown Entertainment Group Steven Wozencraft Greenebaum Enterprises John D. Evans Foundation Joseph S. Pagano, MD Sheilah A. Kast University of North Carolina at The Honorable Ernest F. Hollings, On the Record, WYPR Chapel Hill Honorary

Princess Chulabhorn Mahidol, Honorary

20th Annual International Meeting of the Institute of Human Virology 5 Program Information and Acknowledgements

IHV Scientific Advisory Board

Joseph Pagano, MD, Chair Diane E. Griffin, MD, PhD Peter Palese, PhD University of North Carolina Johns Hopkins Bloomberg School of Mount Sinai School of Medicine Public Health Edward Berger, PhD Jeffrey V. Ravetch, MD, PhD NIAID, NIH Mark H. Kaplan, MD Rockefeller University University of Michigan Carlo M. Croce, MD Health System Michael Saag, MD The Ohio State University University of Alabama at Birmingham Michel Klein, MD Center for AIDS Research William DeGrado, PhD VaxiBio, Inc. University of California, Erica Ollmann Saphire, PhD San Francisco John W. Mellors, MD The Scripps Research Institute University of Pittsburgh Max Essex, DVM, PhD Mario Stevenson, PhD Harvard AIDS Institute Douglas Nixon, MD, PhD University of Miami The George Washington University Warner C. Greene, MD, PhD David Thomas, MD, MPH Gladstone Institute of Virology and Erling C. J. Norrby, MD, PhD Johns Hopkins Medicine Immunology The Royal Swedish Academy of Sciences Sten H. Vermund, MD, PhD Yale School of Public Health

20th Annual International Meeting of the Institute of Human Virology 6 Program Information and Acknowledgements

Organizing Committees

The Institute of Human Virology at the University of Maryland School of Medicine is grateful for the assistance provided by our International and Local Organizing Committees.

International Organizing Committee Robert C. Gallo, MD Quarraisha Abdool Salim, PhD Director, Institute of Human Virology CAPRISA

Roberto Accolla, MD, PhD Alash’le Abimiku, MON, PhD University of Insubria Institute of Human Virology

Local Organizing Committee Anthony DeVico, PhD George Lewis, PhD Institute of Human Virology Institute of Human Virology

Eric Sundberg, PhD Nadia Sam-Agudu, MD Institute of Human Virology Institute of Human Virology

Yang Lui, PhD Shyamasundaran Kottilil, MD, PhD Institute of Human Virology Institute of Human Virology

Deus Mubangizi, DrPH, MPH Yutaka Tagaya, MD, PhD Institute of Human Virology Institute of Human Virology

Clement Adebamowo, BM, ChB Hons, FWACS, ScD Institute of Human Virology

20th Annual International Meeting of the Institute of Human Virology 7 Program Information and Acknowledgements

Communications and Press Policy

To enhance the exchange of information and communication among attendees of IHV2018, the following must be adhered to by all participants:

• All comments at sessions are off-the-record and not for attribution.

• No coverage, reporting or publication of scientific data or presentations at IHV2018 is permitted without the written consent of the presenter(s) and Nora Samaranayake (info below). This rule applies to all forms of media, including blogging, tweeting, etc.

• Alternatively, if content comprises public comments made during the closed meeting, media are acceptable without written consent. If you are not sure if the comments can be publicized, please err on the side of caution and contact Nora Samaranayake.

One-on-one interviews with scientists and media may be arranged by contacting Nora Samaranayake, Director of Public Relations and Marketing, Institute of Human Virology, (410) 706-8614 or [email protected].

Those registering for the meeting as “press” must provide their credentials within 3 days of registration to Amina Teal, [email protected].

20th Annual International Meeting of the Institute of Human Virology 8 Program Information and Acknowledgements

Special Acknowledgements

The Institute of Human Virology wishes to recognize, with gratitude, the following sponsors.

*Funding for this conference was made possible in part by 2 R13 AI 046078 - 19 from the National Institute of Allergy and Infectious Diseases. The views expressed in written conference materials or publications and by speakers and moderators do not necessarily reflect the official policies of the Department of Health and Human Services; nor does mention of trade names, commercial practices, or organizations imply endorsement by the U.S. Government.

20th Annual International Meeting of the Institute of Human Virology 9 Program Information and Acknowledgements

The 2018 IHV Lifetime Achievement Award for Excellence in Medical Education, Clinical Care and Clinical Research Henry Masur, MD Henry Masur, MD is the Chief of Critical Care Medicine Department at the NIH Clinical Center. He trained in infectious diseases at Cornell-New York Hospital. In the early 1980’s he recognized some of the first patients with HIV infection, and initiated a program in New York that described the emerging manifestation of AIDS. In 1982 he was recruited to join the Critical Care Medicine Department at the NIH-Clinical Center. He built a multidisciplinary group that focused on understanding the pathogenesis and natural history of HIV-related opportunistic infections including pneumocystis, CMV, Mycobacterium avium complex, and Cryptococcus. His team did initial studies on new diagnostics and new therapeutic agents for these organisms that form the basis of diagnostic, therapeutic, and preventive management strategies that are still in use.

At NIH, his group was able to determine that pneumocystis was a fungus rather than a protozoa, they were able to develop the diagnostic immunofluorescent test still in use in most laboratories, they did early work on PCR diagnostics, and they sequenced the human, mouse and rate pneumocystis in order to understand the unique characteristics of this organism and how to develop new therapeutic and preventive strategies.

Recognizing that practicing physicians had a difficult time keeping up with new developments in this rapidly emerging field, Dr. Masur initiated the first NIH sponsored guideline related to AIDS management, with a focus on opportunistic infections. This guideline became a model for subsequent NIH or HHS sponsored guidelines on antiretroviral therapy, and pediatric and neonatal management. Each year there are over 1.5 million page views of these documents which serve as a global gold standard for clinical care.

Dr. Masur has been active in other fields including the management of infections in the ICU. He was Chair of the FDA Advisory Panel on Antiviral Drugs for over 10 years. He has been President, Infectious Disease Society of America.

In 2006 he worked with Anthony Fauci and Carl Dieffenbach of NIAID, and Alan Greenberg of the George Washington University School of Public Health and Health Policy, to develop a unique partnership, the DC Partnership for AIDS Progress, between NIH and the District of Columbia Department of Public Health to create a model in the District of Columbia on how urban areas in the US could more effectively deal with the HIV epidemic. That program now includes the nation’s largest urban HIV cohort, with almost 10,000 patients, and a clinical program focusing on HIV comorbidities and implementation strategies to increase ART and PREP adherence. In a cooperative agreement with the University of Maryland and IHV, this partnership has been a national leader in developing directly acting agents for HCV. Dr Masur serves as Co-Chair of the first IDSA-AASLD guidelines committee for management of HCV.

20th Annual International Meeting of the Institute of Human Virology 10 Program Information and Acknowledgements

The 2018 IHV Lifetime Achievement Award for Excellence in Clinical Research Kiyoshi Takatsuki, MD, PhD Kiyoshi Takatsuki, MD, PhD, Professor Emeritus of the Kumamoto University, is a hematologist whose research primarily focused on Adult T-cell leukemia (ATL), a T-cell malignancy caused by Human T-cell Leukemia Virus (HTLV)-1. Dr. Takatsuki graduated from the Kyoto University Medical School, and studied multiple myeloma there in the days when the word “Immunoglobulin” was not yet in use. Around 1973, Dr. Takatsuki and co-workers noticed a peculiar type of leukemia which was seen with patients from South-Western part (Kyushu and Okinawa) of Japan. The leukemic cells from these patients show special indentation or lobulation of cellular nuclei. Dr. Takatsuki’s group later proved that that these leukemic cells are of T-cell origin. In 1977, Dr. Takatsuki and co-workers made a seminal report that this is a new clinical disease and named it as ATL.

The discovery of ATL by Dr. Takatsuki’s group had rippling effects on numerous fields of medical biology, oncology, virology and unexpectedly, neurology as HTLV-1 was later shown to cause HAM/TSP (HTLV-1 associated myelopathy/Tropical spastic paraparesis), a progressive and paralytic neurological disorder. Above all, it led to the discovery of the first human oncogenic retrovirus by Dr. Robert Gallo’s group at the NCI in 1980. Independently, a Japanese group led by Dr. Yorio Hinuma identified a new type C retrovirus (1981) from an ATL cell line. Subsequent studies confirmed that these two viruses were identical, which is now known as the Human T-cell leukemia Virus-1 (HTLV-1).

Dr. Takatsuki’s group continued extensive clinical and basic research on ATL and HTLV-1. They defined the clinical classification of ATL, elucidated mechanism of oncogenesis, and developed new diagnostic methodology andnew treatments. In particular, Takatsuki and his colleagues studied nearly 200 ATL patients in Kyushu, Japan (median age 55) and established the clinical features associated with this disease; lymph node enlargement, hepatomegaly, splenomegaly, and skin lesions. Skin lesions including papules, erythema, and nodules are often associated with ATL patients as ATL cells densely infiltrate the dermis and epidermis to form Pautrier’s microabscesses. In addition, they found the association of hypercalcemia with 72% of ATL patients. They also discovered the familial occurrence of ATL (which prompted virologists to search for the causing virus). Later, Dr. Takatsuki and others elucidated the three routes of HTLV-1 transmission all of which require the passage of virus-infected cells. One major mode of transmission is from mothers to newborns through breast feeding. In addition, the research by Takatsuki and others reported the sexual transmission of HTLV-1 predominantly from males to females, and transmission through blood transfusion.

Dr. Takatsuki has also mentored many young medical researchers who have now become leaders of the HTLV-1/ATL research field.

Dr. Takatsuki has authored and co-authored more than 420 publications. Because of these outstanding scientific accomplishments, Dr. Takatsuki received numerous prestigious awards including the Princess Takamatsu Cancer Foundation Prize (1984, Tokyo), Hammer Prize (1985, Los Angeles), and the Person of Cultural Merit by the Japanese Government (1995).

20th Annual International Meeting of the Institute of Human Virology 11 Program Information and Acknowledgements

Previous Recipients of IHV Lifetime Achievement Awards LIFETIME ACHIEVEMENT AWARDS FOR SCIENTIFIC CONTRIBUTIONS 1999 George Klein, MD, Karolinska Institute, Stockholm, Sweden 2000 Maurice Hilleman, PhD, Merck Research Laboratories, Sumneytown, Pennsylvania, USA 2001 Hilary Koprowski, MD, Thomas Jefferson University, Philadelphia, Pennsylvania, USA 2002 Alexander Rich, MD, Massachusetts Institute of Technology, Cambridge, Massachusetts, USA 2003 Jan Svoboda, PhD, DSc, Institute of Molecular Genetics, Prague, Czech Republic 2004 Paul Zamecnik, MD, Massachusetts General Hospital, Boston, Massachusetts, USA 2005 Manfred Eigen, PhD, Max Planck Institute, Göttingen, Germany 2006 Maxine Singer, PhD, National Institutes of Health, Bethesda, Maryland, USA 2008 Isaac P. Witz, PhD, Tel Aviv University, Tel Aviv, Israel 2010 Rino Rappuoli, PhD, Novartis Vaccines, Sienna, Italy 2011 Max Essex, DVM, PhD, Harvard AIDS Institute, Boston, Massachusetts, USA 2012 Thomas A. Waldmann, MD, National Cancer Institute, Bethesda, Maryland, USA 2013 Vadim I. Agol, MD, PhD, DSc, Russian Academy of Medical Sciences, Moscow, Russia 2014 William Paul, MD, National Institute of Allergy and Infectious Diseases, Bethesda, Maryland, USA 2015 Harald zur Hausen, MD, Nobel Laureate, Gelsenkirchen, Germany 2016 Peter Vogt, PhD, Scripps Research Institute, La Jolla, California, USA 2017 Peter Palese, PhD, Icahn School of Medicine at Mount Sinai, New York, New York, USA LIFETIME ACHIEVEMENT AWARD FOR PUBLIC SERVICE

2004 Stewart Greenebaum, Greenebaum and Rose Associates, Inc., Baltimore, Maryland, USA 2006 Martin Delaney, Project Inform, San Francisco, California, USA 2008 John D. Evans, Evans Telecommunication Company, Miami, Florida, USA The Honorable Robert K. Gray, Gray and Company II, Miami, Florida, USA 2010 Harry Huge, Esq., The Harry and Reba Huge Foundation, Charleston, South Carolina, USA 2011 Bernadine Healy, MD, In Memoriam, Former Director, National Institutes of Health, Bethesda, MD, USA 2012 Yi Zeng, PhD, China Centers for Disease Control, Beijing, China 2013 José G. Esparza, MD, PhD, Bill & Melinda Gates Foundation, Seattle, Washington, USA 2014 John Martin, PhD, Gilead Sciences, Inc., Foster City, California, USA 2015 Anthony S. Fauci, MD, National Institute of Allergy and Infectious Diseases, Bethesda, Maryland, USA 2016 Raymond Schinazi, PhD, Hon DSc, Emory University, Atlanta, Georgia, USA 2017 Quarraisha Abdool Karim, PhD, Center for the AIDS Programme of Research in South Africa, Durban, South Africa 2017 Salim Abdool Karim, MBChB, PhD, DSc, Center for the AIDS Programme of Research in South Africa, Durban, South Africa ONE-TIME LIFETIME ACHIEVEMENT AWARD FOR EXCELLENCE IN TEACHING 2010 Michele LaPlaca, MD, Institute of Microbiology of the University of Bologna, Bologna, Italy LIFETIME ACHIEVEMENT AWARD FOR EXCELLENCE IN MEDICAL EDUCATION, CLINICAL CARE AND CLINICAL RESEARCH 2012 John G. Bartlett, MD, Johns Hopkins Bloomberg School of Public Health, Baltimore, Maryland 20th Annual International Meeting of the Institute of Human Virology 12 Events Schedule

Evening Events Schedule

Monday, October 22, 2018 5:30 – 7:30 pm Opening Reception Grand Prefunction

Tuesday, October 23, 2018 6:15 – 8:15 pm Poster Session Grand Prefunction

Wednesday, October 24, 2018 6:30 pm Lifetime Achievement Awards Gala Reception Grand Prefunction

7:15 pm Lifetime Achievement Gala Banquet and Awards Ceremony Grand Ballroom

20th Annual International Meeting of the Institute of Human Virology 13 Events Schedule

Program Overview Monday, October 22, 2018 9:00 am – 2:55 pm Session A - The 40th Anniversary of the Discovery of the First Human Retrovirus, HTLV

10:30 – 11:00 am Coffee Break

11:50 am – 1:20 pm Lunch Break

2:55 – 3:25 pm Coffee Break

3:25 – 5:30 pm Session B – Exosomes in Health and Disease

5:30 – 7:30 pm Opening Reception

Tuesday, October 23, 2018

9:00 am – 12:20 pm Session C – Cancer Immunology

10:20 – 10:40 am Coffee Break

12:20 – 1:25 pm Lunch Break

1:25 – 3:30 pm Session D – Cancer Epigenetics

3:30 – 3:55 pm Coffee Break

3:55 – 6:10 pm Session E – Cancer Microenvironments

6:15 – 8:15 pm Poster Session

20th Annual International Meeting of the Institute of Human Virology 14 Events Schedule

Program Overview, continued Wednesday, October 24, 2018 9:00 – 11:50 am Session F – Viruses, the Emerging Global Health Challenge

10:25 – 10:45 am Coffee Break

11:50 – 1:10 pm Lunch Break

1:10 – 3:25 pm Session G – PEPFAR: Towards HIV Epidemic Control

3:25 – 3:45 pm Coffee Break

3:45 – 6:30 pm Session H – Lifetime Achievement Mini-Symposium

6:30 pm Gala Reception

7:15 pm Lifetime Achievement Award Dinner

Thursday, October 25, 2018 9:00 am - 12:15 pm Session I – Targeting Early Infection Events

10:40 – 11:00 am Coffee Break

12:15 – 1:20 pm Lunch Break

1:25 – 5:30 pm Session J- Approaches to Eliminate Persistent Viruses

3:30 – 3:50 pm Coffee Break

5:30 pm Adjourn 20th Annual International Meeting of the Institute of Human Virology 15 Speaker Index

Speaker Schedule Monday, October 22, 2018

Session A: The 40th Anniversary of the Discovery of the First Human Retrovirus, HTLV Grand Ballroom Chairpersons and Discussants: Robert Gallo, MD, Director, Institute of Human Virology, University of Maryland School of Medicine, US Yutaka Tagaya, MD, PhD, Institute of Human Virology, University of Maryland School of Medicine, US

9:00 Robert Gallo, MD, Director, Institute of Human Virology, University of Maryland School of Medicine, US Opening Remarks

9:10 Charles Bangham, ScD, FMedSci, Imperial College London, UK A-101 The human leukemia virus - HTLV-1 - persistence and pathogenesis

9:40 Genoveffa Franchini, MD, National Cancer Institute, US A-102 Do biological differences exist between HTLV-1A and HTLV-1C?

10:05 Antoine Gessain, MD, PhD, Institut Pasteur, France A-103 Epidemiology and Origin of HTLV-1 and Related Viruses Infection

Coffee Break, 10:30 AM - 11:00 AM Grand Prefunction

11:00 Roberto Accolla, MD, PhD, University of Insubria, Italy A-104 Tracing the intracellular jouney of HTLV-1 HBV during infection: From asymptomatic carriers to HAM/TSP ending to ATL: A one-way ticket?

11:25 Luigi Chieco-Bianchi, MD, University of Padova, Italy A-105 Role of fibroblasts in HTLV-1-medicated lymphomagenesis

Lunch Break, 11:50 AM – 1:20 PM

1:20 Masao Matsuoka, MD, PhD, Kumamoto University, Japan A-106 Strategy and pathogenesis of human T-cell leukemia virus type 1

1:45 Eduardo Gotuzzo, MD, Universidad Peruana Cayetano Heredia, Peru A-107 A general description of the HTLV-1 Cohort at the Institute of Tropical Medicine Alexander von Humboldt (1989-2015)

2:05 Anne Van den Broeke, DVM, PhD, Institute of Jules Bordet, Universite of Liege, Belgium A-108 HTLV-1/BLV genomic approaches to understanding ATL

2:30 Yutaka Tagaya, MD, PhD, Institute of Human Virology, University of Maryland School of Medicine, US A-109 A novel multi-cytokine inhibitory strategy in treating HTLV-1 diseases

Coffee Break, 2:55 PM - 3:25 PM Grand Prefunction

20th Annual International Meeting of the Institute of Human Virology 16 Speaker Index

Session B: Exosomes in Health and Disease Grand Ballroom Chairpersons and Discussants: Leonid Margolis, PhD, National Institute of Child Health and Human Development, US Robert Gallo, MD, Director, Institute of Human Virology, University of Maryland School of Medicine, US

3:25 Yoel Sadovsky, MD, University of Pittsburgh, US B-101 Placental exosomes in maternal-placental-fetal communication and viral resistance

3:50 Ayuko Hoshino, PhD, Weill Cornell Medical College, US B-102 Exosomal protein signatures: mechanistic insights and biomarker potential

4:15 Leonid Margolis, PhD, National Institute of Child Health and Human Development, US B-103 Not All Soluble Cytokines are Soluble: Cytokines in Extracellular Vesicles Mediate Cell-Cell Communications

4:40 Fatah Kashanchi, PhD, George Mason University, US B-104 Presence of HIV-1 RNA in Extracellular Vesicles from HIV-1 cART-treated Cells

5:05 Xandra Breakefield, PhD, Massachusetts General Hospital, US B-105 Extracellular vesicle as advance forces in cancer

Opening Reception 5:30 PM - 7:30 PM Grand Prefunction Tuesday, October 23, 2018

Session C: Cancer Immunology Grand Ballroom Chairpersons and Discussants: Jeff Schlom, PhD, National Cancer Institute, US Eduardo Sotomayor, MD, PhD, George Washington University, US

9:00 Yang Liu, PhD, Institute of Human Virology, University of Maryland School of Medicine, US C-101 Opening Remarks Sialoside-based pattern recognition and its application in immunotherapy

9:30 Julie Brahmer, MD, Johns Hopkins University C-102 Early Stage Non Small Cell Lung Cancer

9:55 Jeff Schlom, PhD, National Cancer Institute, US C-103 Multimodal Approach to Cancer Immunotherapy

Coffee Break, 10:20 AM - 10:40 AM Grand Prefunction

20th Annual International Meeting of the Institute of Human Virology 17 Speaker Index

10:40 Rongfu Wang, PhD, Weill Cornell Medical College, US C-104 Development of cancer immunotherapy by targeting neoantigens

11:05 Jay Berzofsky, MD, PhD, National Cancer Institute, US C-105 Clinical trial of HER2 cancer vaccine shows benefit in 45% of evaluable patients in phase I study

11:30 Yang-Xin Fu, MD, PhD, UT Southwestern Medical Center, US C-106 Tumor targeting antibodies to improve tumor immunity: the role of microbiota

11:55 Drew Pardoll, MD PhD, Bloomberg-Kimmel Institute for Cancer Immunotherapy, US C-107 How Checkpoint Blockade alters the repertoire and function of tumor specific T-cells

Lunch Break, 12:20 PM - 1:25 PM

Session D: Cancer Epigenetics Grand Ballroom Chairpersons and Discussants: Mark Kaplan, MD, University of Michigan, US Clement Adebamowo, MD, Institute of Human Virology, University of Maryland School of Medicine, US

1:25 Andrei Kozlov, PhD, DrSc, The Biomedical Center, Russia D-101 Expression of Evolutionary Novel Genes in Tumors - the Possible Role of Tumors in Evolution

1:50 TBA D-102

2:15 Paul Fisher, MPh PhD, FNAI, Virginia Commonwealth University, US D-103 Cancer Terminator Viruses: A Strategy for Targeting Metastatic Cancers

2:40 Sofia Gameiro, PharmD, PhD, National Cancer Institute, US D-104 Harnessing the Potential of HDAC Inhibitors for Immunotherapy Combinations.

3:05 Sydney Shaffer, MD, PhD, University of Pennsylvania, US D-105 Cellular memory and rare cell variability in cancer

Coffee Break, 3:30 PM - 3:55 PM Grand Prefunction

Session E: Cancer Microenvironments Grand Ballroom Chairpersons and Discussants: Isaac Witz, PhD, Tel Aviv University, Israel Franco Buonaguro, MD, Istituto Nazionale Tumori Fondazione Pascale, Italy

3:55 Isaac Witz, PhD, Tel Aviv University, Israel Opening Remarks

20th Annual International Meeting of the Institute of Human Virology 18 Speaker Index

4:05 Ze’ev Ronai, PhD, Technion Israel Institute of Technology, Israel E-101 UPR in coordinated regulation of microbiome and anti-tumor immunity

4:30 Hans Schreiber, MD, PhD, University of Chicago, US E-102 Destruction of the tumor microenvironment by neoantigen-specific T cells prevents relapse of therapy-resistant cancer variants

4:55 Adit Ben-Baruch, PhD, Tel Aviv University, Israel E-103 Inflammation-driven networks in the regulation of breast cancer progression

5:20 Peter Friedl, MD, PhD, Radboud University, Netherlands E-104 Intravital microscopy of the tumor microenvironment: escape and relevance for immunotherapy

5:45 Yves Declerck, MD, Univeristy of Southern California, US E-105 Mesenchymal Stromal Cells: Mediators of Inflammation in Cancer

Poster Session, 6:15 PM - 8:15 PM Grand Prefunction Wednesday, October 24, 2018

Session F: Viruses, the Emerging Global Health Challenge Grand Ballroom Chairpersons and Discussants: Christian Brechot, MD, PhD, Global Virus Network, US Alan Schmaljohn, PhD, University of Maryland School of Medicine, US

9:00 Christian Brechot, MD, PhD, Global Virus Network, US Opening Remarks

9:10 Florian Krammer, PhD, Icahn School of Medicine at Mount Sinai, US F-101 A hemagglutinin stalk-based universal influenza virus vaccine

9:35 Johan Neyts, PhD, Rega Institute, Belgium F-102 Antivirals, a lot has been achieved, yet a long way to go

10:00 David Brett-Major, MD, MPH, Uniformed Services University F-103 Catching Chances: The Movement to Be on the Ground and Research Ready Before an Outbreak

Coffee Break 10:25 AM - 10:45 AM Grand Prefunction

10:45 Aaron Mweene, PhD, MSc, BVM, University of Zambia F-105 Surveillance of viral zoonoses in Africa

11:10 Robert Garry, PhD, Tulane University School of Medicine F-106 Ebola and Lassa fever: Lessons learned, continuing challenges

20th Annual International Meeting of the Institute of Human Virology 19 Speaker Index

11:35 Richard H. Scheuermann, PhD, J. Craig Venter Institute, US F-104 Emergence of novel EV-D68 lineages associated with acute flaccid

Lunch Break 11:50 PM - 1:10 PM

Session G: PEPFAR: Towards HIV Epidemic Control Grand Ballroom Chairpersons and Discussants: Manhattan Charurat, PhD, Institute of Human Virology, University of Maryland School of Medicine, US Anthony Amoroso, MD, Institute of Human Virology, University of Maryland School of Medicine, US

1:10 Mark Dybul, MD, Georgetown University, US G-101 Special Lecture: PEPFAR - challenges and opportunities

1:40 Permanent Secretary Jabbin Mulwanda, Health Services, Zambia G-102 Special Lecture : Getting to the Last Mile in HIV Epidemic Control

2:10 Laura Guay, MD, George Washington University, Elizabeth Glazier Pediatric AIDS Foundation G-103 Research in the age of PEPFAR: Evidence Generation and Utilization

2:35 Scott Geibel, MHP, PhD, Population Council G-104

3:00 Deus Bazira, DrPH, MBA, MPH, Institute of Human Virology, University of Maryland School of Medicine, US G-105 Academic institutional impact on global HIV pandemic response: A decade of Implementing PEPFAR programs by University of Maryland Baltimore

Coffee Break, 3:25 PM - 3:45 PM Grand Prefunction

Session H: Lifetime Achievement Mini-Symposium Grand Ballroom Chairpersons and Discussants: John Martin, PhD, Gilead Sciences, Inc., US William Blattner, MD, Salt Run Global, US

3:45 Robert C. Gallo, MD, Director, Institute of Human Virology, University of Maryland School of Medicine, US Opening Remarks

3:55 Richard Whitley, MD, University of Alabama at Birmingham, US H-101 Speaking in Honor of Henry Masur: The Development of Oncolytic Herpes Simplex Viruses for the Treatment of Glioblastoma Multiforme

4:25 Clifford Lane, MD, National Institute of Allergy and Infectious Diseases, US H-102 Speaking in honor of Henry Masur: The Potential Role of “Defective” Proviruses in the Pathogenesis of HIV-1 Infection

20th Annual International Meeting of the Institute of Human Virology 20 Speaker Index

4:55 Masao Matsuoka, MD, PhD, Kumamoto University, Japan H-103 Speaking in honor of Kiyoshi Takatsuki: Clinical landscape of adult T-cell leukemia: its impacts on hematology, virology, and immunology

5:25 Junji Yodoi, MD, PhD, Kyoto University, Japan H-104 Speaking in honor of Kiyoshi Takatsuki: ATL, ADF and Human Virus Research

Gala Reception 6:30 PM, Grand Prefunction

Lifetime Achievement Award Dinner 7:15 PM, Grand Ballroom Thursday, October 25, 2018

Session I: Targeting Early Infection Events Grand Ballroom Chairpersons and Discussants: George Lewis, PhD, Institute of Human Virology, University of Maryland School of Medicine, US Anders Vahlne, MD, PhD, Karolinska Institute

9:00 Paolo Lusso, MD, PhD, National Institute of Allergy and Infectious Diseases, US I-101 Quaternary Contact Improves the Potency of Broadly Neutralizing Antibodies to the CD4-Binding Site of HIV-1

9:25 Thorsten Mempel MD, PhD, Harvard University, US I-102 Viral Fitness Costs and Benefits of Disrupting the Host Cell Actin Cytoskeleton in Mucosal HIV-infection

9:50 Benjamin Chen, MD, PhD, Mount Sinai School of Medicine, US I-103 HIV-1 cell-to-cell infection during acute infection and resistance to neutralizing antibodies

10:15 Mathias Lichterfeld, MD, PhD, Ragon Institute of MGH, MIT and Harvard, US I-104 Distinct Chromosomal Positions of Intact HIV-1 proviruses

Coffee Break, 10:40 AM - 11:00 AM Grand Prefunction

11:00 Jeff Lifson, MD, National Cancer Institute, US I-105 Nonhuman Primate Models in the Study of Early Event in AIDS Virus Infection

11:25 Savita Pahwa, MD, University of Miami Miller School of Medicine, US I-106 Early treatment initiation in children with perinatal HIV infection: Challenges and Opportunities

11:50 Roy Mariuzza, PhD, Institute for Bioscience and Biotechnology Research, University of Maryland, US I-107 Long-range allosteric effects induced by Tax–HLA-A2 binding to an anti-HTLV-1 TCR: Implications for early T cell signaling 1

Lunch Break, 12:15 PM - 1:20 PM

20th Annual International Meeting of the Institute of Human Virology 21 Speaker Index

Session J: Approaches to Eliminate Persistent Viruses Grand Ballroom Chairpersons and Discussants: Shyamasundaran Kottilil, MD, PhD, Institute of Human Virology, University of Maryland School of Medicine, US Henry Masur, MD, National Institutes of Health, US

1:25 Timothy Morgan, MD, National Hepatitis C Resource Center, US J-101 Diagnosis and Treatment of HCV in the VA Healthcare System

1:50 Eleanor Wilson, MD, Institute of Human Virology, University of Maryland School of Medicine, US J-102 Approaches to Eliminate Persistent Viruses

2:15 Peter Revill, PhD, Doherty Institute, Australia J-103 The International Coalition to Eliminate Hepatitis B (ICE-HBV)

2:40 Anuj Gaggar, MD, PhD, Gilead Sciences, Inc., US J-104 Towards a Functional Cure for HBV : An Industry Perspective

3:05 Claudia Hawkins, MD, MPH, Northwestern University, US J-105 Novel antiviral targets for HBV elimination

Coffee Break, 3:30 PM - 3:50 PM Grand Prefunction

3:50 Bhawna Poonia, PhD, Institute of Human Virology, University of Maryland School of Medicine, US J-106 Immune correlates of HBV cure

4:15 Patti Gravitt, PhD, MS, George Washingtion University, US J-107 Interrogating the immunologic and microbial cervical microenvironment in HPV infection

4:40 Attila Lorincz, PhD, Queen Maryland University of London, United Kingdom J-108 Role of DNA Methylation in Prediction of Human Papillomavirus Persistence and Carcinogenesis

5:05 Howard Gendelman, MD, University of Nebraska Medical Center J-109 Sequential administration of LASER ART and CRISPR-Cas9 can facilitate HIV-1 elimination in humanized mice

5:30 Adjourn

20th Annual International Meeting of the Institute of Human Virology 22 Abstracts Index

A-101 Charles Bangham, ScD, FMedSci, Imperial College London, UK The human leukemia virus - HTLV-1 - persistence and pathogenesis

A-102 Genoveffa Franchini, MD, Animal Models and Retroviral Vaccine Section, National Cancer Institute, US Do biological differences exist between HTLV-1A and HTLV-1C?

A-103 Antoine Gessain, MD, PhD, Institut Pasteur, France Epidemiology and Origin of HTLV-1 and Related Viruses Infection

A-104 Roberto Accolla, MD, PhD, University of Insubria, Italy TRACING THE INTRACELLULAR JOURNEY OF HTLV-1 HBZ DURING INFECTION: FROM ASYMPTOMATIC CARRIERS TO HAM/TSP ENDING TO ATL: A ONE-WAY TICKET?

A-105 Luigi Chieco-Bianchi, MD, University of Padova, Italy ROLE OF FIBROBLASTS IN HTLV-1-MEDIATED LYMPHOMAGENESIS

A-106 Masao Matsuoka, MD, PhD, Kumamoto University, Japan Strategy and pathogenesis of human T-cell leukemia virus type 1

A-107 Eduardo Gotuzzo, MD, Universidad Peruana Cayetano Heredia, Peru A general description of the HTLV-1 Cohort at the Institute of Tropical Medicine Alexander von Humboldt (1989-2015)

A-108 Anne Van den Broeke, DVM, PhD, Institut Jules Bordet, University of Liège, Liège, Belgium HTLV-1/BLV genomic approaches to understanding ATL

A-109 Yutaka Tagaya, MD, PhD, Institute of Human Virology, University of Maryland School of Medicine, US A novel multi-cytokine inhibitory strategy in treating HTLV-1 diseases

B-101 Yoel Sadovsky, MD, University of Pittsburgh, US Placental exosomes in maternal-placental-fetal communication and viral resistance

B-102 Ayuko Hoshino, PhD, Weill Cornell Medicine, Weill Cornell Medicine Exosomal protein signatures: mechanistic insights and biomarker potential

B-103 Leonid Margolis, PhD, National Institute of Child Health and Human Development, US NOT ALL SOLUBLE CYTOKINES ARE SOLUBLE: CYTOKINES IN EXTRACELLULR VESICLES MEDIATE CELL-CELL COMMUNICATIONS

B-104 Fatah Kashanchi, PhD, George Mason University, US Presence of HIV-1 RNA in Extracellular Vesicles from HIV-1 cART-treated Cells

B-105 Xandra Breakefield, PhD, Massachusetts General Hospital, US Extracellular vesicles as advance forces in cancer

C-101 Yang Liu, PhD, Institute of Human Virology, University of Maryland School of Medicine, US Sialoside-based pattern recognition and its application in immunotherapy

20th Annual International Meeting of the Institute of Human Virology 23 Abstract Index

C-102 Julie Brahmer, MD, Johns Hopkins Early Stage Non Small Cell Lung Cancer

C-103 Jeff Schlom, PhD, National Cancer Institute, US Multimodal Approach to Cancer Immunotherapy

C-104 Rongfu Wang, PhD, Weill Cornell Medical College, US Development of cancer immunotherapy by targeting neoantigens

C-105 Jay Berzofsky, MD, PhD, Natonal Cancer Institute, US Clinical trial of HER2 cancer vaccine shows benefit in 45% of evaluable patients in phase I study

C-106 Yang-Xin Fu, MD, PhD, UT Southwestern Medical Center, US Tumor targeting antibodies to improve tumor immunity: the role of microbiota

C-107 Drew Pardoll, MD, PhD, Bloomberg-Kimmel Institute for Cancer Immunotherapy, US How Checkpoint Blockade alters the repertoire and function of tumor specific T-cells

D-101 Andrei Kozlov, PhD, DSc, The Biomedical Center, Russian Federation Expression of Evolutionarily Novel Genes in Tumors - the Possible Role of Tumors in Evolution

D-102 TBA

D-103 Paul B. Fisher, MPhil, PhD, FNAI, Virginia Commonwealth University School of Medicine, US Cancer Terminator Viruses: A Strategy for Targeting Metastatic Cancers

D-104 Sofia Gameiro, PharmD, PhD, National Cancer Institute, US Harnessing the Potential of HDAC Inhibitors for Immunotherapy Combinations.

D-105 Sydney Shaffer, MD, PhD, University of Pennsylvania, US Cellular memory and rare cell variability in cancer

E-101 Ze’ev Ronai, PhD, Sanford Burnham Prebys Medical Discovery Institute, Israel UPR in coordinated regulation of microbiome and anti-tumor immunity

E-102 Hans Schreiber, MD, PhD, University of Chicago, US Destruction of the tumor microenvironment by neoantigen-specific T cells prevents relapse of therapy-resistant cancer variants

E-103 Adit Ben-Baruch, PhD, Tel Aviv University, Israel Inflammation-driven networks in the regulation of breast cancer progression

E-104 Peter Friedl, MD, PhD, Radboud University, Netherlands; University of Texas, MD Anderson Cancer Center, US Intravital microscopy of the tumor microenvironment: escape and relevance for immunotherapy

E-105 Yves DeClerck, MD, University of Southern California, US Mesenchymal Stromal Cells: Mediators of Inflammation in Cancer

20th Annual International Meeting of the Institute of Human Virology 24 Abstract Index

F-101 Florian Krammer, PhD, Icahn School of Medicine at Mount Sinai, US A hemagglutinin stalk-based universal influenza virus vaccine

F-102 Johan Neyts, PhD, Rega Institute, Belgium Antivirals, a lot has been achieved, yet a long way to go.

F-103 David Brett-Major, MD, MPH, Uniformed Services University, US Catching Chances: The Movement to Be on the Ground and Research Ready Before an Outbreak

F-104 Richard H. Scheuermann, PhD, J. Craig Venter Institute, US Emergence of novel EV-D68 lineages associated with acute flaccid

F-105 Aaron Mweene, PhD, MSc, BVM, University of Zambia, Zambia Surveillance of viral zoonoses in Africa

F-106 Robert Garry, PhD, Tulane University School of Medicine, US Ebola and Lassa fever: Lessons learned, continuing challenges.

G-101 Mark Dybul, MD, Georgetown University, US PEPFAR - challenges and opportunities

G-102 Permanent Secretary Jabbin Mulwanda, Health Services, Zambia Getting to the Last Mile in HIV Epidemic Control

G-103 Laura Guay, MD, George Washington University, Elizabeth Glazer Pediatric AIDS Foundation, US Research in the age of PEPFAR: Evidence Generation and Utilization

G-104 Scott Geibel, MHP, PhD, Population Council

G-105 Deus Bazira, DrPH, MBA, MPH, BPharm, Institute of Human Virology’s Center for International Health Education and Biosecurity, University of Maryland School of Medicine, US Academic institutional impact on global HIV pandemic response: A decade of Implementing PEPFAR programs by University of Maryland Baltimore

H-101 Richard Whitley, MD, The University of Alabama at Birmingham, US The Development of Oncolytic Herpes Simplex Viruses for the Treatment of Glioblastoma Multiforme

H-102 H. Clifford Lane, MD, National Institute of Allergy and Infectious Diseases, US The Potential Role of “Defective” Proviruses in the Pathogenesis of HIV-1 Infection

H-103 Masao Matsuoka, MD, PhD, Kumamoto University, Japan Clinical landscape of adult T-cell leukemia: its impacts on hematology, virology, and immunology

H-104 Junji Yodoi, MD, PhD, Kyoto University, Japan ATL, ADF and Human Virus Research

I-101 Paolo Lusso, MD, PhD, LIR, National Institute of Allergy and Infectious Diseases, US Quaternary Contact Improves the Potency of Broadly Neutralizing Antibodies to the CD4-Binding Site of HIV-1

20th Annual International Meeting of the Institute of Human Virology 25 Abstract Index

I-102 Thorsten Mempel, MD, PhD, Massachusetts General Hospital, Harvard University, US Viral Fitness Costs and Benefits of Disrupting the Host Cell Actin Cytoskeleton in Mucosal HIV-infection

I-103 Benjamin Chen, MD, PhD, Icahn School of Medicine at Mount Sinai, US HIV-1 cell-to-cell infection during acute infection and resistance to neutralizing antibodies

I-104 Mathias Lichterfeld, MD, PhD, Brigham and Women’s Hospital, Harvard Medical School, US Distinct Chromosomal Positions of Intact HIV-1 proviruses

I-105 Jeff Lifson, MD, AIDS and Cancer Virus Program, Frederick National Laboratory, US Nonhuman Primate Models in the Study of Early Events in AIDS Virus Infection

I-106 Savita Pahwa, MD, University of Miami Miller School of Medicine, US Early treatment initiation in children with vertical HIV infection influences HIV specific immune responses

I-107 Roy Mariuzza, PhD, University of Maryland Institute for Bioscience and Biotechnology Research, US Long-range allosteric effects induced by Tax–HLA-A2 binding to an anti-HTLV-1 TCR: Implications for early T cell signaling

J-101 Timothy Morgan, MD, Veterans Administration Long Beach Healthcare System, US Diagnosis and Treatment of HCV in the VA Healthcare System

J-102 Eleanor Wilson, MD, MHS, Institute of Human Virology, University of Maryland School of Medicine, US Approaches to Eliminate Persistent Viruses

J-103 Peter Revill, PhD, Peter Doherty Institute of Infection and Immunity, Australia The International Coalition to Eliminate Hepatitis B (ICE-HBV).

J-104 Anuj Gaggar, MD, PhD, Gilead Sciences, US Towards a Functional Cure for HBV: An Industry Perspective

J-105 Claudia Hawkins, MD, MPH, Northwestern University, US Novel antiretroviral targets for HBV elimination

J-106 Bhawna Poonia, PhD, Institute of Human Virology, University of Maryland School of Medicine, Baltimore, US Immune correlates of HBV cure

J-107 Patti Gravitt, PhD, MS, George Washington University, US Interrogating the immunologic and microbial cervical microenvironment in HPV infection

J-108 Attila Lorincz, PhD, Queen Mary University of London, UK Role of DNA Methylation in Prediction of Human Papillomavirus Persistence and Carcinogenesis

J-109 Howard Gendelman, MD, University of Nebraska Medical Center Sequential administration of LASER ART and CRISPR-Cas9 can facilitate HIV-1 elimination in humanized mice

20th Annual International Meeting of the Institute of Human Virology 26 Poster Index

PB-1 Joseph Bryant, DVM, Institute of Human Virology, University of Maryland School of Medicine 7, 8 Dihydroxyflavone reduces mitochondrial dysregulation in the HIV-1 transgenic mouse model as a treatment for HIV associated Neurocognitive disorder (HAND)

PC-1 Yin Wang, PhD, Institute of Human Virology, University of Maryland School of Medicine, Baltimore Genetic and Pharmaceutical Inactivation of Hypoxia-Inducible Factor 1α Reveals a Molecular Switch from Graft vs Host Diseases to Graft vs Leukemia Effect

PC-2 Chris Bailey, PhD, Institute of Human Virology, University of Maryland School of Medicine, Baltimore A Liposomal Formulation of HIF-1α Inhibitor Echinomycin Inhibits Growth and Metastasis of Experimental Model of Breast Cancer

PC-3 Xuexiang Du, PhD, Division of Immunotherapy, Institute of Human Virology, University of Maryland School of Medicine, Baltimore A reappraisal of CTLA-4 checkpoint blockade hypothesis in cancer immunotherapy

PC-4 Fei Tang, PhD, Institute of Human Virology, University of Maryland School of Medicine, Baltimore The identification of a novel leukocyte population IMLEC unveils a critical role of mTORC1 in innate immune tolerance

PC-5 Peng Zhang, PhD, Institute of Human Virology, University of Maryland School of Medicine, Baltimore En Masse Discovery of Human Anti-Cancer Antibodies

PC-6 Rajendra Pahwa, MD, University of Miami Miller School of Medicine Cardiac Morbidity in HIV is Associated with Checkpoint Inhibitor LAG-3

PC-7 Mingyue Liu, PhD, Division of Immunotherapy, Institute of Human Virology, University of Maryland School of Medicine Uncoupling Therapeutic from Immunotherapy-related Adverse Effects for Safer and Effective Anti-CTLA- 4 Antibodies in CTLA4 Humanized Mice

PC-8 Peter Smith, PhD, St George’s University of London Novel chemoimmunotherapy combinations for Pancreatic cancer

PC-9 Josephine Geh, MS, Institute of Human Virology, University of Maryland School of Medicine Treatment of LGL Leukemia by a novel Cytokine inhibitor

PC-10 Sally Adebamowo, MD, MSc, ScD, Department of Epidemiology and Public Health, Greenebaum Comprehensive Cancer Center, University of Maryland School of Medicine Classical HLA Alleles are Associated with Prevalent and Persistent Cervical High-Risk HPV Infection in African Women

PC-11 Yajing Wang, Institute of Human Virology, University of Maryland School of Medicine Select Targeting of Diffuse Large B-cell Lymphomas using MyD88 small molecule inhibitors

PC-12 Rossana Trotta, PhD, University of Maryland School of Medicine Bone marrow microenvironment-induced miR-300 expression impairs natural killer cell proliferation and anti-tumor activity

20th Annual International Meeting of the Institute of Human Virology 27 Poster Index

PD-1 Sally Adebamowo, MD, MSc, ScD, Department of Epidemiology and Public Health, and Greenebaum Comprehensive Cancer Center, University of Maryland School of Medicine Genetic Risk Factors for High-Risk Human Papillomavirus (HPV) Infections and Persistence among African Women

PD-2 Toshihiko Tanno, DVM, PhD, Institute of Human Virology, University of Maryland School of Medicine In vivo targeting delivery of miR-26a inhibits tumor growth and protects host from hematological toxicity of chemotherapy in breast cancer

PE-1 Clement Adebamowo, MD, ScD, Department of Epidemiology and Public Health, Greenebaum Comprehensive Cancer Center, University of Maryland School of Medicine Vaginal Microbiota Composition and Persistent High-Risk HPV Infection in HIV Negative and HIV Positive Women

PF-1 Elizabeth Schafer, MS, HPV Serology Laboratory, Leidos Biomedical Research, Inc., Frederick National Laboratory for Cancer Research sponsored by the National Cancer Institute The HPV Serology Standardization Initiative: Development of Critical Assay Reagents

PF-2 Olusegun Adeyemi, MBBS, MPH, Institute of Human Virology, University of Maryland School of Medicine Hepatitis B virus and risk factors among HIV+ and HIV- Nigerian men who have sex with men

PF-3 Mark Kaplan, MD, University of Michigan Is Nigerian Breast Cancer Associated with Endogenous Retrovirus Xq21.33?

PG-1 Jibreel Jumare, MBBS, PhD, Institute of Human Virology, University of Maryland School of Medicine Compromised Growth among HIV Exposed Compared to Unexposed Children in Nigeria

PG-2 Carole McArthur, MD, PhD, University of Missouri-Kansas City Evidence of increased HIV cases in Greater Kinshasa urban health zones: Democratic Republic of Congo (2017-2018)

PG-3 Niel Constantine, PhD, Institute of Human Virology, University of Maryland School of Medicine Assessment of internationally-available diagnostic test kits for their suitability to meet manufacturers’ claims

PG-4 Ernest Ekong, MD, MPH, Institute of Human Virology, University of Maryland School of Medicine Self-reported occupational exposure to HIV and Knowledge, Attitude to Post Exposure Prophylaxis among Health Care Workers in Federal Capital Territory, Abuja, Nigeria

PG-5 Ernest Ekong, MD, MPH, Institute of Human Virology, University of Maryland School of Medicine Assessment of Knowledge, Attitude and Practice towards Post Exposure Prophylaxis for HIV among Health Care Workers in Federal Capital Territory, Abuja, Nigeria

PG-6 Oluwasolape Olawore, ScM, Johns Hopkins Bloomberg School of Public Health What Partner Characteristics Predicts Condom Use in a Network of MSM in Nigeria?

PG-7 Andrew Mitchell, BA, Institute of Human Virology, University of Maryland School of Medicine Association between early sexual debut and risk of HIV and bacterial STIs among men who have sex with men in Nigeria

20th Annual International Meeting of the Institute of Human Virology 28 Poster Index

PG-8 Habib Omari, MD, PhD, Institute of Human Virology, University of Maryland School of Medicine Characterization of Pre exposure prophylaxis (PrEP) cascade among Nigerian MSM

PG-9 Nadia Sam-Agudu, MD, Institute of Human Virology, University of Maryland School of Medicine Predictors of Final HIV Status Outcome for HIV-Exposed Infants at 18 months of Age in 10 Nigerian States

PG-10 Nadia Sam-Agudu, MD, Institute of Human Virology, University of Maryland School of Medicine Implementation of Tuberculosis Service Integration into ANC and PMTCT Programs in Northern Nigeria

PG-11 Nadia Sam-Agudu, MD, Institute of Human Virology, University of Maryland School of Medicine Characteristics of a Nationwide Cohort of Nigerian Adolescents Living with HIV on ART

PG-12 Roman Shrestha, MPH, PhD, University of Connecticut Viral Suppression among HIV-Infected Methadone-Maintained Patients: The Role of Ongoing Injection Drug Use and Adherence to Antiretroviral Therapy (ART)

PI-1 Nanma Dashe, MCs, Department of Medical Microbiology, College of Medical Sciences, University of Jos Age-specific HPV prevalence among adolescent girls in Jos, North-Central Nigeria

PI-2 Nanma Dashe, MSc, Department of Medical Microbiology, College of Medical Sciences, University of Jos Comparison of Type-Specific HPV Detection in Urine and Vulvo-Vaginal Samples from Adeolescent Girls in Jos, Nigeria

PI-3 Krishanu Ray, PhD, Institute of Human Virology, University of Maryland School of Medicine Single molecule fluorescence approaches to probe the binding of soluble-CD4 to native-like HIV-1 SOSIP trimers

PI-4 Chiara Orlandi, PhD, Institute of Human Virology, University of Maryland School of Medicine Trogocytosis of Viral Immune Complexes in the context of HIV-1 infection

PI-5 Mercedes Ferandes, HS, MERIT Health Leadership Academy Regulating Innate Immune Signaling using Single Immunoglobulin Interleukin-1 Regulated Receptor Protein

PI-6 Roushu Zhang, PhD, University of Maryland College Park Construction and Analysis of V3 Glycopeptide Antigens for HIV-1 Vaccine Design

PJ-1 Yvonne Affram, MPhil, Dr.rer.nat, Institute of Human Virology, University of Maryland School of Medicine The HIV-1 Antisense Protein ASP is a Structural Protein of the Viral Envelope

20th Annual International Meeting of the Institute of Human Virology 29 Speaker Abstracts

A-101 A-102 The human leukemia virus - HTLV-1 - persistence and Do biological differences exist between HTLV-1A and HTLV-1C? pathogenesis Dai Fujikawa, MD, Animal Models and Retroviral Vaccine Section, National Charles Bangham, ScD, FMedSci, Imperial College London Cancer Institute, Ramona Moles, PhD, Animal Models and Retroviral Vaccine Section, National Cancer Institute, Maria Omsland, PhD, Animal The human leukemia virus HTLV-1 persists lifelong in infected people. Models and Retroviral Vaccine Section, National Cancer Institute, Damian Although the virus elicits a strong chronically activated T cell immune Purcell, PhD, Department of Microbiology and Immunology, University of response to the major viral proteins Gag, Pol, Env and Tax, the genes Melbourne, Veronica Galli, PhD, Animal Models and Retroviral Vaccine encoding these proteins are usually silent in circulating lymphocytes. In Section, National Cancer Institute, Genoveffa Franchini, MD, Animal contrast, there is a weak T cell response to the viral protein HBZ, which Models and Retroviral Vaccine Section, National Cancer Institute appears to be persistently expressed at a low level. There is recent evidence that the plus strand of the HTLV-1 provirus, which encodes HTLV-1A, the most common HTLV-1 subtype, and HTLV-1C, the most the immunodominant T cell antigens, is expressed in intermittent bursts, divergent type, differ substantially. The apparent differences in susceptibility whereas the minus strand (encoding hbzis almost constantly expressed, in to infection and disease manifestation suggest that the two viral subtypes all cells, at a low level. We are now investigating how HTLV-1 regulates this may affect their host’s immune system differently. HTLV-1A and C have selective expression of the proviral plus- and minus-strands. I shall present similar genetic organization: the structural Gag and Envelope proteins, evidence from single molecule RNA-FISH, chromosome conformation viral enzymes, Reverse Transcriptase, Integrase and Protease, and the capture, small-molecule inhibitors, and transcription analysis (RNA-Seq; transcriptional and post-transcriptional regulators Tax and Rex proteins are qRT-PCR) that specific epigenetic and metabolic factors regulate this highly conserved between the two viral subtypes. Strikingly, however, the strand-specific proviral expression. The results offer an explanation of RNA sequence of orf-I and orf-II, encoding the p12, p8, and p30 proteins, long-standing paradoxes and unexplained observations in the biology of are highly divergent in HTLV-1C. The proteins encoded by HTLV-1A orf-I and this pathogenic retrovirus. orf-II are essential for HTLV-1A to persist in the host and escape immune recognition. The p8/p12 proteins target MHC-I and ICAM-1 expression and inibit the killing of infected cells by Cytotoxic T cells, Natural Killer cells. The p30 protein, via the PU.1 transcription machinery, inhibits interferon responses in monocytes. It is thus conceivable that the expression of these proteins in T cells in individuals with a high number of infected cells may affect the overall host response to pathogens. We therefore focused on orf-I to investigate potential biological differences between HTLV-1A and C. In HTLV-1C, we found that a putative doubly-spliced mRNA produces a 16KD protein (p16) by juxtaposing the first exon of Rex in frame with orf-I. We found that p16 inhibits inflammasome activation and cytokine production, an essential step in monocytes to respond to pathogens.We constructed chimeric HTLV-1A/C viruses whereby either the entire 3’ end or the Orf-I of HTLV-1C was swapped into the HTLV-1A backbone. The overall aim of our studies is to investigate the effect of the orf-I proteins of both viral subtypes on immune cells in vitro and in vivo using isogenic HTLV-1A/C chimeric viruses orf-I mutants.

20th Annual International Meeting of the Institute of Human Virology 30 Speaker Abstracts

A-103 T lymphotropic virus type 4 strains in hunters bitten by gorillas in Central Epidemiology and Origin of HTLV-1 and Related Viruses Infection Africa. Clin. Infect Dis,2016 Sep 15;63(6):800-3.

Antoine Gessain, MD, PhD, Institut Pasteur

HTLV-1, which is the etiological agent of Adult T cell Leukemia/lymphoma and of Tropical Spastic Paraparesis/HTLV-1 Associated Myelopathy, is not a ubiquitous virus. Indeed, this retrovirus, whose origin is the STLV- 1, endemic in many species of Old-World non human primates (NHPs), is present throughout the world with clusters of high endemicity located often nearby areas where the virus is nearly absent. The main endemic areas are the Southwestern part of Japan, Sub-Saharan Africa and South America, the Caribbean area and foci in the Middle East and Australo-Melanesia. The origin of this puzzling geographical or sometimes rather ethnic repartition is probably linked to a founder effect in some groups with the persistence of a high viral transmission rate. Despite different socio-economic and cultural environment, the HTLV-1 prevalence increases gradually with age, especially among women in nearly all highly endemic areas. The number of HTLV-1 infected carriers in the world is estimated to be at least 5-10 millions individuals (a). This is very probably underestimated. In most of the high endemic areas, HTLV-1 is mainly disseminated and maintained in the human population through intra-familial transmission (mother-to-child and by sexual intercourses). More rarely, transmission may also occur by transfusion or intra-venous drug use. In Central Africa, the relative contribution of each of the different transmission routes for HTLV-1/STLV-1 (inter-humans vs inter-species/NHP-Humans) still remains largely unexplored. We have thus performed epidemiological studies in order to get better knowledge on the possible still ongoing STLV-1 retroviral transmission from NHPs to human in a natural setting. These studies were done in populations of high- risk individuals living in villages or settlements in the rain-forest of South Cameroon and Gabon. Bantu and Pygmy groups, who still actively hunt diverse NHP species, inhabit this region. These hunters are thus frequently exposed to the body fluids of these NHPs. Furthermore, many of the NHPs species living in these areas are infected with simian retroviruses, including various STLV-1 strains as well as STLV-3 and STLV-4 strains, and simian foamy viruses. State of the art serologies and different specific and generic PCR studies were performed to detect and characterize the different HTLV infecting these individuals.

The main findings were the following: 1) A severe bite by an ape (gorilla ++) or a monkey is a major risk factor for HTLV-1 infection in hunters, of South Cameroon (b) and Gabon (c, d). 2) HTLV-3, a new human retrovirus discovered in 2005 by our team, is present in hunters of NHPs from these areas (Richard et al., in preparation). 3) HTLV-4 infections (the second and third discovered strains) of zoonotic origin were characterized in two hunters living in Gabon, severely bitten by a gorilla during hunting activities (e).

Interspecies transmission, from apes and monkeys to humans, of different STLV and simian foamy viruses are still ongoing in Central Africa. These studies reinforce the fact that apes, especially gorilla, should be considered as keystone reservoirs for human/disease infections (HIV-1P group, HTLV- 1b, origin of P. falciparum…). a) Gessain A, Cassar O. Epidemiological Aspects and World Distribution of HTLV-1 Infection. Front Microbiol. 2012, Nov 15; 3 :388. b) Filippone C, et al., and Gessain A. A Severe Bite From a Nonhuman Primate Is a Major Risk Factor for HTLV-1 Infection in Hunters From Central Africa. Clin Infect Dis. 2015 Jun 1;60(11):1667-76. c) Kazanji M, et al., and Gessain A. Origin of HTLV-1 in hunters of nonhuman primates in Central Africa. J. Infect Dis. 2015 Feb 1;211(3):361-5. d) Doren-Djuicy D, et al. submitted 2018. e) Richard L, et al, and Gessain A. Zoonotic transmission of two Human 20th Annual International Meeting of the Institute of Human Virology 31 Speaker Abstracts

A-104 cytoplasmic or nuclear localization in the two diseased states, respectively. TRACING THE INTRACELLULAR JOURNEY OF HTLV-1 HBZ Moreover, they show a rather selective expression in distinct cells of either DURING INFECTION: FROM ASYMPTOMATIC CARRIERS TO HBZ or Tax-1. The unprecedented observation that in AC, HBZ is expressed HAM/TSP ENDING TO ATL: A ONE-WAY TICKET? only in the cytoplasm strongly suggests a progressive modification of HBZ localization during the disease states associated to HTLV-1infection. Future Marco Baratella, MD, PhD, University of Insubria, Greta Forlani, PhD, studies will clarify whether the distinct HBZ intracellular localization is University of Insubria, Antoine Gessain, MD, Institut Pasteur, Steve simply a marker or a causative event of disease evolution. Jacobson, PhD, NINDS, NIH, Roberto Accolla, MD, PhD, University of Insubria

HTLV-1 is the etiological agent of Adult T cell Leukemia (ATL) and of HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP) neurologic disorder. Although substantial progress has been made in understanding some cellular and molecular mechanisms underlying the pathology of the neoplastic and neurological diseases, still the intimate reason why some HTLV-1 infected patients develop HAM/TSP and others progress toward the neoplastic state are largely elusive. Two viral proteins, Tax-1 and HBZ, play an important role in both diseases. For example, Tax- 1, the crucial transactivator needed for viral replication, has been implicated in the initiation but not in the maintenance of neoplastic process since leukemic cells may not express it. On the other hand, HBZ seems to be expressed throughout the infection and, importantly, is always expressed in leukemic cells. Nevertheless, the precise mechanism through which HBZ participates to initiation and/or maintenance of leukemic state is still unclear, as it is unclear the association of HBZ expression with initiation and/or maintenance of the inflammatory syndrome leading to HAM/TSP. Studies of this aspect have been partially prevented by the lack of suitable reagents to detect endogenous HBZ protein during the various phases of HTLV-1 infection and disease development. The recent isolation of a specific monoclonal antibody against HBZ, the 4D4-F3 mAb, by our group has allowed to precisely quantify and determine the subcellular distribution of the viral protein. We have demonstrated that HBZ, previously considered an exclusive nuclear protein, is mainly localized in the cytoplasm of PBMCs from HAM/TSP patients. Here, the analysis of a larger panel of patients has added new relevant informations on this point.

PBMC from 13 HTLV-1 infected asymptomatic carriers(AC), 14 HAM/ TSP and 4 ATL patients were analysed. Expression and subcellular distribution of endogenous HBZ and Tax-1 proteins were assessed by confocal microscopy with the 4D4-F3 and A51-2 mAbs, respectively. HBZ expression was confined to the cytoplasm of PBMC of HAM/TSP patients, appearing as discrete dots. The percentage of HBZ-positive cells ranged between 1 to 10% of total PBMC with the exception of one negative patient. Tax-1 was expressed in all HAM/TSP cases analyzed, ranging from 2 to 15% of total PBMC. Tax-1 was preferentially localized in the cytoplasm with fewer speckle-like dots in the nucleus. Interestingly, only in 1 case co-expression of HBZ and Tax-1 was observed in the same cells. In this unique case, however, although 8% and 15% of the cells were positive for HBZ and Tax-1, respectively, only 1% of cells co-expressed the two viral proteins. Of particular interest was the finding that PBMC of 6 out of 13 AC expressed HBZ (1 to 4% of the cells) and again with an exclusive cytoplasmic localization. Tax-1 was expressed in 10 out of 13 cases (1 to 11% of the cells). Only in two AC, HBZ and Tax-1 were found to be co- expressed in a very limited proportion of cells. The study of 4 distinct cases of ATL demonstrated, instead, that HBZ protein was expressed in the vast majority of the leukemic cells and importantly with an exclusive nuclear localization. Interestingly, none of these ATL cases were found to express Tax-1 protein.

These results extend our previous observation on the dichotomy of HBZ localization between HAM/TSP and ATL, pointing to the exclusive either 20th Annual International Meeting of the Institute of Human Virology 32 Speaker Abstracts

A-105 A-106 ROLE OF FIBROBLASTS IN HTLV-1-MEDIATED Strategy and pathogenesis of human T-cell leukemia virus type 1 LYMPHOMAGENESIS Masao Matsuoka, MD, PhD, Kumamoto University Luigi Chieco-Bianchi, MD, University of Padova/Dept of Surgery, Oncology and Gastroenterology, Mattia Vicario, PhD, Veneto Institute of Oncology Human T-cell leukemia virus type 1 (HTLV-1) causes not only adult T-cell IOV - IRCCS, Adriana Mattiolo, BScD, Veneto Institute of Oncology IOV - leukemia-lymphoma (ATL) but also inflammatory diseases. The most IRCCS, Barbara Montini, PhD, Veneto Institute of Oncology IOV - IRCCS, important characteristic of HTLV-1 is that this virus can transmit only Maria Assunta Piano, PhD, Veneto Institute of Oncology IOV - IRCCS, through cell-to-cell contact. Therefore, HTLV-1 increases the number of Maria Luisa Calabrò, BScD, Veneto Institute of Oncology IOV - IRCCS infected cells to facilitate its transmission through breast feeding and sexual intercourse. HTLV-1 promotes proliferation of infected cells, inhibits their Only a low percentage (2-5%) of HTLV-1-infected people develop ATLL apoptosis and facilitates escape from the host immune surveillance. The after a very prolonged latency (2-6 decades). Besides Tax and HBZ viral pathogenesis of these diseases is based on these characteristics of this products, responsible for immortalization of CD4+ T lymphocytes, and virus. Infected cells evade the host immune responses to survive in vivo. genetic and epigenetic cell abnormalities, host factors most likely contribute to the induction of the overt clinical disease. On the basis of previous in Early studies of HTLV-1 focused on Tax that is the trans-activator of vitro studies done by other groups, we conducted in vivo experiments viral gene transcription. Tax can immortalize T cellsin vitroand in vivo. to investigate the role of fibroblasts, one of the major components of Tax activates NFkB pathway, and functionally inhibits p53 function. It is microenvironment, in HTLV-1-induced tumorigenesis. Primary human assumed that Tax is the viral oncogene that causes ATL. However, analyses foreskin fibroblasts (HFF) xenotransplanted together with in vitro HTLV-1- of HTLV-1 proviruses in clinical samples revealed that Tax expression is immortalized C91/PL cells into immunodeficient Balb/c Rag2-/-ɣc-/- mice frequently inactivated in ATL cells by three mechanisms: genetic changes were found to significantly trigger the oncogenic potential of C91/PL cells. of the taxgene (mainly non-sense mutation), deletion of 5’ long terminal Cell lines established from lymphomatous masses and subsequent in repeat (LTR), the promoter/enhancer of the taxgene, and DNA methylation vitro/in vivo passages acquired the stable property to induce aggressive of 5’LTR. On the other hand, 3’ provirus is maintained in all ATL cases and T-cell lymphoma without the need of HFF support.Tumorigenic cell lines, HTLV-1 carriers. This region contains HTLV-1 bZIP factor (HBZ) coding among which C91/III cells, derived from C91/PL cells, showed no significant region. HBZ gene is encoded in the minus strand of the provirus. These variation in the expression of the HTLV-1 gag, env and tax/rex mRNAs finding suggest that HBZ is critical for ATL cells and HTLV-1 infected cells. compared to C91/PL cells; in contrast, all the viral transcripts coding for the To study the function of HBZZ, we generated HBZ-transgenic mice that accessory proteins revealed a significant increase in C91/III cells. Moreover, express HBZ in CD4+ T cells. HBZ-Tg mice developed T-cell lymphoma these cells released higher amounts of several factors, suggesting the and inflammatory diseases, suggesting that HBZ is critical for HTLV-1 amplification of soluble autocrine and paracrine signals. HFF-co-cultured associated diseases. Thereafter, we focus on function of HBZ in biology C91/PL cells acquired several characteristics of C91/III cells, including a and pathology of HTLV-1. more aggressive in vivo behavior. Conversely, viral transcription profile of co-cultured cells was not significantly different from that of C91/PL cells, This strategy is supported by several attributes of this virus. First, HTLV-1 indicating that changes in viral gene expression observed in C91/III cells infected T cells possess the specific immunophenotype; CD4, CD45RO, were likely not responsible for the higher lymphomagenic capacity of the CCR4, CADM1, TIGIT, Foxp3 (approximately 50%) positive T cells. C91/PL-derived cell lines. These findings suggest that the crosstalk with Effector/memory (CD45RO) T cells express higher level of LFA-1, which fibroblasts may boost the tumorigenic properties of HTLV-1-immortalized likely migrate into breast milk and semen. Furthermore, TIGIT suppresses T-cells through activation of autocrine and paracrine pro-lymphomagenic, the host immune responses, which facilitates infected cells to escape stimulatory loops. These results provide new insight into ATLL pathogenic from immune surveillance. HBZ also induces expression of Foxp3. Foxp3 mechanisms and new potential targets for ATLL prevention. induces expression of regulatory T (Treg) cell associated molecules. On the other hand, labile Foxp3 expression is associated with inflammation by increased interferon-gproduction. Thus, HTLV-1 bZIP factor (HBZ) is mainly implicated in immunnophenotype of HTLV-1 infected cells and ATL cells. Second, HTLV-1 infected cells need persistent proliferation and survival in vivo. Both HBZ and tax are implicated in proliferation and survival. Third, HTLV-1 infected cells and ATL cells need to minimize expression of immunogenic viral proteins. Tax is a highly immunogenic protein, and a major target of cytotoxic T-lymphocytes (CTLs) in vivo. On the other hand, immunogenicity of HBZ is quite low. Therefore, HTLV-1 infected cells and ATL cells continuously express HBZ. In contrast, Tax is transiently expressed (Mahgoub et al., PNAS 2018). The intermittent expression of Tax plays an important role to maintain ATL cells, and possibly HTLV-1 infected cells.

Pathogenesis of HTLV-1 is based on these characteristics of this virus; infiltration, inflammation, persistent proliferation, and anti-apoptosis. Thus, pro-inflammatory infected cells cause inflammatory diseases, and lead to development of leukemia. In this meeting, I am going to show the roles of HBZ and Tax in the pathogenesis, discuss about complex relation between virus and diseases.

20th Annual International Meeting of the Institute of Human Virology 33 Speaker Abstracts

A-107 A-108 A general description of the HTLV-1 Cohort at the Institute of HTLV-1/BLV genomic approaches to understanding ATL Tropical Medicine Alexander von Humboldt (1989-2015) Anne Van den Broeke, DVM, PhD, Institut Jules Bordet, ULB, Brussels, Eduardo Gotuzzo, MD, Elsa González, Fernando Mejía, Yessica Ramos, Belgium & Unit of Animal Genomics, GIGA, University of Liège, Liège, Carolina Alvarez, Kristien Verdonck, Instituto de Medicina Tropical Belgium Alexander von Humboldt, Universidad Peruana Cayetano Heredia, Lima, Perú; Department of Infectious, Tropical and Dermatological Diseases, Human T-cell Leukemia Virus (HTLV-1) was the first infectious agent Hospital Cayetano Heredia, Lima, Perú discovered to be the direct cause of cancer and is the most carcinogenic of all oncoviruses. The retrovirus causes Adult T-cell leukemia (ATL) an In Peru, the Institute of Tropical Medicine Alexander von Humboldt, in aggressive CD4+ T-cell malignancy which has a median survival of 8-10 partnership with Hospital Cayetano Heredia, promotes specialized care months for the acute sub-types, despite all advances in therapy. HTLV- for persons with HTLV-1 infection since 1989. Briefly, we offer pre and 1 remains a strong threat to individual and community health in endemic post-test counseling, diagnostic services, and medical attention. People regions, and even more so to global health because of the accelerated rate are eligible for diagnostic services if they have: a prior seropositive result of human migration in recent times. Bovine Leukemia Virus (BLV), a close in Blood Banks; a first-degree relative or sexual partner with HTLV-1 relative of HTLV-1, induces a similar disease affecting the B-cell lineage in infection; a potential diagnosis of HTLV-1-associated diseases (mainly: cattle. Both viruses produce a chronic infection in their respective host that HTLV-1-associated myelopathy (HAM/TSP), Strongyloides stercoralis (SS) evolves into full-blown leukemia/lymphoma in ~5% of infected individuals infection, T-cell leukemia/lymphoma, uveitis, infective dermatitis). Given the after several decades of latency. While not a natural host, it is possible limited capacity to continuously afford confirmatory testing, HTLV infection to infect sheep with BLV. In contrast to cattle, all infected sheep develop is also diagnosed with repeatedly reactive ELISA tests. Cases receive tumors at an accelerated rate (~24 months), providing a unique model for post-test counseling, and specialized medical services. This setting has studying early asymptomatic stages. Historically, research into both viruses promoted our HTLV-1 Cohort; for those consenting, enrollment is at time has primarily focused on virus-encoded transcripts/proteins, especially Tax of HTLV-1 testing. and HBZ. However, increasing evidence from genomic studies suggests that both the proviral integration site and somatic alterations within the host Until June 2015, 8845 persons were enrolled in the cohort; the median age genome play a critical role in oncogenesis, as only a subset of infected was 38.8 years (interquartile range: 26.5-52.3), 5042 (57.5%) were women individuals, following a long period of asymptomatic infection, develop a and 4337 (49.0%) did not report being related to someone with HTLV-1 tumor. infection and were thus defined as index cases. The leading reasons for HTLV testing were family studies (3987, 45.1%), followed by potential Using genomic approaches, we demonstrated that HTLV-1 and BLV diagnosis of HTLV-1 associated diseases (3365, 38.0%), and seropositive integrate in the vicinity of host cancer driver genes, which they perturb results in Blood Banks (718, 8.5%). either by provirus-dependent transcription termination or as a result of viral antisense RNA-dependent cis-perturbation via virus-host chimeric HTLV infection was diagnosed in 3359 persons (48.0%), including1202 transcripts. This was revealed by applying novel NGS-based methods to (13.6%) with available confirmatory testing. Most (58.3%) were women; primary tumors, enabling (i) genome-wide mapping of proviral integration the median age was 43 years (IQR: 31.0-55.6), but 285 were children. The sites and (ii) targeted capture RNA-seq with increased sensitivity. To proportion of HTLV diagnosis varied by reason for testing: 79.0% for those address the role of proviral integration and insertional mutagenesis at early with potential HAM/TPS, 69.8% for potential ATL, 31.0% in cases with stages, we set up a retrospective longitudinal study of infected individuals SS; 79.0% in donors and 34.0% when testing was done as part of family who developed aggressive leukemia, tracking back their evolution during studies. At entry, the cases with HTLV infection included potential HAM/TSP asymptomatic stages in the BLV animal model. NGS clonality at polyclonal (621, 18.5%); other complications mostly of infectious nature (338, 10.1%); time points revealed hotspots of proviral integration and allowed us to SS infection (238, 7.0%), and ATL (5.6%). monitor clonal architecture over time, providing novel insights into tumor evolution. Most cases (1426, 43.0%) were lost to follow-up in the first year after diagnosis; in those remaining, with 8227 person-years of follow-up up to The novel NGS clonality approach includes several critical modifications, December 31st, 2016, there were 88 incident cases of HAM/TSP, 47 of SS, overcoming some of the limitations of previously published protocols mainly and 8 of ATL. In those not lost-to-follow-up, 113 out of 1933 (5.6%) died. in terms of sensitivity, cost and hands-on time, providing a new molecular tool for monitoring patients in a clinical setting. In a longitudinal study of ATL Our cohort offers a valuable platform to increase the quality of evidence patients, we found that the optimized NGS mapping approach outperformed regarding clinical consequences of HTLV-1 infection; at the same time, the any other currently available method, enabling a better estimate of number of pediatric cases remark the imperative need to implement sound molecular response in leukemia patients, the detection of refractoriness actions for prevention of transmission of HTLV-1 from mother-to-child. to first-line therapy and a better prediction of relapse. Overall, we provide a proof-of-concept for the integration of a quantitative molecular HTLV-1- clonality signature into response assessment criteria for the monitoring of ATL patients and the follow-up of clinical trials that remain critical in the future.

20th Annual International Meeting of the Institute of Human Virology 34 Speaker Abstracts

A-109 pharmacodynamics of the PEGylated form of the BNZ-1 peptide (BNZ-1/ A novel multi-cytokine inhibitory strategy in treating HTLV-1 PEG) in animal models (mouse and non-human primate) and in healthy diseases human volunteers (Phase I study) and observed that it blocks IL-2 and IL-15 activity effectively in humans, and that a weekly or biweekly administration Yutaka Tagaya, MD, PhD, Institute of Human Virology, University of maintains the drug level above the minimum effective dose. BNZ-1/PEG Maryland School of Medicine has been approved as an IND for treating HAM/TSP and T-cell malignancies (CD8 type LGL-leuekmia / cutaneous T-cell Lymphoma (CTCL)). Currently Human T-cell leukemia virus-I (HTLV-1) is the most oncogenic human virus we are conducting a phase II clinical trial involving LGL-leukemia/CTCL and arguably the most carcinogenic agent to humans (Gallo, Willems and (see a poster presented by J Geh et al.) and are aiming at starting a trial Tagaya, 2017, Martin et al. 2018). Nevertheless, HTLV-1 is not receiving the involving HAM/TSP in the near future. deserving attention. We have been advocating for HTLV-1 to enhance the visibility of its research and to make the public aware of its biological and social importance for the past few years as a part of HTLV-1 task force of B-101 Global Virus Network (GVN), and we believe we are seeing some promising Placental exosomes in maternal-placental-fetal communication changes. and viral resistance

Despite nearly 40 years of extensive research on the mechanisms by Yingshi Ouyang, MD, Magee-Womens Research Institute and Department which HTLV-1 causes multiple human diseases including adult T-cell of OBGYN and Reproductive Sciences, University of Pittsburgh, Hui Li, leukemia (ATL), HAM/TSP (HTLV-1 associate myelopathy/Tropical Spastic BS, Magee-Womens Research Institute, Department of OBGYN and Paraparesis), and immunosuppressive condition leading to bacterial Reproductive Sciences, University of Pittsburgh, and Xiangya School of infections, no reliable cures are available for these diseases. HTLV-1 Medicine, South Central University, Kamil Krawczynski, PhD, Magee- infection to CD4 T-cells enhances the production of multiple cytokines Womens Research Institute and Department of OBGYN and Reproductive by CD4 T-cells through the transactivating nature of virus genes such as Sciences, University of Pittsburgh, Jean-Francois Mouillet, PhD, Magee- Tax. This causes a by-stander activation of CD8 T-cells and turn them into Womens Research Institute and Department of OBGYN and Reproductive inflammatory cells, which contributes to worsening the disease burden in Sciences, University of Pittsburgh, Carolyn Coyne, PhD, Department HTLV-1 diseases. For example, the damages to spinal cord cells in HAM/ of Microbiology and Molecular Genetics and Department of Pediatrics, TSP is caused by the inflammatory CD8 T-cells. We have shown that such University of Pittsburgh, Alexander Sorkin, PhD, Department of Cell activation of CD8 T-cells is mainly caused by the cooperation of IL-2 and IL- Biology, University of Pittsburgh, Yoel Sadovsky, MD, Magee-Womens 15, two sibling cytokines belonging to the common gamma (γc)-family (Nata Research Institute, Department of OBGYN and Reproductive Sciences, et al. 2015, Massoud et al. 2015) and that only the co-inhibition of these two and Department of Microbiology and Molecular Genetics, University of cytokines, but not the inhibition of either of them, effectively suppresses the Pittsburgh activation of CD8 T-cells isolated from HAM/TSP patients in an ex vivo assay system. The co-inhibition of two cytokines is a clinical challenge because The placenta plays a critical role in regulating maternal-fetal gas exchange, currently available modalities do not allow to accomplish the goal without supply of nutrients to the fetus and removal of waste, production of adverse effects. For example, monoclonal antibodies need to be combined, hormones, and immunological defense, including resistance to diverse but is infeasible in the clinic from the viewpoint of cost. Bispecific antibodies pathogens. While many of these functions are controlled by hormones, do not exist to co-inhibit these two cytokines. Signal inhibitors such as Jak growth factors and other signaling molecules, the recent discovery of kinase inhibitors will have profound side effects by broadly blocking non-γc placental small RNAs and their release to the plasma within extracellular cytokines such as Erythropoietin and Thrombopoietin and causing severe vesicles provides a new dimension to our investigation into paracrine and anemia and bleeding tendency. Even specific JAk3 inhibitors, if available, distant signaling networks that constitute maternal-fetal crosstalk. In this will cause immunodeficiency by blocking IL-7 and significantly reducing context, we found that primary human trophoblasts are resistant to infection the number of T-cells when used chronically. We thus developed a novel by diverse types of DNA and RNA viruses, and that this resistance can technology to develop inhibitors which block only desired members of the be partly conferred to non-trophoblastic cells by transferring placenta- and γc-family cytokines. We noted that all γc-tyokines (e.g., IL-2, -4, -7, -9-, 15, primate-specific miRNAs, expressed from the chromosome 19 miRNA and -21) use their D-helices to interact with the shared γc-receptor subunit. cluster (C19MC). Furthermore, we found that all trophoblastic EVs contain Accordingly, we found that the D-helices from 6 γc-cytokine show modest C19MC miRNAs, and that trophoblastic exosomes execute an antiviral conservation in their primary structure. We postulated that a short peptide effect when applied to non-placental cells. To pursue the patterns of miRNA mimicking these D-helices might inhibit multiple γc-cytokines by competing transport in vivo among the maternal, placental and fetal compartments, with them in the binding to the γc, and that leveraging the conserved and we created a humanized mouse model that stably expresses the human non-conserved positions in this region across all γc-cytokines might allow C19MC miRNA cluster. We detected the trafficking of placental miRNAs us to synthesize a specific inhibitor to a given choice of γc-cytokines. We among the maternal and fetal compartments. Our current work centers on in fact successfully synthesized several peptides showing inhibition to the mechanisms of uptake of trophoblastic exosomes by non-trophoblastic only selected γc-cytokines, but not all γc-cytokines with different target cells, and the proteins that are essential for that process. Together, our spectrums. Among them is the BNZ-1 peptide which blocks IL-2, IL-15 and findings establish previously unrecognized mechanisms of exosome-based IL-9. In an ex vivo assay using T-cells derived from HAM/TSP patients, BNZ- maternal-fetal crosstalk. These pathways have functional implications for 1 effectively blocked the proliferation and activation of HAM/TSP T-cells defense against viral pathogens and possibly have other homeostatic whereas mAb for IL-2 or IL-15 only showed marginal inhibition, suggesting functions during pregnancy. that this compound represents a novel therapeutic candidate for HAM/TSP. It is likely that BNZ-1 could treat chronic ATL as well since chronic ATL has been shown to pathogenically involve IL-2 and IL-15 produced by HTLV- 1 infected CD4 T-cells. We have tested the safety, pharmacokinetics and 20th Annual International Meeting of the Institute of Human Virology 35 Speaker Abstracts

B-102 since many cytokines in vitro, ex vivo, and in vivo are released in EV- Exosomal protein signatures: mechanistic insights and biomarker associated forms. EVs carry cytokines both on their surface and in potential encapsulated forms; the latter are not detectable by standard cytokine assays. Cytokines associated with EVs may target vesicles to particular Ayuko Hoshino, PhD, Weill Cornell Medicine, David Lyden, MD, PhD, cells and upon contact with them are capable of eliciting biological effects. Weill Cornell Medicine Association of cytokines with EVs is not a property of a particular cytokine but rather of a biological system and is changed upon system activation. In 1889, Stephen Paget first proposed that organ distribution of metastases Moreover, the pattern of such association is altered in different pathologies. is a non-random event, yet metastatic organotropism remains one of Deciphering the regulatory mechanisms of EV-cytokine association in the greatest mysteries in cancer biology. A growing number of studies health and disease may lead to new therapeutic strategies. demonstrate that tumor-derived microvesicles, referred to as exosomes, may alter the tumor microenvironment at future sites of metastasis B-104 promoting pre-metastatic niche formation, and thus creating a favorable Presence of HIV-1 RNA in Extracellular Vesicles from HIV-1 cART- “soil” for incoming metastatic “seeds”. However, by what mechanism, and treated Cells whether their role is significant in tumor progression remains unknown. We have recently demonstrated that exosomes released by lung-, liver- and Fatah Kashanchi, PhD, George Mason University, Catherine Demarino, brain-tropic tumor cells preferentially fuse with resident cells at their future PhD student, George Mason University, Michelle Pleet, PhD student, metastatic sites, such as fibroblasts and epithelial cells in the lung, Kupffer George Mason University, Robert Barclay, PhD student, George Mason cells in the liver, and endothelial cells in the brain. We found that tumor- University, Walter Royal, PhD, Department of Neurology, University of derived exosome homing to organ-specific cell types prepares the pre- Maryland School of Medicine, Nicole Noren Hooten, PhD, Laboratory of metastatic niche. Moreover, treatment with exosomes derived from lung- Epidemiology and Population Science, National Institute on Aging, National tropic models can redirect to the lung the metastatic distribution of cells Institutes of Health that normally lack the capacity to form lung metastasis. Proteomic profiling of exosomes revealed distinct integrin expression patterns associated with HIV-1 is a complex retrovirus that produces chronic infection affecting each organ-specific metastatic site. Whereas exosomal α6β4 integrins approximately 40 million people worldwide and 1.1 million new infections were associated with lung metastasis, exosomal integrin αvβ5 was linked each year. to liver metastasis and αvβ3 to brain metastasis. Targeting α6β4 and αvβ5 integrins decreased exosome uptake and metastasis in the lung and liver, We have previously shown that during infection, EVs contain a non-coding respectively. Moreover, our clinical data indicate that integrin expression HIV-1 RNA, which has been shown to elicit responses in recipient cells profiles in circulating plasma exosomes from cancer patients could be (1-3). used to predict organ-specific metastasis. To gain a more comprehensive understanding of the relationship between exosomal protein cargo and First, we investigated the effect of exosomes derived from uninfected cells tumor progression, we have built one of the largest exosome proteomics on latent HIV-1–infected cells and found that there is an abundant level of databases, including human and murine normal, pre-cancer and cancer short noncoding RNA in infected cells, arguing that a true “transcriptional exosomes from a variety sources, from cell lines to plasma and other latency” may not exist in vivo since cells are constantly in contact with bodily fluids. Out of 490 human samples, 206 were isolated from normal exosomes from uninfected cells. subjects and 284 were from cancer patients. This dataset has allowed us to extend the list of markers that can be used to identify and isolate exosomes A possible mechanism for this finding revealed that the exosomes cause from human samples. When comparing the protein cargo of blood plasma an increase in RNA Polymerase II loading onto the DNA within the infected exosomes isolated from normal subjects versus cancer patients with early cells; this was possibly driven by the presence of specific kinases in the stage pancreatic, colorectal, breast and lung cancer, we were able to define exosomes, some of which were unique to T-cell-derived and myeloid- a cancer-specific proteomic signature that distinguishes cancer exosomes. derived exosomes. Subsequently transcribed viral transcripts, which Using paired samples from tumor tissue and plasma of the same cancer include TAR and a novel RNA termed “TAR-gag”, can then be packaged patients with breast, lung or pancreatic cancer, we were able to derive into exosomes and potentially be exported to neighboring uninfected cells. cancer type-specific exosomal signatures, which can be used as biomarkers TAR-gag is a long, noncoding RNA that is 615 bases long, contains the to identify and classify tumors of unknown origin. Therefore, proteomic TAR element, and terminates within the p17 region of HIV-1 gag (1). In profiling of exosomes has great clinical potential as a non-invasive, rapid the presence of transcription inhibitors F07#13 (a Tat peptide mimetic) and liquid biopsy that could aid in tumor detection classification. CR8#13 (an ATP-binding analog of Cdk9), TAR-gag is capable of binding to SWI/SNF components in the nucleus, including the mSin3A/HDAC- B-103 1 complex, and serves as a scaffolding RNA. Additionally, TAR-gag can NOT ALL SOLUBLE CYTOKINES ARE SOLUBLE: CYTOKINES recruit suppressive factors and RNA-binding proteins to the HIV-1 promoter, IN EXTRACELLULR VESICLES MEDIATE CELL-CELL resulting in transcriptional gene silencing (TGS) (2). COMMUNICATIONS In our most recent data, we found altered levels of genomic RNA within EVs Leonid Margolis, PhD, National Institute of Child Health and Human while other RNAs, such as TAR RNA, remained unaffected by the addition Development, National Institutes of Health of cART treatment in both cell lines, primary macrophages, and patient biofluids. Furthermore, we determined possible mechanisms involved To maintain complex multicellular systems, cells need to communicate in the selective packaging of HIV-1 RNA products into EVs specifically, with each other. At least two systems of such communication are known: an increase in EV-associated RNA-binding protein hnRNPA2/B1, and a Cytokines, classical soluble factors, and recently discovered extracellular “reader” for methylated RNA. vesicles (EVs). We found that these two systems are not strictly separated 20th Annual International Meeting of the Institute of Human Virology 36 Speaker Abstracts

B-105 C-103 Extracellular vesicles as advance forces in cancer Multimodal Approach to Cancer Immunotherapy

Xandra Breakefield, PhD, Departments of Neurology and Radiology, Jeff Schlom, PhD, Laboratory of Tumor Immunology and Biology, Center Massachusetts General Hospital and Program in Neuroscience, Harvard for Cancer Research, National Cancer Institute, NIH Medical School, Boston, MA The use of checkpoint inhibitor monoclonal antibodies (MAbs) has Extracellular vesicles (EVs) provide a unique mode of communication transformed the landscape of cancer immunotherapy. Consequently, human between cells during development, normal physiology and disease. They tumors can be characterized as either “hot” or “cold.” Hot tumors are defined can transfer non-secreted molecules, including cytoplasmic and nuclear by the presence of tumor infiltrating T-cell lymphocytes (TILs); melanoma proteins, as well as RNA and DNA. This capacity has the potential to expand is the prototype of a hot tumor. Studies have shown that the presence of informational transfer to a previously unimagined level of control. Here we TILs results in tumor cells expressing molecules, termed “checkpoints,” with focus on the action of EVs released by glioblastoma cells on normal cells the ability to anergize T cells. The clinical use of these checkpoint inhibitor in the brain which receive a continuous barrage of these infiltrators. EV MAbs has resulted in durable anti-tumor responses in approximately 50% cargo released by cancer cells is delivered by endocytosis or fusion with of patients with melanoma and in 10-15% of patients with some solid tumors the plasma membrane. We have documented functional transfer of miRNA such as lung cancer. The vast majority of solid tumors, i.e., carcinomas of from glioblastoma cells to microglia, macrophages and astrocytes in their the breast, prostate, colon, and lung, as well as others, however, can be vicinity. In addition, we have found dramatic changes in the transcriptome characterized as cold in that they do not respond to checkpoint inhibitor of these target cells in vivo which serve to change their phenotypes such therapy. Preclinical studies and ongoing clinical studies are now revealing that they support tumor growth and invasion, act to suppress the immune that a multi-modal approach to cancer immunotherapy can result in response to tumor antigens and “accept” the tumor as self. Although the increased anti-tumor activity. This includes the use of agents designed to (a) mechanistic aspects of this functional delivery are still being explored, activate the immune response with the use of vaccines, (b) potentiate the increasing evidence implicates EVs as an important mode of informational immune response with cytokines such as IL-15 and IL-12; these cytokines transfer between tumor and normal surrounding cells, with the tumor EVs also have the potential to activate the innate immune system, e.g., natural taking control of their environment. killer (NK) cells, (c) eliminate or reduce immunosuppressive entities such as TGF-beta, IL-8, and checkpoint molecules, and (d) modify the tumor C-101 phenotype to render tumor cells more susceptible to T-cell‒mediated attack. Sialoside-based pattern recognition and its application in Recent preclinical and clinical studies have also shown that the use of immunotherapy bifunctional agents capable of bringing both immunostimulatory molecules as well as molecules to inhibit immunosuppressive entities to the tumor Yang Liu, PhD, Institute of Human Virology, University of Maryland School microenvironment results in enhanced anti-tumor activity. of Medicine, Pan Zheng, MD, PhD, Institute of Human Virology, University of Maryland School of Medicine C-104 Development of cancer immunotherapy by targeting neoantigens It is well established that the innate immune system recognizes both pathogen-associated and danger-associated molecular patterns (PAMPs Rongfu Wang, PhD, Weill Cornell Medical College and DAMPs respectfully). We have demonstrated that CD24-Siglec interactions selective represses innate immune response to DAMPs but Despite significant progresses in cancer immunotherapy, only a fraction of not PAMPs. Since this pathway is based on sialic acid on the ligands that cancer patients respond to immune checkpoint blockade therapy, which relies interact with Siglecs, we termed the it sialoside-based pattern recognition. on tumor-specific T cells, mutation loads and PD-L1 expression. Mutational Given the intrinsic connection between innate and adaptive immune loads are correlated with immune checkpoint blockade response, suggesting responses, we have explored the possibility to suppress T-cell-mediated that tumor neoantigens are ideal targets for cancer immunotherapy. Here, immune damages to host tissues. Our data from both preclinical and we build a systematic approach to identify tumor neoantigens by deploying clinical investigation support the utility of bolstering the sialoside-based non-synonymous mutation library screening generated by next generation pattern recognition to treat autoimmune diseases, sequela of viral infection sequencing as well as the autologous cDNA library screening. The tumor and graft vs host diseases. infiltrated T cells and their T cell clones were used for the screening and characterization of neoantigens. We show that the number of neoantigens C-102 is limited, but with the existence of dominant neoantigens in MHC class I Early Stage Non Small Cell Lung Cancer and II restricted antigens. Furthermore, the processing and presentation of neoantigens are controlled by multiple mechanisms, which may render Julie Brahmer, MD, Johns Hopkins University the resistance to cancer immunotherapy. Furthermore, we will show novel vaccine strategies to generate potent immune responses against cancer. No abstract Our studies provide comprehensive understanding of how to identify neoantigens for personalized immunotherapy and what kind of neoantigens are the best as potential targets for T cell based cancer immunotherapy.

20th Annual International Meeting of the Institute of Human Virology 37 Speaker Abstracts

C-105 and CD8. CD47 is highly expressed stem-like cancer cells that are more Clinical trial of HER2 cancer vaccine shows benefit in 45% of resistant to conventional treatment. Using xenograft and in vitro models, evaluable patients in phase I study anti-CD47antibody (Ab) that blocks SIRP signaling by CD47 is thought to enhance “eat me” signaling to kill tumor cells by macrophage-mediated Jay Berzofsky, MD, PhD, National Cancer Institute, NIH, Lauren Wood, phagocytosis. Our study is revealing that local anti-CD47 antibody regresses MD, National Cancer Institute, NIH, Hoyoung Maeng, MD, National Cancer tumor cells depending on cGAS/STING but not MyD88, IFN, and CD8+ T Institute, NIH, Jane Trepel, PhD, National Cancer Institute, NIH, David cells. Therefore, our studies have now revealed a distinct mechanism for Stroncek, MD, National Institutes of Health Clinical Center, John Morris, antibody-mediated tumor regression that include different innate sensing MD, University of Cincinnati Medical School and adaptive pathways and open new avenues for combinational therapies with other conventional drugs andimmunotherapy. We have developed and tested therapeutic cancer vaccine targeting HER2-expressing cancers based on autologous dendritic cells (DCs) We have further observed that the anti-tumor efficacy of anti-CD47 antibody transduced with an adenovirus expressing the non-signaling extracellular blockade relies on the gut microbiota. Gut microbiota are generally and transmembrane domains of HER2, a driver oncogene in many cancers hypothesized to influence anti-tumor responses by initiating gut immunity. including breast, ovarian, lung, colorectal, gastroesophageal, and bladder, However, we observed the primary site of enhancing anti-tumor immunity among others. In mice, the homologous vaccine cured virtually all mice with is inside tumor by microbiota. Furthermore, intratumoral administration of large established tumors up to 2 cm and with established macroscopic lung a microbiota isolated from tumor tissues restore anti-tumor immunity in metastases. In mice, the protection was dependent on antibodies to HER2 non-responder of anti-CD47 treatment. Together, our study has identified that inhibited HER2 phosphorylation, but was FcR (ADCC) independent, gut microbiota colonized in the tumor sites facilitates CD47-based and thus different from the main recognized mechanism of the clinically immunotherapy by STING signaling and has applicability to improve anti- approved anti-HER2 monoclonal antibody, trastuzumab. A phase I trial is CD47 immunotherapy. ongoing in patients with advanced metastatic cancers who have failed at least one line of standard therapy, whose tumors scored HER2 1+ , 2+ C-107 or 3+ by immunohistochemistry or have a HER2 FISH score ≥ 1.8 . Part How Checkpoint Blockade alters the repertoire and function of 1 of the trial was carried out in patients naïve to trastuzumab or other tumor specific T-cells HER2-directed therapies, as it is important to demonstrate safety in the absence of complicating effects of prior HER2-targeted therapies. In Part Drew Pardoll, MD, PhD, Bloomberg-Kimmel Institute for Cancer 1, although no responses were seen in 6 patients at the lowest dose of 5 Immunotherapy million DCs, at the second and third dose escalations (10 and 20 million DCs), of 11 evaluable patients, 5 (45%) had clinical benefit, including one The past 10 years have seen a transformation in cancer treatment, as CR lasting 89 weeks, one PR lasting 24 weeks, and 3 cases of stable immunotherapy has come to fruition after many decades of research. disease, seen in patients with metastatic ovarian, gastroesophageal or Interestingly, this inflexion point has not been based on stimulation of colorectal cancers. Adverse reactions were mainly injection site reactions anti-tumor immunity by agents like vaccines or systemically delivered that did not require treatment in most patients. Serial echocardiograms did cytokines, but rather by blockade of inhibitory receptors or their ligands – not show any evidence of cardiotoxicity. The number of circulating tumor generally referred to as checkpoints. These advances were highlighted in cells also decreased in 40% (8/20), 83% (5/6) and 100% (2/2) at 12, 28 Science’s 2013 “Breakthrough of the Year” and by this year’s Nobel Prizes. and 48 weeks on study, respectively. Based on these results and safety The success of checkpoint-blocking antibodies demonstrates that many, data, the FDA and IRB have approved increasing the maximum dose to arguably most, cancer patients contain T cells capable of recognizing and 40 million DCs and opening Part 2 of the trial in patients who have failed killing their cancer. The most significant checkpoint to be blocked is PD-1, prior HER2-directed therapies like trastuzumab, mostly metastatic breast whose ligands are PD-L1 and PD-L2. Three anti-PD-1 and three anti-PD-1 and gastric cancer patients. Early results in Part II starting at 20 million DCs antibodies have been approved for treatment of 13 different cancer types. already showed 2/6 patients with stable disease. Thus, we have translated The activity of these antibodies depends on activation of T cells. There are a cancer vaccine from mice to human clinical trials with very promising early two FDA approved biomarkers to identify patients more likely to respond results, and intend to combine this vaccine with checkpoint inhibitors, as to anti-PD-1. One is expression of PD-L1 and the other is mismatch repair vaccines can induce T cell responses that turn “cold” tumors into “hot” ones deficiency, which is the cause of 4% of cancers. Mismatch repair deficiency amenable to checkpoint blockade immunotherapy. (MMRd also called micro-satellite instability-MSI) results from homozygous inactivation of one of four mismatch repair genes. These cancers typically C-106 have over 1000 non-synonymous mutations/exome. Because a major Tumor targeting antibodies to improve tumor immunity: the role of target of anti-tumor T cells is mutation-associated “neoantigenic” peptides, microbiota patients with MMRd cancers have huge numbers of neoantigens that can be recognized but they are not killed because they are restrained by engaging Yang-Xin Fu, MD, PhD, UT Southwestern Medical Center PD-1. Anti-PD-1 antibodies induce major cancer regressions in over 50% of MMRd cancers, regardless of tissue of origin. Three major endeavors are Tumor cells express a panel of surface molecules to promote their growth advancing cancer immunotherapy for the 75-80% or cancer patients NOT and evade immune responses, such as oncogenic receptors, PD-L1, benefitted by monotherapy with anti-PD-1/PD-L1 antibodies: 1) Therapeutic andCD47. Tumor targeting antibodies have been designed to kill tumor combinations with anti-PD-1 or anti-PD-L1 being foundational, 2) Reversal cells. Several mechanisms have been proposed, including stress-induced of T cell dysfunction and 3) Refined development of biomarkers to identify apoptosis, antibody-dependent cytotoxicity, complement dependent patients most likely to respond to various immunotherapies and their cytotoxicity, and increased phagocytosis. We have now observed that anti- combinations. Recent technologies, including TCRseq, single cell analyses Her2/neu-mediated tumor regression depends on MyD88, interferon,CD4+ and multispectral imaging are accelerating the identification of new drug or CD8+ T cells. Anti-CD20 mediated tumor eradication depends on IFN targets and biomarkers to promote this endeavor. 20th Annual International Meeting of the Institute of Human Virology 38 Speaker Abstracts

D-101 VCU Massey Cancer Center, Virginia Commonwealth University, School Expression of Evolutionarily Novel Genes in Tumors - the Possible of Medicine, Richmond, VA, Luni Emdad, MBBS, PhD, Department Role of Tumors in Evolution of Human and Molecuar Genetics, VCU Institute of Molecular Medicine, VCU Massey Cancer Center, Virginia Commonwealth University, School of Andrei Kozlov, PhD, DSc, The Biomedical Center, St. Petersburg, Peter Medicine, Richmond, VA the Great St. Petersburg Polytechnic University, St. Petersburg, State Research Institute of Highly Pure Biopreparations, St. Petersburg, Vavilov Our laboratory pioneered subtraction hybridization and used this Institute of General Genetics, Moscow elegant and effective gene identification strategy to clone novel genes of physiological relevance. This methodology defined differentially regulated Earlier I formulated the hypothesis of the possible evolutionary role of genes in an unbiased manner that are modified when metastatic human tumors. This hypothesis suggests that heritable tumors at earlier stages of melanoma cells are pharmacologically induced to terminally differentiate progression supply evolving multicellular organisms with extra cell masses and lose irreversibly oncogenic potential following treatment with IFN- for the expression of newly evolving genes. After expression of novel genes band the protein kinase C activator mezerein. This approach, called DISH in tumor cells, tumors differentiate in new directions and may give rise (differentiation induction subtraction hybridization), identified melanoma to new cell types, tissues and organs (A.P. Kozlov, “Evolution by Tumor differentiation associated (mda) genes relevant to growth control, cancer Neofunctionalization”, Elsevier/Academic Press, 2014). development, tumor progression, and cancer cell survival. One intriguing gene identified using the DISH scheme was mda-7, which based on In my lab we described several genes with dual specificity – evolutionary chromosomal location, secretory properties and structure has been novel genes expressed specifically or predominantly in tumors (OTP, ESRG, classified as interleukin-24 (IL-24). mda-7/IL-24 is a novel member of the PVT1, ELFN1-AS1, HHLA1, DCD, SPRR1A, CLLU1, PBOV1 and others). IL-10 gene family that promotes apoptosis and toxic autophagy in a broad- spectrum of human tumors, exerts potent “bystander” antitumor activity, We also described the evolutionary novelty of the whole classes of inhibits tumor angiogenesis, stimulates the immune system and synergizes genes expressed predominantly in tumors, i.e. CT-X genes and genes of with conventional therapies (including chemotherapy, radiation, monoclonal noncoding tumor specifically expressed RNAs. antibodies and immunomodulators) to promote selective tumor destruction. mda-7/IL-24 displays profound anti-cancer activity in preclinical animal We studied the phylogenetic distribution of the orthologs of genes models (including nude, syngeneic and transgenic mice) and following expressed in tumors and found that different functional gene classes have intratumoral administration using a type 5 adenovirus in a Phase I/II clinical different evolutionary novelty. Some of them are enriched by evolutionarily trial in patients with advanced cancers. To enhance the therapeutic efficacy novel genes. We showed the evolution of oncogenes, tumor suppressor of mda-7/IL-24, we generated a novel class of adenoviruses, called Cancer genes and differentiation genes occurred in a parallel way, which supports Terminator Viruses (CTVs), that selectively replicate in cancer cells and the participation of tumors in the origin of new cell types. Some human simultaneously produce mda-7/IL-24, Ad.5-CTV. A further iteration of this genes which determine progressive traits originated in fishes and were first virus employs a chimera between Ad.5 and Ad.3, Ad.5/3, that employs expressed in fish tumors. Coxsackie-Adenovirus Receptors (CAR) as well as desmoglien and CD46 to infect cells, thereby increasing its infectivity in cancer cells with The existing data obtained in our lab and by other authors suggest that reduced CAR. Ad.5/3-CTV displays profound anti-cancer activity in pre- genes originated by gene duplication; from endogenous retroviruses; by clinical animal models, including GBM, melanoma, and prostate, colorectal exon shuffling; and de novo are expressed in tumors, sometimes with high and breast cancer. A clinical trial is in preparation to test the effect of the tumor specificity. Ad.5/3-CTV in patients with recurrent glioma. To facilitate the delivery of adenoviruses systemically, avoiding immune clearance and liver trapping, The conclusion will be made that the expression of evolutionarily novel we have refined the ultrasound-targeted microbubble-destruction (UTMD) genes in tumors may be a novel biological phenomenon with important approach. This strategy has allowed us to deliver therapeutic viruses and evolutionary role. proteins intravenously to internal target organs, such as the prostate, to evoke pre-clinical antitumor activity. To enhance further the therapeutic efficacy of the UTMD approach, we are employing microbubbles that D-102 contain targeting ligands on their surface permitting accumulation in the tumor vasculature, i.e., decorated microbubbles. Employing the same D-103 cancer-selective promoter used in the original CTV, the rat progression Cancer Terminator Viruses: A Strategy for Targeting Metastatic elevated gene-3 promoter (PEG-Prom), we also developed genetic- Cancers based imaging approaches for metastases. These approaches use the PEG-Prom (or another cancer-selective promoter) to drive an imaging Paul B. Fisher, MPhil, PhD, FNAI, Department of Human and Molecular gene (e.g., luciferase or HSV-Tk) linked to a delivery vehicle PEI. These Genetics, VCU Institute of Molecular Medicine, VCU Massey Cancer nanoparticle vectors when combined with bioluminescence imaging and Center, Virginia Commonwealth University, School of Medicine, Richmond, SPECT-CT permit non-invasive imaging of tumors and metastases in pre- VA, Martin G. Pomper, MD, PhD, Division of Nuclear Medicine and clinical animal models. As a further iteration of our CTV we have used two Molecular Imaging, Johns Hopkins Medical School, Johns Hopkins cancer-selective and a non-selective promoter to generate first in class University, Baltimore, MD, Alexander K. Klibanov, PhD, Division of tripartite Ads that selectively replicate in cancer cells, produce an imaging Cardiovascular Medicine and Department of Biomedical Engineering, agent in cancer cells (Lucirerase or HSV-Tk) and simultaneously produce University of Virginia, Charlottesville, VA, Devanand Sarkar, MBBS, PhD, the therapeutic immunogenic cytokine mda-7/IL-24, Ad.Tri-CTV. These Department of Human and Molecular Genetics, VCU Institute of Molecular “theranostic viruses” permit tumor and metastasis imaging and treatment Medicine, VCU Massey Cancer Center, Virginia Commonwealth University, through application of a single vector. Overall, the novel reagents and School of Medicine, Richmond, VA, Swadesh K. Das, PhD, Department methodologies we have developed are providing paradigm shifts in how of Human and Molecuar Genetics, VCU Institute of Molecular Medicine, cancers will be detected and treated in the future. 20th Annual International Meeting of the Institute of Human Virology 39 Speaker Abstracts

D-104 rare subpopulation of cells exhibiting resistance to chemotherapy. More Harnessing the Potential of HDAC Inhibitors for Immunotherapy generally, this method has the potential to reveal other new phenotypes Combinations. associated with rare cell biology including metastasis and the early stages of stem cell differentiation. Taken together, our findings in melanoma Sofia Gameiro, PharmD, PhD, Laboratory of Tumor Immunology and and novel methods for studying cellular plasticity outline a framework for Biology, Center for Cancer Research, National Cancer Institute, NIH, using single-cell technologies for applications in basic biology and clinical Kristin C. Hicks, PhD, Laboratory of Tumor Immunology and Biology, medicine. Center for Cancer Research, National Cancer Institute, NIH, James W. Hodge, PhD, MBA, Laboratory of Tumor Immunology and Biology, Center E-101 for Cancer Research, National Cancer Institute, NIH, Jeffrey Schlom, UPR in coordinated regulation of microbiome and anti-tumor PhD, Laboratory of Tumor Immunology and Biology, Center for Cancer immunity Research, National Cancer Institute, NIH Ze’ev Ronai, PhD, Sanford Burnham Prebys Medical Discovery Institute The clinical promise of cancer immunotherapy relies on the immune system recognizing and eliminating tumor cells identified as non-self. RNF5 is a ubiquitin ligase implicated in the control of ER stress and ER However, the tumor microenvironment (TME) can evade a tumor targeted associated degradation, part of the greater Unfolded Protein Response. immune response by increasing immunosuppressive elements that hamper RNF5 mutant mice were found to limit tumor growth, of both melanoma and maturation, recruitment, and function of immune effector cells through colon cancer models, owing to enhanced anti-tumor immunity. Enhanced numerous pathways, including upregulation of immune checkpoints such TLR signaling resulted in enhanced infiltration of CD4/8+ T cells as well as as PD-L1. Hence, there is an unmet clinical need to develop effective Dendritic cells to the tumors grown in RNF5 mutant mice. Cross of RNF5 therapeutic strategies that can reprogram the TME to restore tumor immune mutant with MYD88 KO or use of neutralizing antibodies against CD4/8+ recognition and reverse immune evasion. Studies in our laboratory recently T cells effectively attenuated anti-tumor immunity and tumor inhibition demonstrated that Entinostat, a class I histone deacetylase (HDAC) inhibitor, phenotypes. Coincided with the enhanced anti-tumor immunity was reduced reverses carcinoma immune escape to human T cell- and NK-mediated UPR signaling in intestinal epithelial cells of RNF5 mutant mice. Indeed, lysis and augments the effector function of human NK cells. In preclinical cultured intestinal epithelial MODE-K cells that were subjected to inhibition studies, the IL-15/IL-15Rasuperagonist ALT803 has been shown to exhibit of RNF5 expression exhibited reduced UPR signaling, and were able to tumor control in multiple murine models of cancer through the expansion activate, in co-culture studies, DC and T cells. Surprisingly, co-housing of of NK and CD8+T cells with high effector function. We hypothesized that RNF5 mutant and WT mice resulted in loss of anti-tumor immunity and the the antitumor activity promoted by ALT803 in combination with PD-L1 loss of tumor growth inhibition, suggesting that microbiota of RNF5 mutant checkpoint blockade or a therapeutic adenoviral vaccine targeting CEA mice may play a key role in activating anti-tumor immunity. Analysis of (Ad-CEA) could be augmented by the epigenetic reprograming of the TME gut microbiota composition in RNF5 KO mice led to the identification of induced by Entinostat. The immune mechanisms associated with antitumor specific bacterial strains that were able to induce anti-tumor immunity and efficacy of these multivalent therapies were examined in the TME as well as limit melanoma growth, when administered to germ free mice. The role of in the periphery. Results of these studies provide a rationale for combining altered UPR in the coordinated regulation of microbiome and anti-tumor Entinostat with multivalent immunotherapy combinations, including immunity will be discussed. cytokines, antibodies targeting PD-L1, and therapeutic cancer vaccines.

D-105 Cellular memory and rare cell variability in cancer

Sydney Shaffer, MD, PhD, University of Pennsylvania

Targeted therapies for cancer are a promising class of drugs that inhibit the specific molecular alterations that underlie the uncontrolled proliferation seen in cancer. The primary shortcoming of targeted therapy is disease relapse, which is driven by a subpopulation of cells that are resistant to these drugs. This phenomenon is generally thought to be genetic in origin; however, our recent work on melanoma shows that non-genetic cellular plasticity may provide a mechanism of resistance to these therapies. Furthermore, we showed that through the addition of the drug itself, cells transition from this transient plasticity into a new, stably resistant cell state via cellular reprogramming, suggesting that the time an individual cell exists in a state is important for producing the divergent resistance phenotype. However, there are currently no methods available to quantify the timescale of these fluctuations for the whole transcriptome. Thus, broadly generalizing this concept of timescales for cellular plasticity, we developed a novel method for genome-wide quantification of the timescales of gene expression memory based on a modern version of the ingenious Luria- Delbrück fluctuation analysis. In melanoma, this method revealed the gene expression state of rare cells resistant to targeted therapy. In a completely new model, triple negative breast cancer, this method revealed a novel 20th Annual International Meeting of the Institute of Human Virology 40 Speaker Abstracts

E-102 cells in anti-PD-L1 resistant tumors and lead to cancer eradication11. Destruction of the tumor microenvironment by neoantigen-specific T cells prevents relapse of therapy-resistant cancer variants 1. Monach PMID:7600302 2. Spiotto PMID:14981514 Steven Wolf, MD, PhD, University of Chicago, Department of Pathology, 3. Arina PMC4941507 Karin Schreiber, BS, University of Chicago, Department of Pathology, 4. Singh PMID:1309851 Madeline Steiner, BS, University of Chicago, Department of Pathology, 5. Seung PMC:41496 Ralph Weichselbaum, MD, University of Chicago, Department of Radiation 6. Zhang PMC226202 of Cellular Oncology, Matthias Leisegang, PhD, Institute of Immunology, 7. Kammertoens PMID:28445461 Charité, Campus Buch, Hans Schreiber, MD, PhD, University of Chicago, 8. Zhang PMC2118433 Department of Pathology 9. Zhang PMID:18316622 10. Arina PMC5354300. Microorganisms frequently escape host defenses by generating heritable 11. Leisegang PMID: 26667491 variants. Cancer cells replicate more slowly than most microorganisms, 12. Schietinger PMC2964573 but variants nevertheless arise frequently because malignant cells carry numerous mutations and are genetically very instable. Thus, chemo-, E-103 radiation and/or immunotherapy may stabilize or even reduce a solid tumor, Inflammation-driven networks in the regulation of breast cancer but relapse is common due to outgrowth of therapy-resistant variants. We progression discovered that destruction of the cancer microenvironment by T cells recognizing neoantigens, which arise from cancer mutations1, eliminates Adit Ben-Baruch, PhD, Tel Aviv University, Yulia Liubomirski, PhD such variants, thereby preventing relapse2. The cancer microenvironment, Student, Tel Aviv University, Shalom Lerrer, PhD, Tel Aviv University, Tsipi also referred to as stroma (Greek, bed), contains mostly macrophages and Meshel, MSc, Tel Aviv University, Linor Rubinstein, PhD Student, Tel Aviv fibroblasts3, in addition to tumor capillaries. While tumor macrophages are University, Dina Morein, PhD Student, Tel Aviv University bone marrow (BM)-derived, tumor-associated fibroblasts as well as tumor endothelial cells are derived from sessile precursors2. When tumor stroma Accumulating evidence substantiates potent pro-malignancy roles for is destroyed by neoantigen-specific T cells, cancer cells are deprived of stromal cells, such as bone marrow-derived mesenchymal stem cells essential attachment or paracrine growth factors that are essential for all and cancer-associated fibroblasts, in breast cancer. In parallel, the breast cancer cells including their variants to grow and survive4,5. At least in some tumor microenvironment (TME) is enriched with pro-inflammatory cytokines tumor models, both the BM-derived as well as non-BM-derived cells must that play causative roles in promoting disease course. Focusing on the be targeted by the T cells. Also, both cell types must express the receptors aggressive triple negative subtype of breast cancer (TNBC), we have for IFNγ and TNF and T cells must be able to produce both cytokines6. analyzed by patient dataset studies, in vitro co-culture experiments and IFNγ alone is inefficient to destroy tumor vessels7. However, when stromal in vivo model systems the interactions between TNBC cells, stromal cells microenvironment is destroyed, the ensuing cancer cell destruction is not and pro-inflammatory cytokines, and their pro-metastatic potential. This selective for cancer cells expressing the antigen or the antigen-presenting integrative approach demonstrated that the stimulation of TNBC:stroma MHC Class I molecule; thus escape variants are equally well eradicated. co-cultures by pro-inflammatory cytokines has led to elevated pro- metastatic phenotypes at multiple levels: (1) The expression levels of We discovered that destruction of the cancer microenvironment by chemokines that are pro-angiogenic and can lead to high levels of myeloid neoantigen-specific T cells can be achieved by multiple different inflammatory cells at the TME was much increased. (2) The cytokine- approaches. When neoantigen expression on the cancer cells is high, and stimulated TNBC:stroma co-cultures were enriched with angiogenic factors can be cross-presented by stromal cells, then tumor stroma is sensitized that promoted endothelial cell sprouting (3) The tumor cells gained high and killed directly by T cells. Cancer variants embedded in the stroma are migratory and invasive capabilities. Moreover, studies in animal model also destroyed and relapse is prevented2. When neoantigen expression systems indicated that TNBC cells that formed contacts with stromal cells level on the cancer cells is low, local irradiation of the tumor can temporarily in the context of pro-inflammatory stimulation became more aggressive, up-regulated the level of cross-presented antigen on stromal cells to allow as indicated by increased incidence of mice having lungmicro-metastases. stromal destruction by T cells and relapse is being prevented8. When Molecular studies with siRNA and CRISPR in TNBC cells and/or in stromal cancer cells lack the MHC Class I but maintains neoantigen expression, cells identified the cellular source for elevated chemokines in cytokine- neoantigen released from the cancer cells can still be cross-presented by stimulated TNBC:stroma co-cultures. We have identified the molecules that stromal cells. CD8+ T cells destroy these stromal cells and thereby much of participate in mediating TNBC:stroma cell-to-cell contacts in the context the tumor mass, even though residual cancer cells persist for months without of pro-inflammatory signals, and the transcription factors regulating these escape by antigen loss variants9. Finally, the CD8+ T cells after having processes. Overall, our findings identified novel players controlling pro- maintained the equilibrium for months become exhausted which results metastatic events TNBC, regulating the triage formed by tumor-stroma- in tumor escape10. Escape is also common when autochthonous mutant inflammation interactions. These findings pose pro-inflammatory factors antigens are targeted by CD8+ T cells. These cancer-specific antigens as candidate targets whose inhibition may break detrimental networks that are caused by non-synonymous single nucleotide variants (nsSNVs)1 promote TNBC progression. and are often expressed at low levels11. In these situations, recognition of additional antigens on the cancer cells by CD4+ T cells may be needed11. Even though most cancer cells are MHC Class II negative, they release the antigen into the tumor stroma where it is cross-presented by MHC Class II positive stromal macrophages. Using antigen models, we could show that CD4+ T cells indeed cooperate with CD8+ T cells and this interaction occurs at the effector phase12. Such CD4+ T cells could rescue CD8+ T 20th Annual International Meeting of the Institute of Human Virology 41 Speaker Abstracts

E-104 provide preclinical evidence that targeting these cells or the pathways they Intravital microscopy of the tumor microenvironment: escape and activated in tumor cells is a valuable therapeutic approach. relevance for immunotherapy F-101 Peter Friedl, MD, PhD, Radboud University Nijmegen Medical Centre, A hemagglutinin stalk-based universal influenza virus vaccine Nijmegen & The University of Texas, MD Anderson Cancer Center, Houston, TX, USA Florian Krammer, PhD, Icahn School of Medicine at Mount Sinai

Cancer cell invasion results from coordination of cell shape, deformability and Influenza virus infections are a significant cause of morbidity and actin dynamics relative to the tumor microenvironment. When monitored in mortality worldwide. Current vaccines show acceptable efficacy against vivo, using intravital multiphoton second and third harmonic generation and antigenically matched viruses by inducing strain specific antibodies against fluorescence microscopy, tissue microniches provide invasion-promoting the membrane-distal globular head domain of the viral hemagglutinin, tracks that enable collective migration along tracks of least resistance. As but fail to protect against drifted and pandemic strains. The membrane- main routes, non-destructive contact-guidance is mediated by preformed proximal stalk domain of the viral hemagglutinin exhibits a high degree of multi-interface perimuscular, vascular and –neural tracks of 1D, 2D and conservation across influenza virus subtypes, and monoclonal antibodies 3D topography with form constitutive tissue conduit-like tracks with defined directed against this region typically show broad neutralizing activity. geometry, nanotropography and molecular composition as predominant However, these antibodies are rare and usually not induced/boosted by routes of invasion (“highways”). During adoptive T cell therapy, interstitial regular seasonal vaccines. Here, we developed a universal influenza virus conduits further represented a preferential route for cytotoxic T cell (CTL) vaccination strategy based on the conserved stalk domain of group 1 and distribution, which allowed CTL accumulation around invading tumor nests group 2 hemagglutinins. By sequential vaccination of mice and ferrets with and effective killing, by CTL swarming and cooperation. In conclusion, both chimeric hemagglutinin constructs that share the same stalk domain but cancer invasion and CTL trafficking occurs in predefined tissue niches of have divergent head domains we were able to specifically boost broadly the tumor microenvironment indicating common themes of cell guidance by neutralizing antibody titers against conserved epitopes in the hemagglutinin encountered physical space and molecular cues which can be exploited for stalk. Animals vaccinated with these constructs were protected from adoptive T cell therapy. morbidity and mortality induced by infection with a panel of heterologous and heterosubtypic influenza A viruses, including avian influenza virus E-105 subtypes of concern like H5N1 and H7N9. The induced antibody response Mesenchymal Stromal Cells: Mediators of Inflammation in Cancer was long-lived and also interfered with virus transmission between animals. The present data suggest that this vaccine strategy has the potential to Yves DeClerck, MD, USC/Children’s Hospital Los Angeles provide broad influenza virus protection in humans and clinical trials are currently ongoing. A universal influenza virus vaccine would represent a Cancer-associated fibroblasts (CAF) have been identified in the tumor major advance towards the control of influenza worldwide and would microenvironment (TME) of many cancers. CAF represent a heterogeneous significantly enhance our pandemic preparedness. population of cells that can have pro-tumorigenic and anti-tumorigenic functions. We have isolated from primary human neuroblastoma tumors, a population of CAF that share phenotypic and functional characteristics of bone marrow-derived mesenchymal stromal cells (MSC). These cells are CD73+, CD90+, CD105+, CD34-, CD45-, CD14-, CD19-, CD31- , and VEGFR2-, and retain the ability to differentiate into osteoblasts, chondrocytes and adipocytes, a feature of MSC. However, we show that these cells also express fibroblast activation protein alpha (FAP/DPPIV), fibroblast specific protein 1 (FSP1/S1004A) and alpha smooth muscle actin (SMA), markers of cancer-associated fibroblasts. When in the presence of tumor cells, these MSC/CAF stimulate the production of multiple pro- tumorigenic cytokines and chemokines including interleukin (IL)-6, IL-8, CCL2/monocyte chemoattractant protein 1, CXCL-12/stromal-derived factor 1 (SDF1), CXCL1, vascular endothelial growth factor (VEGF-A), plasminogen activator inhibitor 1 (PAI-1) and transforming growth factor (TGF) β. The production of these cytokines/chemokines by MSC/CAF is stimulated by the production of soluble factors by tumor cells including galectin-3 binding protein and extracellular vesicles. In addition to stimulating angiogenesis, the recruitment and M2 polarization of macrophages, and to suppress immune cells, MSC/CAF have a direct effect on tumor cells by stimulating tumor cell growth, survival and resistance to chemotherapy in an ERK1/2 and STAT3-dependent manner. We then show that targeting ERK1/2 and STAT3 or targeting MSC in combination with chemotherapy or immunotherapy in mice orthotopically implanted with human neuroblastoma tumors, inhibits tumor growth and extends survival. In contrast, targeting a single cytokine like IL-6 has no significant effect. These data thus identify a new type of CAF sharing characteristics of bone marrow-derived MSCs that contribute to a pro-tumorigenic inflammatory reaction in the TME and 20th Annual International Meeting of the Institute of Human Virology 42 Speaker Abstracts

F-102 F-104 Antivirals, a lot has been achieved, yet a long way to go. Emergence of novel EV-D68 lineages associated with acute flaccid paralysis Johan Neyts, PhD, KU Leuven, Rega Institute Richard H. Scheuermann, PhD, J. Craig Venter Institute, US Today, small molecule antiviral drugs are available for the treatment of infections with herpesviruses, HIV, HBV and HCV as well as with influenza Enterovirus D68 (EV-D68) has historically been associated with respiratory viruses. Yet, for many other viruses that cause life-threatening infections illnesses. However, in the summers of 2014 and 2016, EV-D68 outbreaks and many of which are considered emerging and/or neglected pathogens, coincided with a spike in polio-like acute flaccid myelitis/paralysis (AFM/ there are no drugs available. I will discuss our efforts to develop potent AFP) cases. This raised concerns that EV-D68 could be the causative antivirals against flaviviruses (such as dengue), alphaviruses (such as agent of AFM during these recent outbreaks. To assess the potential chikungunya) and enteroviruses as well as against the hepatitis E and the neurotropism of EV-D68, we utilized the neuroblastoma-derived neuronal rabies virus. Several excellent molecular targets for the selective inhibition cell line SH-SY5Y as a cell culture model to determine if differential of viral replication (and that have remained largely unexplored) have been infection is observed for different EV-D68 strains. In contrast to HeLa identified, such as the non-structural protein NS4B of flaviviruses, the and A549 cells, which support viral infection of all EV-D68 strains tested, capping machinery of alphaviruses and the 2C helicase of enteroviruses. SH-SY5Y cells only supported infection by a subset of contemporary EV- Besides the development of antiviral strategies, our team is also developing D68 strains, including isolates from the 2014 outbreak. Viral replication novel vaccines. More in particular we developed the PLLAV (Plasmid and infectivity in SH-SY5Y were assessed using multiple assays: virus Launched Live Attenuated Virus) vaccine technology platform. Simple production, cytopathic effects, cellular ATP release, and VP1 capsid administration (mice, hamsters, NHP and pigs) of a PLLAV-plasmid that protein production. Similar differential neurotropism was also observed carries the entire coding sequence of the yellow fever 17D vaccine virus, in differentiated SH-SY5Y cells, primary human neuron cultures, and results in the efficient vaccination. Next we demonstrate that foreign a mouse paralysis model. Using the SH-SY5Y cell culture model, we sequences can be inserted in the YFV-17D sequence, thus resulting in, determined that barriers to viral binding and entry were at least partly for example, dual vaccine candidates against either the yellow fever and responsible for the differential infectivity phenotype. Transfection of the rabies virus or the yellow fever and the Lassa fever virus. The PLLAV genomic RNA into SH-SY5Y generated virions for all EV-D68 isolates, but technology allows to rapidly produce using a straightforward fermentation only a single round of replication was observed from strains that could process thermostable alternatives for live attenuated viral vaccines. not directly infect SH-SY5Y. In addition to supporting virus replication and other functional studies, this cell culture model may help identify the www.antivirals.be www.facebook.com/NeytsLab signatures of virulence to confirm epidemiological associations between EV-D68 strains and AFM and allow for the rapid identification and F-103 characterization of emerging neurotropic strains. Catching Chances: The Movement to Be on the Ground and Research Ready Before an Outbreak

David Brett-Major, MD, MPH, Uniformed Services University

What does it mean to be ready to conduct clinical virologic research in an emergency? After the thousands of cases of Ebola virus disease in West Africa duringccthe 2014–2016 epidemic, the world remains without a licensed vaccine or therapeutic broadly available and demonstrated to alleviate suffering. This deficiency has been felt acutely in the two, short, following years with two Ebola virus outbreaks in the Democratic Republic of Congo (DRC), and a Marburg virus outbreak in Uganda. Much of the fault lies in a lack of clinical research preparedness complicating just-in- time research efforts in the field. In this brief presentation, critical aspects of readiness will be discussed.

20th Annual International Meeting of the Institute of Human Virology 43 Speaker Abstracts

F-105 for Health in Zambia. Surveillance of viral zoonoses in Africa This work contributes to building the capacity for Africa to be better Aaron Mweene, PhD, MSc, BVM, Africa Center of Excellence for Infectious prepared for any eventual outbreak of highly infectious diseases of humans Diseases of Humans and Animals, the University of Zambia, GVN Affiliate and animals. Centre of Excellence, University of Zambia, School of Veterinary Medicine, University of Zambia, Ayato Takada, PhD, BVM, Division of Global Epidemiology, Research Center for Zoonosis Control, Hokkaido University, Sapporo, Japan, Global Station for Zoonosis Control, Global Institution for Collaborative Research and Education, Hokkaido University, Sapporo, Japan

In recent years, the increased rates in the mergence and re-emergence of highly infectious diseases of humans and animals, with high health and socio-economic impacts and serious biosafety and biosecurity challenges have been observed, worldwide. In Africa, highly dangerous pathogens even unpredictably re-emerge or emerge in new geographic areas or are newly discovered. Most recent examples include discovery of highly pathogenic Old World arenavirus (Lujo virus) following air transport of a fatally ill patient from Zambia to South Africa and the spread of Zaire ebolavirus associated with severe and widespread outbreaks of Ebola viral haemorrhagic fever in West Africa in 2014. To strengthen the research and surveillance capacity for viral zoonosis in Zambia, a 5 year (2013 - 2018) project entitled “Surveillance of viral zoonoses in Africa” was implemented through collaborative research between Zambia and Japanese Research Institutions. This is supported through a Technical Cooperation Project by the Japan International Cooperation Agency (JICA) and the Agency for Medical Research and Development (AMED)/Japan Science and Technology Agency (JST) under the framework of the Science and Technology Research Partnership for Sustainable Development (SATREPS). The University of Zambia (UNZA) with financing from the World Bank has established the Africa Centre of Excellence for Infectious Diseases of Humans and Animals (ACEIDHA) to address some of the public health challenges. ACEIDHA endeavours to achieve the regional goal of understanding the natural history of some infectious diseases, through new evidence-based, cost effective, multi- disciplinary, multi-sectoral, and collaborative strategies to be implemented by well-trained and skilled scientists. It will, subsequently, increase the sub- region’s human resource capacity to deal with these problems by training a pool of scientists at MSc and PhD levels. Recently, ACEIDHA has been accepted as a GVN Affiliate Centre of Excellence. This status will enable ACEIDHA to better train virologists at MSc, PhD and post-doctoral levels. It will, further, help to facilitate interactions of other GVN members with a number of partners in Africa, which is critical to GVN’s mission in preparing the world for future outbreaks of viral diseases.

Considering that zoonoses cannot be eradicated, it is imperative to take pre-emptive action to determine the circulation of the related pathogens in the environment. In this regard, biological samples from potential hosts (wild animals, livestock and human) are collected and examined for the status of the known and unknowns pathogens. We, also, embark on establishment an/or improvement of detection methods for known viral zoonoses. In this regard, inter alia, a simple, reliable, low cost immunochromatographic assay, named QuickNaviTMEbola, for rapid diagnosis of Ebola virus disease (EVD) has been developed. Furthermore, working together in a multidisciplinary One Health platform, activities are conducted to identify natural reservoirs for the elucidation of transmission pathways of zoonotic viruses and risk factors as well as drivers for emergence of known and/or unknown viruses in communities and our work has potential for discovery of novel viruses originating from animals. Incidentally, since the outbreak of 2014 EVD in West Africa, all samples from cases of suspected EVD in Zambia are tested under our project working with the Ministry responsible 20th Annual International Meeting of the Institute of Human Virology 44 Speaker Abstracts

F-106 the most recent outbreaks with apparent success. Experimental drugs, Ebola and Lassa fever: Lessons learned, continuing challenges. including monoclonal antibody therapies, are now being used in African patients. Robert Garry, PhD, Tulane University The World Health Organization (WHO) and the Coalition for Epidemic The 2013–2016 West African Ebola outbreak was the largest, most Preparedness Innovations (CEPI) have each now ranked LASV as a geographically dispersed and deadliest on record. Since the West Africa priority pathogen. These rankings are based on the potential for further outbreak began four independent outbreaks of Ebola have occurred, all geographic expansion of the rodent reservoirs, the ease of procurement in the Democratic Republic of the Congo (DRC). The last outbreak was and weaponization of the virus, the frequent importation to North America detected only a week after the previous outbreak was declared over. Ebola and Europe, and the emergence of novel strains in densely populated West is not the only global health challenge that is emerging with increasing Africa. The Food and Drug Administration recently recognized Lassa fever frequency. During 2018 Nigeria experienced an unprecedented increase in as a neglected tropical disease, which could also spur development of Lassa fever cases. Nearly 500 cases have been diagnosed by August, more countermeasures. Reclassifying LASV as a Tier 1 Select Agent should now than reported in any previous year. While confirmed Lassa fever cases are become a priority of the Centers for Disease Prevention and Control and concentrated in the southwest states of Edo (42%) and Ondo (24%), and the United States Department of Agriculture (USDA), a change which would the southeast state of Ebonyi (15%), additional cases have originated in 18 also accelerate development of much needed vaccines and therapeutics. other states country-wide. Lessons learned may improve the next response to an international health Emerging viruses such as Ebola virus (EBOV) and Lassa virus (LASV) crisis caused by a viral pathogen that emerges in a region of the world present enormous challenges to global public health. Numerous gaps with a severely limited health care infrastructure. However, predicting when exist in our understating of the factors that drive viral emergence and the next new human viral pathogen will mutate or where it will emerge in may be responsible for the increased frequency of Ebola outbreaks and people is not achievable. There are far too many possible pathogens and the geographic expansion of LASV. For example, the EBOV strains that too little known about the changes that may determine the ability of animal emerged in DRC in 2014 and during the latest 2018 outbreak in eastern DRC viruses to jump to humans. Rather, the most effective way to prepare for (North Kivu, virological.org/t/drc-2018-viral-genome-characterization/230) the inevitable emergence of new pathogens is surveillance of humans, are phylogenetically most similar to EBOVs isolated during the 1995-1996 particularly those living in locations that are most vulnerable. Isolation of a outbreaks in Middle Africa, rather than more recent isolates. EBOVs from novel pathogen from a person exhibiting symptoms or animals experiencing the 2017 DRC outbreak in northern DRC (Yambuko) and 2018 outbreak die-offs can occur in literally a matter of days. Scarce resources should be in western DRC (Bikoro) also cluster in a manner that further challenges prioritized to surveillance efforts for known pathogens such as EBOV and a simple monophyletic clock. The now uncertain evolutionary trajectory of LASV. Employing rapid and effective point-of-care diagnostics designed for EBOV is only one of many conundrums surrounding Ebola emergence. environments that lack advanced laboratory infrastructure will greatly aid in early detection and containment efforts during future outbreaks. In contrast to EBOV whose reservoir is currently unknown, most LASV infections result from contact with Mastomys natalensis, the major natural G-101 reservoir. Previous phylogenetic investigations of LASV reported extensive PEPFAR- challenges and opportunities viral genetic diversity and established the presence of at least six viral lineages across West Africa. The surge of Nigerian Lassa fever cases in 2018 Mark Dybul, MD, Georgetown University is not attributable to a single Lassa virus strain, nor has it been sustained by human-to-human transmission (Siddle et al., accepted). Extensive viral The Lancet called the US President’s Emergency Plan for AIDS Relief diversity structured by geography, with major rivers appearing to act as “the most effective international health initiative in history.” Launched in barriers to migration of the rodent vector. Together these results suggest President George W. Bush’s 2003 State of the Union address, the session that the 2018 Lassa fever surge was driven by cross-species transmission will look back on the past 15 years and look forward to the challenges and of multiple viral strains from local rodent populations. opportunities ahead.

The rapid availability of genomic sequence information for the recent Ebola G-102 outbreaks and the Lassa surge in Nigeria highlights the fact that there have Getting to the Last Mile in HIV Epidemic Control been fundamental changes in the ways that the international community responds to outbreaks. At the beginning of the West African outbreak Permanent Secretary Jabbin Mulwanda, Health Services, Zambia governments, often acting on the advice of outside “special” advisors, withheld information on actual numbers of cases. The threat of spread of the There is greater global focus on increasing efforts towards the HIV epidemic virus was minimized because it was felt that the outbreak would “burnout” control. To achieve this, nations should limit the annual number of new HIV within a timeframe of a few weeks, and that releasing actual case numbers infections to less than the number of deaths among people living with HIV. would have a deleterious effect on the already fragile economies. Real- time case reporting has since become the norm. In prior outbreaks it was Dr. Mulwanda discusses the status of the Sub-Saharan Africa epidemic and argued that no research, including genomic sequencing, should be done uses the Zambian approach on being granular and employing targeted, in an outbreak, so as not to impede the public health response. Promising data-driven and cost-efficient approach, in order to reach the last mile. He experimental treatment and vaccines were withheld from Africans, including discusses how taking this scientific evidence to scale requires reorienting researchers with long experience with VHFs. While some trials of vaccines HIV program leadership and augmenting health workforce so as to and drugs did occur late in the outbreak, in most cases definite results accelerate progress towards HIV Epidemic Control. of effectiveness were not obtained due to diminishing case numbers. It is encouraging that a rVSV-ZEBOV vaccine is being rapidly deployed in 20th Annual International Meeting of the Institute of Human Virology 45 Speaker Abstracts

G-103 Results. From 2004-2018, our programs have implemented models of care Research in the Age of PEPFAR: Evidence Generation and for delivering HIV/AIDS and related services for rural, peri-urban and the Utilization urban poor in ten countries. These programs have resulted in: 1) provision of antiretroviral treatment to over 1 million PLWH including 285,000 who are Laura Guay, MD, George Washington University, Elizabeth Glazer Pediatric enrolled in current programs; 2) reduced mother-to-child HIV transmission AIDS Foundation from 7.8% in 2010 to less than 2.5% by September 2016 in Kenya; 3) increased access to prevention of mother-to-child transmission (PMTCT) No abstract interventions, 4) trained more than 50,000 healthcare providers in resource- limited settings; 5) increased comprehensive combined prevention services to key and priority populations; 6) implementation of novel electronic health G-104 records solutions; 7) led HIV and health policy and guidelines development; and 8) institutionalized data and evidence use as part of continuous quality improvement initiatives in more than 1,500 health facilities. Significantly, Scott Geibel, MHP, PhD, Population Council these programs have improved key patient and population health outcomes including achieving more than 90% virologic suppression among PLHIV No abstract. receiving antiretroviral treatment in CIHEB programs.

G-105 Conclusions Currently, CIHEB implements programs in 7 countries as Academic institutional impact on global HIV pandemic response: a key partner to local government health authorities. Working through A decade of Implementing PEPFAR programs by University of local systems and with national institutions has been critical to our Maryland Baltimore achievements, while the application of academic principles of inquiry to program interventions and adaptation of innovations to new settings has Deus Bazira, DrPH, MBA, MPH, BPharm, Institute of Human Virology’s provide a template for success. We present the CIHEB model as an optimal Center for International Health Education and Biosecurity,University of framework for global health involvement that allows for integration of global Maryland School of Medicine, Cassidy Claassen, MD, MPH, nstitute of best practices and local knowledge throughout the implementation process. Human Virology, University of Maryland School of Medicine, Baltimore, Emily Koech, MMed MPH, Institute of Human Virology, University of Maryland School of Medicine, Baltimore, Reson Marima, MMed, MSc, Institute of Human Virology, University of Maryland School of Medicine, Baltimore, Marie-Claude Lavoie, Institute of Human Virology, University of Maryland School of Medicine, Baltimore

Background. The global HIV burden remains high with nearly 40 million persons living with HIV (PLWH) to date. Encouragingly HIV incidence and AIDS-related mortality have dropped significantly over the past 20 years due in part to availability of antiretroviral treatment in all parts of the world most especially in resource-limited countries. Global interventions such as U.S President’s Emergency Plan for AIDS Relief (PEPFAR) and the Global Fund to Fight TB, Malaria and AIDS (GFATM) are credited for this unprecedented response. As a result, to date more than 22 million are receiving antiretroviral treatment. The Center for International Health, Education and Biosecurity (CIHEB) and its predecessors within the Institute of Human Virology (IHV) at the University of Maryland Baltimore (UMB) has played a key role in the global HIV response since PEPFAR inception.

Methods. Under PEPFAR 1.0 which focused on decreasing the high mortality rate due to HIV our interventions aimed at enhancing provider competencies and health facility care processes to deliver quality HIV services. PEPFAR 2.0 placed emphasis on transition of health programs to local ownership for sustainability, and we shifted our focus to building technical stewardship capacity to sustain key programmatic interventions. PEPFAR 3.0 has focused on achievement of epidemic control and likewise our strategies have evolved to implementation of targeted health-systems strengthening and community-owned innovations for achievement and sustenance of HIV epidemic control. Our approaches have included: using data and evidence to inform decisions, policy and practice; ensuring effectiveness and competence of highly trained multi-disciplinary teams; building robust data and information systems; modeling care delivery; and institutionalization of continuous quality improvement to enhance service delivery. It is imperative that we assess the impact of these interventions in order to optimize future academic institutions’ engagement in global health.

20th Annual International Meeting of the Institute of Human Virology 46 Speaker Abstracts

H-101 performance score (five of seven patients). Serial imaging of these children The Development of Oncolytic Herpes Simplex Viruses for the demonstrates continued improvement 18 months after a single treatment. Treatment of Glioblastoma Multiforme These data taken together for both viruses indicate safety of intracerebral Richard Whitley, MD, The University of Alabama at Birmingham inoculation of an engineered HSV. Specifically, in no patient was there evidence of herpes encephalitis or any other form of encephalitis. In In the pursuit of genes that influence the pathogenesis of herpes simplex addition, while the data are limited, preliminary findings suggest a beneficial virus (HSV), the γ134.5 gene was identified between the Roizman and survival effect for the children who participated in this trial. The results of Whitley laboratories. It is a diploid gene that maps in the inverted repeat the adult studies with M032 are ongoing. Serial outcome data, including of the UL segment of the genome. This gene controls neurovirulence, radiological responses will be presented. replicating in dividing cells but not post mitotic cells. Studies with an HSV deleted in both copies of γ134.5, demonstrated that direct intracerebral H-102 inoculation failed to result inmortality, even at doses of 106 viral particles. The Potential Role of “Defective” Proviruses in the Pathogenesis A virus in which the gene was re-engineered back into the genome of HIV-1 Infection resulted in neurovirulence equivalent to that of wild type virus. Further, it was recognized that this virus was capable of replicating in tumor cells, H. Clifford Lane, MD, NIAID/NIH, Hiromi Imamichi, PhD, NIAID/NIH prompting studies in a variety of different tumor models. Among the most susceptible were cells obtained from patients with glioblastoma multiforme. A pool of CD4+T cells harboring HIV-1 proviruses is established early during This first-generation virus, G207, in addition to the deletion of both copies HIV-1 infection and persists despite years of suppressive combination of the γ134.5 gene, also had a second site mutation in ribonucleotide antiretroviral therapy (cART). Greater than 95% of the proviruses in these reductase. This latter mutation was introduced to prevent the potential for pools are “defective” due to large internal deletions and lethal genetic reversion of G207 to wild type virus, ergo restoring its neurovirulence. In mutations. Although unable to encode intact viruses, these “defective” order to improve replication competence of G207, a second-generation proviruses are biologically active, transcribe HIV-RNA and produce HIV-1 virus, M032, was engineered that similarly had deletions in the γ134.5 gene proteins in vivo. We hypothesize that ongoing production of foreign proteins but now expressed human-IL-12 which was capable of inducing an immune from these translationally-competent yet defective HIV-1 proviruses response in the brain as well also having anti-angiogenic properties. contribute to the persistent immune activation and systemic inflammation during suppressive ART. In order to test the hypothesis that G207 had a biological effect, studies of intratumoral administration in, first, SCID mice and, then, immune competent mice demonstrated prolonged survival and, in some cases, survival with no evidence of residual tumor. Further, the kinetics of viral replication in these tumors was established which proved enhanced replication with M032 as compared to G207. To determine if it was possible to further enhance viral replication, low grade radiation was introduced into the experimental murine studies. In so doing, viral replication was enhanced by approximately one log additionally.

Biodistribution studies work performed in aotus monkeys proved safety with no evidence of toxicity. Importantly, attempts at reactivation of virus from sensory ganglia and the brain were unsuccessful. With these data, clinical grade production of virus was undertaken, according to GMP regulations.

Three phase 1B studies have been completed in adults with recurrent glioblastoma multiforme utilizing the first generation virus, G207. The studies were dose-escalating and undertaken to prove safety and potential efficacy.With the third study, low-dose radiation was added to the clinical protocol.The following findings were noted. First, there was no evidence of toxicity upon direct occupation of G207 into the tumor bed. Second, no patients excreted G207 from a peripheral site. Third, of the patients entered in the clinical trial, five of 27 were long term survivors with no evidence of residual tumor >3 years after inoculation. For our adult studies, M032 was introduced into a similar population to again determine safety and the potential for efficacy in a dose-escalating fashion. These studies are ongoing.

In parallel, studies in children with recurrent glioblastoma multiforme have been initiated with G207. Parenthetically, G207 replicates by a log greater in pediatric tumors as compared to those of adults. The results obtained to date again indicated no evidence of toxicity upon direct intratumoral inoculation in the brain and, more importantly, long-term survival several of these children both without evidence of relapse and an improved Karnosky 20th Annual International Meeting of the Institute of Human Virology 47 Speaker Abstracts

H-103 early 1970s. Clinical landscape of adult T-cell leukemia: its impacts on hematology, virology, and immunology In the initiation of Adult T-Cell Leukemia (ATL) research, both of my mentors Drs. Kimishige Ishizaka and Kiyoshi Takatsuki have been involved. Masao Matsuoka, MD, PhD, Kumamoto University Dr. Kiyoshi Takatsuki was a kind of hero of our medical school in B cell Prof. Takatsuki and his colleagues reported adult T-cell leukemia (ATL) malignancy multiple myeloma and Heavy Chain Diseases. Dr. Kimishige as the distinct clinical entity based on the clinical features including the Ishizaka, Discoverer of Immunoglobulin E (IgE) reaginic antibody, and Dr. presence of leukemic cells with characteristic nuclear shape (flower cells), Takatsuki had been working in the field of Immunoglobulin and myeloma skin lesion, hypercalcemia and frequent opportunistic infections, and mature proteins with great pioneers including late H Kunkel, and EF Osserman. T-cell immunophenotyped (Uchiyama T, et al., Blood, 1977). Importantly, they already predicted that ATL is caused by the pathogen since the birth Before my first description of ATL Cases with Dr. Takatsuki and the active places of ATL patients accumulated in the southwestern Japan (Kyushu instruction of late Dr. Toru Masuda in the Institute for Virus Res (IVR) of and Okinawa). In 1980, Prof. Gallo and his colleagues reported the first Kyoto Univ. returning from the Late Dr. L Herzenberg in Stanford Univ., human retrovirus, human T-cell leukemia virus (HTLV), from a patient with I had been involved in the study of peculior myeloma-related disease, cutaneous T-cell lymphoma who was later diagnosed as ATL. Thereafter, POEMS Syndrome/ Takatsuki Disease/ Crow-Fukase Syndrome. The it was established that HTLV causes ATL. Since Prof. Gallo found another POEMS Syndrome are characterized by polyneuropathy, organomegaly, human retrovirus, the first human retrovirus was named human T-cell endocrinopathy, myeloma protein, and skin changes. Drs. Y. Nishitani and leukemia virus type 1 (HTLV-1). Late M. Fukase in Kyoto Univ. also contributed in this Takatsuki Disease/ Syndrome research. Indeed, Dr. Takatsuki was a kind of hero of our medical Detection of anti-HTV-1 antibody enables us to identify HTLV infected school in B cell malignancy multiple myeloma and HeavyChain Diseases, individuals, which discloses unique distribution of HTLV-1carriers in Japan before ATL and HTLV. and the world. In addition, serological studies disclosed clinical landscape of ATL. Based on clinical features, ATL is classified to four clinical subtypes: Retrospectively, the study of adult T cell leukemia (ATL) and the related acute, chronic, lymphoma-type and smoldering types (Yamguchi K, et al, virus HTLV-I was a forerunner for all of human retrovirology, in which Blood, 1983). In addition, the familial clustering of ATL cases was prominent, AIDS and the related retrovirus HIV were identified a few years later in suggesting that genetic or virological factors are involved in development the 1980s. I remember the great contribution of late Dr. Yohei Ito, who of ATL. Serological analyses found that HTLV-1 mainly transmits from had initiated the cooperative interaction between Kyoto and Dr. Gallo in male to female in horizontal transmission. Another clinical feature of ATL NCI in 70’s. Using the anti-TAC monoclonal antibody generated by the is the frequent spontaneous remission, which suggests immunological late Dr. Takashi Uchiyama, my close colleague, during his stay in Dr. T. A. mechanism. Waldmann’s laboratory in NIH Bethesda, a cDNA encoding IL-2Ra chain was cloned by our group in Kyoto and by Waldmann’s group in Bethesda. Early studies of HTLV-1 focused on Tax, which not only transactivates viral Abnormal IL-2Ra chain expression and the IL-2 dependency of ATL cell genes transcription from the plus strand, but also influences cellular genes. lines greatly contributed to the study of leukemogenesis of ATL. A new However, Prof. Takatsuki’s group thought that clinical ATL samples contain soluble factor named ADF/ATL-derived factor was also detected in ATL clue of leukemogenic mechanisms by HTLV-1. We found that Tax was not cell lines. Dr. Michiyuki Maeda greatly contributed establishing many ATL expressed in half of ATL cases, and three mechanisms of inactivation of cell lines with his green thumb. After years of study, ADF proved to be a Tax expression: deletion of 5’ long terminal repeat (LTR), DNA methylation first human counterpart of thiol-related oxido-reductase thioredoxin/TRX, of 5’LTR, and genetic changes of the tax gene (nonsense mutation, deletion which opened the field of redox regulation of cell signaling involved in a and insertion), indicating that Tax is not necessary for maintenance of ATL variety of diseases. Quite interestingly, TRX-family member protein, GIF/ (Tamiya S, et al., Blood, 1996). However, pX region and 3’LTR remain intact MIF involved in the IgE regulation was characterized by the group of Dr. K. in all ATL cases, indicating that this region is critical for ATL. Thereafter, Ishizaka who have moved from J. Hopkins Univ. Baltimore to La Jolla, LIAI. we showed that HTLV-1 bZIP factor (HBZ), which is encoded by the minus Close interaction among Drs. Kimishige Ishizaka,Kiyoshi Takastuki and T. strand, plays critical roles for pathogenesis by HTLV-1. A. Waldmanns before ATL and HTLV-I study was an essential base for our initiation of ATL research with late Takashi Uchiyama and many other close ATL is the first human disease caused by retrovirus. Tremendous efforts on colleagues. I remember Dr. Gallo’s helpful comment on the importance of HTLV-1 research by many researchers contribute to studies of next human the Three Letter naming of ATL and ADF. retrovirus, human immunodeficiency virus (HIV). Thus, discovery of ATL in association with identification of causative human retrovirus leads to great In the therapeutic directions of ATL, monoclonal antibody seems to be still contribution to medical science. struggle: 1) Anti-Tac IL-2Ra Chain Therapies have been geared by TA Waldmann Group with many coworkers. However, the therapeutic effectiveness may H-104 be limited; 2) Anti-CCR4 mAbs applied to ATL cases by Dr. R Ueda Group ATL, ADF and Human Virus Research in Japan is therapeutically effective. However high frequency of severe side effect namely Stevens-Johnson Syndrome, Toxic Epidermal Necrolysis Junji Yodoi, MD, PhD, Kyoto University, IVR/JBPA (SJS/TEN) have been reported. Prehistory of ATL Discovery and ADF/TRX I may recall great contribution of late Drs Takashi Uchiyama, Mitsuru Tsudo, Kazumasa Usami in Kyoto Univ. and Thomas Tursz of IGR Paris More than forty years have passed since our initial description of peculiar in our early ATL and ADF research. This paper is also dedicated for late cases of adult-onset leukemia with abnormal cells having multi-convoluted Dr. Kimishige Ishizaka, discoverer of IgE and my great mentor close to Dr. nuclei and T cellproperties, frequent in the southern regions of Japan in the Kiyoshi Takatsuki. 20th Annual International Meeting of the Institute of Human Virology 48 Speaker Abstracts

I-101 I-103 Quaternary Contact Improves the Potency of Broadly Neutralizing HIV-1 cell-to-cell infection during acute infection and resistance to Antibodies to the CD4-Binding Site of HIV-1 neutralizing antibodies

Paolo Lusso, MD, PhD, LIR, NIAID, NIH, Qingbo Liu, PhD, LIR, NIAID, Benjamin Chen, MD, PhD, Icahn School of Medicine at Mount Sinai, NIH, Yen-Ting Lai, PhD, VRC, NIAID, NIH, Mark Louder, PhD, VRC, Kenneth Law, PhD, Rocket Pharmaceuticals, Hongru Li, PhD, Icahn NIAID, NIH, Peter D Kwong, PhD, VRC, NIAID, NIH, John R Mascola, School of Medicine at Mount Sinai MD, VRC, NIAID, NIH Interactions between infected T cells and uninfected T cells called Broadly neutralizing antibodies (bNAb) directly cloned from HIV-infected virological synapses (VS) enhance HIV-1 infection. When studied in vitro, individuals are attracting increasing consideration for the prevention and this mode of transmission results in the frequent co-transmission of multiple treatment of HIV-1 infection. We recently reported the identification of copies of HIV-1 across the VS, which can reduce sensitivity to antiretroviral a second, quaternary CD4-binding site (CD4-BS) in the native HIV-1 drugs. Our studies of HIV-1 infection in humanized mice, have measured envelope trimer, showing that selected anti-CD4BS NAbs also establish the frequency of co-transmission and the spatiotemporal organization of quaternary interactions with a neighboring gp120 protomer through the infected cells as indicators of cell-to-cell transmission in vivo. We inoculated extended framework 3 (FR3) loop of their heavy chain. In contrast, some mice with cells co-infected with two viral genotypes distinguished by two potent bNAbs like VRC01 and N6 contain a shorter FR3 loop and appear different fluorescent proteins, and observed high levels of co-transmission to interact with a single gp120 protomer. Here, we used structure-based to target cells. The mixed genotype of the input cells was preserved in engineering to engraft the extended FR3 loop of VRC03 onto four potent the first round of infection in vivo, suggesting that cell-to-cell transmission anti-CD4 supersite antibodies, namely, VRC01, VRC07, N6 and 3BNC117, occurs in vivo. Micro-anatomical clustering of viral genotypes within with the aim of enabling them to contact an adjacent gp120 promoter. With lymphoid tissue indicates that viral spread is driven by local processes and the exception of 3BNC117, all the chimeric antibodies showed an enhanced not a diffuse viral cloud. Intravital splenic imaging reveals that anchored neutralizing capacity against the majority of a large HIV-1 envelope panel HIV-infected cells can induce arrest of interacting, uninfected CD4(+) (208 strains), which correlated with an increased binding affinity for the pre- T cells to form Env-dependent cell-cell conjugates. Viral neutralization fusion envelope trimer. The crystal structure of one engineered antibody, studies indicate that antibodies are less potent in their inhibitory capacity N6 FR3-03, was solved in complex with a soluble stabilized trimer, BG505 against cell-to-cell infection, when compared with the same virus presented SOSIP.664, which allowed to visualize the quaternary interaction of the in a cell-free form. Antibodies are both less potent and also can display engrafted FR3 loop with residues at the base of the V3 loop of a neighboring significant decreases in the maximum inhibitory potential. We present gp120 protomer. Thus, engraftment of the VRC03 FR3 loop enabled potent models whereby HIV-1 spread between immune cells can be anatomically anti-CD4BS antibodies to establish quaternary contact with a neighboring localized into infectious clusters and is represents an important mechanism protomer of the HIV-1 Env timer, leading to increased neutralization of evasion from antibody responses. potency. FR3 loop-chimeric bNAbs may be considered for applications in HIV-1 prevention and treatment. I-104 Distinct Chromosomal Positions of Intact HIV-1 proviruses I-102 Viral Fitness Costs and Benefits of Disrupting the Host Cell Actin Mathias Lichterfeld, MD, PhD, Brigham and Women’s Hospital/Harvard Cytoskeleton in Mucosal HIV-infection Medical School

Thorsten Mempel, MD, PhD, Massachusetts General Hospital, Shariq A small reservoir of chromosomally-integrated, genome-intact but Usmani, PhD, Massachusetts General Hospital, Thomas Murooka, PhD, transcriptionally-silent HIV-1 proviruses persists lifelong despite suppressive Univesity of Manitoba antiretroviral therapy, and makes HIV-1 infection an incurable disease. Yet, very little is known about the positions of such intact proviruses in the HIV-1 disrupts multiple processes that support the motility of infected host human genome, or the mechanisms that contribute to maintaining their cells, including expression and proper localization of chemokine receptors, transcriptional latency. Here, we used a novel experimental approach their downstream signal transduction machinery, and proteins regulating involving multiple displacement amplification of individual HIV-1 proviral actin cytoskeletal turnover. While models have been developed to explain species, followed by near full-length HIV-1 next-generation sequencing and how these conserved lentiviral activities support HIV replication, their role corresponding chromosomal integration site analysis to selectively map the and relative importance for HIV infection in vivo are largely unexplored. chromosomal positions of intact HIV-1 proviruses in three HIV-1-infected Recently, intravital microscopy studies in advanced humanized mouse individuals undergoing long-term antiretroviral therapy. We observed that models of HIV infection have enabled the visualization of the dynamic in comparison to defective proviral sequences, intact HIV-1 proviruses behavior of HIV-infected cells in the environmental context of lymphoid were enriched for non-genic chromosomal positions and more frequently tissues, such as spleen and lymph node. Our lab is studying how HIV displayed an opposite orientation relative to host genes. In addition, alters the migratory behavior of HIV-infected T cells in lymph nodes of intact HIV-1 proviruses were preferentially integrated either in relative BLT humanized mice, and how these alterations affect viral replication and proximity or in increased distance to active transcriptional start sites and persistence. We will present and discuss our recent findings on the roles of to accessible chromatin regions. These studies strongly suggest selection the HIV envelope, and the accessory Vpu, and Nef proteins in this context. of intact proviruses with features of deeper viral latency during prolonged antiretroviral therapy, and may be important for developing targeted strategies to purge the genome-intact viral reservoir.

20th Annual International Meeting of the Institute of Human Virology 49 Speaker Abstracts

I-105 Project and discuss a group of children from Rome, Italy. The goal of the Nonhuman Primate Models in the Study of Early Events in AIDS present study is to evaluate HIV-specific immunity of vertically HIV infected Virus Infection children in relation to timing of ART initiation.

Jeff Lifson, MD, AIDS and Cancer Virus Program, Frederick National Methods: The study group consists of older vertically infected HIV+ Laboratory children and adolescents who initiated ART at different ages after birth and have maintained durable viral control (plasma HIV-RNA<50cp/mL). Nonhuman primate (NHP) models have proven invaluable for the detailed Immunologic studies were performed in 27 children (at ages 2.1-15.7yrs) study of many aspects of AIDS virus pathogenesis difficult or impossible of whom 22 had started ART early, at age <6 mo [early treated (ET)] and 5 to study with comparable rigor in HIV infected humans. Key aspects who started ART later, at age >2 yrs [late treated (LT )] with ET experiencing of HIV infection in humans can be authentically recapitulated in NHP longer duration of ART (p<0.05) at the time of study. ET children were also models. Experimental advantages of NHP models include the ability to evaluated by HIV serology (Abbott Architect HIV Ag/Ab Combo Assay) exactly control the identity, dose, route, and timing of the viral inoculum to establish if they were seropositive (SP) or seronegative (SN) to HIV. employed, control over the timing of initiation and discontinuation of various Flow cytometry was performed using BD LSRFortessa for T cells and BD experimental interventions and the ability to conduct in vivo proof of concept FACS Aria II for B cells. HIV-gag specific CD4+ and CD8+ T cells were studies of promising but unproven and potentially dangerous treatments. As investigated by flow cytometry in cryopreserved PBMC for the induction AIDS virus infection is a tissue based disease, perhaps the most important of intracellular cytokines (IL-2, IFN-g, TNF, IL-21) in CD40L+ CD4+ T cells advantage of NHP models is the ability to obtain extensive longitudinal and intracellular cytokines (IL-2, IFN-g, TNF) as well as Perforin, Granzyme tissue samples, including from scheduled euthanasia and necropsy with B and CD107a in CD69+ CD8+ T cells following 12hr stimulation with HIV extensive tissue collection and analysis. gag PTE peptides. In addition, Env-specific CD4+ T cells were evaluated following 12 hr stimulation of PBMC with Env peptides. IgD+ and IgM+ B Early events in the course of AIDS virus infection are critically important, but cell subsets were determined in gp140+ B cells. Moreover, env-specific difficult to study in HIV infected humans, due to factors that often include and non-specific B cells were sorted to perform transcriptomic analysis delayed diagnosis, and uncertainty about the exact timing of exposure, with Fluidigm (Biomark). Differences between groups were determined by along with lack of availability of informative tissue specimens. NHP models unpaired or Mann-Whitney t tests if the data were normally distributed or therefore have an important role to play in the study of early events in AIDS not, respectively. virus infection. Using examples from our recent studies, results will be presented in a series of vignettes demonstrating the utility of NHP models Results: In this group of HIV+ children, frequencies of HIV gag-specific for the study of early events in infection, including: i. the use of a sequence CD4+ T cells and CD8+ T cells were similar between ET and LT but differed tagged viral inoculum for tracking independent chains of infection events in qualitatively. Gag stimulated CD4+ T cells of ET exhibited higher proportions vivo involved in mucosal viral transmission and systemic dissemination of of IL-21 and IFNg with enrichment of polyfunctional T cells defined by the infection; ii. the impact of early implementation of combination antiretroviral simultaneous presence of 3 or more cytokines. Gag stimulated CD8+ T cells drug treatment (cART) on limiting the extent of establishment of a durable, of ET exhibited higher frequencies of cytotoxic cells (CD107a+Perf+GrzB+). recrudescence competent viral reservoir; iii. the contribution of arrest of viral replication at distal sites, after initial dissemination from a mucosal In ET, serologic evaluation of HIV Ab revealed 6/22 (27.3%) to be SN. portal of entry, to protection from infection mediated by broadly neutralizing The gp140-specific CD4+ T cell frequencies were similar in SN andSP monoclonal antibodies; and iv. the early establishment of expanded clones but intracellular IL-21 expression was higher in SP. Frequencies of of CD4+ T cells harboring clonally integrated proviruses that may contribute gp140+ CD19+ B cells were similar between SN and SP, but HIV-specific to the recrudescence competent viral reservoir that persists during cART. CD27+ memory B cells were predominantly IgM+ in SN while in SP, the gp140+CD27+ memory B cells were enriched in IgD- cells. Gene expression signatures in gp140+IgM+ cells revealed upregulation of genes involved in I-106 both plasma cell differentiation (PRDM1) and GC reaction (BCL6) only in Early treatment initiation in children with vertical HIV infection SP after in-vitro stimulation. influences HIV specific immune responses Conclusions: Time of ART initiation after birth has a long-term impact Stefano Rinaldi, MD, University of Miami School of Medicine, Miami, Nicola on the quality of the host HIV-specific immune responses in vertically Cotugno, MD, PhD, University of Rome “Tor Vergata”/Childrens’Hospital infected HIV+ children with durable virus suppression. Earlier ART initiation Bambino Gesu, Suresh Pallikkuth, PhD, University of Miami Miller School is associated with preserved HIV gag-specific CD4+ and CD8+ T cells. of Medicine, Elena Morrochi, MSc, University of Rome “Tor Vergata”/ Moreover, even in those who become seronegative for HIV, the HIV Env- Chairs of Pediatrics Department of Public Health, Rome, Rajendra Pahwa, specific CD4+ T cells and B cells persist, the latter demonstrating a blunted MD, University of Miami Miller School of Medicine, Paolo Palma, MD, PhD, differentiation with enrichment of IgM+ B cells. ET children with consistent University of Rome “Tor Vergata”/Childrens’Hospital Bambino Gesu, Savita viral control are prime candidates for therapeutic approaches aimed at Pahwa, MD, University of Miami Miller School of Medicine permanent remission of HIV. These studies are supported by ViiV Health Care grant to EPIICAL and NIH grant AI127347 to SP. Background: Despite successes in prevention of mother to child HIV transmission (MTCT), issues related to early diagnosis, ART initiation and adherence play a role in the disease course of HIV infected children. Early ART initiation in HIV infected infants leads to reduced size of HIV reservoirs and curtails clinical progression but role of the immune system in this process is not well understood. With early initiation of ART, HIV infected infants preserve their CD4+ T cells and in some instances remain seronegative for HIV due to limited exposure of B cells to HIV antigen. We are performing immunologic assessments in the HIV Exposed Pediatric Patients (HEPP) 20th Annual International Meeting of the Institute of Human Virology 50 Speaker Abstracts

I-107 Teams (HITs). Composed of HCV providers and system redesign (process Long-range allosteric effects induced by Tax–HLA-A2 binding to improvement) experts, HITs were coached in the use of Lean methodology an anti-HTLV-1 TCR: Implications for early T cell signaling to identify gaps in current care, develop solutions and implement changes, and measure improvement in care. Annually, each HIT prepared an A3 Sneha Rangaranjan, PhD, University of Maryland Institute for Bioscience (plan) describing their goals for improving HCV diagnosis and treatment. and Biotechnology Research, Yanan He, PhD, University of Maryland HITs reported activities towards their annual goals and shared their Institute for Bioscience and Biotechnology Research, Melissa Kerzic, MS, successful practices (“best practices”) on monthly conference calls with University of Maryland Institute for Bioscience and Biotechnology Research, HIT leadership coaches and other VISNs. Data on HCV screening and Buyong Ma, PhD, Frederick National Laboratory for Cancer Research, treatment starts, by facility, was updated monthly on the VA website, and Brian Pierce, PhD, University of Maryland Institute for Bioscience and was critical for implementing change. Annually, HIT leadership established Biotechnology Research, Ruth Nussinov, PhD, Frederick National goals for screening, treatment, and sustained virologic response (SVR) Laboratory for Cancer Research, John Orban, PhD, University of Maryland (steps in the HCV care cascade). Progress towards those goals was Institute for Bioscience and Biotechnology Research, Roy Mariuzza, PhD, reviewed monthly with the HITs. The NHCRC’s evaluation team assessed University of Maryland Institute for Bioscience and Biotechnology Research implementation strategies used by the most successful HIT’s, as measured by treatment starts at the facility. Change infrastructure, develop The mechanism whereby αβ T cell receptor (TCR) engagement by peptide– stakeholder relationships, and use evaluative/iterative strategies were three MHC (pMHC) is first communicated to the CD3 signaling apparatus of the of strategies used by the most successful HITs. TCR–CD3 complex, a process termed early T cell activation, is not well understood. To address the possibility that pMHC binding induces allosteric As of summer 2018, HCV screening of the 1945-1965 birth cohort had changes in TCR conformation and/or dynamics that are relayed to CD3, we increased above 80%. The VA had treated more than 110,000 patients carried out NMR analysis and molecular dynamics (MD) simulations of both with DAAs, which included many with older age (>60), and/or substance the α and β chains of a human antiviral TCR (A6) that recognizes the Tax use disorders/mental health diagnoses. Approximately 88% of treated antigen from HTLV-1 bound to HLA-A2. We observed pMHC-induced NMR patients had been tested for SVR12, and among those tested, SVR12 rates signal perturbations in the TCR V domains that propagate to three distinct exceeded 95%. Of the approximately 28,000 patients remaining to be sites in the C domains: 1) the Cβ FG loop that projects from the Vβ/Cβ treated, it is estimated that between 10-15,000 are currently not candidates interface, 2) a cluster of Cβ residues near the Cβ αA helix, a region involved because of patient preference for non-treatment or treatment-limiting in interactions with CD3, and 3) the Cα AB loop located at the membrane- co-morbidities. The number of patients starting treatment each month proximal base of the TCR. A biological role for each of these allosteric sites continues to decline, as it has since ~6/2016, although >1,000 patients still is supported by previous mutational and functional studies of TCR signaling. start treatment each month. In addition, the pattern of long-range ligand-induced changes in TCR A6 seen by NMR is broadly similar to that predicted by MD simulations. We In summary, VA has screened > 80% of the 1945-1965 birth cohort in propose that the unique structure of the TCR β chain enables allosteric current VA care and treated approximately 75% of the known viremic communication between the TCR binding sites for pMHC and CD3. patients in current VA care. Many of the remaining untreated patients have barriers to HCV treatment that VA is addressing. The VA has a goal of 90- 90-90 (screening, treated, documented SVR) by 2020. Sufficient funding for medications, support from leadership, real-time data, and creating and J-101 sustaining teams on the ground trained in Lean management and system Diagnosis and Treatment of HCV in the VA Healthcare System redesign were critical to VA’s successes.

Rachel Gonzalez, MD, VA Long Beach Healthcare System, Angela Park, J-102 PharmD, VA Northampton Healthcare System, Pamela Belperio, PharmD, Approaches to Eliminate Persistent Viruses VA Greater Los Angeles Healthcare System, David Ross, MD, PhD, MBI, VA Washington DC Healthcare System, Maggie Chartier, PhD, VA San Eleanor Wilson, MD, MHS, Institute for Human Virology, University of Francisco Healthcare System, Timothy Morgan, MD, VA Long Beach Maryland School of Medicine Healthcare System With new directly acting antiviral treatments for Hepatitis C, we are learning More than 145,000 Veterans were known to be HCV viremic and how to directly target and cure a persistent viral infection for the first time. approximately 66% of the 1945-1965 birth cohort had been screened for Dr. Wilson will discuss approaches to eliminating persistent viral infections HCV when all-oral direct acting antivirals (DAAs) were placed on the VA and promising future research directions. formulary in January 2015. Although the VA had addressed HCV screening and treatment for more than 15 years, the availability of highly effective treatments heightened the focus on HCV. Beginning in FY15, Congress appropriated additional funds for DAAs. VA negotiated favorable pricing for DAAs and wrote guidelines that allowed treatment of patients with and without cirrhosis as well as those with ongoing substance use disorders or mental health conditions. Training nurse practitioners (NP), physician assistants (PA), and clinical pharmacists (PharmD) resulted in more than 60% of patients being treated by non-physicians, with excellent success. In anticipation of the availability of DAAs, the VA created the National Hepatitis C Resource Center (NHCRC) to oversee HCV care in VHA in 2014. In collaboration with the VA’s New England Veteran Engineering Resource Center (VERC), the NHCRC created VISN-based Hepatitis Innovation 20th Annual International Meeting of the Institute of Human Virology 51 Speaker Abstracts

J-103 J-105 The International Coalition to Eliminate Hepatitis B (ICE-HBV). Novel antiviral targets for HBV elimination

Peter Revill, PhD, VIDRL. Peter Doherty Institute of Infection and Immunity, Claudia Hawkins, MD, MPH, Northwestern University Capucine Penicaud, Ms, Peter Doherty Institute of Infection and Immunity Chronic hepatitis B virus (CHB) infection continues to be a major global Background. Over 257 million people worldwide are chronically infected public health issue despite the availability of effective HBV vaccines. with hepatitis B virus (HBV), resulting in over 880,000 deaths per year from Approximately 257 million people worldwide are infected with CHB and cirrhosis and liver cancer. There is no known cure for chronic HBV, due in complications from HBV are now a leading cause of morbidity and mortality. part to the continued presence of transcriptionally active DNA in the nucleus The number of deaths from CHB now exceed >1 million per year. which is not directly targeted by current antiviral therapies. Our aim is to inspire and support the discovery of a safe, scalable and effective cure for In 2016, the WHO Global health sector strategy on viral hepatitis, announced the benefit of all people living with CHB. new goals to achieve a 90% reduction in new cases of HBV and hepatitis C (HCV) and a 65% reduction in mortality due to HBV and HCV by 2030. Methods. To achieve this, we have created an international research To achieve the ambitious HBV targets, significant progress is needed in driven forum, the International Coalition to Eliminate Hepatitis B (ICE-HBV), several key intervention areas along the continuum of HBV care including i) which is coordinating collaborative partnerships among researchers and improved access to HBV vaccination and drugs for the prevention of mother stakeholders to accelerate the search of an HBV cure. to child transmission; ii) more rapid and affordable diagnostics for improved screening and detection of HBV; and iii) innovative therapeutics that can Results. ICE-HBV working groups have developed a joint global scientific result in HBV cure. strategy for HBV cure, with input from key stakeholders including the HBV affected community. Through engagement with key stakeholders, ICE-HBV Current recommended therapies for CHB include either pegylated aims to drive changes in governmental policy to ensure more funds are interferon-alpha which stimulates innate immune responses against HBV or channelled to HBV cure research and drug development. ICE-HBV fosters oral nucleoside reverse transcriptase inhibitor (NUC) therapies which block new collaborations among HBV researchers and industry worldwide and the maturation of HBV genome into its infectious form and thus release initiate new projects to fast-track the discovery of an HBV cure. of infectious virus containing HBV DNA. While both therapies effectively suppress HBV DNA, they rarely result in complete loss of HBsAg, which Conclusions. The push for a cure for chronic HBV infection is particularly is needed to achieve functional cure, a serological state associated with a timely thanks to the recent development of cell culture infection models higher remission rate after treatment cessation, and lower rates of cirrhosis that, for the first time, empower truly curative research. Through its global and hepatocellular carcinoma. Sterilizing cure is unlikely to be achievable network, ICE-HBV is striving to promote effective collaboration and facilitate at the current time because of the persistence of the active transcriptional opportunities that can produce a cure for chronic HBV infection. template of HBV covalently closed circular DNA (cccDNA).

Recently there have been promising advances in the treatment of HBV that could potentially achieve widespread functional cure and bring us closer J-104 to achieving the ambitious WHO goals of HBV elimination. These include Towards a Functional Cure for HBV: An Industry Perspective the development of novel therapeutics that target various stages of the HBV lifecycle (e.g. HBV entry, viral replication, HBV cccDNA production, Anuj Gaggar, MD, PhD, Gilead Sciences and viral protein expression) and immunotherapeutic agents, as well as innovative treatment approaches with existing HBV therapies that seek Globally, Hepatitis B Virus (HBV) remains a public health concern. to maximize the possibility of functional cure. This goal of this talk us to Despite the availability of safe and effective suppressive therapies and an provide a comprehensive overview of these new developments in HBV effective prophylactic vaccine, there remains a need for the development therapeutics, covering the following key areas: i) current goals of treatment, of medication regimens that can lead to durable HBsAg loss with a finite- and definitions of HBV ‘cure’; ii) the HBV life cycle, antiviral targets and duration therapy, a functional cure. The dentification of novel therapies to investigational agents currently being developed that target virus including achieve a functional cure for HBV requires a thorough understanding of inhibition of viral entry, HBV surface antigen production and elimination the viral life cycle within the hepatocyte as well as the complex interactions or silencing of cccDNA; and iii) the use of novel surrogate markers (i.e. of the virus with the immune system. The development of appropriate quantitative HBsAg) to assess treatment response in clinical trials. model systems that faithfully recapitulate the virology and immunology of chronic HBV infection (CHB) facilitate screening efforts and can help evaluate efficacy of emerging therapeutic targets. Current approaches for a functional HBV cure include targeting viral RNA or protein products and augmenting the innate and adaptive immune response to HBV. It is expected that a combination of approaches will be required to achieve high rates of a functional cure. Further efforts to understand better patient heterogeneity will aid the development of these novel agents.

20th Annual International Meeting of the Institute of Human Virology 52 Speaker Abstracts

J-106 density (e.g., every week) to allow interrogation of the dynamic interplay Immune correlates of HBV cure between the shifting microenvironment and HPV detection. Prioritizing a focus on understanding the dynamics and immune mediators involved in Bhawna Poonia, PhD, Institute of Human Virology, University of Maryland healthy control of HPV infection may be an overlooked fundamental system School of Medicine, Baltimore component required to fully understand the causes of dysregulation of HPV infection and persistent detection. This represents a paradigm shift Hepatitis B infection in adults results in resolution and development of in studying the molecular epidemiology of human viral infections, reflects protective immunity, while in neonates, it results in HBV persistence without more fully a systems approach to understanding biological complexity, and development of protective immunity. Current treatment for chronic hepatitis may lead to development of less invasive interventions at earlier stages in B includes long term suppression with nucleotide analogs, which does not viral natural history to prevent severe pathological outcomes. lead to viral clearance. Though viral elimination strategies are actively being researched, sterilizing cure is unlikely to be feasible in near future and HBV References cure efforts are moving towards the more achievable functional cure. A 1. Gravitt PE. The known unknowns of HPV natural history. J Clin Invest. clear understanding of immune correlates of HBV phenotypes in different 2011;121(12):4593-9. patient populations is vital in pushing a functional cure strategy for chronic HBV infection. HBV specific B and T cells exhibit persistent exhaustion or 2. Strickler HD, Burk RD, Fazzari M, et al. Natural history and possible anergy in most patients with treated chronic infection. Developing strategies reactivation of human papillomavirus in human immunodeficiency virus- for reversal of exhaustion such as use of checkpoint block or breaking positive women. J Natl Cancer Inst. 2005;97:577-86. tolerance by reducing serum HBs antigen levels in NUC treated patients will be critical for restoring HBV specific immunity to levels that achieve 3. Nowak RG, Gravitt PE, Morrison CS, et al. Increases in human functional cure. Apart from adaptive immunity, strategies to boost innate papillomavirus detection during early HIV infection among women in immunity such as use of TLR agonists will further aid in development of HBV Zimbabwe. J Infect Dis. 2011;203(8):1182–1191. specific immunity in these patients. A combination strategy using antiviral and immunomodulation will thus be needed to achieve HBV functional cure. 4. Marks MA, Viscidi RP, Chang K, et al. Differences in the concentration and correlation of cervical immune markers among HPV positive and J-107 negative perimenopausal women. Cytokine. 2011;56(3):798-803. Interrogating the immunologic and microbial cervical 5. Gravitt PE, Marks M, Kosek M, et al. Soil-transmitted helminth infections microenvironment in HPV infection are associated with an increase in human papillomavirus prevalence and a T-helper type 2 cytokine signature in cervical fluids. J Infect Dis. Patti Gravitt, PhD, MS, George Washington University 2016;213(5):723-30. Infection with high-risk human papillomavirus (hrHPV) infection in the oral and anogenital mucosa has been confirmed to be a necessary but insufficient cause of invasive cervical cancer (ICC), which is a leading cause of cancer incidence and mortality worldwide. Over the past two decades, our understanding of the natural history of cervical hrHPV infection has evolved, especially with regard to the influence of co-infections and the dynamics of the cervical microenvironment. For example, it is now recognized that at least a proportion of hrHPV infections are immunologically controlled for long periods of time in an undetectable (latent) state, at risk of recurrent detection (reactivation) upon immune suppression [1]. This phenomenon is most clearly illustrated when comparing the HPV natural history in HIV- infected and HIV-uninfected individuals, where both incident and persistent detection of HPV is proportionally increased with increasing immune suppression [2]. Multiple new type cervical HPV detection increases nearly 4-fold within weeks of acute HIV infection, suggesting a key role for tissue resident T-cell memory in control of latent HPV infection [3]. In HIV-uninfected women, we have observed polarization toward T-helper type 2 immune profiles of the lower genital tract immune microenvironment. In an older, well-screened US population, HPV positive women exhibited immune profiles similar to those described in allergic inflammation [4]. In the developing world, we have reported an increased prevalence of HPV infection at older ages in Amazonian women with soil-transmitted helminth (STH) infection, who showed evidence of Th2-skewed immunity in lower genital tract secretions compared with STH-uninfected women [5]. This epidemiologic evidence, combined with experimental animal models of papillomavirus infection, collectively implicate a key role of host immunity in the control of cervical HPV infection and, by extension, risk of cervical cancer. This presentation will make a case that the time has come to move human HPV natural history studies away from traditional designs with large sample sizes and long interval censored sampling (e.g., every 6 months) to designs with smaller sample sizes and more frequent sampling 20th Annual International Meeting of the Institute of Human Virology 53 Speaker Abstracts

J-108 to the definition of HPV persistence (by means of epigenetic signatures) Role of DNA Methylation in Prediction of Human Papillomavirus and to the determination of treatment options. Persistence and Carcinogenesis It was originally thought that cervical cancer evolved from HPV infected Attila Lorincz, PhD, Wolfson Institute of Preventive Medicine, Queen Mary normal cervical epithelium via sequential progression through consecutive University of London pre-cancerous grades of CIN1, CIN2, CIN3 and early invasive cancer. However, we have shown by means of methylation signatures that CIN1 High risk human papillomavirus types (HPV) account for an estimated is not a pre-cancer and that CIN3 can evolve directly from normal HPV- 530,000 new cervical cancers and 270,000 deaths annually, most of which infected epithelium. We used epigenetic markers and HPV typing to occur in developing countries. In addition to cancer of the cervix HPV causes investigate two main models of precancerous cervical disease progression many other kinds of epithelial malignancies, including oropharyngeal, anal in areas of cervical lesions with discrete coexisting foci of different grades. and vulvar cancer. More than 25 types of HPV are transmitted through Methylation of tumor suppressor gene EPB41L3 and the viral regions of sexual contact but most infections do not cause symptoms and are cleared HPV16-L1/L2, HPV18-L2, HPV31-L1 and HPV33-L2 were determined after a short time. by a highly accurate quantitative pyrosequencing of bisulfite converted DNA. There was a significant trend of increased methylation with disease There is a well-defined premalignant phase in HPV carcinogenesis, which grade comparing normal to CIN1 and CIN3 (p<0.0001). CIN1 adjacent to makes HPV infection tractable to effective cancer prevention efforts and CIN3 predominantly shared the same HPV types as the CIN3, however, the study of molecular mechanisms involved in precancer progression methylation differed substantially between adjacent-CIN1 and CIN3 to frank invasive cancer. When HPV infection becomes persistent there (p=0.008). In contrast, diagnostically principal-CIN1 (no adjacent CIN3 is an increased chance of high grade cervical intraepithelial neoplasia detectable) had an indistinguishable methylation distribution compared (CIN3). It can take 10 to 15 years of persistent HPV infection to develop to CIN1 that was adjacent to CIN3 (p>0.1). Our results suggest that invasive cervical cancer. A clearer understanding of the molecular changes progression from normal epithelium to CIN1 or CIN3 is usually promoted by during HPV persistence leading to CIN3 and early cancer has provided the same HPV type but occurs via distinct DNA epigenotypes. more accurate biomarkers for diagnosis and prognosis and allows better informed consideration of preferential druggable targets for effective non- The implications of our results are profound and suggest that cervical cancer surgical elimination or stalling of persistent HPV infections. is predominantly or perhaps solely an epigenetic disease. To further test the epigenetic origin of cancer we performed extensive exome sequencing Current modalities for elimination of persistent HPV infection invariably of a large number of precancer specimens from women followed-up in involve physical removal or destruction of the affected tissues. These the UK ARTISTIC trial. We observed progression-related SNPs of both surgical options have a large effect in reducing the risk of incident cervical somatic and germline origin; however, it appears from omics comparisons cancer, albeit at the cost of considerable overtreatment and morbidity, that the epigenetic biomarkers are far more common and much stronger most especially serious complications during pregnancy. Follow-up studies than genetic biomarkers defined by Watson-Crick type changes. Despite consistently show that molecularly detectable HPV prior to treatment these contrasts it remains of interest to construct multivariable classifiers becomes undetectable after treatment, with the most ultrasensitive DNA composed of both epigenetic and genetic components in an attempt to tests. However, we must not confuse lack of detectability with elimination further improve predictions of precancer progression. These biomarker of the persistent viral reservoir. It is not known to what extent there remain signatures will directly impact on persistent HPV infections by allowing a hidden inactive reservoirs of HPV which can reactivate much later and more refined approach to treatment options. produce new disease. The age trend of HPV prevalence, where high levels of HPV DNA detectability in young women (25% or more) are followed by rather low levels of HPV prevalence in middle-aged women (5 to 10%) and subsequently by significantly increased prevalence in older women, suggests that a reactivatable silent reservoir remains, which leaves older sexually inactive women at risk of cervical cancer.

The study of DNA methylation levels of candidate human genes and the HPV genome is a way to shed light on the molecular progression of precancerous cervical lesions and on issues of HPV persistence. Most often studied is methylation at the 5-position of cytosine in a CpG motif. DNA methylation is a reproducible and mitotically stable epigenetic change involved in a variety of cellular processes that plays an important role in the progression of many different cancers. With respect to HPV-related disease, numerous studies have highlighted the importance of host and viral gene methylation in the development of cervical cancer and potential for use as biomarkers to triage HPV positive patients. A strong and statistically highly significant association is observed between DNA methylation patterns and CIN of various grades in both cervical scrapes and biopsies. DNA methylation in normal cervical epithelium and low-grade disease is generally absent or low. In contrast increased methylation is observed in patients with advanced intraepithelial lesions and very high levels are seen in carcinoma. These observations have been validated in many large studies in different countries and led to the development of clinically relevant DNA methylation classifiers such as S5. A growing role of DNA methylation testing is related 20th Annual International Meeting of the Institute of Human Virology 54 Speaker Abstracts

J-109 Sequential administration of LASER ART and CRISPR-Cas9 can facilitate HIV-1 elimination in humanized mice

Howard E. Gendelman, MD, University of Nebraska Medical Center, Omaha, NE, Kamel Khalili, PhD, Temple University School of Medicine, Philadelphia, PA

Eradication of the human immunodeficiency virus type one (HIV-1) requires either the clearance of infected cells or the removal of integrated proviral DNA from its cellular tissue reservoirs. Success is affirmed by the absence of viral rebound following prolonged cessation of antiretroviral therapy (ART). Here, we demonstrate that inhibition of HIV-1 infection in humanized mice with long-acting slow-effective release ART (LASER ART) followed by the treatment with CRISPR-Cas9 gene editing molecules aimed for the removal of the proviral DNA from host genome eliminates viral infection. In greater than third of HIV-1 infected dual treated mice virus could not be detected in blood, spleen, lung, kidney, liver, gut-associated lymphoid tissue and brain by ultrasensitive nested and digital droplet PCR and RNAscope tests. Excision of HIV-1 sub-genomic DNA fragments, spanning the LTRs and the Gag gene, was demonstrated with no evidence for off- target effects. No viral rebound was observed followed ART cessation and CD4+ T cell restoration. Progeny virus was not recovered after adoptive transfer of human immunocytes from dual treated virus-free animals to uninfected humanized mice. Direct co-cultivation of bone marrow and spleen human cells from virus eradicated animals with uninfected mitogen stimulated lymphocytes also failed in any attempt to recover progeny virus. In contrast, replication competent HIV-1 was readily detected in infected animals treated with LASER ART or CRISPR-Cas9 alone. These data provide the first proof-of-concept that viral sterilization is possible.

20th Annual International Meeting of the Institute of Human Virology 55 Speaker Abstracts

PB-1 7, 8 Dihydroxyflavone reduces mitochondrial dysregulation in the HIV-1 transgenic mouse model as a treatment for HIV associated Neurocognitive disorder (HAND)

Joseph Bryant, DVM, Institute of Human Virology, University of Maryland School of Medicine, Sanketh Andhavarapu, HS, Department of Neurology, University of Maryland School of Medicine, Muhammed Ikbal Arvas, MD, Department of Neurology, University of Maryland School of Medicine, Udit Gupta, HS, Department of Neurology, University of Maryland School of Medicine, Akhil Katuri, UnderG, Department of Neurolory, University of Maryland School of Medicine, Girma Asemu, PhD, VA Medical Center, Baltimore, Tapas Makar, PhD, University of Maryland School of Medicine, Harry Davis, DVM, Institute of Human Virology, University of Maryland School of Medicine

The introduction of combined antiretroviral therapy (cART) significantly increased the lifespan of HIV patients, turning a fatal disease to a chronic one. However, as a lower but persistent level of HIV infection remains, the susceptibility of HIV-associated neurocognitive disorder (HAND) is increased. Therefore, research is currently seeking improved treatment for this complication of HIV. 7, 8 Dihydroxyflavone (DHF) is a TrkB agonist that can cross the blood brain barrier and mimic the effect of Brain Derived Neurotrophic Factor (BDNF). Previous studies have described its potential as a treatment in a myriad of neurological diseases including Alzheimer’s disease, peripheral sensory neuropathies, amyotrophic lateral sclerosis, Parkinson’s disease, and Multiple Sclerosis. This study investigates mitochondrial dysregulation in the brain of HIV-1 Tg26 mice, a murine model of HIV, and the potential therapeutic effects of DHF treatment on this dysregulation in HAND. The mice were divided into three groups: wild type, untreated-Tg26, and DHF-treated Tg26 (Tg+DHF). Mice were sacrificed after 28 days and 7 µm thick paraffin sections of the brainof each mice were prepared. Tissues were immunohistochemically stained to detect the expression of mitochondria regulating proteins – SIRT3, PGC1-a, FIS-1, MFN-2, Citrate Synthase, SUR1, TRPM4 – in the hippocampal and cortex regions. Our results show, that in these regions of Tg26 mice, SIRT3, PGC1-a, FIS-1, MFN-2, and Citrate Synthase were present in decreased levels, implicating the extensive role of mitochondrial dysfunction in HAND pathology. However, following DHF treatment, Tg26 mice expressed these cells at greater levels, suggesting a possible mechanism of DHF. Furthermore, both SUR1 and TRPM4 were upregulated in Tg26 mice. Previous studies have shown that SUR1 and TRPM4 often co-assemble to form an ion channel that plays a significant role in central nervous system injury and calcium homeostasis. Calcium is a regulator of mitochondrial dynamics, suggesting that the upregulation of SUR1 and TRPM4 may contribute to the mitochondrial changes that are characteristic to HAND. Interestingly, administration of DHF resulted in decreased expression of SUR1 and TRPM4. Therefore, the present study suggests that DHF treatment in the hippocampal and cortex regions of the TG26 model plays a role in reducing mitochondrial dysfunction by regulating calcium balance via the SUR1-TRPM4 ion channels, indicating its therapeutic potential as a treatment for HIV-associated neurocognitive disorder.

20th Annual International Meeting of the Institute of Human Virology 56 Speaker Abstracts

PC-1 GVL and GVHD. Genetic and Pharmaceutical Inactivation of Hypoxia-Inducible Factor 1α Reveals a Molecular Switch from Graft vs Host PD-1 negatively regulates T cell immune function through the interaction with its ligand PD-L1. PD-L1 is expressed on both hematopoietic and Diseases to Graft vs Leukemia Effect non-hematopoietic cells, and the expression can be induced by immune stimulation. PD-1/PD-L1 blockade with monoclonal antibodies exacerbates Yin Wang, PhD, Institute of Human Virology, University of Maryland acute GVHD, and PD-L1 expression on parenchymal cells is critical for School of Medicine, Baltimore, Yan Liu, PhD, Institute of Human Virology, suppression of acute GVHD. CD8-intrinsic PD-L1 can promote GVL through University of Maryland School of Medicine, Baltimore, Chris Bailey, PhD, its interaction with CD80, while host tissue-intrinsic PD-L1 can mediate CD8 Institute of Human Virology, University of Maryland School of Medicine, T cell apoptosis and exhaustion in target tissues to reduce GVHD. We have Baltimore, Pan Zheng, MD, PhD, Institute of Human Virology, University shown that Hif1a mutation increased PD-L1 levels in CD8 T cells, making of Maryland School of Medicine, Baltimore, Yang Liu, PhD, Institute of it possible for a robust CD80-PD-L1 interaction on CD8 T cells. We also Human Virology, University of Maryland School of Medicine, Baltimore observed increased IFN-γ levels in the serum due to elevated frequency of Tc1 cells, which was shown to be the underlying cause of PD-L1 expression Introduction: Allogeneic hematopoietic stem cell transplantation in host tissues. Using anti-PD-L1 antibodies against either mouse or human (HSCT) is a curative option for hematopoietic malignancies and non- PD-L1, we probed the function of PD-L1 on T cells and non-T cells. Our malignant conditions such as sickle cell anemia and severe combined data showed that PD-L1 on non-T cells play a critical role in suppression immunodeficiency. However, graft-versus-host disease (GVHD) is a leading of GVHD by Echinomycin, while PD-L1 on T cells is not critical for GVHD. cause of morbidity and mortality associated with HSCT patients and limits Surprisingly, blocking either mouse or human PD-L1 is sufficient to cause the scope of HSCT applications. While the lymphocytes in donor bone altered CD4/CD8 ratio. These data make two interesting points. First, marrow (BM) play a critical role in the prevention of tumor relapse, they since blocking either mouse or human PD-L1 increased CD4/CD8 ratio, are also responsible for the development of GVHD. Despite advances in an increased CD4/CD8 ratio does not always lead to GVHD when the HIF preventing GVHD by the use of immunosuppressive drugs, GVHD remains activity is blocked by Echinomycin. Second, given the similar effect on T a significant cause of morbidity and mortality following HSCT. cells in the hematopoietic tissues, the differential effects of anti-mouse vs anti-human PD-L1 may relate to the induction of mouse PD-L1 in target Hypoxia-inducible factor 1α (HIF-1α) plays a critical role in driving T cell tissues. In this regard, we demonstrated that PD-L1 expression correlates differentiation, metabolism and cytotoxic activity. In addition, activation of with T cell apoptosis in the target organs, including liver and kidney. T cells induces and stabilizes HIF-1α, and the stabilized HIF-1α increases the cytolytic activity of CD8+ T cells by stimulating expression and release Conclusion: In this study, we showed that the HIF-1α-PD-L1 antagonism of cytolytic molecules and costimulatory molecules. However, the function is responsible for a molecular switch between GVL and GVHD. We of HIF-1α in GVHD and graft-versus-leukemia (GVL) effect has not been further demonstrated that pharmacologic inhibition of HIF-1α can reverse investigated to our knowledge. Since targeting HIF-1α abrogated leukemia this switch to treat GVHD, while preserving the GVL effect. We have stem cells, it is of great interest to test the function of HIF-1α in the context demonstrated the therapeutic efficacy of Echinomycin in relapsed acute of GVL and GVHD. myeloid leukemia by targeting leukemia stem cells without adverse effects on host hematopoietic stem cells. Here we show that Echinomycin markedly Results: Our in silico analyses and experimental validations revealed that diminishes GVHD in our humanized mouse model without interfering with hypoxia-inducible factor 1α (HIF-1α) target genes were enriched in T cells of GVL. Therefore, Echinomycin may be uniquely suited for transplantation in GVHD vs non-GVHD patients. Remarkably, targeted mutation of the Hif1a leukemia patients. gene in donor T cells abrogated GVHD without affecting GVL. To explore translational potential of this finding, we developed a novel GVHD model comprising transplantation of human bone marrow into newborn NSG mice, and showed that Echinomycin, a known HIF-1α inhibitor with anti-leukemia properties, conferred significant protection against GVHD and leukemia. As an immunological basis for the molecular switch, we found that genetic and pharmacologic ablation of HIF-1α selectively expanded CD8 T cells while suppressing that of CD4 T cells, with concurrent induction of programmed death-ligand 1 (PD-L1) on T cells and host tissues. Taking advantage of the xenograft model, we showed that PD-L1 on T cells and non-T cells plays overlapping but distinct roles. While T cell-associated PD-L1 contributed to selective expansion of CD8 T cells in the lymphoid organs, PD-L1 expressed on non-T cell host cells limited GVHD in addition to supporting selective CD8 T cell expansion. Our data revealed HIF-1α as a molecular switch from GVL to GVHD and provided a therapeutic approach to preserve or even enhance GVL while abrogating GVHD.

Discussion: Recent studies on mouse T cells have shown that HIF-1α plays a critical role in driving T cell differentiation, metabolism and cytotoxic activity. T cell activation both induces and stabilizes HIF-1α, leading to increased cytolytic activity of CD8+ T cells. Here our study provides a missing link between HIF-1α and GVHD pathogenesis and that genetic or therapeutic targeting of HIF-1α inhibits GVHD but preserves GVL. By showing convergence of genetic and pharmacology data, we established the central role for HIF-1α-PD-L1 antagonism as a critical switch between 20th Annual International Meeting of the Institute of Human Virology 57 Speaker Abstracts

PC-2 1α pathway. Treatment with liposomal echinomycin eliminated protein A Liposomal Formulation of HIF-1α Inhibitor Echinomycin Inhibits expression of HIF-1α target, VEGF-A, in breast cancer cells in vivo. Our Growth and Metastasis of Experimental Model of Breast Cancer data demonstrate that, with proper formulation, echinomycin provides a safe and effective approach for in vivo targeting of HIF-1α activity to inhibit Yin Wang, PhD, Institute of Human Virology, University of Maryland School growth and metastasis of solid tumors. of Medicine, Baltimore, Chris Bailey, PhD, Institute of Human Virology, University of Maryland School of Medicine, Baltimore, Yan Liu, PhD, Discussion: Echinomycin is the most potent inhibitor of HIF-1α binding Institute of Human Virology, University of Maryland School of Medicine, to DNA. Echinomycin may be advantageous over repurposing some Baltimore, Pan Zheng, MD, PhD, Institute of Human Virology, University FDA-approved compounds as HIF-1α inhibitors, which are limited by their of Maryland School of Medicine, Baltimore, Yang Liu, PhD, Institute of pleiotropic drug effects. On the other hand, echinomycin has an advantage Human Virology, University of Maryland School of Medicine, Baltimore over untested HIF-1α inhibitors because safe doses have already been established in over a dozen clinical trials. Our data presented herein Introduction: Hypoxia-inducible factor 1α (HIF-1α) is a transcription factor demonstrated that liposomal echinomycin is safer and more effective than that acts as a master regulator for the expression of genes that promote CrEL-echinomycin, and should be better tolerated in clinical trials. tumor growth, vascularization, and metastasis, and is highly expressed in cancer tissues. HIF-1α activates transcription by binding to hypoxia HIF-1α is overexpressed in 70% of human cancers. HIF-1α drives tumor response elements (HRE) in the promoter region of its target genes. HIF- progression because it orchestrates fundamental processes such as 1α inhibition has shown success as a therapeutic strategy in mouse models angiogenesis, glycolytic switch, and metastasis. It is therefore of interest of metastatic cancer. Therefore, HIF-1α represents a prime molecular target to consider whether the failure of previous trials was due to improper for cancer therapy. However, no specific HIF inhibitor has been approved formulation, or poor choice of targets or targeting agents. The termination for clinical use. of echinomycin in clinical trials immediately preceded the first clinical report identifying HIF-1α as a potential target for cancer, and nearly a decade Echinomycin is a small-molecule inhibitor of HIF-1α, which functions later, echinomycin was first identified as a HIF-1α inhibitor. Therefore, through its sequence-specific binding to HRE to competitively inhibit HIF- while echinomycin was not effective as a putative cytotoxic therapy, it was 1α binding to its target genes. Targeting the DNA binding site of HIF-1α is never examined as a HIF-1α inhibitor in clinical setting. Here, we used advantageous as a strategy because it avoids the possibility of acquired HIF1A-addicted breast cancer cell lines to demonstrate that the previous drug resistance by target mutation in cancer, as there are numerous HIF failure was completely attributable to improper formulation. First, dose- targets. Before HIF-1α was identified as molecular target of echinomycin, limiting toxicities of CrEL-echinomycin may have prevented therapeutically the drug was tested in multiple phase I and phase II trials for the treatment effective doses from being reached. This is evidenced in that the maximum of solid tumors. However, clinical development of echinomycin was tolerated dose of CrEL-echinomycin was insufficient to inhibit tumor growth discontinued because it was not found to be effective for patients with solid and eliminate metastasis in the breast cancer model. Second, the efficiency tumors that were refractory to available treatments. in which CrEL delivers the drug to its target is suboptimal. Although CrEL- echinomycin and liposomal echinomycin are equally effective in vitro, only Several factors could have contributed to failure of the earlier clinical trials. liposomal echinomycin is effective in vivo. Therefore, liposomes delivered First, the trials were conducted in the absence of preclinical studies to echinomycin to relevant cells more efficiently in vivo, and could potentially identify the drug target, making it impossible to judge the in-target activity of provide the same advantage in humans. These results are in line with the echinomycin in vivo. Second, no methods have been developed to evaluate concept that liposomal formulations reduce the toxicity of drugs, while the drug availability in vivo. Echinomycin is extremely insoluble in water, providing enhanced therapeutic effects. Liposomal echinomycin achieved which complicates its formulation into a suitable dosage form. In earlier in vivo targeting as evidenced by the reduction of VEGF-A protein. clinical trials, echinomycin was formulated with Cremophor EL® (CrEL). However, CrEL has been under scrutiny for its allergenic activity. In clinical Conclusion: Previous failures in echinomycin trials for multiple cancer trials of the conventionally-formulated echinomycin (CrEL-echinomycin), types with HIF-1α activation is likely due to inappropriate formulation. hypersensitivity reactions were observed. In addition, CrEL-echinomycin Liposomal nanoformulation of echinomycin allows effective targeting of caused severe nausea and vomiting, which constituted its major dose- HIF-1α in experimental breast cancer. Given the extensive data showing limiting toxicity. the critical function of the target in human cancer, it is of great interest to re- evaluate the potential of this new formulation in new clinical trials. Liposomes are credited for reducing toxicity and potentiating therapeutic effects in comparison to free-drug or CrEL-based drug formulations. Since liposomal formulations have been shown to improve drug delivery to solid tumors via EPR effect, we explored their potential as an enabling technology for use of echinomycin in solid tumors.

Results: We investigated if HIF-1α protein could be effectively targeted by echinomycin, a potent HIF-1α inhibitor, using preclinical models of breast cancer growth and metastasis. We reformulated echinomycin in liposomes and compared the therapeutic index of liposomal echinomycin with the previously tested clinical formulation of echinomycin. HIF-1α expression in breast cancer cells correlated with echinomycin cytotoxicity in vitro. However, consistent with clinical observations, no significant inhibition of primary tumor growth could be observed in xenograft mouse models using the previous clinical formulation. Reformulating echinomycin in liposomes increased therapeutic index with effective in vivo< targeting of the HIF- 20th Annual International Meeting of the Institute of Human Virology 58 Speaker Abstracts

PC-3 pathogenicity of harmful clones, while innate destruction is controlled at A reappraisal of CTLA-4 checkpoint blockade hypothesis in effector phase. We report here that deletion of Rptor (an indispensable cancer immunotherapy component of the mTOR complex 1) in hematopoietic stem/progenitor cells causes self-destructive innate immunity by massively increasing Xuexiang Du, PhD, Division of Immunotherapy, Institute of Human Virology, the population of previously uncharacterized innate myelolymphoblastoid University of Maryland School of Medicine, Fei Tang, PhD, Division of effector cells (IMLECs). IMLECs are CD3-B220-NK1.1-Ter119-CD11c low/- Immunotherapy, Institute of Human Virology, University of Maryland School CD115-F4/80low/-Gr-1- CD11b+, but surprisingly express high levels of of Medicine, Mingyue Liu, PhD, Division of Immunotherapy, Institute of PD-L1. Although they morphologically resemble lymphocytes and actively Human Virology, University of Maryland School of Medicine, Pan Zheng, produce transcripts from Immunoglobulin loci, IMLECs have non-rearranged MD, PhD, Division of Immunotherapy, Institute of Human Virology, Ig loci, are phenotypically distinguishable from all known lymphocytes, University of Maryland School of Medicine,Yang Liu, PhD, Division of and have a gene signature that bridges lymphoid and myeloid leukocytes. Immunotherapy, Institute of Human Virology, University of Maryland School Rptor deletion unleashes differentiation of IMLECs from common myeloid of Medicine progenitor cells by reducing expression of Myb. Importantly, IMLECs broadly overexpress pattern-recognition receptors and their expansion The classic checkpoint blockade hypothesis states that cancer immunity is causes systemic inflammation in response to Toll-like receptor ligands. restrained by two distinct checkpoints: the first is the CTLA-4:B7 interaction that limits priming of naive T cells in lymphoid organs, while the second Our data unveil a novel leukocyte population and an unrecognized role of is the PD-1/B7-H1(PD-L1) interaction that results in exhaustion of effector Raptor/mTORC1 in innate immune tolerance. Our work challenges the strict T cells within the tumor microenvironment. Ipilimumab, a clinically-used dichotomy of myeloid and lymphoid lineages in the immune system, and so-called immune checkpoint inhibitor (ICI) has been FDA approved for suggests a new mode of immune regulation for innate effector cells. The the treatment of metastatic melanoma and might get clinical approval for identification of this new cell population may allow us to more effectively additional oncological indications, most likely in combination with other regulate inflammation under pathological conditions. These findings might drugs, for example anti-PD-1/PD-L1. It is assumed that anti-CTLA-4 help explain the inflammation caused by mTORC1 inhibitors treatments in antibodies cause tumor rejection by blocking negative signaling from the some patients with cancers and transplantation. Moreover, since IMLECs B7-CTLA-4 interactions. constitutively express high levels of PD-L1, it is interesting to investigate their functions in cancer immunotherapy. Surprisingly, at concentrations considerably higher than plasma levels achieved by Ipilimumab blocks neither B7 transendocytosis by CTLA-4 PC-5 nor CTLA-4 binding to immobilized or cell-associated B7. In Ctla4h/m mice expressing both human and mouse CTLA4 genes, anti-CTLA-4 antibodies En Masse Discovery of Human Anti-Cancer Antibodies that bind to human but not mouse CTLA-4 efficiently induce Treg-depletion and Fc receptor-dependent tumor rejection. The blocking antibody L3D10 Peng Zhang, PhD, Institute of Human Virology, University of Maryland is comparable to the non-blocking Ipilimumab in causing tumor rejection. School of Medicine, Baltimore, Hung-Yen Chou, PhD, Institute of Human Remarkably, L3D10 progenies (HL12/HL32) that lost blocking activity during Virology, University of Maryland School of Medicine, Baltimore, Pan Zheng, humanization remain fully competent in Treg depletion and tumor rejection. MD, PhD, Institute of Human Virology, University of Maryland School of Medicine, Baltimore, Yang Liu, PhD, Institute of Human Virology, University We also set out to test three commercially available anti-mouse Ctla-4 of Maryland School of Medicine, Baltimore mAbs(4F10/9H10/9D9) that had been shown to induce tumor rejection for their ability to block the B7-Ctla-4 interaction under physiologically relevant Generation of specific antibodies for cancer therapy is a major endeavor. As conditions, these data also argue against a role for blocking the B7-Ctla-4 a radical departure from conventional approach, we hereby describe rapid interaction in the induction of antitumor immunity by anti-mouse Ctla-4 and potentially en masse identification of cancer-specific antibodies directly mAbs. Since these mAbs showed comparable immunotherapeutic effect from human cancer tissues. A computational framework was developed and and comparable depletion of Treg cells in the tumor microenvironment. Thus, successfully tested for antibody discovery by mining TCGA RNA-seq data both anti-human CTLA-4 mAbs and anti-mouse CTLA-4 mAbs cause tumor from 1945 cases of solid tumor samples. Surprisingly, synthetic antibodies rejection by mechanisms that are independent of checkpoint blockade but based on high-abundance CDR3 sequences from lung adenocarcinoma dependent on host Fc receptor. These data have important implications for (LUAD) patients bound all lung cancer samples tested and cross-reactive to the development of the next generation of immunotherapeutic anti-CTLA-4 other cancer types but rarely to normal tissues. Targeted DNA sequencing mAbs and call for a reappraisal of the checkpoint blockade hypothesis. of the B cell receptor from 5 lung tumortissues also allowed us to identify variable region sequences with somaticmutations. Antibodies based on predominant variable region sequences showed specific binding to PC-4 autologous lung cancer samples. Our platform dramatically reduces barrier The identification of a novel leukocyte population IMLEC unveils a in developing human anti-cancer antibodies and paved the way for cancer critical role of mTORC1 in innate immune tolerance treatment using patient-derived tumor-reactive monoclonal antibodies.

Fei Tang, PhD, Institute of Human Virology, University of Maryland School of Medicine, Peng Zhang, PhD, Institute of Human Virology, University of Maryland School of Medicine, Yang Liu, PhD, Institute of Human Virology, University of Maryland School of Medicine, Pan Zheng, MD, PhD, Institute of Human Virology, University of Maryland School of Medicine

Adaptive autoimmunity is restrained by controlling population sizes and

20th Annual International Meeting of the Institute of Human Virology 59 Speaker Abstracts

PC-6 PC-7 Cardiac Morbidity in HIV is Associated with Checkpoint Inhibitor Uncoupling Therapeutic from Immunotherapy-related Adverse LAG-3 Effects for Safer and Effective Anti-CTLA-4 Antibodies in CTLA4 Humanized Mice Rajendra Pahwa, MD, University of Miami Miller School of Medicine, Suresh Pallikkuth, PhD, University of Miami Miller School of Medicine, Mingyue Liu, PhD, Division of Immunotherapy, Institute of Human Virology, Bagavathi Kausalya, PhD, YRG Centre for AIDS Research and Education University of Maryland School of Medicine, Xuexiang Du, PhD, University (YRG CARE), Shanmugam Saravanan, PhD, YRG Centre for AIDS of Maryland School of Medicine, Juanjuan Su, PhD, University of Maryland Research and Education (YRG CARE), Nagalingesawaran Kumarasamy, School of Medicine, Peng Zhang, PHD, University of Maryland School MD, PhD, YRG Centre for AIDS Research and Education (YRG CARE), of Medicine, Yang Liu, PhD, Institute of Human Virology, University of Savita Pahwa, MD, University of Miami Miller School of Medicine Maryland School of Medicine, Pan Zheng, MD, PhD, Institute of Human Virology, University of Maryland School of Medicine Background: Cardiovascular disease (CVD) is a major contributor to mortality and morbidity in HIV infection. The impact of viral suppression Anti-CTLA-4 monoclonal antibodies (mAbs) confer cancer with combination antiretroviral therapy and underlying pathophysiologic immunotherapeutic effect (CITE) but cause severe immunotherapy-related mechanisms are under investigation. Elevated expression of certain adverse events (irAE). Targeting CTLA-4 has shown remarkable long- checkpoint inhibitor (CPI) molecules (e.g. PD-1, TIGIT, LAG3, TIM3) term benefit and thus remains a valuable tool for cancer immunotherapy if on T cells is associated with dampened immunity. Recent evidence for the irAE can be brought under control. An animal model that recapitulates expression of receptors for CPI at the tissue level with selective enrichment clinical irAE and CITE would be valuable for developing safer CTLA-4- of LAG3 receptors in the heart point to a control mechanism for organ targeting reagents. Here we report such a model using mice with the immune homeostasis (Rev Immunity 44, 2016). This study was aimed at humanized Ctla4 gene. In this model, clinical drug Ipilimumab induced defining the relationship of CPI molecules on immune cells and CVD in HIV severe irAE especially when combined with anti-PD-1 antibody; while infection in a low resource setting. another mAb L3D10 induced comparable CITE with very mild irAE under the same condition. The irAE corresponded to systemic T cell activation Methods: Study participants were recruited in YRG CARE, a tertiary care and reduced Treg/Teff ratios among autoreactive T cells. Using mice HIV service provider in Chennai, India. ART naive viremic (Gp1, n=102) that were either homozygous or heterozygous for the human allele, we and ART experienced aviremic (Gp2, n=172) were compared to healthy found that irAE required biallelic engagement, while CITE only required volunteers (Gp3, n=64) in a cross-sectional analysis of cardiac function and monoallelic engagement. As the immunological distinction for monoallelic immunologic markers including CPI molecules on CD4 and CD8 T cells. vs biallelic engagement, we found that biallelic engagement of Ctla4 gene was necessary for preventing conversion of autoreactive T cells into Treg. Results: In Gp1 findings of CVD were significant (Mann-Whitney’ U Humanization of L3D10 that led to loss of blocking activity further increased test) for lower cardiac ejection time, stroke volume, stroke volume index, safety without affecting the therapeutic effect. Taken together, our data cardiac output and small arterial elasticity with higher systemic vascular demonstrate that complete CTLA-4 occupation, systemic T cell activation resistance compared to Gp2 and Gp3 respectively. Large arterial elasticity and preferential expansion of self-reactive T cells are dispensable for tumor was lower in comparison to Gp2. Immune activation and inflammatory rejection but correlate with irAE, while blocking B7-CTLA-4 interaction cytokines were maximally altered in Gp1. Frequencies of CPI molecules impacts neither safety nor efficacy of anti-CTLA-4 antibodies. These data showed differences among the groups, with higher frequencies of CD4+ T provide important insights for clinical development of safer and potentially cells expressing LAG3 and PD1 in Gp1 compared to GPs 2 and 3, while more effective CTLA-4 targeting immunotherapy. TIGIT and TIM3 did not differ significantly among the groups. [LAG3 Gp1: 4.9±3.4; Gp2: 2.5±1.5; Gp3: 2.4±1.3; PD1 Gp1: 6.2±7.3; Gp2: 1.5±2.5; Gp3: 0.9±1.6; TIGIT Gp1: 34.2±14.9; Gp2: 33.5±11.8; Gp3: 30.1±7.8 and Tim3 Gp1: 1.7±2.7; Gp2: 1.3±1; Gp3: 1.3±0.9]. Frequencies of CD4+ T cells positive for LAG3, PD1, and for dual expression of LAG3 plus PD1 were inversely correlated with cardiac ejection time, cardiac output, cardiac index, stroke volume, stroke volume index and systemic vascular resistance in Gp1 and with large artery elasticity, and except for PD1, also with small artery elasticity in Gp2.

Conclusions: In ART naive HIV subjects continuous antigenic stimulation of the immune system results in upregulation of multiple CPI molecules in association with immune activation. Our finding of the association of LAG3 and PD1 expressing CD4 cells in cardiac morbidity points to a dominant role of these pathways in regulating cardiac health, given that LAG3 receptors are enriched at the tissue level in the heart. Investigations to understand the immune mechanisms involved could provide insight into potential role of LAG3 immunotherapy (which is in early clinical trials in cancer) in prevention or treatment of cardiac dysfunction in HIV.

20th Annual International Meeting of the Institute of Human Virology 60 Speaker Abstracts

PC-8 PC-9 Novel chemoimmunotherapy combinations for Pancreatic cancer Treatment of LGL Leukemia by a novel Cytokine inhibitor

Peter Smith, PhD, St George’s University of London, Valentina Capizzuto, Josephine Geh, MS, Institute of Human Virology, University of Maryland Msc, St George’s University of London, Angus Dalgleish, MD, St George’s School of Medicine, Xiaorong Wu, BSC, Institute of Human Virology, University of London University of Maryland School of Medicine, Yutaka Tagaya, MD, PhD, Institute of Human Virology, University of Maryland School of Medicine Introduction: Pancreatic cancer (PC) is a devastating malignancy. It is usually diagnosed at an incurable stage and has the poorest of prognoses of LGL-leukemia (LGL-L) is a rare type of lymphocyte malignancy originating any cancer. Despite its relatively low incidence, it is the fourth leading cause from NK or CD8 T-cells. It accounts for2-5% of chronic lymphoproliferative of cancer-related death. A few chemotherapies have shown modest efficacy diseases and about 2000 patients are newly diagnosed every year in the US. but are associated with significant toxicities and development of tumour Aggressive forms of LGL-L do not have an approved therapy and therefore resistance. For these reasons the median survival after diagnosis is about represent unmet medical need. Signaling analysis/systems biology study 4.6 months, 18% of patients survive one year and less than 5% survive for and mouse models suggested that the CD8 type LGL-leukemic cells are five years. Without improvement in PC therapy it may soon become the 2nd dependent on 2 gamma-family cytokines, IL-2 and IL-15, in vivo, which leading cause of cancer related deaths. Immunotherapies are beginning to promoted us to hypothesize that our novel multi-cytokine inhibitor, BNZ-1, show efficacy as first line therapies for a number of cancers but have yet to would effectively treat LGL-leukemia. BNZ-1 is a 19mer peptide mimicking prove effective against PC. This is due to the dense desmoplastic stroma and a preserved structure (D-helices) of all gamma-family cytokines (IL-2, -4, immune suppressive microenvironment characteristic of advanced disease. -7, -9-, 15 and -21). Since each gamma-family cytokine uses this region to Thus novel chemo-immunotherapeutic combinations will likely be required interact with the shared gamma-receptor subunit (CD132) which transduces to target the tumour and its microenvironment to create the conditions in signal, BNZ-1 can compete with many gamma-family cytokines by blocking which immunotherapies, such as checkpoint inhibition, will be effective. The their binding to the gamma/CD132. Interestingly, it specifically blocks IL- data presented here details the development of combination chemotherapy 2, IL-15 and IL-9 without inhibiting other cytokines, suggesting that the capable of killing tumour cells whilst increasing the immunogenicity of the target specificities of BNZ-like peptides are dependent on their amino acid tumour. sequence. Because target cytokines of BNZ-1 are presumably causing LGL- leukemia, it is a suitable compound to treat LGL-L. Recent ex vivo studies in Results: Combinations based upon the chemotherapeutic drug collaboration with the Loughran group at the University of Virginia (Dr. Tom Gemcitabine were studied. Gemcitabine was combined with Zolodronic Loughran discovered LGL-leukemia in 1985) showed that freshly isolated acid, Pomalidomide, Oxaliplatin and mycobacterial adjuvants. These LGL-L cells from patients show proliferative response to IL-2 and IL-15, and combinations demonstrated increased cytotoxicity of pancreatic cell lines their response was completely blocked by BNZ-1. BNZ-1 blocked multiple- compared to single agent treatment. Gemcitabine increased markers branches of IL-2/IL-15 signaling in LGL-L cells and induced their quick of immune recognition on these cell lines independently of its cytotoxic apoptotic death. These results promoted us to test if we can treat LGL-L properties whilst Oxaliplatin increased markers of immunogenic cell death cases with BNZ-1. BNZ-1/PEG has been approved by the FDA as an IND and uptake of tumour cells into dendritic cells. Combination treatment was and a phase I clinical trial targeting healthy individuals demonstrated that able to enhance dendritic cell maturation and the activation of CD8+ T-cells, it reversibly blocks in vivo IL-2 and IL-15 action effectively (i.e., profoundly measured as increases in the expression of IFN-γ. reduces the number of NK and T-regs which are dependent on these two cytokine in vivo) with minimum adverse effects. For clinical use BNZ-1 Discussion: Taken together the data presented here shows that gemcitabine peptide had been PEGylated (BNZ-1/PEG) and Pharmacokinetics data based combinations exhibit superior in vitro cytotoxicity and immunogenic from Phase I study demonstrated that its biological half life is around 80 properties compared to single agent therapy. Each of these agents has hours in humans, enabling a weekly dosing. Based on these observations, previously been paired with gemcitabine for treatment of pancreatic cancer, we are currently conducting a phase II clinical trial on LGL-L patients. For demonstrating low toxicity and potential clinical efficacy. This supports their this trial, we are collaborating with BIONIZ therapeutics (Irvine, CA), and 4 development as 3 or 4 agent combinations. Further research using pre- major referral centers (Ohio State University Hospital, University of Virginia clinical pancreatic cancer models is planned including the use of checkpoint Hospital, City of Hope, and Moffitt Cancer Center) for LGL-L. Three LGL-L inhibition in combination with Chemoimmunotherapy. patients diagnosed at these Institutions were recruited to the program and treated with 0.5 mg/kg BNZ-1/PEG (a dose barely above the minimum effective dose) for 3 months (4 weekly intravenous injections of BNZ-1/PEG + 2 months of extended weekly injections, after patient’s consent) with a promising lab finding that only LGL-L cells but not other blood cells showed robust apoptotic death in response to BNZ-1. Currently, 3 patients in cohort 2 are being treated with 1.0 mg/kg BNZ-1/PEG and some of them show improvements of clinical data as well. The adverse effects seem minimum to modest. We will next increase the treatment dose to 2.0 mg/kg (and to 4.0 mg/kg, if necessary) pending safety committee review, to continue our efforts to establish a new curative therapy for LGL-L.

20th Annual International Meeting of the Institute of Human Virology 61 Speaker Abstracts

PC-10 Sherman, BSc, University of Maryland College Park, Justin Montague, Classical HLA Alleles are Associated with Prevalent and BSc, Loyola University, Robert Beadenkopf, MSc, Institute of Human Persistent Cervical High-Risk HPV Infection in African Women Virology, University of Maryland School of Medicine, Kamal Saikh, PhD, US Army MEDCOM, Greg Snyder, PhD, Institute of Human Virology, Sally Adebamowo, MD, MSc, ScD, Department of Epidemiology and University of Maryland School of Medicine Public Health, and Greenebaum Comprehensive Cancer Center, University of Maryland School of Medicine, Adebowale Adeyemo, MD, National Background: A recurring single amino acid somatic mutation associated Institutes of Health, Clement Adebamowo, MD, ScD, Department of with nearly 1/3 of human diffuse large B cell lymphomas (DLBCLs), over Epidemiology and Public Health, and Greenebaum Comprehensive Cancer 90% of Waldenström macroglobulinemia (WM) and 54% of immunoglobulin Center, University of Maryland School of Medicine M monoclonal gammopathy, has been identified within the myeloid differentiation factor 88 (MyD88). This gain of function single amino acid Background: Persistent cervical high-risk human papillomavirus (hrHPV) mutation correlates with tumor cell proliferation and survival involving infection is a necessary cause of cervical cancer. However, the genetic spontaneous and sustained activation of MyD88-dependent NF-κB and factors underlying its risk are not well understood. We hypothesized that Janus Kinase (JAK) signaling pathways. MyD88 acts as a central signaling immunogenetic variation plays a role in hrHPV infection and persistence. adapter for mediating innate and cytokine driven inflammation for the Therefore, we conducted a study of classical HLA alleles and their Interleukin-1 (IL-1R) and Toll-like receptors (TLRs). In normal healthy cells, association with hrHPV infection and persistence. MyD88 is thought to be held in an auto-inhibitory state with its own death and TIR domains fused together in negative self-regulation until activated Methods: We characterized HPV infection using SPF25/LiPA10 in Nigerian by appropriate receptor mediated ligand engagement, involving Toll-like or women at baseline and at 6 months follow-up visits in 2014. hrHPV infection Interleukin-1 ligands. We propose the oncogenic mutation, MyD88L265P was prevalent if at least one carcinogenic HPV genotype was detected located within the TIR domain of MyD88 results in discrete structural in a sample provided at the baseline visit and persistent if at least one changes which releases binding and auto-inhibition of MyD88 death carcinogenic HPV genotype was detected in each of the samples provided domains resulting in MyDDosome assembly, spontaneous recruitment of at the baseline and follow-up visits. Genotyping was performed with the IL-1 receptor associated kinases (IRAKs) and sustained signaling. Illumina Multi-Ethnic Genotyping Array. Classical HLA alleles were imputed from genotypes in the MHC region using the HLA genotype imputation with Observation: Recently, CADD derived small molecule compounds which attribute bagging (HIBAG) algorithm. HLA association tests were conducted inhibit MyD88 dimer formation have been identified and functionally under additive genetic models. P values were adjusted for multiple characterized to protect against Staphylococcal enterotoxin B (SEB) comparisons with the false discovery rate (FDR) method. induced death in animal models.

Results: The mean (±SD) age of the study participants was 38 (±8) Hypothesis: Based on their ability to target MyD88 in protection against years, 48% (247/517) were HIV negative, 24% (125/517) were hrHPV Staphylococcal enterotoxin B induced death we hypothesize that CADD positive at baseline and 10% (51/517) had persistent hrHPV infections. derived MyD88 small molecule inhibitors may also be useful therapeutic In multivariate regression models adjusted for age, HIV status and the agents in treating DLBCLs bearing the oncogenic mutation MYD88L265P first principal component, DQA1*01:02 (OR 1.46; 95% CI: 1.07 - 1.97; p by inhibiting MyDDosome formation and subsequent recruitment of IL-1 = 0.03). and DQA1*02:01 (OR 1.89; 95% CI: 1.12 - 3.15; p = 0.03) were receptor associated kinases. positively associated with prevalent but not persistent hrHPV infections, while DQA1*05:01 was negatively associated with prevalent hrHPV (OR Approach: Using in vitro and in vivo studies we are evaluating MyD88 0.45; 95% CI: 0.24 - 0.85; p = 0.03) but positively associated with persistent specific small molecule inhibitors for the ability to inhibit tumor cell cervical hrHPV infections (OR 2.46; 95% CI: 1.27 - 4.77; p = 0.04). proliferation, MyDDsome assembly, IRAK recruitment and signaling in Four haplotypes (A*30:01 - DQA1*05:01, B*07:02 - C*07:02, B*07:02 - human patient cancer cells OCI Ly3 and OCI Ly19 bearing the oncogenic DQA1*05:01 and C*07:02 - DQA1*05:01) were significantly associated with mutation MYD88L265P. prevalent cervical hrHPV infections and several haplotypes that included the DQA1*05:01 allelic variant (including B*15:10 - DQA1*05:01, DQA1*05:01 - Results: We show 1) MyD88 small molecule inhibitors are able to inhibit DQB1*02:01 and DQA1*05:01 - DRB1*03:01) were significantly associated cell proliferation of activated human B cell lymphoma cells bearing the with persistent cervical hrHPV infections. Six amino acids located on the MyD88L265P mutation using a MTS cell proliferation assay, 2) Purified DQA1 gene were associated with prevalent but not persistent cervical recombinant MyD88 and small molecule inhibitors exhibit unique binding hrHPV infections. chromatograms in comparison to vehicle controls using a thermal shift assay and 3) MyD88 SMIs inhibit LPS activated TLR4-blue cell NF-kB Conclusions: This study, the first to investigate the association between signaling in comparison to the TLR4 specific inhibitor TAK242. We are HLA alleles and persistent hrHPV risk in African women, has identified continuing to biochemically characterize MyD88 small molecule inhibitors important risk alleles that merit further study. Our findings provide new as well as test additional human cancer cells bearing oncogenic MyD88 insights into risk factors for hrHPV infection in women of African ancestry. mutations. Conclusion: CADD derived MyD88 specific SMIs previously shown to PC-11 be effective in protection again microbial infection and death may also be Select Targeting of Diffuse Large B-cell Lymphomas using MyD88 useful in targeting B cell lymphoma cells bearing the MyD88L265P mutation. small molecule inhibitors Future studies defining the molecular mechanism of this MyD88L265P specific mutation associated with nearly one third of human patient tumor Yajing Wang, PhD, Institute of Human Virology, University of Maryland isolates will rationally inform and propel development of novel therapeutics School of Medicine, Lindsay Brown, PhD, US Food and Drug to counteract both inflammation as well as tumor cell formation. Administration, Ciara Faupel, BSc, Stevenson University, Matthew 20th Annual International Meeting of the Institute of Human Virology 62 Speaker Abstracts

PC-12 PD-1 Bone marrow microenvironment-induced miR-300 expression Genetic Risk Factors for High-Risk Human Papillomavirus (HPV) impairs natural killer cell proliferation and anti-tumor activity Infections and Persistence among African Women

Rossana Trotta, PhD, University of Maryland School of Medicine, Sally Adebamowo, MD, MSc, ScD, Department of Epidemiology and Giovannino Silvestri, PhD, University of Maryland School of Medicine, Public Health, and Greenebaum Comprehensive Cancer Center, University Lorenzo Stramucci, PhD, Regina Elena National Cancer Institute, Guido of Maryland School of Medicine, Adebowale Adeyemo, MD, National Marcucci, MD, City of Hope National Medical Center, Martin Guimond, Institutes of Health, Clement Adebamowo, MD, ScD, Department of PhD, University of Montreal, Xiaoxuanfan Fan, PhD, University of Maryland Epidemiology and Public Health, and Greenebaum Comprehensive Cancer School of Medicine, Maria Baer, MD, University of Maryland School of Center, University of Maryland School of Medicine Medicine, Danila Perrotti, MD, PhD, University of Maryland Baltimore Background: Genetic factors may influence the susceptibility to high-risk Natural killer (NK) cells mediate immune responses against cancer; human papillomavirus (hrHPV) infection and persistence. We conducted a however, NK cell quantitative and functional defects are features of cancers genome-wide association study (GWAS) to identify variants associated with including chronic myelogenous leukemia (CML). As increased numbers of hrHPV infection and persistence among women of African ancestry. activated NK cells were found in CML patients in treatment-free remission, the understanding of the molecular events inhibiting NK proliferation and Methods: Participants were 522 Nigerian women evaluated at baseline function may lead to the development of NK cell-based therapies against and 6 months follow-up visits for HPV. HPV was characterized using drug-resistant cancer stem cells. SPF25/LiPA10. hrHPV infection was positive if at least one carcinogenic HPV genotype was detected in a sample provided at the baseline visit and Because altered miRNA expression and inactivation of the protein persistent if at least one carcinogenic HPV genotype was detected in each phosphatase 2A (PP2A) tumor suppressor are also features of cancer, of the samples provided at the baseline and follow-up visits. Genotyping and SET-dependent PP2A inhibition is essential for NK cell function, we was done using the Illumina Multi-Ethnic Genotyping Array (MEGA) and hypothesized that increased expression of miR-300, a miRNA with anti- imputation was done using the African Genome Resources Haplotype proliferative activity, found inhibited in CML and targeting the PP2A inhibitor Reference Panel. Association analysis was done under additive genetic SET, accounts for impaired NK cell proliferation/activity. models adjusted for age, HIV status and the first 3 principal components of the genotypes. An initial analysis revealed that miR-300 levels were significantly higher in peripheral blood (PB) CD56+CD3-NK cells from CML patients at diagnosis Results: The mean (±SD) age of the study participants was 38 (±8) years, compared to healthy individuals. As NK cell activity is regulated by the 46% were HIV negative, 24% were hrHPV positive and 10% had persistent bone marrow microenvironment (BMM), we evaluated whether hypoxic hrHPV infections. The GWAS yielded 71 and 107 variants associated conditions and/or cell-to-cell interaction influence NK cell proliferation and with hrHPV infection and persistence, respectively, with suggestive cytotoxic activity by modulating miR-300 intracellular levels. genome-wide significance [p value <1.0 × 10−5]. The top variants (rs149473200, rs147344426, rs151071053 and rs572823632) associated A marked and significant increase in miR-300 expression was detected with hrHPV infections are in or near KLF12 [all p = 1.5 x 10-6]. KLF12 in NK-92 and primary CD56+CD3-NK cells exposed to low O2 levels or is an important regulator of gene expression during carcinogenesis, and cultured in the presence of conditioned medium (CM) or exosomes isolated it is highly expressed by human immune cells. In several studies, it was from BM-derived primary mesenchymal stromal (MSC) and HS-5 MSC associated with HPV and cervical cancer. The top variants associated cells. As expected, increased miR-300 levels correlated with decreased with persistent hrHPV infections were 3 variants upstream of AL450244 SET levels and markedly reduced NK cell number. Interestingly, miR- (rs143668247, rs12740341, rs2502139), a cluster of 5 intronic variants in 300-induced growth inhibition was rescued in NK cells treated with CM/ JPH2 (rs116834259, rs74358070, rs11452236, rs79032354, rs6130527) exosomes from HS-5 cells expressing an anti-miR-300 lentivirus. Notably, and 2 intronic variants in GPR39 (rs16832308, rs62167448) [all p < 7.0 x qRT-PCR indicated that miR-300 was contained in MSC exosomes. 10-7]. These variants are in enhancer histone marks in several tissues and Functionally, exposure to MSCs (CM or exosomes) inhibited NK cell IL-12/ alter the motifs Ets, GATA, NR4A, RXRA, which have been associated with IL-18-induced IFN-γ production and cytotoxic activity against K562 CML- several cancers of the female reproductive system and leiomyosarcomas. BC cells in a miR-300-dependent manner. Accordingly, miR-300 lentiviruses and/or CpG-miR-300 oligonucleotides inhibited SET expression, reduced Conclusions: This exploratory GWAS yielded risk loci that provide clues to proliferation and suppressed spontaneous cytotoxicity of NK-92 and/or the pathogenesis of hrHPV infection and persistence in women of African primary NK cells, likely through reactivation of PP2A. ancestry. Given the limited sample, larger discovery and replication studies are under way to further characterize the reported associations. Because BM hypoxic conditions and MSCs significantly contribute to decreased NK cell number and cytotoxic activity through upregulation of miR-300, its genetic or pharmacologic inhibition may result in reactivation of NK cell activity against leukemic stem/progenitor cells.

20th Annual International Meeting of the Institute of Human Virology 63 Speaker Abstracts

PD-2 Although our study focused on breast cancer models, miR-26a as a In vivo targeting delivery of miR-26a inhibits tumor growth and tumor suppressor has been observed in other cancer types, including protects host from hematological toxicity of chemotherapy in prostate cancer, pancreatic cancer and lung cancer. Likewise, the c-KIT breast cancer. is also widely expressed among human cancers, including gastrointestinal stromal tumors, myeloid leukemia, small-cell lung cancer, prostate cancer, Toshihiko Tanno, DVM, PhD, Institute of Human Virology, University pancreatic cancer, ovarian cancer and glioblastoma. Therefore, the clinical of Maryland School of Medicine, Peng Zhang, PhD, Institute of Human significance of our miR-26a chimera targeting c-KIT+cancers could extend Virology, University of Maryland School of Medicine, Christopher Lazarski, well beyond breast cancer. Besides, our targeting delivery platforms will PhD, Children’s National Medical Center, Yang Liu, PhD, Institute of Human provide not only novel therapeutics for a wide range of diseases, but also Virology, University of Maryland School of Medicine, Pan Zheng, MD, PhD, research tools to understand the roles of disease-related genes in specific Institute of Human Virology, University of Maryland School of Medicine tissues in vivo.

Breast cancer is the most common malignant disease in women. In the United States, it is estimated that 252,710 women will be diagnosed with invasive breast cancer, and 40,610 women will die of breast cancer in 2017. Recent molecular-based classification categorizes the breast cancer into HER-2+, luminal-like, normal-like and basal-like breast cancer. The 12-37% of breast cancer patients are classified into the basal-like breast cancer. The basal-like breast cancer has an unfavorable prognosis with high risk of early relapse within the first 2–5 yrs treatment, resulting in lower 5-yr survival rate than other types of breast cancer due to lack of effective target therapy. Thus, development of novel therapeutics is urgently needed.

The recent rapid expansion of genomic data greatly contributes to the understanding of disease development and progression. To translate these genetic discoveries into clinical applications, we need to develop therapeutic platforms that can specifically modulate the expression of disease-related genes in vivo. Small RNAs, such as microRNAs (miRNAs) and siRNAs function in messenger RNA silencing and post-transcriptional regulation of gene expression. Accumulating evidences have demonstrated the therapeutic potential of these small RNAs that modulate the gene expressions in many diseases including cancers. However, difficulties of in vivo delivery to specific cells have limited the potential utility of miRNA/ siRNA in cancer therapy.

Given the challenge of in vivo delivery, we developed a small RNAs targeting delivery platform, comprising a miRNA/siRNA sequence, a cell surface receptor-targeting DNA aptamer (a “chemical antibody”) and a complimentary passenger sequence of the miRNA/siRNA conjugated with cholesterol. These oligonucleotide sequences were heavily modified to prevent the degradation by nucleases in serum. Our newly designed delivery platform enables target-specific delivery of the small RNAs into desired cells and tissues in vivo.

Our in silico gene expression analysis using data from the breast cancer and normal tissues in The Cancer Genome Atlas (TCGA) database revealed that the suppression of miR-26a expression and overexpression of a receptor tyrosine kinase, c-KIT in the basal-like breast cancer were significantly associated with disease outcome. Therefore, we hypothesized that restoration of miR-26a loss in the cancer cells using our small RNA delivery platform can inhibit the cancer growth. To test this hypothesis, we developed c-KIT targeting miR-26a delivery therapeutic using a c-KIT targeting aptamer (termed “miR-26a chimera”). This miR-26a chimera significantly inhibited the tumor growth of c-KIT+ basal-like breast cancer cells by silencing an oncogene, EZH2 in xenograft models. Interestingly, the miR-26a chimera not only enhanced the anti-tumor effect of chemotherapy (5-FU or carboplatin) in its combinational use, but also ameliorated myelosuppresive adverse effects of the chemotherapy by protecting c-Kit+ hematopoietic progenitor cells from apoptosis via silencing a pro-apoptotic gene, Bak1. By preventing the major adverse effect of chemotherapy, our new approach may allow even broader use of chemotherapeutic drugs for the advanced breast cancer.

20th Annual International Meeting of the Institute of Human Virology 64 Speaker Abstracts

PE-1 sponsored by the National Cancer Institute,Troy J. Kemp, PhD, HPV Vaginal Microbiota Composition and Persistent High-Risk HPV Serology Laboratory, Leidos Biomedical Research, Inc., Frederick National Infection in HIV Negative and HIV Positive Women Laboratory for Cancer Research sponsored by the National Cancer Institute, Casper Alabanza, BS, HPV Serology Laboratory, Leidos Biomedical Eileen Dareng, MD, MPH, Department of Public Health and Primary Care, Research, Inc., Frederick National Laboratory for Cancer Research University of Cambridge, Sally Adebamowo, MD, MSc, ScD, Department sponsored by the National Cancer Institute, Angelina C. Richards, BS, of Epidemiology and Public Health, Greenebaum Comprehensive Cancer HPV Serology Laboratory, Leidos Biomedical Research, Inc., Frederick Center, University of Maryland School of Medicine, Bing Ma, PhD, Institute National Laboratory for Cancer Research sponsored by the National of Genome Sciences, University of Maryland School of Medicine, Jacques Cancer Institute, Ligia A. Pinto, PhD, HPV Serology Laboratory, Leidos Ravel, PhD, Institute of Genome Sciences, University of Maryland School Biomedical Research, Inc., Frederick National Laboratory for Cancer of Medicine, Paul Pharoah, MD, PhD, Department of Public Health and Research sponsored by the National Cancer Institute Primary Care, University of Cambridge, Clement Adebamowo, MD, Introduction: Human Papillomavirus (HPV) has been linked to numerous ScD, Department of Epidemiology and Public Health, Greenebaum cancers including cervical, oropharyngeal, and additional anogenital Comprehensive Cancer Center, University of Maryland School of Medicine cancers, and is believed to be associated with approximately 5% of cancers world-wide. Current licensed vaccines have shown great promise in being Background: Reports from previous studies suggest that the vaginal able to reduce persistent infection and HPV-linked cancers, and are based microbiota may play a role in cervical HPV pathogenesis. In this study, we on the use of virus-like particles (VLPs) which are comprised of type-specific examined associations between the vaginal microbiome and persistent HPV L1-expressing empty capsids. While commendable strides have been high-risk human papillomarvirus (hrHPV) infection among HIV-negative and made within the HPV research community to focus on understanding how HIV-positive women. the HPV vaccines work and eradicating this cancer-causing virus, there is still a lack of assay standards, reference reagents and testing guidelines Methods: We used 16S rRNA gene amplicon sequencing to characterize for HPV serology assays. Our laboratory is leading an international HPV the vaginal microbiota in two serial mid-vaginal samples taken approximately Serology standardization initiative to develop a series of standards, six months apart in 211 Nigerian women and the SPF10LIPA25 system for multiplex immunoassays, and procedures in order to harmonize evaluation HPV detection. We used generalized estimating equation (GEE) logistic of antibody responses to currently available vaccines in the context of regression models with robust variance estimation and the cluster option HPV vaccine trials. To reduce costs associated with serology testing, we for repeated measures, to evaluate the association between the vaginal investigated performance of alternative transfection reagents typically used microbiota composition and persistent hrHPV infection (defined as being in critical reagent production. positive for hrHPV at two visits 6 months apart); Linear discriminant analysis effect size (LEfSe) to identify phylotype biomarkers of persistent hrHPV; Discussion: Currently licensed HPV vaccines are based on HPV L1 Markov chain transition probabilities to evaluate transition patterns and virus-like particles. HPV VLPs are used extensively in HPV research and hierarchical clustering algorithms for community state (CST) assignments. as critical reagents in the assessment of HPV-induced immune responses. There are a variety of available methods to create HPV VLPs for use in Results: Some 142 women were HIV-positive and 69 were HIV-negative. the research setting; however, transfection methods are expensive and Of the 211 participants, 71 were persistently positive for hrHPV. Mean age time-consuming. Our team is currently producing HPV VLPs for the nine (SD) of participants was 38 (8) years. Most participants (84%, 175/211) were HPV types included in the currently administered vaccines to be used as premenopausal. High diversity, low Lactobacillus spp. bacterial community assay reference reagents by the serology scientific community to aid in state types, CST IV (A and B) were the most prevalent community state standardization and harmonization of HPV serology testing in vaccine trials. types (CST) in HIV-negative (57% at baseline and 40% at the follow-up visit) With the aim of reducing costs and saving time in VLP production while and HIV-positive (73% at baseline and 65% at the follow-up visit) women. maintaining robust HPV particle assembly, we have investigated different There was effect modification by HIV status (p=0.02). Among HIV-negative transfection approaches in a mammalian-based HPV L1L2 VLP production women, those who had a high relative abundance of Lactobacillus spp. system. were less likely to have persistent hrHPV (OR: 0.35, 95% CI: 0.14 – 0.89, p=0.03) compared to women with low relative abundance of Lactobacillus Aspects of consideration include transfection reagents and efficiency, cell spp. LEfSe analysis identified Sneathia spp as being differentially more viability, materials, and method optimization in the context of final VLP output abundant in HIV-negative women with persistent hrHPV. Markov chain via HEK293TT transfection with pHPVL1L2. The VLPs are subsequently transition probabilities showed that most CST transitions were to the highly confirmed by electron microscopy and dynamic light scattering as well diverse, low Lactobacillus spp., CST IV. In HIV-positive women, there was as epitope confirmation assays. Results demonstrate that cost-efficient no significant association between the relative abundance of Lactobacillus reagents such as PEI and TransporterTM5 are as efficient as Lipofectamine spp and persistent hrHPV. in producing particles. Similarly, adaptation of various transfection methods and use of large-scale production techniques lead to faster production time Conclusion: Our results provide evidence to suggest that persistent hrHPV with similar output. is associated with a lack of Lactobacillus spp in the vaginal microbiota of Conclusion: The development of HPV L1-based standardized reagents HIV-negative women. and immunoassays allow research laboratories to better evaluate and compare the vaccine-induced immune response across clinical trials. VLPs, PF-1 the cornerstone of the current vaccine, are used to develop immunoassays The HPV Serology Standardization Initiative: Development of and standards by which researchers can gauge the immune response. Critical Assay Reagents By reducing costs and time to produce VLPs, it becomes more feasible to create large production sets of VLPs in less time and with less financial Elizabeth Schafer, MS, HPV Serology Laboratory, Leidos Biomedical burden for immune monitoring laboratories. Research, Inc., Frederick National Laboratory for Cancer Research Funded by NCI Contract No. HHSN261200800001E 20th Annual International Meeting of the Institute of Human Virology 65 Speaker Abstracts

PF-2 Hepatitis B virus and risk factors among HIV+ and HIV- Nigerian men who have sex with men

Olusegun Adeyemi, MBBS, MPH, University of Maryland Baltimore, Institute of Human Virology, Trevor Crowell, PhD, US Millitary HIV Research Program, Shelia Peel, MSPH, PhD, US Millitary HIV Research Program, Nicaise Ndembi, PhD, University Of Maryland Baltimore, Institute of Human Virology, Nigeria, Ashley Shutt, MPH, University of Maryland Baltimore, Institute of Human Virology, Stefan Baral, MD, MPH, MBA, MSC., Johns Hopkins Bloomberg School of Medicine, Man Charurat, PhD, University of Maryland School of Medicine, Institute of Human Virology, Rebecca Nowak, PhD, University of Maryland School of Medicine, Institute of Human Virology

Introduction: Despite the advent of hepatitis B virus infection (HBV) vaccine since 1982, HBV prevalence among men who have sex with men (MSM) ranges between 8-18%, differing by population settings and geographic regions of Nigeria. Because of shared risk factors for viral acquisition, HBV is more common in HIV infected individuals and MSM are 2- 4 times more likely to be infected with HBV as compared to the general population. We conducted a cross sectional study to estimate the prevalence and risk factors of HBV among HIV-infected and HIV-uninfected MSM.

Methods: From March 2013 to December 2017, the TRUST/RV368 study recruited MSM into HIV care and treatment services in Abuja and Lagos, Nigeria using respondent driven sampling. Men were screened for Hepatitis B surface antigen using ELISA and confirmed to have active infection with PCR detection of HBV DNA. All participants with HBV and HIV diagnoses at baseline were included in the analysis (n=717). Differences in demographics and behavioral characteristics were compared using Pearson Chi-square test for categorical outcomes. Bivariate and multivariable analyses were conducted using logistic regression models.

Results: Median age was 24 years (Inter quartile range: 21-27) and the prevalence of HBV was similar between the HIV uninfected and HIV-infected (9% vs. 10%, p=0.60). Among the HIV-infected, prevalence was higher for those not on an ART regimen with anti-HBV activity (tenofovir, lamivudine, or emtricitabine) as compared to those with anti-HBV regimen (11% vs. 5%), although not statistically significant (p=0.12). In the multivariable analysis, HIV infection status was not associated with HBV prevalence (OR=1.1, 95% CI: 0.6-2.0). Any condomless sex at last anal intercourse was associated with a 2-fold higher odds of HBV as compared to those always using condoms (OR= 2.3, 95% CI: 1.3, 3.5). Those self-reporting as homosexual as compared to bisexual trended towards a higher odds of HBV (OR= 1.5, 95% CI: 0.9, 2.5). Age, access to health care, concurrent STIs, receptive partnerships, and concurrency were not associated with HBV.

Conclusion: HBV prevalence was modest in this high risk population and did not differ by HIV status. This lower than expected prevalence may be attributed to ART with anti-HBV activity. Although condomless sex continues to elevate the risk of HBV, reinforcing the need to increase communication and education on HBV and its potential complications.

20th Annual International Meeting of the Institute of Human Virology 66 Speaker Abstracts

PF-3 Cancer and >47yearsold <47years old Is Nigerian Breast Cancer Associated with Endogenous Retrovirus Viral Status (126), (100%) (321) (100%) +BCa+Vir) 13/28 (46.4%) 55.5 yrs 15/28 (53.6%) 39 yrs Xq21.33? +BCa -Vir 74/208 (35.6%) 56.6 yrs 134/208(64.4%) 37.7yrs -BCA +Vir 2/23 (8.7%) 53.5 yrs 21/23 (91.3%) 35.3yrs Mark Kaplan, MD, University of Michigan, Clement Adebamowo, MD, -BCa -Vir 37/188 (19.7%) 53.5 yrs 151/188 (80.3%) 36.2yr ScD, Department of Epidemiology and Public Health, and Greenebaum Comprehensive Cancer Center, University of Maryland School of Medicine, Among women who are older than 47 years, the proportion of virus xq21.33 Sally Adebamowo, PhD, Department of Epidemiology and Public positives is higher among women with BCa (14.9%) than women without Health, and Greenebaum Comprehensive Cancer Center, University of BCa (5.13%), but it is not significant (p-value=0.15) [see below] Maryland School of Medicine, Galya Bigman, MB, BS, PhD, Department of Epidemiology and Prevention Division, Institute of Human Virology, Virus xq21.33 in cases and controls in age groups >47 years n=126 University of Maryland School of Medicine Xq21.33 No breast cancer With breast cancer Total Negative 37 (94.9%) 4 (85.1%) 111 (88.1%) Background: Wildschutte et al recently discovered a new HERV K HML- Positive 2 (5.13%) 13 (14.9%) 15 (11.9%) 2 (HK2) endogenous retrovirus Xq21.33 (NCBI GenBank accession Total 39 (100%) 87 (100%) 126 (100%) no. KU054272) to be uncommonly present in Pygmy populations and in Nigerian people in Africa (<4%) . It has been estimated that this virus has Among women who are 47 years or younger, the proportion of virus been inserted in the human genome between ∼0.67–1.3 Mya and possibly xq21.33 is lower among women with BCa (10.07%) than women without earlier. Since this virus is fully intact and is similar to mouse mammary tumor BCa (12.21%), but it is not significant(p-value=0.60). virus, we looked to see if it is associated with breast cancer in Nigerian populations. Virus xq21.33 in cases and controls in age groups <47 years n=321 Xq2133 No Breast Cancer With Breast Cancer Total Methods: Peripheral blood mononuclear cells were obtained with informed Negative 151 (87.8%) 134 (89.9%) 285 (88.8%) consent from Nigerian women with breast cancer (BCa) (237) and matched Positive 21 (12.2%) 15 (10.0%) 36 (11.2%) controls (225) without BCa. Samples from the United States included Total 172 (100%) 149 (100%) 321 (100%) samples from a BCa study and HIV study carried out earlier. DNA was extracted using the DNeasy Blood and Tissue Kit (Qiagen). We also tested for Xq21.33 in the following USA samples:

Samples were tested for the Xq21.33 virus using primer Caucasian Americans African Americans Xq21.33R2 ACGCTGTTTTGTCCCTTTGA and K1011 Women with BCa 0/95 0/3 CGTCGACTTGTCCTCAATGACCACGCT to screen samples, and primers Men/Women 0/8 0/9 1584R TTTGCGTTGACTGAGCCATTACCG, 2499R TTG AGC AAC ATC Other conditions TTG GAG CCT TGC, 3460R ACTTGCCCAATATGCAGCCTTTCCTCC, HIV+ Men/Women 0/6 1/16 (lymphoma) 6115R TCAACTATGGCCTGTCCTTGC, F Flank Cell Line BCa 0/11 1/1 DT22 positive TCAGTCTGAAGACAATGACATACT T and 5359F Other Cell lines 0/19 TCGGCTCAAAGAGCAGAGATGGTT to confirm positive samples. Samples were tested using the Long Amp PCR kit (New England Bio Labs) Conclusion: Our sample size does not provide sufficient power to see if conditions suggested by the manufacturer using a total volume of 25ul. Xq21.33 presents an increased risk for breast cancer. However, the trend Hetero vs Homozygosity was determined using F Flank and Xq21.33R2 with too increased risk in virus positive women 12.7% vs 9.7% in controls , and Platinum taq Hi Fi Thermo Fisher also using conditions suggested by the the increase in numbers of women >47 year with +BCa + virus (46.4%) manufacturer. Samples with adequate DNA were tested using primer K1011 vs the +BCa - virus (35.6%), and the striking low numbers of women in and Xq21.1R2. Positive samples were all confirmed using Xq21.33R2 to -BCa + virus (8.7%) vs (19.7%) in -BCa -virus and greater homozygosity 1584R, 2499R, 3460R and 5359F to F Flank. One batch of samples did not in +Bca+virus women suggests differences which may be caused by yield good quality DNA and some samples had such low yields of DNA that carrying this provirus. We suggest designing trials with adequate sample the data on these patients was not included in this study. sizes of virus+and - young women without BCa to assess the future risk of cancer from this provirus. We are now sequencing the env gene Results: We detected 28/220 (12.7%) positive samples in women with to see if women with BCa have a more replicative competent virus. We BCa vs 23/236 (9.7%) in women without BCa. These differences were are gathering pathological data to see if +women have different forms of not statistically significantly different. 5/28 women with BCa (ages 38, 44, BCa than –women. This virus may be still present in Nigerian rodent and 50, 53, 82) vs 2/23 (ages 32, 58) normal women were homozygous for primate populations and should be searched for in these animals. It may Xq21.33. still infect people contributing to BCa without becoming endogenized. It could be detected by deep sequencing DNA from BCa tissue looking for As shown below women with BCa and virus were more likely to be post- integrated Xq21,33 in other sites than the X chromosome. Molecular clones menopausal (46%) than women without BCa and virus (8.7%). Similarly and more cell lines, like DT22, should be established from BCa+Virus+to women with BCa and no virus were also more likely to be post-menopausal look for replicative virus with alternative integration sites. Virus should be 35% vs women with no BCa and no virus 19.7%. There was not enough searched for in HIV + Nigerians to see if it contributes to other neoplasms power in this study to determine if the virus is contributing to more cases of The discovery of a human BCa virus would present a new way of treating or post-menopausal breast cancer in positive women. preventing breast cancer using antiretrovirals.

20th Annual International Meeting of the Institute of Human Virology 67 Speaker Abstracts

PG-1 Compromised Growth among HIV Exposed Compared to Unexposed Children in Nigeria

Jibreel Jumare, MBBS, PhD, Institute of Human Virology, University of Maryland School of Medicine, Pam Datong, MBBS, FWACP, Plateau State Human Virology Research Center, Jos, Plateau State, Sophia Osawe, MPH, Institute of Human Virology Nigeria, Federal Capital Territory, Abuja, Felicia Okolo, BSc, Plateau State Human Virology Research Center, Jos, Plateau State, Bukola Inyang, MBBS, FMCPaed, Plateau State Specialist Hospital, Jos, Plateau State, Alash’le Abimiku, MSc, PhD, Institute of Human Virology, University of Maryland School of Medicine

Introduction: HIV exposed but uninfected (HEU) children may be at an increased risk of impaired growth and development when compared to their unexposed and uninfected (HUU) counterparts. We compared growth pattern between HEU and HUU children in Nigeria.

Methods: HIV infected and uninfected pregnant women were enrolled at the Plateau State Specialist Hospital (PSSH) Jos Nigeria. Babies born to these mothers were recruited at birth and the mother-infant pairs followed up until 18 months. Weight, length, and head circumference of the babies were measured at each study visit. Age and gender standardized z scores were generated for each anthropometric measure using the World Health Organization Child Growth Standards. Children with length for age (LAZ), weight for age (WAZ) and weight for length (WLZ) z scores <-2 were classified as stunted, underweight, and wasted respectively.

Results: A total of 415 children (307 HEU and 108 HUU) were included in this analysis. At birth, 117 (28.4%), 9 (2.2%) and 32 (7.8%) babies were stunted, underweight and wasted respectively. In a multivariable longitudinal analysis, the odds of stunting was higher among HEU as compared to HUU children (OR: 2.4 [95% CI: 1.4, 4.1]; P=0 .001). Similarly, odds of being underweight was higher among the HEU children (OR: 1.6 [95% CI: 1.1, 2.2]; P=0.009). While the odds of wasting appeared higher for the HEU children (OR: 1.5 [95% CI: 0.9, 2.4]; P=0.128), the difference did not reach statistical significance.

Conclusion: We found strong evidence of greater impairment of linear and ponderal growth among HEU as compared to HUU children during the first 18 months of life in Nigeria. Further studies are needed to explore the causal basis for these differences.

20th Annual International Meeting of the Institute of Human Virology 68 Speaker Abstracts

PG-2 collection system was slow to respond due to poor internet connectivity. In Evidence of increased HIV cases in Greater Kinshasa urban this pilot study we focused on assuring test availability, high risk locations, health zones: Democratic Republic of Congo (2017-2018) and developed an improved data collection method with strengthening of site personnel relationships. The HIV prevalence we detected in Kinshasa Mohammad Pour, MD, University of Missouri-Kansas City; Linda James, in this preliminary study is generally 8-10-fold higher than recent previous BA, MPH, Gaetan Bondo, MD, Jonathan Fumunguya, Jeansy Mavinga, estimates raising the alarm. The reason for the discrepancy is partly Basimike Mulenda, Jonathan Niles, Medard Omakoy, Yves Tshangala, because most recent PEPFAR/WHO/Global Fund data is based upon 2012- MD, Francois Tshibaka, Samuel Mampunza, MD, PhD, Universite 2013 National statistics and UNAIDS 2015 Spectrum estimates (version Protestante au Congo; Carole McArthur, MD, PhD, University of Missouri- 5.51). Reliable 2017 National empirical DRC data were not available to us. Kansas City There were a number of limitations to this study, the primary shortcoming being that we have not determined the true HIV incidence. This will require Background: The 2018 The President’s Emergency Plan for Aids Relief follow-up of HIV negative patients over the coming 2 years to determine (PEPFAR) Annual Report to the US Congress declared that new HIV cases emergence of HIV seropositivity. Most important driving factors are test in the Democratic Republic of the Congo (DRC) in 2016 exceeded HIV availability, personnel support, data integrity, and financial oversight. mortality. This suggests a loss of epidemic control. USAID and PEPFAR national estimates of HIV prevalence in 2016 were 1.6% for urban Kinshasa Conclusions: This study showed focused testing of high risk groups and 0.9% for rural areas. In 2016 PEPFAR/DRC tested 915,609 individuals by a well-trained team in densely populated areas is a productive case- and determined an overall rate of 2.86%; in 2017 a similar study resulted finding strategy. It reveals that HIV positive patients need prompt access in 2.93%. According to The World Bank, the average peak prevalence to cART to induce viral suppression and prevent further spread within in the DRC reached 2.2% for adults (15-49) from 1996 to 2000, with a the Kinshasa community. Increased HIV in rural areas has already been steady decline until today. HIV national prevalence in the DRC over the documented.⁴ Results of this study suggest spatial variability. past decade has been generally lower than surrounding countries and has Sub-national data is vital to reliable modeling of national country estimates. raised questions among PEPFAR, WHO and USAID stakeholders as to the Reliable data is essential for programmatic planning, effective scale- reliability of data collection and/or estimates from computer modeling. Our up,cost-effective use of resources and importantly, to obtain epidemic recent data restricted to urban Kinshasa suggests that the HIV rate may control. Like many sub-Saharan countries, more than 50% of the population be much higher than previous national estimates. USAID and WHO 2017 in the DRC is under 22 years old. This cohort is rapidly becoming sexually reports are based upon Spectrum estimates using computer modeling. active and entering reproductive years. It is unlikely the DRC will reach the These relatively low HIV estimates are inconsistent with the data we present UNAIDS 90:90:90 goals by 2020. Due to the large expansion in the youth in this sub-national study. population, we could experience an explosion in the HIV epidemic over the coming years. An urgent intervention is required to understand and manage Methods: A study was conducted to determine the rate of new HIV positive the DRC epidemic. individuals in an existing Kinshasa urban HIV cohort between February 2017 and August 2018. After approval from Université Protestante au Congo Ethics Committee, and training of a five-member post graduate medical team and a technician, a prospective adult HIV case-finding study was aggressively conducted. The network was directed by an experienced physician and immunologist with an on-going HIV research program. Individual participants provided demographic data and received an HIV test at one of thirty hospitals, community health centers and clinics in 2017, and forty-four of the same and an additional fourteen sites in 2018. The sites are in twenty-two of thirty-five different urban health zones and represented a range of levels of healthcare delivery services. Approximately half the sites were located in PEPFAR supported zones in Kinshasa Province.

Results: 8,526 individuals (>18yrs) were tested for HIV between February 2017 and May 2018. The number of new seropositive individuals sequentially tested and confirmed by the national algorithm (Determine HIV-1/2 [Determine; Alere, USA], Uni-Gold HIV [Uni-Gold; Trinity Biotech, Ireland], Vikia HIV 1/2 [Vikia; bioMérieux, France], was 1,605 HIV positive and 6,921 seronegative. The number of HIV positive women exceed the number of HIV positive men under 50 years. Interestingly, the number of men older than 50 years exceeded that of women suggesting women die earlier of HIV-related consequences. These sub-national preliminary data suggest the annual HIV positive rate (22.8 per 100 person-years in 2017 and 18.8 per 100 person-years in 2018) is significantly higher in this cohort than previous reports and estimates of prevalence in the DRC.

Discussion: This study confirms apprehension in the 2017 PEPFAR DRC Country Operational Plan concerning the reliability of estimates from the DRC. We encountered a noticeable lack of testing and confirmation resources and limited access for patients to HIV therapy and viral load testing. HIV test kit stock-outs were common and the national data 20th Annual International Meeting of the Institute of Human Virology 69 Speaker Abstracts

PG-3 exposures to the human immune deficiency virus (HIV) and other blood Assessment of internationally-available diagnostic test kits for borne infectious agents. Not much is known about factors that predict their suitability to meet manufacturers’ claims correct and effective practice of management of such exposures. This study was conducted to determine the prevalence and types of self-reported Niel Constantine, PhD, Institute of Human Virology, University of Maryland occupational exposures to HIV among HCWs, and factors that influence School of Medicine, Ahmed Abouhmada, MD, Institute of Human Virology, the practice of managing such exposures by the HCWs. With PEPFAR University of Maryland School of Medicine, Bhavneet Athwal, BS, Institute emphasizing epidemic control, the HCW must know how to prevent of Human Virology, University of Maryland School of Medicine, Ebtehal occupational exposure. Saleh, BS, Institute of Human Virology, University of Maryland School of Medicine Methods: A cross-sectional study was conducted among HCWs in 20 health care facilities providing primary, secondary, tertiary and private care Background: Diagnostic test kits are used throughout the world as a services in Federal Capital Territory, Abuja, Nigeria in June 2018. Data was primary measure to protect the blood supply and provide diagnosis to collected using self-administered questionnaire on occupational exposures save lives. The US government purchases large numbers of HIV, syphilis, in the last 12 months and situations the exposures occurred. Results were hepatitis, and other varieties of test kits from a number of manufacturers summarized in percentages, median and interquartile range (IQR). at considerable expense, and expects them to perform adequately when provided to countries. Results: A total of 88 HCWs who had at least one occupational exposure completed the survey, of which 37 (42.0%), 18 (20.5%), 16 (18.2%) and Objective: To assess a large number and variety of rapid test kits, 17 (19.3%) were from primary, private, secondary and tertiary health care purchased for many countries, to determine if they meet the claims of the facilities respectively. Majority of the HCWs were females 58 (67.4%), 61 manufacturers. (71.8%) were aged 18-39 years and 33 (37.9%) were nurses. The median number of patients seen daily by HCWs was 30 (IQR 20 – 60) and the Methods: From September 2010 through July 2018, a total of 1,502 lots median number of years in clinical practice was 9 (IQR 4 – 14). of rapid test kits from 16 manufacturers, representing 11 different types of tests from 26 countries, were received for evaluation at the IHV. The Of 88 HCWs who had at least one occupational exposure, 51 (57.0%) performance of each test kit was assessed for performance characteristics had experienced at least one occupational injury in the past 12 months, using panels of sera (n=30 -160) that included positives (n=20-80), and 70 (82.4%) were screened and followed up for HIV after occupational negatives (n=20-80). Greater than 1 false positive or false negative result exposure. Among those who did not screen for HIV, half of them had constituted failure. assumed the patient was HIV negative or of no risk.

Results: Of the 1,502 rapid test kit lots, 1,491 (99.3%) successfully passed Thirty-seven (43%) of HCWs had experienced exposure through needle the evaluation. Of the 11 lots from five manufacturers that did not pass, 3 stick injury, 20 (23.3%) had splashing of blood or bodily fluid on mucosal lots were found to produce high background that interfered with reading, 2 surfaces, 23 (26.7%) had both needle stick injury and splashing of blood or lots performed inadequately with high-temperature testing, 4 lots gave two bodily fluid on mucosal surfaces and 6 (7.0%) had other exposures. false-positive results, and 2 lots gave two false-negative results. In one case, the failure resulted in cessation of bulk purchase of test kits by the US Exposures were experienced during the following circumstances: Setting Government and removal from WHO’s e-catalogue. In another case, the up IV line (25, 31.6%), during surgery (22, 27.8%), giving injections (23, manufacturer acknowledged that their internal lot release results indicated 29.1%), collecting blood samples (31, 39.2%), recapping needles (23, a less than usual level and that it was subsequently addressed. 29.1%), during delivery (28, 35.4%), others (4, 5.1%).

Conclusion: In our evaluation of a large number and variety of rapid test Eighty-one (94.2%) of the HCWs had heard about Post Exposure kit lots from 16 manufacturers that were sent to or targeted for 26 countries, Prophylaxis (PEP) for HIV, while only 49 (55.7%) had PEP for 28 days. nearly all performed as expected and met the manufacturers’ claims. An evaluation system for the monitoring of test kit performance is essential to Conclusion: Majority of HCWs had experienced at least one occupational identify test kits that may not meet manufacturers’ claims. exposure during the past 12 months, with the highest frequency being needle stick injuries and/or splashing of blood or bodily fluid on mucosal surfaces. There is the need for improved knowledge of the risk of HIV PG-4 transmission and provision of health education on occupational exposure. Self-reported occupational exposure to HIV and Knowledge, This will strengthen healthcare workers’ practices to manage occupational Attitude to Post Exposure Prophylaxis among Health Care exposure. Keywords: HIV, Occupational exposure, Health care workers Workers in Federal Capital Territory, Abuja, Nigeria

Clementina Iwodi, BSc, Institute of Human Virology Nigeria, Olayemi Olayemi, MBBS, MPH, Institute of Human Virology Nigeria, Adeyosola Adetunji, MD, Institute of Human Virology Nigeria, Chidozie Edokwe, BSc, MPH, Institute of Human Virology Nigeria, James Okuma, BSc, MSc, Institute of Human Virology Nigeria, Samuel Peters, BSc, MSc, PhD, Institute of Human Virology Nigeria, Patrick Dakum, MBBS, MPH, Institute of Human Virology Nigeria, Ernest Ekong, MD, MPH, PhD, Institute of Human Virology, University of Maryland School of Medicine, Baltimore

Background: Health care workers (HCW) face major occupational 20th Annual International Meeting of the Institute of Human Virology 70 Poster Abstracts

PG-5 Assessment of Knowledge, Attitude and Practice towards Post Exposure Prophylaxis for HIV among Health Care Workers in Federal Capital Territory, Abuja, Nigeria

Clementina Iowdi, BSc, Institute of Human Virology Nigeria, Olayemi Olayemi, MBBS, MPH, Institute of Human Virology Nigeria, John Dung, BSc, Institute of Human Virology Nigeria, Chidozie Edokwe, BSc, MPH, Institute of Human Virology Nigeria, James Okuma, BSc, Institute of Human Virology Nigeria, Samuel Peters, BSc, MSc, PhD, Institute of Human Virology Nigeria, Patrick Dakum, MBBS, MPH, Institute of Human Virology Nigeria, Ernest Ekong, MD, MPH, PhD, Institute of Human Virology, University of Maryland School of Medicine

Background: HIV/AIDS infection in the health care facility is a major health problem in resource limited settings. Health Care Workers (HCW) are caring for a large number of HIV infected patients. This makes them exposed to HIV infection, warranting the use of Post Exposure Prophylaxis (PEP) for HIV very critical. Here we assess Knowledge, Attitude and Practice of HCW towards PEP for HIV.

Methods: This study was cross-sectional and was conducted among health care workers in 20 health care facilities providing primary health care, secondary, tertiary and private care in June 2018 under the US President Emergency Plan For AIDS Relief (PEPFAR). Data was collected using self- administered questionnaire. Results were summarized in percentages, median and Interquartile range (IQR).

Results: A total of 195 HCWs completed the survey, 74 (37.9%), 34 (17.4%), 46 (23.6%) and 41 (21.1%) from Primary health care, private, secondary and tertiary health care facilities respectively. Majority of the HCWs were females, 128 (66.7%), 134 (70.2%) were aged 18-39 years and 66 (34.4%) were nurses. The median number of patients seen daily was 28 (IQR 20 – 50) and the median number of years in practice was 8 (IQR 4 – 12).

One hundred and seventy-seven (92.7%) HCWs had heard of PEP for HIV and 107 (58.5%) had excellent/good knowledge about PEP for HIV. Majority of HCW 168 (92.8%) had good attitude and would recommend PEP for HIV to others; 150 (81.5%) of HCW consider themselves to be at risk and 88 (46.1%), had occupational exposure. Among those exposed, 75 (85.2%) screened for HIV.

One hundred and sixty-three (86.7%) of the HCW are aware of hospital policy after occupational exposure and 107 (57.6%) would recommend commencing PEP for HIV within 1-72 hours after exposure; 131 (72.4%) are satisfied with current HIV infection protocol at their facility while 177 (92.7%) feel that more training is required for staff on HIV prevention.

Conclusions: Majority of HCW had excellent/good knowledge, favorable attitude and practice towards PEP for HIV. There is need for policy makers in health sector to put policies, guidelines and pogram that will rapidly scale up PEP for HIV services in health care settings. This is much more important given the increased need for staff at these facilities to multitask and can self- expose. Keywords: Health care workers, Post exposure prophylaxis, HIV

\

20th Annual International Meeting of the Institute of Human Virology 71 Poster Abstracts

PG-6 likely to consistently use condoms (RR: 0.93; 95% CI: 0.87-0.98). Egos who What Partner Characteristics Predicts Condom Use in a Network never or rarely discussed HIV with alters also had a reduced risk of CCU of MSM in Nigeria? (Never- RR: 0.83; 95% CI: 0.77-0.90, Rarely- RR: 0.89; 95% CI: 0.82-0.96) as well as a sexual partner being older (RR:0.92; 95% CI: 0.89-0.97). Oluwasolape Olawore, ScM, Johns Hopkins Bloomberg School of Public Health, Trevor Crowell, MD, PhD, U.S. Military HIV Research Program, Although consistent condom use was observed in this cohort of MSM, Walter Reed Army Institute of Research, S Omari, MD, PhD, Institute condomless sex was still common. High risk behaviors among sexual of Human Virology, University of Maryland School of Medicine, Hongjie partners of MSM is associated with a reduced likelihood of CCU. The data Liu, PhD, University of Maryland School of Public Health, College Park, presented here highlights the need for new approaches including structural Sosthenes Ketende, MS, Johns Hopkins Bloomberg School of Public interventions targeted to partners of MSM who may not be engaged in Health, Man Charurat, PhD, Institute of Human Virology, University of care. Furthermore, approaches that safely increase condom use such Maryland School of Medicine, Rebecca Nowak, PhD, Institute of Human as provision of condoms in safe spaces, education on proper usage of Virology, University of Maryland School of Medicine, Stefan Baral, MD, condoms as well as better condoms and lubricants are needed to prevent PhD, Johns Hopkins Bloomberg School of Public Health the acquisition and transmission of HIV.

Even in the context of a generalized HIV epidemic in Nigeria, men who have sex with men (MSM) carry a disproportionate burden of HIV in the country with 18% reported to be living with HIV compared to 4% of the general population. In the context of emerging HIV prevention strategies including PrEP, consistent condom use (CCU) remains a mainstay of HIV prevention among MSM. The consistent use of condoms may however not only be influenced by individual level behavioural risk factor but also partner risk characteristics. Here we assess the prevalence of consistent condom use across time in a cohort of MSM as well as the partner characteristics and risk factors associated with CCU.

TRUST/RV368, as a prospective cohort study, evaluates the efficacy of peer-driven chain referral network-based recruitment of MSM into HIV testing, care, treatment, and prevention services at trusted community- based venues. The cohort enrolls MSM and TGW participants in Abuja and Lagos, Nigeria, using respondent-driven sampling (RDS). Participants who were recruited into the study between March 2013 and March 2018, who reported having anal sex and who had information about at least one sexual partner were included in these analyses. Participants were classified as consistently using condoms if they reported always using condoms all the times they had insertive or receptive anal sex or both types of sex with a male partner. Participants (egos) were then asked questions about the demographics and risk behaviors of up to five of their sexual partners (alters) at alternating visits. Crude and multivariable mixed effect Poisson regression models with clustering on the ego and 95% confidence intervals were used to assess the characteristics of the alters associated with the ego’s condom use. The multivariable model was adjusted for time, site and how true the egos believed the responses they provided about the alters were.

1474 participants (egos) reported on 9654 most recent sexual partners (alters). The median age of egos was 24 years (1QR:21-27) while the median age of the alters was 26 (IQR:23-30). Most of the egos identified as men (79%) while 32% of them were homosexual or gays. Alters tended to be older than the egos (61%), of a higher socio-economic status than the egos (56%), more educated than the egos. Although inconsistent condom use was common in the cohort, there was a trend of increasing consistent usage of condoms across study visits (visit 1: 41%, visit 2: 67%, visit 3: 75%). In the crude analysis, the partner characteristics associated with ego CCU included, a more educated alter, alters consistently using a condom with other sexual partners and the alter encouraging the ego to use condoms with partners. In the multivariable analysis, factors associated with CCU were a more educated alter, alter consistently using a condom with other partners and alter having the same socio-economic status as the ego. Egos who reported that their sexual partners ever had an STI symptom (RR: 0.93; 95% CI: 0.87-0.99), ever paid money to have sex were less

20th Annual International Meeting of the Institute of Human Virology 72 Poster Abstracts

PG-7 PG-8 Association between early sexual debut and risk of HIV and Characterization of Pre exposure prophylaxis (PrEP) cascade bacterial STIs among men who have sex with men in Nigeria among Nigerian MSM

Andrew Mitchell, BA, Institute of Human Virology, University of Maryland Habib Omari, MD, PhD, Institute of Human Virology, University of Maryland School of Medicine, Trevor Crowell, MD, PhD, U.S. Military HIV Research School of Medicine, Dorcas Ayande, BSc, Institute of Human Virology Program, Walter Reed Army Institute of Research, Habib Omari, MD, PhD, Nigeria, Teclaire Ndo-Ndombi, MSc, MBA, Institute of Human Virology Institute of Human Virology, University of Maryland School of Medicine, Nigeria, Rebecca Nowak, PhD, University of Maryland School of Medicine, Nicaise Ndembi, MSc, PhD, Institute of Human Virology Nigeria, Hongjie Institute of Human Virology, Trevor Crowell, MD, PhD, U.S. Military HIV Liu, PhD, University of Maryland School of Public Health, College Park; Research Program, Walter Reed Army Institute of Research, Stefan Stefan Baral, MD, MPH, Johns Hopkins Bloomberg School of Public Baral, MD, MPH, Johns Hopkins Bloomberg School of Public Health, Health, Man Charurat, PhD, Institute of Human Virology, University of Nicaise Ndembi, PhD, MSc, Institute of Human Virology, Man Charurat, Maryland School of Medicine, Rebecca Nowak, PhD, Institute of Human PhD, MHS, University of Maryland School of Medicine, Institute of Human Virology, University of Maryland School of Medicine Virology

Introduction: Younger age at first anal intercourse (AFAI) has been Introduction: With an estimated HIV incidence of 15.4 / 100 person years, identified as an early indicator of sexual risk-taking and behaviors that Nigerian men who have sex with men (MSM) account for one of the highest occur in the early stages of sexual initiation may persist into adulthood. In HIV incidence among members of key populations. Proven HIV biomedical sub-Saharan Africa, men who have sex with men (MSM) at a young age intervention such as Pre exposure Prophylaxis (PrEP) will potentially may establish long-term behaviors that heighten risk for HIV and sexually decrease new HIV infections and likely benefit MSM in this setting. Here transmitted infections (STIs). The objective of this cross-sectional study we characterize engagement in the HIV PrEP cascade and assess factors was to characterize AFAI among Nigerian MSM and to evaluate younger associated with PrEP initiation among Nigerian MSM. AFAI as a risk factor for HIV and STI infections. Methods: The TRUST/RV368 cohort employs respondent-driven-sampling Methods: From March 2013 to March 2018, TRUST/RV368 recruited MSM (RDS) to recruit MSM into HIV/STI prevention and treatment services into HIV care and treatment in Abuja and Lagos, Nigeria, using respondent- in Abuja and Lagos, Nigeria. HIV negative MSM at the Abuja site who driven sampling (RDS). Comprehensive structured instruments and HIV/ completed a survey instrument on awareness and willingness to use PrEP STI testing were administered at baseline and quarterly. Men with a were approached by telephone for PrEP initiation. Follow-up visits were one reported AFAI and HIV/STI diagnostic results were included in the analysis month after enrollment and quarterly thereafter. Bivariate logistic regression (n=1396). AFAI was categorized as younger (≤15 years) and older (≥16 models were used to assess factors associated with PrEP initiation. years). Demographics and behavioral differences by AFAI were evaluated using Rao-Scott Chi-Square tests. Crude and adjusted odds ratios (ORs) Results: Between March 2013 and July 2018, 428 HIV negative MSM for prevalent HIV, Neisseria gonorrhea (NG), and Chlamydia trachomatis completed the survey instrument on awareness and willingness to use (CT) by AFAI were calculated using logistic regression. Multivariate models PrEP. Of these, 13 (3%) seroconverted during their initial follow up prior to controlled for demographic characteristics that were significantly associated PrEP initiation and were excluded, and the remaining 415 were included in with AFAI. these analyses. Participants had a median age of 25 (interquartile range [IQR]: 22-29) years. Among 415 HIV negative, 250 (60%) were successfully Results: Median AFAI was 17 years (interquartile range [IQR] 15-20] contacted, 144 (35%) screened and 133 (32%) initiated PrEP (Figure 1). and median age of participants was 24 years (IQR 21-27). Four hundred Younger MSM, (≤19 years vs. ≥ 25 years (OR 0.6; 95% CI 0.4 to 0.9)) and forty-eight (448; 32.1%) MSM with younger AFAI were younger and religion, (Muslims vs. Christians, (OR 0.5; 95% CI 0.3 to 0.9) were at enrollment, less educated, self-identified as homosexual or female- associated with decreased odds of PrEP initiation. Exposure to HIV gendered, reported more male partners, more receptive partnerships, had education such as receiving information on HIV prevention in the past a history of condomless anal sex, and engaged in transactional sex within 12-months was associated with increased odds of PrEP initiation, (OR 1.7; the past year (all p≤0.01). The first sexual partner was primarily male and 95% CI 1.1 to 2.7). self-reporting of forced sex was higher among MSM with younger AFAI (all p≤0.01). Poor mental health and limited access to health services were not Conclusion: Engagement in PrEP in this population is relatively low with associated with younger AFAI (all p>0.05). In the crude analysis, prevalent younger individuals less likely to engage in PrEP. Reinforcing HIV prevention HIV (OR 1.20; 95% CI: 0.8-1.7) did not differ by AFAI. NG (OR 2.13; 95% CI: education and facilitating young MSM to engage in PrEP programs is critical 1.0-4.5) and CT (OR 1.40; 95% CI: 1.0-1.9) prevalence was higher among in order to prevent onward HIV transmission. those MSM with younger AFAI. Adjustment for demographic correlates of AFAI diminished associations of prevalent NG (OR 1.76; 95% CI: 0.9-3.6) and CT (OR 1.23; 95% CI: 0.9-1.6) with younger AFAI. HIV prevalence trended higher for those with younger AFAI (OR 1.31; 95% CI:1.0-1.9) as compared to older in the multivariate analysis.

Conclusions: Younger AFAI was strongly associated with recent reporting of condomless sex, receptive anal sex, and multiple partnerships. If these findings are attributed to pattern-forming sexual practices adopted in adolescence, younger AFAI may be indicative of a group at high risk for HIV and STIs. Accessible sexual health education for these young men may promote lasting, safer same-sex practices and reduce the prevalence of HIV and STIs. 20th Annual International Meeting of the Institute of Human Virology 73 Poster Abstracts

PG-9 Abraham, BSc, Institute of Human Virology Nigeria, Esther Dunia, BSc, Predictors of Final HIV Status Outcome for HIV-Exposed Infants Institute of Human Virology Nigeria, Nadia Sam-Agudu, MD, Institute at 18 months of Age in 10 Nigerian States of Human Virology, University of Maryland School of Medicine, Halima Ibrahim, RN, Institute of Human Virology Nigeria, Ernest Ekong, MD, Babatunde Adelekan, MD, PhD, Academy for Health Development Nigeria MPH, PhD, Institute of Human Virology Nigeria, Patrick Dakum, MD, MPH, Abidemi Harry-Erin, BSc, Institute of Human Virology Nigeria, Nadia Sam- Institute of Human Virology, University of Maryland School of Medicine Agudu, MD, Institute of Human Virology, University of Maryland School of Medicine, Martha Okposo, MPH, Institute of Human Virology Nigeria, Background: Tuberculosis (TB) service integration into antenatal care Nicaise Ndembi, PhD, Institute of Human Virology Nigeria, Charles (ANC) and prevention of mother-to-child transmission of HIV (PMTCT) Mensah, MBA, Institute of Human Virology Nigeria, Patrick Dakum, MD, can facilitate prevention and control of TB/HIV co-infection among HIV- MPH, Institute of Human Virology Nigeria, Ahmad Aliyu, MD, PhD, Institute positive pregnant women and their HIV-exposed infants. Such integration of Human Virology Nigeria requires TB intervention roll-out across all Maternal, Newborn and Child Health (MNCH) points of care, and should include the engagement of ANC Introduction: There were an estimated 37,000 new child HIV infections in providers. Nigeria in 2016, the highest globally. For Nigeria, 6 week and final mother- to-child transmission of HIV (MTCT) rates are estimated at 13.1 and 23.0%, Objective: To assess the feasibility and impact of TB service integration respectively. The UNAIDS has targeted final MTCT rates of <2% and <5% into ANC and PMTCT, and identify potential gaps. among non-breastfeeding and breastfeeding infants, respectively. Data on 18-month final outcomes among HIV-Exposed Infants (HEI) in Nigeria is Methods: This retrospective study was conducted at 6 PEPFAR TB-MNCH scarce. We evaluated for predictors of HIV status among HEI at 18 months pilot sites between February and April 2018. Facilities were selected based of life in 10 Nigerian states. on monthly ANC attendance, and comprised rural and semi-rural health facilities (5 secondary, one tertiary). A TB integration manual, and TB Methods: This retrospective, cross-sectional study collected data from 96 screening algorithm and data-capturing tools were developed and deployed PEPFAR-supported health facilities supported by the Institute of Human to facilities, along with healthcare worker engagement and training. TB Virology Nigeria in 10 Nigerian states between October 2014 and September prophylaxis and treatment services were to be provided to TB-negative 2015. Only HEI with a first DNA PCR result at ≥4-6 weeks, and a rapid HIV and presumptively-infected pregnant women respectively, after universal antibody test result at ≥18 months of age were included. Data including screening. Data were collected from TB screening registers and cards and residence, birth weight, breastfeeding status, and maternal ART access ANC general registers. TB-DOT clinic registers were reviewed to determine were collected for analysis. Multivariate logistic regression (adjusted odds the number of presumptive cases that accessed GeneXpert testing. A ratios [aORs] evaluated for predictors of HIV test positivity at 18 months. survey was conducted among healthcare workers (HCWs) to explain gaps identified.

Results: A total of 2,405 HEI from the 96 facilities were included in the study. Results: Out of 5,767 ANC attendees presenting in the three month period Median birthweight was 3 kg (IQR 1.2-6.1), and at final testing was 10kg 100% were screened for HIV, and 2,993 (51.8%) were screened for TB. A (IQR 5.5-15). Of the 2,405 HEI negative at first DNA PCR test and tested total of 140/5,767 (2.4%) women were HIV-positive, with 37/2,993 (1.2%) at ≥18 months, 68 (2.8%) were positive. After a minimum of 18 months of TB-screened women determined active TB-presumptive, all of whom age, 51 (75%) of the 68 HIV-positive infants were alive on ART; 7 (10%) accessed Gene Xpert testing. Ultimately, 36/37 women tested TB-negative had died, 4 (6%) were lost to follow-up and 6 (9%) had transferred out to and 1 (0.12%) tested positive. One facility had no documentation of ANC- other facilities for care. Infant birth weight of ≥ 2.5kg (AOR 0.40, p=0.009), TB screening for the review period. urban residence (OR 0.45, p=0.008) and exclusive breastfeeding (OR 0.04, p<0.001) protected against MTCT; maternal non-initiation/utilization of Of the 139 HIV-positive pregnant women confirmed TB-negative, only 3 antenatal/in-labor ART (OR 9.59, p<0.001) correlated with MTCT. (2.2%) were placed on isoniazid prophylaxis. The sole TB/HIV+ woman was commenced on TB/HIV treatment, and ultimately, her TB/HIV-exposed Conclusion: The final HIV positivity rate of 2.8% in our cohort is lower infant was provided both isoniazid and HIV prophylaxis. than the national estimates, which is encouraging. However, this should be interpreted with caution: the HIV status of HEI seen at the study facilities Eleven key HCWs (4 doctors, 6 ANC nurses, and 1 pharmacist) were who did not present for early and/or final testing was not available and thus surveyed across the 6 sites. Only 7/11 (63.6%) HCWs indicated being not evaluated. Nevertheless, supported by our findings, we recommend trained on TB-MNCH integration. Excessive workload was universally strengthening universal maternal access to ART, ideally in the pre- reported as the reason for poor TB screening at ANC. Unavailability of conception and prenatal stages. This should be prioritized especially for Isoniazid was reported as the major reason for non-provision of prophylaxis rural women living with HIV. Furthermore, our findings correlate with the to eligible HIV-positive pregnant women. nationally-recommended 6-months of exclusive infant breastfeeding. We acknowledge that data from non-presenting HEI are also needed to devise Conclusion: Integration of TB services into ANC/PMTCT was inadequate, interventions for universal uptake of early and final HIV testing. We expect mainly due to screening and prophylaxis initiation gaps. Closing these gaps that as Option B plus is scaled up in Nigeria, more women would access will require health systems strengthening to address training/knowledge and be maintained on ART through their first and subsequent pregnancies, deficiencies, task-shifting and supervision needs, drug/commodity stock- thereby reducing the gaps in maternal-infant HIV service uptake. outs and leadership at the facility and state level. Linkage to confirmatory testing for the TB-presumptive cases was excellent, and maternal treatment PG-10 initiation and infant prophylaxis were encouraging for the sole mother-infant Implementation of Tuberculosis Service Integration into ANC and pair identified. To complement gains and accelerate progress made in both PMTCT and TB program areas, universal TB screening coverage and PMTCT Programs in Northern Nigeria. prophylaxis initiation, confirmatory diagnosis and prompt treatment initiation Genevieve Anih, BSc, Institute of Human Virology Nigeria, Oluchi must be achieved at MNCH facilities in Nigeria. 20th Annual International Meeting of the Institute of Human Virology 74 Poster Abstracts

PG-11 health services, including PMTCT and partner notification. Data collection Characteristics of a Nationwide Cohort of Nigerian Adolescents for relevant indicators need to be incorporated into routine programming Living with HIV on ART for improved service delivery. Longitudinal monitoring for this cohort can potentially yield valuable data to improve treatment outcomes. Olawale Fadare, MD, Caritas Nigeria, Fei Badejo, MD, FHI 360, Olabanjo Ogunsola, MD, APIN Public Health Initiatives, Iboro Nta, MD, MSc, Institute of Human Virology Nigeria, Jude Ilozumba, MD, Center for Clinical Care and Clinical Research Nigeria, Olusegun Busari, MSc, Center for Integrated Health Programs, Nadia Sam-Agudu, MD, Institute of Human Virology, University of Maryland School of Medicine, Echezona Ezeanolue, MD, MPH, Healthy Sunrise Foundation

Background: At an estimated 240,000, Nigeria has the second highest number of adolescents living with HIV (ALHIV) globally. Treatment outcomes for ALHIV have been poorer than for adults and younger children living with HIV. In order to improve outcomes for this population, comprehensive profile information is needed for programming innovations and differentiated care. We collated patient-level data from a large cohort of Nigerian ALHIV on ART to facilitate high-level decision-making for better outcomes.

Methods: Between April and September 2017, data from all sites supported by six of the largest member organizations of the Nigeria Implementation Science Alliance were collected from the relevant State Health agencies. These 6 PEPFAR-implementing partners (IPs) supported healthcare facilities across all 6 of Nigeria’s geopolitical zones.

Data from 10-19 year old ALHIV enrolled in care and on ART during the review period were targeted. Data collected were extracted from IP-verified de-identified programmatic databases that included socio-demographic and clinical treatment information. Data from each partner were merged into a single Microsoft Excel database and descriptive analysis conducted using STATA 13.

Results: A total of 22,551 unique ALHIV entries were identified, from 29 of Nigeria’s 37 states and the Federal Capital Territory. The highest proportion of ALHIV (34.1%) came from the North-Central Zone, and the lowest proportion (9.3%) from the South-West. ALHIV in this cohort comprised 13,473 (59.7%) females, and were spread at 30.5%, 33.5% and 36.0% across early (10-13 yrs), mid (14-16 yrs) and late (17-19 yrs) adolescence, respectively. The greatest proportion of females (77.5%) was in the 19 year age group, with the lowest proportion (~50%) across the 10-14 year age group.

After excluding 4% missing data, approximately 91% of adolescents in the cohort were documented as being currently on first line NNRTI-based adult or pediatric combination ART. The remaining 5% of ALHIV were on PI-based second-line regimens. Facility-based ART refills for the majority (59.4%) of this cohort were on a two-monthly cycle; 29.7% on a one-monthly cycle and 10.2% on a three-monthly schedule.

There were significant data gaps, with little to no information available on source of HIV infection and point of service entry into care, marital or sexual activity status, HIV disclosure status, or viral suppression.

Conclusions: This ALHIV cohort represents nearly 10% of the estimated 240,000 ALHIV in Nigeria, and offers an opportunity to understand and program for impactful differentiated ALHIV care in the country. Questions remain on the relative absence of older adolescent males in care, regimen adjustments and switching based on weight and viral load data, and the best schedule and approach for delivering ART to this challenging population. Missing and non-prioritized data is an issue, specifically that needed to provide adherence support and comprehensive sexual and reproductive 20th Annual International Meeting of the Institute of Human Virology 75 Poster Abstracts

PG-12 “undetectable = untransmittable” (U=U) campaign, clinical care of HIV- Viral Suppression among HIV-Infected Methadone-Maintained infected individuals, including those for methadone-maintained patients, Patients: The Role of Ongoing Injection Drug Use and Adherence could be enhanced by improving communication and counseling about the to Antiretroviral Therapy (ART) importance of consistent ART adherence and viral suppression. As such, future interventions should encourage both HIV-infected individuals and Roman Shrestha, MPH, PhD, University of Connecticut, Michael their partners to discuss options for HIV and other sexually transmitted Copenhaver, PhD, University of Connecticut infections (STIs) prevention, including HIV and STI treatment, condoms, pre-exposure prophylaxis (PrEP) and post-exposure prophylaxis (PEP) Introduction: Methadone maintenance therapy (MMT) is associated within substance abuse treatment settings. with improved virologic outcomes among HIV-infected opioid-dependent individuals, which support the use of MMP as part of the integrated approach to improve HIV treatment and care continuum. However, opioid-dependent individuals stabilized on MMT are highly diverse and beyond the benefit of HIV treatment as prevention (TasP) efforts. Given the critical role of sustained viral suppression in maximizing benefits of antiretroviral therapy (ART), we sought to assess factors associated with viral suppression in patients stabilized on MMT. Identifying subgroups at-risk for not achieving viral suppression and addressing factors causing the disparities could inform approaches to optimize HIV treatment outcomes and prevention efforts (e.g., HIV TasP).

Methods: A sample of 133 HIV-infected, methadone-maintained patients who reported HIV-risk behaviors were enrolled from a community-based methadone maintenance drug treatment facility in New Haven, Connecticut. Participants were recruited through clinic-based advertisements and flyers, word-of-mouth, and direct referral from counselors in the methadone clinic. Participants were assessed using an audio-computer assisted self- interview (ACASI). Multivariable logistic regression was used to identify significant correlates of viral suppression. Additionally, we examined the interactive effect of pairs of variables in the main effects model to determine the moderated effect on viral suppression. Model fit was assessed using a Hosmer and Lemeshow Test.

Results: The mean age of participants was 49.3 (±8.3) years. The mean duration of HIV diagnosis was 14.1 (±9.6) years and 63.2% of participants reported to have disclosed their HIV status to a sexual partner. Of 121 (91.0%) individuals who were taking ART, 57.9% had achieved optimal adherence, and 80.4% had achieved viral suppression. Self-reported HIV risk behaviors were highly prevalent among study samples. Almost half of participants (46.6%) reported injecting illicit drugs in the past 30 days. Of those, 58.1% reported having shared injection equipment. Similarly, 21.1% of participants reported having sex with more than one sexual partner, and only 14.3% reported always using condoms with their sexual partners in the past 30 days. Having optimal adherence to ART was associated with an over four-fold odds (aOR=4.883, p=0.009) and having high CD4 count was associated with a two-fold odds of being virally suppressed (aOR=2.483, p=0.045). Additionally, participants who reported having injected drugs in the past 30 days (aOR=0.081, p=0.036) were significantly less likely to achieve viral suppression. Furthermore, we found a significant interaction effect that involved optimal ART adherence and injection of drugs on viral suppression (aOR=2.953, p=0.029). That is, the influence of optimal ART adherence on viral suppression was reduced due to ongoing injection drug use practices.

Conclusion: Overall, our findings illustrated how the benefit of MMT programs may be negated among a significant segment of methadone- maintained patients and highlights unaddressed HIV-related treatment challenges faced by this risk group. These findings have important implications for the recently identified concept of HIV TasP as a clinical care strategy to reduce the harmful impact of ongoing HIV replication among HIV- infected individuals as well as transmission risk between serodiscordant couples. As advocates have recently called for the recognition of 20th Annual International Meeting of the Institute of Human Virology 76 PI-1 Results: The mean (SD) age of participants was 14.9 (2.3) years. We Age-specific HPV prevalence among adolescent girls in Jos, detected anyHPV in 13.2% of vulvo-vaginal and 21.0% of urine samples. North-Central Nigeria 7.8% and 11.2% of vulvo-vaginal swab and urine had hrHPV respectively. The commonest hrHPV types in vulvo-vaginal swab were 52 (3.9%), 51 Nanma Dashe, MSc, Department of Medical Microbiology, College of (2.4%) and 18 (1.5%), and in urine were 52 (6.8%), HPV 18 (5.4%) and Medical Sciences, University of Jos, Lohya Nimzing, PhD, Department HPV 51 (2.9%). Approximately 10% and 14% of vulvo-vaginal samples of Medical Microbiology and Medical Laboratory Science, College of and urine samples had single infections; and 3.4% and 7.3% had multiple Medical Sciences, University of Jos, Daniel Egah, MD, Department of infections respectively. Multiple hrHPV infection was detected in 2.9% of Medical Microbiology, College of Medical Sciences, University of Jos and vulvo-vaginal swab and 5.9% of urine samples. Of the 27 vulvo-vaginal Jos University Teaching Hospital, Sally Adebamowo, MD, Department of swabs and 43 urine samples positive for anyHPV, in only 10 (37.0%) Epidemiology and Public Health, and Greenebaum Comprehensive Cancer instances were both vulvo-vaginal and urine samples positive for anyHPV. Center, University of Maryland School of Medicine, Clement Adebamowo, There was poor concordance between the urine and vulvo-vaginal samples MD, Department of Epidemiology and Public Health, and Greenebaum for anyHPV (κ = 0.15, p=0.03). Comprehensive Cancer Center, University of Maryland School of Medicine Conclusion: The poor concordance suggests that first-void urinary HPV is Background: Knowledge of the age-specific prevalence of HPV types not a suitable proxy for vulvo-vaginal HPV infection in this population. among adolescent girls in SSA is essential to determine the best age for introduction of HPV vaccination, monitoring of vaccine efficacy and PI-3 provision of insight into persistent infection. Single molecule fluorescence approaches to probe the binding of soluble-CD4 to native-like HIV-1 SOSIP trimers Methods: We randomly selected 205 girls, age 9–20 years living in Jos, Nigeria. Informed consent and assent were obtained prior to training on Parul Agrawal, PhD, Institute of Human Virology, University of Maryland self-collection of vulvo-vaginal samples using sterile swab stick and first School of Medicine, Anthony DeVico, PhD, Institute of Human Virology, void urine. HPV detection was carried out using HPV SPF10-DEIA/LiPA25. University of Maryland School of Medicine, George Lewis, PhD, Institute Data analysis was done using STATA14®. of Human Virology, University of Maryland School of Medicine, Marzena Pazgier, PhD, Institute of Human Virology, University of Maryland School Results: The mean (SD) age of the girls was 14.9 (2.3) years. AnyHPV of Medicine, Krishanu Ray, PhD, Institute of Human Virology, University of was detected in 29.3% of participants. The earliest age at which anyHPV Maryland School of Medicine and high-risk HPV (hrHPV) infections were detected in either urine or vulvo- vaginal samples were 10 and 11 years of age respectively. The prevalence Several lines of evidence suggest that HIV-1 envelope (Env) on virions of anyHPV, hrHPV, lrHPV and multiple hrHPV peaked at 16 years of age. transition through a series of conformations in solution as well as when they The prevalence of hrHPV infection was 3.4% among the 9–12 years age engage CD4 molecules during viral attachment. Moreover, the flexibility and group, 7.8% among 13–16 years and 5.4% among 17–20 years old. The antigenicity of trimers changes as they progressively become saturated with commonest hrHPV types detected were 52 (10.2%), 18 (6.3%) and 51 CD4 molecules. HIV-1 Env can potentially engage up to three independent (4.4%). CD4 molecules for efficient Env triggering in the virial fusion. However, it is still unknown if one, two or three CD4 receptor molecules are required Conclusion: While a larger study is warranted, our findings suggest that in for this process. To date, the ensemble techniques and indirect biological this population, HPV vaccination starting at 9 years of age would cover the assays have been unable to address this question quantitatively. Here, we at-risk population. employed a unique approach utilizing the single molecule detection (SMD) analyses to determine quantitatively the number of sCD4 molecules bound PI-2 to HIV-1 Env and capture the intermediate interaction states that may be Comparison of Type-Specific HPV Detection in Urine and Vulvo- missed by the ensemble methods. A key step in direct counting of single Vaginal Samples from Adeolescent Girls in Jos, Nigeria molecules is to ensure single fluorophore labeling of the target molecule. For this purpose, we constructed a C-terminus SNAP-tagged human Nanma Dashe, MSc, University of Jos, Lohya Nimzing, PhD, Department sCD4 fusion protein and fluorescently labeled it with a single Alexa 488 of Medical Microbiology and Medical Laboratory Science, College of fluorophore (sCD4-SNAP-A488). This approach was devoid of any genetic Medical Sciences, University of Jos, Daniel Egah, MD, Department of or external perturbation to the SOSIP.664 trimers. Medical Microbiology, College of Medical Sciences, University of Jos and Jos University Teaching Hospital, Sally Adebamowo, MD, Department of Our results by SMD confirm that up to three sCD4-SNAP-A488 molecules Epidemiology and Public Health, and Greenebaum Comprehensive Cancer bind a single SOSIP trimer and provide insight into trimer occupancy shifts Center, University of Maryland School of Medicine, Clement Adebamowo, over time. The experimental data reveals that Env is intrinsically dynamic, MD, Department of Epidemiology and Public Health, and Greenebaum transitioning between three distinct stoichiometries (one-, two- and Comprehensive Cancer Center, University of Maryland School of Medicine three- sCD4 bound states). Real-time single molecule association kinetic experiments divulge different states of trimer triggering and stoichiometry of Objective: To compare self-collected vulvo-vaginal swab and first void the complexes. We have developed an algorithm for automated analyses urine for the detection of HPV among adolescent girls in Jos. of our data to infer the stoichiometry in real-time. Importantly, our single- molecule based association kinetic analysis indicates that assemblies of Methods: We randomly recruited 205 girls, age 9–20 years from ten public trimer with one or three sCD4 molecules are more stable whereas binding and private high schools in Jos, Nigeria. After informed consent and assent, of two sCD4s seems transitional. Our findings are consistent with structural each participant self-collected vulvo-vaginal samples and first-void urine information available for conformations of HIV-1 Env in its ligand-free, which were tested using SPF10-DEIA/LiPA25. Data were analyzed using prefusion state and in the CD4-bound states and provide new critical STATA14®. insights into the sCD4 interaction with the Env for better understanding of 20th Annual International Meeting of the Institute of Human Virology the complex biology of HIV-1 entry into cells. 77 PI-4 therapeutic for IL-1R and TLR receptor antagonism. Using biochemical, Trogocytosis of Viral Immune Complexes in the context of HIV-1 biophysical and functional studies, we will determine the molecular infection mechanism of SIGIRR’s negative regulation of IL-1R and Toll-like receptor signaling. Specifically, we will characterize the structure-function relationship Chiara Orlandi, PhD, Institute of Human Virology, University of Maryland of SIGIRR-IL1R and TLR interactions using X-ray crystallography. In support School of Medicine, Robin Flinko, MS, Institute of Human Virology, of these studies we have successfully expressed, purified and crystallized a University of Maryland School of Medicine, Institute of Human Virology, SIGIRR fusion protein. SIGIRR fusion crystals diffract to 2.8 angstrom at the University of Maryland School of Medicine, Krishanu Ray, PhD, Institute National Synchrotron Light Source II AMX beamline in Brookhaven National of Human Virology, University of Maryland School of Medicine, Yi Hu, PhD, Laboratory. We are currently collecting more X-ray diffraction data for Institute of Human Virology, University of Maryland School of Medicine, determining the structure of the crystallized SIGIRR fusion protein. Future Joao Mamede, PhD, Institute of Human Virology, University of Maryland studies include structure determination of SIGIRR protein with IL-1 and Toll- School of Medicine, Danijela Maric, PhD, Northwestern University, like receptor and development of an IL-1R -SIGIRR based signaling assay. Thomas Hope, PhD, Northwestern University, George Lewis, PhD, Molecular studies of SIGIRR’s negative regulation of IL-1R will aid in our Institute of Human Virology, University of Maryland School of Medicine molecular understanding and development effective therapeutic treatment options for regulating IL-1 based inflammation and disease. Fc-mediated Ab functions rely on multiple mechanisms of action that include the recruitment of complement and Fc receptor-bearing cellular subsets PI-6 that can mediate trogocytosis, phagocytosis, and cellular cytotoxicity. Construction and Analysis of V3 Glycopeptide Antigens for HIV-1 Monocytes-mediated trogocytosis is defined as the active exchange Vaccine Design of membrane fragments between cells tightly interacting through an immunological synapse. Here, we propose to define the trogocytic activity Roushu Zhang, Department of Chemistry and Biochemistry, University of of anti-Envelope human monoclonal antibodies in the context of HIV-1 Maryland College Park, Hui Cai, Department of Chemistry and Biochemistry, infection. With this aim we employ the optimized RFADCC, adding a new University of Maryland College Park, Jared Orwenyo, Department of one-step anti-CD14 and Live/dead staining. Combining flow cytometry and Chemistry and Biochemistry, University of Maryland College Park, John high-resolution confocal microscopy, we were able to follow the movement Giddens, Department of Chemistry and Biochemistry, University of of fragments of membrane from the targets to the effectors, specifically to Maryland College Park, Qiang Yang, Department of Chemistry and monocytes. Particularly, in the presence of monoclonal IgGs specific for Biochemistry, University of Maryland College Park, Celia C. LaBranche, Cluster A epitopes (A32 and C11) exposed on HIV-1 envelope, we were Department of Surgery, Duke University, David C. Montefiori, Department able to visualize the formation of stable immune synapses that include of Surgery, Duke University, Lai-Xi Wang, Department of Chemistry and a Ba-L gp120-coated target and one or multiple monocytes. During the Biochemistry, University of Maryland College Park interaction, the whole immune complex, formed by Ba-L gp120 Ag and IgG, migrated and clustered towards the points of contact with monocyte(s) The heavy glycosylation on HIV-1 envelope protein (Env) plays an and transferred onto the surface of the effectors by trogocytosis. This important role in viral evasion and is critical for the viral plasticity and phenomenon is very fast and it is strictly dependent on the formation diversity in the circulating strains. The discovery of a new class of broadly of stable immunological synapses between HIV-1 sensitized cells and neutralizing antibodies (bnAbs), including PG9, PGT128, PGT121, and monocytes, since trogocytosis is not observed in the case of Synagis, 10-1074, that recognize conserved glycopeptide epitopes from the V1V2 which lacks its specific antigen and, in turns the ability of bridging Targets and V3 domains provide a valuable template for vaccine design. Structural and Effectors. These findings support a new role for monocytes, potentially and mutational studies have provided basic information on the nature and being the mediators of a new mechanism for clearance of viral antigens structure of the glycopeptide epitopes of these antibodies. Nevertheless, from target cells or potentially being new targets for the immune response due to the tremendous heterogeneity of envelope glycosylation, the fine against the virus after the acquisition viral IC from HIV-1 sensitized cells. glycan specificity of these antibodies remains to be fully characterized. Moreover, it remains a challenging task to reconstruct glycosylation-well PI-5 defined antigenic structures even when the glycan specificity is defined. To Regulating Innate Immune Signaling using Single Immunoglobulin address these problems, we have launched a chemical biology program Interleukin-1 Regulated Receptor Protein aiming to reconstitute a library of structurally well-defined glycopeptides and glycoproteins to probe the glycan specificity of these glycan- reactive Mercedes Ferandes, HS, MERIT Health Leadership Academy, Jahid Carr, broadly neutralizing antibodies. Through the chemoenzymatic synthesis and HS, Mount Carmel High School, Joseph Crnkovich, HS, The Heights antibody-binding studies of a library of V3 glycopeptides, we found that the School, Shouq Alanezis, MSc, Catholic University, Yajing Wang, PhD, PGT128 requires a high-mannose N-glycan on V3 domain with promiscuous Institute of Human Virology, University of Maryland School of Medicine, site of glycosylation at either N332, N301, orN295); the PGT121 shows Lindsey Brown, PhD, US Food and Drug Administration, Greg Snyder, binding specificity towards a sialylated N-glycan at N301 site; and the 10- PhD, Institute of Human Virology, University of Maryland School of Medicine 1074 prefers a high-mannose type glycan at N332 site. From the mapping of the epitopes, we designed glycopeptide-based immunogens derived from The Single Immunoglobulin Interleukin-1- related receptor protein (SIGIRR) the V3 domain through chemical and biological approaches. The synthetic has been observed to be a negative regulator of the IL-1 (IL-1R) and Toll- glycopeptide immunogens obtained by chemoenzymatic synthesis and like receptor (TLR) signaling pathways. Negative regulation of TLR and IL- the glycosylation-defined V3 glycopeptide-Fc fusion proteins obtained 1R signaling by SIGIRR is important for innate immune signaling. SIGIRR through mammalian cell expression both showed potent binding towards has been implicated in diseases involving chronic and acute inflammation, multiple V3-targeting bnAbs. Rabbit immunization experiments revealed including but not limited to asthma, allergies, autoimmunity, and cancer. that the synthetic V3 glycopeptide could elicit glycan-dependent antibody Based on SIGIRR’s ability to negatively regulate IL-1R and TLR signaling, responses. These results together suggested that our glycosylation-defined we hypothesize that SIGIRR could be developed as an IL-1 specific V3 glycopeptide immunogens could serve as a valuable vaccine component in the combination with other vaccine candidates for further immunization 20th Annual International Meeting of the Institute of Human Virology studies. 78 PJ-1 mutated single nucleotides in the HIV-1NL4-3 genome thus introducing The HIV-1 Antisense Protein ASP is a Structural Protein of the early stop codons in the ASP open reading frame without affecting the Viral Envelope amino acid sequence of Env encoded on the opposite strand. We found that these ASP-deficient viruses displayed a ~50% reduction in replication Yvonne Affram, MPhil, Dr.rer.nat, Institute of Human Virology, University rate compared to wildtype virus. of Maryland School of Medicine, Juan Carlos Zapata, PhD, Institute of Human Virology, University of Maryland School of Medicine, Wei Zhou, Conclusions: Our results indicate that ASP is expressed in the nuclei of non- BS, Institute of Human Virology, University of Maryland School of Medicine, productively infected cell lines. Upon viral reactivation, ASP translocates to Marzena Pazgier, PhD, Institute of Human Virology, University of Maryland the surface where it co-localizes with gp120. Moreover, ASP is present on School of Medicine, Maria Iglesias-Ussel, PhD, Institute of Human the membrane of viral particles, indicating that ASP is a structural protein Virology, University of Maryland School of Medicine, Krishanu Ray, PhD, in the envelope of mature HIV-1 virions. Further, ASP expression promotes Institute of Human Virology, University of Maryland School of Medicine, viral replication. Overall, our results suggest that ASP may represent a new Olga Latinovic, MSc, PhD, Institute of Human Virology, University of target for therapeutic or preventive vaccine. Maryland School of Medicine, Fabio Romerio, PhD, Institute of Human Virology, University of Maryland School of Medicine

Introduction: The antisense strand of the HIV-1 genome encodes a 189- aa, highly hydrophobic protein (ASP) with no known homologs. Humoral and cellular immune responses against ASP in HIV-1 infected individuals demonstrate its expression invivo. However, whether ASP plays a role in viral replication is still unknown. We studied the expression and subcellular localization of ASP in various chronically infected cell lines. In addition, we investigated the impact of ASP expression on viral fitness.

Methods: For intracellular and nuclear stainings, we used BD Cytofix/ Cytoperm and eBioscience FoxP3 kits. Flow cytometry data were acquired on a Millipore Guava and analyzed with FlowJo. Confocal and super- resolution microscopy images were acquired on Zeiss LSM 800 and Nikon N-STORMTi-E microscopes, and analyzed with Zen Blue and Nikon Elements Software Version 3.1. For virion-capture assays, antibodies against ASP and gp120 were immobilized on Protein G-dynabeads. For Fluorescence Correlation Spectroscopy (FCS) we used an ISS Q2 confocal microscope and the data were analyzed with ISS VistaVision.

Results/Discussion: We generated an in-house monoclonal antibody 324.6 against an epitope located between two putative transmembrane domains in the ASP protein. Using this antibody in flow cytometry and confocal microscopy, we found thatASP is expressed in the nuclei of chronically infected myeloid (U1andOM-10.1), and lymphoid (H9-IIIB, H9-CC, H9-MN,H9-RF, ACH2 and 8E5) celllines, but not their parental uninfected lines. However, ASP was not detectable neither on the cell surface or in the cytoplasm of infected cell lines. ASP expression was higher in cells cultured at low density compared to cells cultured at high density, suggesting that the rate of cell division may influence ASP expression levels. Confocal microscopy showed a polarized nuclear distribution of ASP, preferentially in areas of the nucleus containing actively transcribed chromatin. However, after reactivation of HIV-1 expression with PMA, we found that ASP translocated to the cytoplasm and to the cell membrane of all infected cell lines. In addition, the ability to detect ASP on the cell surface without permeabilization indicates that the ASP epitope recognized by324.6 antibody is extracellular. Confocal microscopy showed that ASP and gp120 co-localize on the cell surface of productively infected cells, and we determined that the Manders overlap coefficient is 78%. Super- resolution microscopy analyses provided further evidence of ASP and gp- 120 co-localization. These results suggest that ASP might be incorporated in the membrane of budding virions upon their release from infected cells. Indeed, the anti-ASP 324.6 antibody was able to capture HIV-1 particles with an efficiency similar to the anti-gp120 VRC01 antibody. Moreover, FCS showed that the binding efficiency of 324.6 antibody to single virions in solution was ~28%. Altogether, these two assays demonstrate the presence of ASP on the surface of mature HIV-1 particles released from infected cells. To investigate whether ASP expression impacts viral replication, we 20th Annual International Meeting of the Institute of Human Virology 79