DOCSLIB.ORG

Phylogenetic Study of Living Fossil Psilotum Nudum L

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Phylogenetic Study of Living Fossil Psilotum Nudum L Bangladesh J. Bot. 48(3): 457-466, 2019 (September) PHYLOGENETIC STUDY OF LIVING FOSSIL PSILOTUM NUDUM L. FROM HIMALAYAN RANGE OF PAKISTAN USING DNA BARCODES 1 BUSHRA KHAN, KHUSHI MUHAMMAD*, ZAINAB HAMAYUN, HABIB AHMAD , 2 3 SHAFEE UR REHMAN, ABDUL MAJID , YOUXIONG QUE , 4 5 MUHAMMAD SHAHID NADEEM AND IMDAD KALEEM Department of Genetics, Hazara University Mansehra, 21300, Pakistan Keywords: Phylogenetic, Psilotum nudum, DNA barcodes Abstract The genus Psilotum belongs to Psilotaceae family, with about 133 to 189 species having outstanding social, economic and medically important relict plants. However, being living fossil plant, many hurdles come in way while trying to discern its phylogenetics reconstruction. The partial conserve nucleotide sequences of rbcLa, trnA, trnV, matK, ITS, ycF3 and rpoB genes were used to select the best suitable barcodes in Psilotum nudum L. The amplified fragments were subjected to Sanger sequencing and then Maximum likelihood, Maximum Parsimony and Neighbor Joining trees were generated using bioinformatics software. i.e., MUSCLE, BioEdit and Mega-7. Current population showed the best match between P. complanatum (KY099851.1), population reported from New Zealand and P. nudum (F384430.1) with identity value 100 and 99% having E-value 0.0 and 0.0 by rbcLa and trnA barcode region, respectively. The findings showed that P. nudum L. sequences are ever first reported from the Himalaya regions of Pakistan and could be utilized for further comparison among different populations of this relict plant species across the globe. Introduction The floristic studies still fall behind in Pakistan. Although comprehensive data are available for angiosperms but grievously only limited work has been done on pteridophytes, predecessors to modern flora that still require vast level exploration. First ever preliminary checklist of 133 species of 39 dwells in District Mansehra, KPK (Stewart 1972). Later on, the Japanese team in 1992 and 1993 contributed a lot in adding information in pteridophytes study (Sundas et al. 2012). and furthermore, Frazer-Jenkins discovered that 189 species of pteridophytes are endemic to Western Himalaya of Pakistan (Gul et al. 2016). So far, no record has been found from any area of Pakistan neither in wild nor in cultivated form. Nearly 400 million years ago, Psilophytes, first ever fossil records were found from Scotland in the same way as Psilotum is studied today. It is the most pre-historic primitive vascular plant, abundantly available in tropical and sub-tropical regions of the globe (Zhang 2013, Gul et al. 2016). A Greek world "Psilotum" as well as Latin word "Nudum" both have same meaning i.e., “naked” (Yamazaki et al. 2001, Nazarian et al. 2010). Recently its imprints were reported for the first time from Elum mountains of Buner and Hazara, KP in Pakistan and was named as Psilotum hazaricum (Rahman et al. 2015). Psilotum carries ancestral twiggy structural qualities having diminutive flowering broom, fruits and seeds with prehistoric Y-shaped branches; reproductive structures occupy with little pillboxes like spores along the side of the stem that’s seems to be due *Author for correspondence: <[email protected]>. 1Islamia College, Peshawar, KP-Pakistan. 2Department of Botany, Hazara University Mansehra, Pakistan-21300. 3Key Laboratory of Sugarcane Biology and Genetic Breeding, Ministry of Agriculture, Fujian Agriculture and Forestry University, Fuzhou, China. 4Department of Biochemistry, Faculty of Science, King Abdulaziz University Jeddah 21589, Saudi Arabia. 5Department of Bioscience, COMSATS University, Islamabad, Pakistan. 458 KHAN et al. to unfavorable environmental conditions. Its origin and dispersal are yet to be identified (Miriam 1951, Ray et al. 1983). A single population was recorded reflecting its rarity in the particular area. It also contains certain medicinal attributes (Gul et al. 2016). Hence, the best in situ as well as ex situ conservation strategies are needed to be implemented for such remnant plants in Pakistan (Fazli et al. 2015). Recently, DNA based techniques have totally changed the dimensions of the molecular genetics. These molecular approaches have been successfully used to study the extent and distribution of variation in plant species gene-pool, identification, baseline conservation strategies and to address the typical taxonomic and evolutionary questions of such exotic plants (Karp et al. 1997). The evolutionary studies are the mirror image of the natural history to understand the biodiversity in their ecosystems. The previous studies were based on morphological traits along with some plasid and nuclear genes analysis but there is still lack of phylogenomic studies for their proper delimitation and conservation. Hence the correct species delimitation that is a very crucial step for conservation and biodiversity preservation (Hebert et al. 2003, CBOL Plant working group 2009). DNA sequences have become the major source of new information for genetic relationship and evolutionary studies because of the progress in sequencing and computational technologies (Hajibabaei et al. 2007, Dick and Kress 2009). Plastid as well as the nuclear genome of plant thus suggested the best optimization and yielding of some appropriate sequences for DNA fingerprinting, i.e., that will be variable enough to discriminate among species and at the same time have less intra than infra-specific inconsistency (Chase et al. 2005, Kress et al. 2005). It basically involves the evolutionary aspects depending upon character based (Maximum Parsimony and Maximum Likelihood) and distance-based method (Neighbor-Joining). Being sensitive Maximum Parsimony method is generally less effective for phylogenies but the Maximum Likelihood is the comparatively good method. Although these two methods are robust to determine the heterogeneity while the Neighbor-Joining method is not much enough in this respect (Felsenstein 1985). Indeed, the strange Psilotum nudum L., i.e., ‘Living Relics’ requires a vast level critical comprehensive molecular study for their survival. Pakistan is blessed to have these evolutionary dead-end plants available for exploring their phylogenetic issues. So, it is hoped that upcoming researchers will be successful to solve the riddle of practically relics pteridophytes through advance molecular fingerprinting techniques. The purpose of the present study was to obtain best DNA barcodes for species in the genus Psilotum, in order to determine their existence of the phylogenetic relationships in the respected genus. The present research work was conducted to evaluate the phylogenetic diversity of Psilotum and its condition under these objectives: (1). To characterize the collected samples P. nudum L. on the basis of standard DNA barcode markers. (2). To perform the phylogenetic analysis of P. nudum L. (3). To propose the suitable barcodes for the species identification. Materials and Methods Plant material Psilotum nudum L. was collected from 1,038 m (3,406 ft) high mountains of District Battagram, Khyber Pakhtunkhwa, Pakistan. The collected sample was correctly identified and kept at Herbarium of Hazara University Mansehra. Description of the research material is given in Table 1. The total nucleic acid was extracted by using plant genomic DNA purification kit Tiangen [cat. no. DP309] from the desired tissues of selected plant species. For quantification and clarification of DNA 0.1% agarose gel electrophoresis was done. The DNA barcode regions were amplified by using universal DNA barcoding markers from CBOL Plant Working Group (2009). PHYLOGENETIC STUDY OF LIVING FOSSIL PSILOTUM NUDUM 459 Primarily, seven plastid and nuclear plant DNA barcode regions (rbcLa, TrnA, TrnV, matK, ITs, ycF3 and rpoB) because of their suitability, universality, robustness, good resolving power and reliable sequence consistency were selected to test the effectiveness in P. nudum L. (Chase et al. 2005). Table 1. Descriptive information of research material. Plant Research Location of GPS co-ordination Altitude sample material collection Psilotum nudum L. Leaves/stem Battagram Mansehra, 34.672654, 73.024309 1,038 m (3,406 ft) Pakistan For confirmation of the present studied plant species, its sequences were BLAST at NCBI or species. Clipping and low-quality sequences and primer areas were cleaned by CodonCode Aligner 3.7.1 (Codon Code, Co. Centreville, MA. USA). Alignment of DNA sequences and phylogenetic analysis of current specie P. nudum L. was carried by using ClustalX version 1.81 (Thompson 1997), MUSCLE, BioEdit and cladistics analysis was carried out by Mega 7 (Kumar et al. 2012). The bootstrap consensus inferred from 500 replicates along with pairwise deletion of missing sites for the evolutionary study of taxa (Felsenstein 1985). The genetic distance was calculated on the basis of Kimura-2 parameter model (Kimura 1980). Results and Discussion A 25 μl PCR reaction mixture was amplified according to the procedure described by Zhang et al. (2014) by using the conditions mentioned in Table 2. Table 2. Various DNA barcode regions used in current study. Sl. No Primer name Sequence 5´ to 3´ 1 rbcLa-F 5’ATGTCACCACAAACAGAGACTAAAGC3’ R 5’GTAAAATCAAGTCCACCCRCG3’ 2 trnA-F 5’GGTTCAAGTCCCTCTATCCC3’ R 5’ATTTGAACTGGTGACACGAG3’ 3 trnV–F 5’GTAGAGCACCTCGTTTACAC3’ R 5’CTCGAACCGTAGACCTTCTC3’ 4 ITs-F 5’GCCGTTAAGACCAGGGAT3’ R 5’TGATTCACGGGATTCTGC3’ 5 rboB-F 5’ATGCAACGTCAAGCAGTTCC3’ R 5’GATCCCAGCATCACAATTCC3’ 6 Mat-K-F 5’CCCTATTCTATTCAYCCNGA3’ R 5’CGTATCGTGCTTTTRTGYTT3’ 7 ycF3-F 5’AGAACCGTACTTGAGAGTTTCC3’
Load more

Recommended publications
  • Handbook Publication.Pub
    Table of Contents Maui County’s Landscape and Gardening Handbook Xeriscaping in Maui County ................................................................. 1 Planning and Design................................................................................................................. 1 Hydro-zones.............................................................................................................................. 1 Plant Selection and the Maui jkCounty Planting Zones............................................................ 2 Soil Preparation ........................................................................................................................ 4 Mulching.................................................................................................................................... 5 Irrigation .................................................................................................................................... 5 Maintenance ............................................................................................................................. 7 Other Interesting Techniques for the Ambitious ..................................... 8 Xeriscape Ponds....................................................................................................................... 8 Aquaponics in the Backyard ..................................................................................................... 9 Water Polymer Crystals ...........................................................................................................
    [Show full text]
  • "National List of Vascular Plant Species That Occur in Wetlands: 1996 National Summary."
    Intro 1996 National List of Vascular Plant Species That Occur in Wetlands The Fish and Wildlife Service has prepared a National List of Vascular Plant Species That Occur in Wetlands: 1996 National Summary (1996 National List). The 1996 National List is a draft revision of the National List of Plant Species That Occur in Wetlands: 1988 National Summary (Reed 1988) (1988 National List). The 1996 National List is provided to encourage additional public review and comments on the draft regional wetland indicator assignments. The 1996 National List reflects a significant amount of new information that has become available since 1988 on the wetland affinity of vascular plants. This new information has resulted from the extensive use of the 1988 National List in the field by individuals involved in wetland and other resource inventories, wetland identification and delineation, and wetland research. Interim Regional Interagency Review Panel (Regional Panel) changes in indicator status as well as additions and deletions to the 1988 National List were documented in Regional supplements. The National List was originally developed as an appendix to the Classification of Wetlands and Deepwater Habitats of the United States (Cowardin et al.1979) to aid in the consistent application of this classification system for wetlands in the field.. The 1996 National List also was developed to aid in determining the presence of hydrophytic vegetation in the Clean Water Act Section 404 wetland regulatory program and in the implementation of the swampbuster provisions of the Food Security Act. While not required by law or regulation, the Fish and Wildlife Service is making the 1996 National List available for review and comment.
    [Show full text]
  • 1 Ophioglossidae (PDF, 873
    Ophioglossidae 1 Polypodiopsida Ophioglossidae – Gabelblattgewächse (Polypodiopsida) Zu den Ophioglossidae werden 2 rezente Ordnungen gestellt, die Psilotales (Gabelfarne) und die Ophioglossales (Natternzungenartigen). Die Ophioglossidae sind eine sehr alte Landpflanzengruppe. Die Blätter sind, anders als dies für viele makrophylle Farnpflanzen typisch ist, zu Beginn nicht eingerollt. Ein gemeinsames Merkmal der Psilotales mit den Ophioglossales sind eusporangiate Sporangien, d. h. die Sporangienwand weist mehrere Zellschichten auf (Unterschied lepto- sporangiate Farne, hier einschichtig). Bei einigen Arten der Psilotales fehlt eine echte Wurzel. Alle Arten sind mykotroph (Ernährung mittels Pilzsymbiose im Boden, Mykorrhiza). 1. Ordnung: Psilotales (Gabelfarne) 1.1 Systematik und Verbreitung Die Ordnung der Psilotales enthält nur 1 Familie, die Psilotaceae mit nur 2 Gattungen und 17 Arten (Psilotum 2 und Tmesipteris 15 Arten). Die Familie ist überwiegend tropisch verbreitet. 1.2 Morphologie 1.2.1 Habitus Die Arten der Psilotales sind ausschließlich krautige Pflanzen mit einem kräftigen, unterirdischen Kriechspross (Rhizom), das zahlreiche Rhizoide ausbildet. Echte Wurzeln fehlen. Die vollständige Reduktion der Wurzel wird hier als sekundäres, abgeleitetes Merkmal angesehen. Wie der Gametophyt ist auch der Sporophyt mykotroph, was erst die morphologische Reduktion der Wurzel erlaubte. Die oberirdischen sparrig dichotom verzweigten Sprossachsen weisen eine (angedeutete) Siphonostele mit einem holzigen Mark auf. Die unterirdischen Rhizome haben hingegen eine Protostele. 1.2.2 Blatt Arten aus den Psilotales haben ausschließlich schraubig angeordnete Mikrophylle. Bei Psilotum sind nur die Sporophylle Gabelblätter (im Unterschied zu den sterilen © PD DR. VEIT M. DÖRKEN, Universität Konstanz, FB Biologie Ophioglossidae 2 Polypodiopsida Blättern). Die Photosynthese erfolgt daher hauptsächlich über die chlorophyllreichen Sprossachsen (Rutenstrauch-Prinzip). Abb. 1 & 2: Psilotum nudum, dichotom verzweigte Sprossachse (links); Querschnitt einer Sprossachse (rechts).
    [Show full text]
  • A Landscape-Based Assessment of Climate Change Vulnerability for All Native Hawaiian Plants
    Technical Report HCSU-044 A LANDscape-bASED ASSESSMENT OF CLIMatE CHANGE VULNEraBILITY FOR ALL NatIVE HAWAIIAN PLANts Lucas Fortini1,2, Jonathan Price3, James Jacobi2, Adam Vorsino4, Jeff Burgett1,4, Kevin Brinck5, Fred Amidon4, Steve Miller4, Sam `Ohukani`ohi`a Gon III6, Gregory Koob7, and Eben Paxton2 1 Pacific Islands Climate Change Cooperative, Honolulu, HI 96813 2 U.S. Geological Survey, Pacific Island Ecosystems Research Center, Hawaii National Park, HI 96718 3 Department of Geography & Environmental Studies, University of Hawai‘i at Hilo, Hilo, HI 96720 4 U.S. Fish & Wildlife Service —Ecological Services, Division of Climate Change and Strategic Habitat Management, Honolulu, HI 96850 5 Hawai‘i Cooperative Studies Unit, Pacific Island Ecosystems Research Center, Hawai‘i National Park, HI 96718 6 The Nature Conservancy, Hawai‘i Chapter, Honolulu, HI 96817 7 USDA Natural Resources Conservation Service, Hawaii/Pacific Islands Area State Office, Honolulu, HI 96850 Hawai‘i Cooperative Studies Unit University of Hawai‘i at Hilo 200 W. Kawili St. Hilo, HI 96720 (808) 933-0706 November 2013 This product was prepared under Cooperative Agreement CAG09AC00070 for the Pacific Island Ecosystems Research Center of the U.S. Geological Survey. Technical Report HCSU-044 A LANDSCAPE-BASED ASSESSMENT OF CLIMATE CHANGE VULNERABILITY FOR ALL NATIVE HAWAIIAN PLANTS LUCAS FORTINI1,2, JONATHAN PRICE3, JAMES JACOBI2, ADAM VORSINO4, JEFF BURGETT1,4, KEVIN BRINCK5, FRED AMIDON4, STEVE MILLER4, SAM ʽOHUKANIʽOHIʽA GON III 6, GREGORY KOOB7, AND EBEN PAXTON2 1 Pacific Islands Climate Change Cooperative, Honolulu, HI 96813 2 U.S. Geological Survey, Pacific Island Ecosystems Research Center, Hawaiʽi National Park, HI 96718 3 Department of Geography & Environmental Studies, University of Hawaiʽi at Hilo, Hilo, HI 96720 4 U.
    [Show full text]
  • Ferns, Cycads, Conifers and Vascular Plants
    Flora of Australia Glossary — Ferns, Cycads, Conifers and Vascular plants A main glossary for the Flora of Australia was published in Volume 1 of both printed editions (1981 and 1999). Other volumes contain supplementary glossaries, with specific terms needed for particular families. This electronic glossary is a synthesis of all hard-copy Flora of Australia glossaries and supplementary glossaries published to date. The first Flora of Australia glossary was compiled by Alison McCusker. Mary D. Tindale compiled most of the fern definitions, and the conifer definitions were provided by Ken D. Hill. Russell L. Barrett combined all of these to create the glossary presented here, incorporating additional terms from the printed version of Volume 37. This electronic glossary contains terms used in all volumes, but with particular reference to the flowering plants (Volumes 2–50). This glossary will be updated as future volumes are published. It is the standard to be used by authors compiling future taxon treatments for the Flora of Australia. It also comprises the terms used in Species Plantarum — Flora of the World. Alternative terms For some preferred terms (in bold), alternative terms are also highlighted (in parentheses). For example, apiculum is the preferred term, and (=apiculus) is an alternative. Preferred terms are those also used in Species Plantarum — Flora of the World. © Copyright Commonwealth of Australia, 2017. Flora of Australia Glossary — Ferns, Cycads, Conifers and Vascular plants is licensed by the Commonwealth of Australia for use under a Creative Commons Attribution 4.0 International licence with the exception of the Coat of Arms of the Commonwealth of Australia, the logo of the agency responsible for publishing the report, content supplied by third parties, and any images depicting people.
    [Show full text]
  • Chapter 23: the Early Tracheophytes
    Chapter 23 The Early Tracheophytes THE LYCOPHYTES Lycopodium Has a Homosporous Life Cycle Selaginella Has a Heterosporous Life Cycle Heterospory Allows for Greater Parental Investment Isoetes May Be the Only Living Member of the Lepidodendrid Group THE MONILOPHYTES Whisk Ferns Ophioglossalean Ferns Horsetails Marattialean Ferns True Ferns True Fern Sporophytes Typically Have Underground Stems Sexual Reproduction Usually Is Homosporous Fern Have a Variety of Alternative Means of Reproduction Ferns Have Ecological and Economic Importance SUMMARY PLANTS, PEOPLE, AND THE ENVIRONMENT: Sporophyte Prominence and Survival on Land PLANTS, PEOPLE, AND THE ENVIRONMENT: Coal, Smog, and Forest Decline THE OCCUPATION OF THE LAND PLANTS, PEOPLE, AND THE The First Tracheophytes Were ENVIRONMENT: Diversity Among the Ferns Rhyniophytes Tracheophytes Became Increasingly Better PLANTS, PEOPLE, AND THE Adapted to the Terrestrial Environment ENVIRONMENT: Fern Spores Relationships among Early Tracheophytes 1 KEY CONCEPTS 1. Tracheophytes, also called vascular plants, possess lignified water-conducting tissue (xylem). Approximately 14,000 species of tracheophytes reproduce by releasing spores and do not make seeds. These are sometimes called seedless vascular plants. Tracheophytes differ from bryophytes in possessing branched sporophytes that are dominant in the life cycle. These sporophytes are more tolerant of life on dry land than those of bryophytes because water movement is controlled by strongly lignified vascular tissue, stomata, and an extensive cuticle. The gametophytes, however still require a seasonally wet habitat, and water outside the plant is essential for the movement of sperm from antheridia to archegonia. 2. The rhyniophytes were the first tracheophytes. They consisted of dichotomously branching axes, lacking roots and leaves. They are all extinct.
    [Show full text]
  • The Taxonomic Position of the Psilotales in the Light of Our Knowledge of Devonian Plant Life*
    THE TAXONOMIC POSITION OF THE PSILOTALES IN THE LIGHT OF OUR KNOWLEDGE OF DEVONIAN PLANT LIFE* F. P. JONKER Laboratory of Palaeobotany and Palynology, Utrecht, The Netherlands ABSTRACT exclusively Devonian Psilophytales and of the latter the Rhyniaceae are regarded The order Psilotales, containing the two recent genera Psilatum and Tnzesiptel'is only, is usually usually as the closest relatives. Among classified by taxonomists and palaeo botanists those who take this st?nd I mention G. M. in the phylum Psiiophyta. This concept is, Smith (1955), Magdefra.u in Strasburger in spite of the synangia, based on the primitive (1971) and Lcmoigne (1968c). The concept general appearance reminding one of that of the of the last mentioned author will be dis• Devonian Rhyniaceae. Numerous attempts have been made to derive both genera, including their cussed further on. Darrah (1960) states synangia, from either the Rhvniaceae or from other that the status of the putative primitive Psilophyta. These attempts' sometimes led to the nature of the plant body in the Psilotaceae acceptance of a series of missing Jinks but this concept is, however, not supported bv palaeo· is controversial although there is a strong botanical data. tendency to accept the family as a pel'sis• In the opinion of the present reporter the order tent remnant of the Psilopsida. Andrews has kept a primitive general appearance of its (1961) states that Psilatum has been reaarded Devonian ancestors but in its synangia and in its monolete spores it is more advanced. by some botanists as a very simpl~ land In its anatomy, its microphyllous leaves, and in its plant, possibly a very ancient type that gametophyte perhaps, it shows more affiinity to the has managed to survive for several hundreds phylum Lycopodiophyta.
    [Show full text]
  • Pteridophyte Fungal Associations: Current Knowledge and Future Perspectives
    This is a repository copy of Pteridophyte fungal associations: Current knowledge and future perspectives. White Rose Research Online URL for this paper: http://eprints.whiterose.ac.uk/109975/ Version: Accepted Version Article: Pressel, S, Bidartondo, MI, Field, KJ orcid.org/0000-0002-5196-2360 et al. (2 more authors) (2016) Pteridophyte fungal associations: Current knowledge and future perspectives. Journal of Systematics and Evolution, 54 (6). pp. 666-678. ISSN 1674-4918 https://doi.org/10.1111/jse.12227 © 2016 Institute of Botany, Chinese Academy of Sciences. This is the peer reviewed version of the following article: Pressel, S., Bidartondo, M. I., Field, K. J., Rimington, W. R. and Duckett, J. G. (2016), Pteridophyte fungal associations: Current knowledge and future perspectives. Jnl of Sytematics Evolution, 54: 666–678., which has been published in final form at https://doi.org/10.1111/jse.12227. This article may be used for non-commercial purposes in accordance with Wiley Terms and Conditions for Self-Archiving. Reuse Unless indicated otherwise, fulltext items are protected by copyright with all rights reserved. The copyright exception in section 29 of the Copyright, Designs and Patents Act 1988 allows the making of a single copy solely for the purpose of non-commercial research or private study within the limits of fair dealing. The publisher or other rights-holder may allow further reproduction and re-use of this version - refer to the White Rose Research Online record for this item. Where records identify the publisher as the copyright holder, users can verify any specific terms of use on the publisher’s website.
    [Show full text]
  • Winter 2011 - 1 President’S Message
    THE HARDY FERN FOUNDATION P.O. Box 3797 Federal Way, WA 98063-3797 Web site: www.hardvfems.org The Hardy Fern Foundation was founded in 1989 to establish a comprehen¬ sive collection of the world’s hardy ferns for display, testing, evaluation, public education and introduction to the gardening and horticultural community. Many rare and unusual species, hybrids and varieties are being propagated from spores and tested in selected environments for their different degrees of hardiness and ornamental garden value. The primary fern display and test garden is located at, and in conjunction with, The Rhododendron Species Botanical Garden at the Weyerhaeuser Corporate Headquarters, in Federal Way, Washington. Satellite fern gardens are at the Birmingham Botanical Gardens, Birmingham, Alabama, California State University at Sacramento, California, Coastal Maine Botanical Garden, Boothbay , Maine. Dallas Arboretum, Dallas, Texas, Denver Botanic Gardens, Denver, Colorado, Georgeson Botanical Garden, University of Alaska, Fairbanks, Alaska, Harry R Leu Garden, Orlando, Florida, Inniswood Metro Gardens, Columbus, Ohio, New York Botanical Garden, Bronx, New York, and Strybing Arboretum, San Francisco, California. The fern display gardens are at Bainbridge Island Library. Bainbridge Island, WA, Bellevue Botanical Garden, Bellevue, WA, Lakewold, Tacoma, Washington, Lotusland, Santa Barbara, California, Les Jardins de Metis, Quebec, Canada, Rotary Gardens, Janesville, Wl, and Whitehall Historic Home and Garden, Louisville, KY. Hardy Fern Foundation members participate in a spore exchange, receive a quarterly newsletter and have first access to ferns as they are ready for distribution. Cover design by Will anna Bradner HARDY FERN FOUNDATION QUARTERLY THE HARDY FERN FOUNDATION QUARTERLY Volume 21 Editor- Sue Olsen ISSN 154-5517 President’s Message Patrick Kennar American Fern Society - 2010 Fern Foray Tom Stuart Thelypteris noveboracensis Tapering fern, New York fern.
    [Show full text]
  • Flora of South Australia 5Th Edition | Edited by Jürgen Kellermann
    Flora of South Australia 5th Edition | Edited by Jürgen Kellermann KEY TO FAMILIES1 J.P. Jessop2 The sequence of families used in this Flora follows closely the one adopted by the Australian Plant Census (www.anbg.gov. au/chah/apc), which in turn is based on that of the Angiosperm Phylogeny Group (APG III 2009) and Mabberley’s Plant Book (Mabberley 2008). It differs from previous editions of the Flora, which were mainly based on the classification system of Engler & Gilg (1919). A list of all families recognised in this Flora is printed in the inside cover pages with families already published highlighted in bold. The up-take of this new system by the State Herbarium of South Australia is still in progress and the S.A. Census database (www.flora.sa.gov.au/census.shtml) still uses the old classification of families. The Australian Plant Census web-site presents comparison tables of the old and new systems on family and genus level. A good overview of all families can be found in Heywood et al. (2007) and Stevens (2001–), although these authors accept a slightly different family classification. A number of names with which people using this key may be familiar but are not employed in the system used in this work have been included for convenience and are enclosed on quotation marks. 1. Plants reproducing by spores and not producing flowers (“Ferns and lycopods”) 2. Aerial shoots either dichotomously branched, with scale leaves and 3-lobed sporophores or plants with fronds consisting of a simple or divided sterile blade and a simple or branched spikelike sporophore ..................................................................................
    [Show full text]
  • A Preliminary List of the Vascular Plants and Wildlife at the Village Of
    A Floristic Evaluation of the Natural Plant Communities and Grounds Occurring at The Key West Botanical Garden, Stock Island, Monroe County, Florida Steven W. Woodmansee [email protected] January 20, 2006 Submitted by The Institute for Regional Conservation 22601 S.W. 152 Avenue, Miami, Florida 33170 George D. Gann, Executive Director Submitted to CarolAnn Sharkey Key West Botanical Garden 5210 College Road Key West, Florida 33040 and Kate Marks Heritage Preservation 1012 14th Street, NW, Suite 1200 Washington DC 20005 Introduction The Key West Botanical Garden (KWBG) is located at 5210 College Road on Stock Island, Monroe County, Florida. It is a 7.5 acre conservation area, owned by the City of Key West. The KWBG requested that The Institute for Regional Conservation (IRC) conduct a floristic evaluation of its natural areas and grounds and to provide recommendations. Study Design On August 9-10, 2005 an inventory of all vascular plants was conducted at the KWBG. All areas of the KWBG were visited, including the newly acquired property to the south. Special attention was paid toward the remnant natural habitats. A preliminary plant list was established. Plant taxonomy generally follows Wunderlin (1998) and Bailey et al. (1976). Results Five distinct habitats were recorded for the KWBG. Two of which are human altered and are artificial being classified as developed upland and modified wetland. In addition, three natural habitats are found at the KWBG. They are coastal berm (here termed buttonwood hammock), rockland hammock, and tidal swamp habitats. Developed and Modified Habitats Garden and Developed Upland Areas The developed upland portions include the maintained garden areas as well as the cleared parking areas, building edges, and paths.
    [Show full text]
  • Classification, Molecular Phylogeny, Divergence Time, And
    The JapaneseSocietyJapanese Society for Plant Systematics ISSN 1346-7565 Acta Phytotax. Geobot. 56 (2): 111-126 (2005) Invited article and Classification,MolecularPhylogeny,DivergenceTime, Morphological Evolution of Pteridophytes with Notes on Heterospory and and Monophyletic ParaphyleticGroups MASAHIRO KATO* Department ofBiotogicat Sciences,Graduate Schoot ofScience,Universitv. of7bkyo, Hongo, 7bk)]o IJ3- O033, lapan Pteridophytes are free-sporing vascular land plants that evolutionarily link bryophytes and seed plants. Conventiona], group (taxon)-based hierarchic classifications ofptcridophytes using phenetic characters are briefiy reviewcd. Review is also made for recent trcc-based cladistic analyses and molecular phy- logenetic analyses with increasingly large data sets ofmultiplc genes (compared to single genes in pre- vious studies) and increasingly large numbers of spccies representing major groups of pteridophytes (compared to particular groups in previous studies), and it is cxtended to most recent analyses of esti- mating divergcnce times ofpteridephytes, These c]assifications, phylogenetics, and divergcncc time esti- mates have improved our understanding of the diversity and historical structure of pteridophytes. Heterospory is noted with referencc to its origins, endospory, fertilization, and dispersal. Finally, menophylctic and paraphyletic groups rccently proposed or re-recognized are briefly dcscribcd. Key words: classification, divergence timc estimate. fems,heterospory, molecular phylogcny, pteri- dophytcs. Morphological
    [Show full text]