Bangladesh J. Bot. 48(3): 457-466, 2019 (September) PHYLOGENETIC STUDY OF LIVING FOSSIL PSILOTUM NUDUM L. FROM HIMALAYAN RANGE OF PAKISTAN USING DNA BARCODES 1 BUSHRA KHAN, KHUSHI MUHAMMAD*, ZAINAB HAMAYUN, HABIB AHMAD , 2 3 SHAFEE UR REHMAN, ABDUL MAJID , YOUXIONG QUE , 4 5 MUHAMMAD SHAHID NADEEM AND IMDAD KALEEM Department of Genetics, Hazara University Mansehra, 21300, Pakistan Keywords: Phylogenetic, Psilotum nudum, DNA barcodes Abstract The genus Psilotum belongs to Psilotaceae family, with about 133 to 189 species having outstanding social, economic and medically important relict plants. However, being living fossil plant, many hurdles come in way while trying to discern its phylogenetics reconstruction. The partial conserve nucleotide sequences of rbcLa, trnA, trnV, matK, ITS, ycF3 and rpoB genes were used to select the best suitable barcodes in Psilotum nudum L. The amplified fragments were subjected to Sanger sequencing and then Maximum likelihood, Maximum Parsimony and Neighbor Joining trees were generated using bioinformatics software. i.e., MUSCLE, BioEdit and Mega-7. Current population showed the best match between P. complanatum (KY099851.1), population reported from New Zealand and P. nudum (F384430.1) with identity value 100 and 99% having E-value 0.0 and 0.0 by rbcLa and trnA barcode region, respectively. The findings showed that P. nudum L. sequences are ever first reported from the Himalaya regions of Pakistan and could be utilized for further comparison among different populations of this relict plant species across the globe. Introduction The floristic studies still fall behind in Pakistan. Although comprehensive data are available for angiosperms but grievously only limited work has been done on pteridophytes, predecessors to modern flora that still require vast level exploration. First ever preliminary checklist of 133 species of 39 dwells in District Mansehra, KPK (Stewart 1972). Later on, the Japanese team in 1992 and 1993 contributed a lot in adding information in pteridophytes study (Sundas et al. 2012). and furthermore, Frazer-Jenkins discovered that 189 species of pteridophytes are endemic to Western Himalaya of Pakistan (Gul et al. 2016). So far, no record has been found from any area of Pakistan neither in wild nor in cultivated form. Nearly 400 million years ago, Psilophytes, first ever fossil records were found from Scotland in the same way as Psilotum is studied today. It is the most pre-historic primitive vascular plant, abundantly available in tropical and sub-tropical regions of the globe (Zhang 2013, Gul et al. 2016). A Greek world "Psilotum" as well as Latin word "Nudum" both have same meaning i.e., “naked” (Yamazaki et al. 2001, Nazarian et al. 2010). Recently its imprints were reported for the first time from Elum mountains of Buner and Hazara, KP in Pakistan and was named as Psilotum hazaricum (Rahman et al. 2015). Psilotum carries ancestral twiggy structural qualities having diminutive flowering broom, fruits and seeds with prehistoric Y-shaped branches; reproductive structures occupy with little pillboxes like spores along the side of the stem that’s seems to be due *Author for correspondence: <[email protected]>. 1Islamia College, Peshawar, KP-Pakistan. 2Department of Botany, Hazara University Mansehra, Pakistan-21300. 3Key Laboratory of Sugarcane Biology and Genetic Breeding, Ministry of Agriculture, Fujian Agriculture and Forestry University, Fuzhou, China. 4Department of Biochemistry, Faculty of Science, King Abdulaziz University Jeddah 21589, Saudi Arabia. 5Department of Bioscience, COMSATS University, Islamabad, Pakistan. 458 KHAN et al. to unfavorable environmental conditions. Its origin and dispersal are yet to be identified (Miriam 1951, Ray et al. 1983). A single population was recorded reflecting its rarity in the particular area. It also contains certain medicinal attributes (Gul et al. 2016). Hence, the best in situ as well as ex situ conservation strategies are needed to be implemented for such remnant plants in Pakistan (Fazli et al. 2015). Recently, DNA based techniques have totally changed the dimensions of the molecular genetics. These molecular approaches have been successfully used to study the extent and distribution of variation in plant species gene-pool, identification, baseline conservation strategies and to address the typical taxonomic and evolutionary questions of such exotic plants (Karp et al. 1997). The evolutionary studies are the mirror image of the natural history to understand the biodiversity in their ecosystems. The previous studies were based on morphological traits along with some plasid and nuclear genes analysis but there is still lack of phylogenomic studies for their proper delimitation and conservation. Hence the correct species delimitation that is a very crucial step for conservation and biodiversity preservation (Hebert et al. 2003, CBOL Plant working group 2009). DNA sequences have become the major source of new information for genetic relationship and evolutionary studies because of the progress in sequencing and computational technologies (Hajibabaei et al. 2007, Dick and Kress 2009). Plastid as well as the nuclear genome of plant thus suggested the best optimization and yielding of some appropriate sequences for DNA fingerprinting, i.e., that will be variable enough to discriminate among species and at the same time have less intra than infra-specific inconsistency (Chase et al. 2005, Kress et al. 2005). It basically involves the evolutionary aspects depending upon character based (Maximum Parsimony and Maximum Likelihood) and distance-based method (Neighbor-Joining). Being sensitive Maximum Parsimony method is generally less effective for phylogenies but the Maximum Likelihood is the comparatively good method. Although these two methods are robust to determine the heterogeneity while the Neighbor-Joining method is not much enough in this respect (Felsenstein 1985). Indeed, the strange Psilotum nudum L., i.e., ‘Living Relics’ requires a vast level critical comprehensive molecular study for their survival. Pakistan is blessed to have these evolutionary dead-end plants available for exploring their phylogenetic issues. So, it is hoped that upcoming researchers will be successful to solve the riddle of practically relics pteridophytes through advance molecular fingerprinting techniques. The purpose of the present study was to obtain best DNA barcodes for species in the genus Psilotum, in order to determine their existence of the phylogenetic relationships in the respected genus. The present research work was conducted to evaluate the phylogenetic diversity of Psilotum and its condition under these objectives: (1). To characterize the collected samples P. nudum L. on the basis of standard DNA barcode markers. (2). To perform the phylogenetic analysis of P. nudum L. (3). To propose the suitable barcodes for the species identification. Materials and Methods Plant material Psilotum nudum L. was collected from 1,038 m (3,406 ft) high mountains of District Battagram, Khyber Pakhtunkhwa, Pakistan. The collected sample was correctly identified and kept at Herbarium of Hazara University Mansehra. Description of the research material is given in Table 1. The total nucleic acid was extracted by using plant genomic DNA purification kit Tiangen [cat. no. DP309] from the desired tissues of selected plant species. For quantification and clarification of DNA 0.1% agarose gel electrophoresis was done. The DNA barcode regions were amplified by using universal DNA barcoding markers from CBOL Plant Working Group (2009). PHYLOGENETIC STUDY OF LIVING FOSSIL PSILOTUM NUDUM 459 Primarily, seven plastid and nuclear plant DNA barcode regions (rbcLa, TrnA, TrnV, matK, ITs, ycF3 and rpoB) because of their suitability, universality, robustness, good resolving power and reliable sequence consistency were selected to test the effectiveness in P. nudum L. (Chase et al. 2005). Table 1. Descriptive information of research material. Plant Research Location of GPS co-ordination Altitude sample material collection Psilotum nudum L. Leaves/stem Battagram Mansehra, 34.672654, 73.024309 1,038 m (3,406 ft) Pakistan For confirmation of the present studied plant species, its sequences were BLAST at NCBI or species. Clipping and low-quality sequences and primer areas were cleaned by CodonCode Aligner 3.7.1 (Codon Code, Co. Centreville, MA. USA). Alignment of DNA sequences and phylogenetic analysis of current specie P. nudum L. was carried by using ClustalX version 1.81 (Thompson 1997), MUSCLE, BioEdit and cladistics analysis was carried out by Mega 7 (Kumar et al. 2012). The bootstrap consensus inferred from 500 replicates along with pairwise deletion of missing sites for the evolutionary study of taxa (Felsenstein 1985). The genetic distance was calculated on the basis of Kimura-2 parameter model (Kimura 1980). Results and Discussion A 25 μl PCR reaction mixture was amplified according to the procedure described by Zhang et al. (2014) by using the conditions mentioned in Table 2. Table 2. Various DNA barcode regions used in current study. Sl. No Primer name Sequence 5´ to 3´ 1 rbcLa-F 5’ATGTCACCACAAACAGAGACTAAAGC3’ R 5’GTAAAATCAAGTCCACCCRCG3’ 2 trnA-F 5’GGTTCAAGTCCCTCTATCCC3’ R 5’ATTTGAACTGGTGACACGAG3’ 3 trnV–F 5’GTAGAGCACCTCGTTTACAC3’ R 5’CTCGAACCGTAGACCTTCTC3’ 4 ITs-F 5’GCCGTTAAGACCAGGGAT3’ R 5’TGATTCACGGGATTCTGC3’ 5 rboB-F 5’ATGCAACGTCAAGCAGTTCC3’ R 5’GATCCCAGCATCACAATTCC3’ 6 Mat-K-F 5’CCCTATTCTATTCAYCCNGA3’ R 5’CGTATCGTGCTTTTRTGYTT3’ 7 ycF3-F 5’AGAACCGTACTTGAGAGTTTCC3’