Abstract
Abstract
The high mobility group protein HMGB1 is the most abundant non-histone chromosomal protein in mammals and has counterparts in all eukaryotes. It has long been known as an architectural transcription factor involved in gene activation as well as in other nuclear processes. More recently, HMGB1 has been found to have extra-cellular functions as a late mediator in immune response and also as a cytokine. We have been interested in how the human HMGB1 gene is regulated as well as how HMGB1 regulates other genes in the cell.
In this study, an anti-sense strategy was used to suppress the HMGB1 expression level in the human breast cancer MCF-7 cell line. An MCF-7 cell line that expresses HMGB1 at only half the level of the original cell line was established. The expression profiles of these two cell lines were compared using cDNA microarray and the genes differentially expressed at a significant level were identified in these two cell lines. Among these genes, 96 were down regulated and
76 were up regulated in the HMGB1 suppressed MCF-7 cells. Real-time RT-PCR was also used to check the expression levels of some of the differentially expressed genes. Furthermore, these genes were classified into 11 functional groups including transcription factors, cell cycle related factors, apoptosis regulators, kinases and metabolism-related proteins, etc. The potential regulatory roles of HMGB1 on some of these groups were then discussed. In addition, to find out the possible interactions among these differentially expressed genes,
Pathwayassist Software was used for analysis. It was found that the products of 16 of these differentially expressed genes fall into a complex network with p53 as the key node. The expression levels of the p53 and MDM2 genes were found to be
II Abstract significantly lower in the HMGB1 down-regulated MCF-7 cells. This indicates the importance of HMGB1 in p53 expression and cell cycle checkpoint control.
Based on the possible role of HMGB1 in the p53 network, investigattion on whether HMGB1 could regulate some potential downstream genes at the transcriptional level was carried out. An HMGB1 expression plasmid together with the p53, the MDM2 or the E2F1 promoter-containing reporter plasmid were co-transfected into the MCF-7, the HMGB1 suppressed MCF-7 and the p53-null human osteosarcoma Saos-2 cell lines to examine the transcriptional effects of exogenous HMGB1 on these promoters. In a parallel experiment, a p53 expression plasmid was also included to find out if the p53 protein may influence the regulatory effect of HMGB1 on these promoters. The luciferase assay results demonstrated that HMGB1 does not regulate the p53 promoter directly but may affect the expression of p53 via its regulation on the MDM2 and the E2F1 promoters. The action of HMGB1 on the MDM2 promoter is in a p53-dependent manner whereas its activation of the E2F1 promoter is p53-independent. Therefore,
HMGB1 is an important regulatory factor in the p53-MDM2-E2F1 network.
III Acknowledgments
Acknowledgements
I would like to take this chance to express my sincere gratitude to the following people for their invaluable support during my research and study in these three years.
Firstly, I owe numerous thanks to my chief supervisor Dr. Kam-len Daniel
Lee, for his patient guidance, invaluable advices and consistent encouragement throughout the entire project. As my supervisor, he has not only guided me on the rough but magnificent research way, but also supported me to explore my own thinking and trials during the whole time. My accomplishment of the Ph.D degree is directly attributed to his guidance. Moreover, his enthusiasm and devotion to science will guide me in my future research career.
Then I would like to thank Dr. Tat-kan Robbie Chan, my co-supervisor, for his kind support to the experiments. I would also like to thank Dr. Pei Li for her important advice on the project.
I wish to give special thanks to Dr. Meng-Su Yang for his generous support during the microarray experiments. I would also like to thank his research team, especially Chi-Hung Tzang and Qi Zhang, for their technical assistance.
I also wish to thank Prof. Dr. A. K. Bosserhoff (University of Regensburg) for his kind gifts (the plasmids pAshmg1 and pcDNA3) and helpful advice and discussions on the stable cell line as well as Dr. J. M. Shohet (Baylor College of
Medicine), Dr. W. D. Cress (University of South Florida), Dr. R. Fukunaga (Osaka
University) and Dr. B. Vogelstein (Johns Hopkins University School of Medicine)
IV Acknowledgments
for their generous gifts (the plasmids MDM2-luc, E2F1-luc, p53-luc, PG13 and
MG15, respectively) and helpful information.
I would like to thank Dr. Hon-Kei Lum for his useful discussions during the project, the technicians of our department, especially Ms. Sarah Yeung, for their support in coordinating and facilitating the use of different equipments, my teammates, especially Dr. Lijun Li and Miss Yuen-Shan Siu, for their help in this project and all my friends for their assistance, encouragement and support throughout this project. I am very glad to have the chance to work with all my colleagues during these three years.
I would also like to thank the Hong Kong Polytechnic University for granting me the research studentship for these three years and the American Society for
Biochemistry and Molecular Biology for awarding me the Travel Award to present the results in the Experimental Biology 2006 meeting in San Francisco, April
2006.
Finally, I would like to thank my family, especially my husband Ting Shao for their constant support and encouragement during my study. I would like to dedicate my thesis to them.
V Contents
Contents
Certification of Originality...... I
Abstract ...... II
Acknowledgements...... IV
Contents ...... VI
List of Figures ...... XII
List of Tables...... XIV
List of Appendices ...... XV
List of Abbreviations...... XVI
Chapter 1 Introduction ...... 1
1.1 The HMG Family ...... 1
1.1.1 History of the HMG Proteins...... 1
1.1.2 The HMG Proteins Classified by the Functional Motifs ...... 1
1.2 The HMGB1 Protein ...... 3
1.2.1 History of the HMGB1 Protein...... 3
1.2.2 The Human HMGB1 Gene...... 4
1.2.3 Structure of the HMGB1 Protein...... 5
1.3 The Expression and Localization of HMGB1 ...... 7
1.3.1 Regulation of HMGB1 Expression...... 7
1.3.2 Localization of HMGB1 ...... 9
1.4 Intracellular Functions of the HMGB1 Protein...... 10
1.4.1 Binding to DNA...... 10
1.4.2 Facilitating Nucleosome Remodeling...... 13
1.4.3 Interacting with Other Transcription Factors...... 15
1.4.4 Promoting Enhanceosome Assembly ...... 18
VI Contents
1.4.5 Stimulating V(D)J Recombination ...... 19
1.5 Extracellular Functions of the HMGB1 Protein...... 20
1.5.1 Extracellular Release of HMGB1...... 20
1.5.2 Multiple Receptors of HMGB1 ...... 23
1.5.3 HMGB1 as a Cytokine...... 25
1.5.4 HMGB1 in Inflammation and Sepsis ...... 27
1.5.5 HMGB1 in Cell Proliferation and Migration...... 29
1.5.6 HMGB1 in Cell Differentiation...... 30
1.5.7 HMGB1 in Tissue Repair ...... 32
1.5.8 HMGB1 in Cancer...... 33
1.6 Outline of This Project ...... 34
Chapter 2 Establishment of an HMGB1 Down-Regulated MCF-7 Cell line...... 36
2.1 Introduction ...... 36
2.2 Materials and Methodologies ...... 39
2.2.1 Materials ...... 39
2.2.2 Cell Line ...... 40
2.2.3 Plasmid Preparation ...... 41
2.2.3.1 Preparation of Escherichia coli (E. coli) Competent Cells...... 41
2.2.3.2 DNA Ligation...... 41 2.2.3.3 Chemical Transformation of Plasmid into E. coli Competent Cells ...... 42
2.2.3.4 Isolation of Plasmid DNA...... 42
2.2.3.5 Quantification of DNA and RNA...... 43
2.2.3.6 Restriction Endonuclease Digestion of DNA ...... 44
2.2.3.7 Agarose Gel Electrophoresis...... 44
2.2.4 Plasmid Construction...... 44
2.2.4.1 Design of Human HMGB1-specific siRNA ...... 44
VII Contents
2.2.4.2 Annealing of Complementary Oligonucleotides (siRNA Insert) . 46
2.2.4.3 Construction of siRNA-coding Plasmid ...... 46
2.2.4.4 Description of Plasmids ...... 47
2.2.5 Cell Culture...... 47
2.2.6 Transfection of DNA ...... 48
2.2.7 Establishment of Stable Cell Lines...... 50
2.2.7.1 Killing Curve Experiment...... 50
2.2.7.2 Selection of Stable Cell Lines...... 51
2.2.8 Detection of HMGB1 Protein Level by Western Blotting...... 51
2.2.8.1 Protein Extraction from Cultured Cells...... 51
2.2.8.2 Determination of Protein Concentration ...... 51
2.2.8.3 SDS-PAGE...... 52
2.2.8.4 Western Blotting...... 53
2.2.8.5 Antibody Treatment and Detection ...... 54
2.2.9 Detection of the HMGB1 mRNA level by Real-time RT-PCR ...... 55
2.2.9.1 Total RNA Isolation ...... 55
2.2.9.2 DNase Treatment...... 56
2.2.9.3 Reverse Transcription ...... 57
2.2.9.4 Real-time PCR ...... 57
2.2.10 Detection of Genomic Integration and Expression of Plasmid pAshmg1 in the Transformed Cells ...... 58
2.2.10.1 Genomic DNA Purification...... 58
2.2.10.2 Detection for Genomic Integration of the Plasmid pAshmg1.... 59
2.2.10.3 Detection for the Expression of Integrated pAshmg1...... 60
2.3 Results ...... 61
2.3.1 Construction of the HMGB1-targeting siRNA Plasmid ...... 62
2.3.2 Identification of Plasmids pAshmg1 and pcDNA3 ...... 64
2.3.3 HMGB1 Protein Levels in Transiently Transfected Cells ...... 67
VIII Contents
2.3.4 G418 Killing Curve of MCF-7 Cells ...... 69
2.3.5 Establishment of Stably-Transfected MCF-7 Cell Lines...... 70
2.3.6 HMGB1 Protein Levels in the Established Stable Cell Lines ...... 70
2.3.7 HMGB1 mRNA Level in the HMGB1-Suppressed MCF-7 Cell Line 72
2.3.8 Genomic Integration of the pAshmg1 Plasmid in the Stably Transfected MCF-7 Cell Lines ...... 72
2.3.9 Expression of the Integrated pAshmg1 Plasmid in the HMGB1 Suppressed MCF-7 Cell Line ...... 74
2.4 Discussion ...... 75
Chapter 3 Expression Profile of the HMGB1 Down-Regulated MCF-7 Cells...... 78
3.1 Introduction ...... 78
3.2 Materials and Methodologies ...... 79
3.2.1 Materials ...... 79
3.2.2 Cell lines ...... 79
3.2.3 Cell Culture...... 80
3.3.4 RNA Isolation ...... 80
3.2.5 cDNA microarray...... 81
3.2.6 Microarray Data Analysis...... 82
3.2.7 Functional Classification ...... 83
3.2.8 Pathway Analysis...... 83
3.2.9 Real-time RT-PCR ...... 84
3.3 Results ...... 86
3.3.1 Differential Expression Profiles in HMGB1 Down-Regulated MCF-7 Cells Compared to the Control Cells ...... 86
3.3.2 Relative Expression Level of Selected Genes ...... 86
3.3.3 Functional Classification of the Differentially Expressed Genes...... 87
3.3.4 Potential HMGB1-Associated Pathway ...... 97
IX Contents
3.4 Discussion ...... 102
3.4.1 Functional Classification of the Differentially Expressed Genes...... 103
3.4.2 Potential HMGB1-Assocated Network ...... 111
Chapter 4 The HMGB1/p53/MDM2/E2F1 Network...... 113
4.1 Introduction ...... 113
4.2 Materials and Methodologies ...... 116
4.2.1 Materials ...... 116
4.2.2 Cell lines ...... 116
4.2.3 Cell Culture...... 117
4.2.4 Genomic DNA Purification ...... 117
4.2.5 Purification of PCR Products and DNA from Agarose Gels ...... 117
4.2.6 Plasmids Preparation ...... 118
4.2.6.1 Construction of Expression Plasmids ...... 118
4.2.6.2 Construction of Promoter-containing Reporter Plasmids ...... 120
4.2.5.3 p53 Response Reporter Plasmid ...... 122
4.2.7 Transient Transfection ...... 123
4.2.8 Luciferase Reporter Assay...... 124
4.2.9 Statistical Analysis...... 125
4.3 Results ...... 125
4.3.1 Plasmid Construction...... 125
4.3.2 Decreased p53 Activity in the HMGB1 Down-regulated MCF-7 Cell Line ...... 127
4.3.3 The Effect of Exogenous HMGB1 and p53 on the p53 Promoter..... 128
4.3.4 The Effect of Exogenous HMGB1 and p53 on the MDM2 Promoter130
4.3.5 The Effect of Exogenous HMGB1 and p53 on the E2F1 Promoter .. 132
4.4 Discussion ...... 134
4.4.1 HMGB1 Does Not Regulate the p53 Promoter Directly ...... 134
X Contents
4.4.2 HMGB1 Regulates the MDM2 Promoter in a p53-dependent Manner ...... 134
4.4.3 HMGB1 Activates the E2F1 Promoter in a p53-independent Manner ...... 135
4.4.4 The HMGB1/p53/MDM2/E2F1 Network ...... 136
Chapter 5 Summary...... 137
Appendices...... 141
Appendix I Photos and Information on the MCF-7 and Saos-2 Cell Lines. ... 141
Appendix II Photos of the Stably-Transfected MCF-7 Cells...... 146
Appendix III Schematic Diagrams of the Vector Plasmids...... 147
Appendix IV Standard Curves of Real-time PCR...... 153
Appendix V Sequences of the Expression and Reporter Plasmids ...... 158
References...... 160
XI List of Figures
List of Figures
Figure Page
1.1 The Human HMGB1 Gene. 5
1.2 The Human HMGB1 Protein. 6
1.3 3D Structure of the HMG A and B Boxes. 7
1.4 3D Structure of HMG Box/DNA Complexes. 12
Mechanisms of the Involvement of HMGB1 in Nucleosome 1.5 14 Remodeling.
Alternative Successions of Steps for HMGBs’ Architectural 1.6 17 Activities.
An Enhanceosome That Contains Multilayer Proteins Binding to the 1.7 18 Target Sequence.
1.8 Intracellular and Extracellular States of HMGB1. 22
1.9 HMGB1 Signal Transduction Pathways. 23
HMGB1 Inhibitors as Potential Therapeutics in the Treatment of 1.10 28 Sepsis.
Schematic Representation of the Putative Mechanisms by Which 1.11 Amphoterin Regulates Myogenic Differentiation via RAGE 32 Engagement.
2.1 A Comparison of the Different Antisense Strategies. 37
2.2 Gene Silencing by RNA Interference (RNAi). 38
Schematic Diagram Showing Design of Oligonucleotide for 2.3 45 Generation of Hairpin RNA in the Cell.
The Double-stranded Oligonucleotide Used to Create the 2.4 45 HMGB1-specific siRNA Construct.
2.5 Gel Electrophoresis of PI-1 and pNCP after Digestion with Sca I. 63
2.6 Sequencing Result of Plasmid PI-1. 64
Gel Electrophoresis of pAshmg1 and pcDNA3 after Digestion with 2.7 65 EcoR I.
2.8 Sequencing Result of Plasmid pAshmg1. 66
XII List of Figures
Figure Page
2.9 Western Blotting Results of Transient Transfection. 68
2.10 Results of the G418 Killing Curve Experiment for MCF-7 Cells. 69
2.11 Western Blotting Results of the Stably Transfected MCF-7 Cells. 71
Gel Electrophoresis of the PCR Products Amplified from the 2.12 73 Genomic DNA of the Stably Transfected MCF-7 Cell Lines.
Gel Electrophoresis of RT-PCR Products to Investigate the mRNA 2.13 74 Expression of the Integrated pAshmg1 Plasmid.
Putative Interacting Pathways among the Differentially Expressed 3.1 98 Genes.
4.1 Major Activities Implicated for p53 and MDM2. 114
E2F1 Promotes Apoptosis in Both p53-dependent and 4.2 115 p53-independent Manners.
Gel Electrophoresis of the Plasmids pcDNA3, pcDNA3-HMGB1, 4.3 127 pcDNA3-TP53, pGL3-Basic and TP53-luc after Digestion.
Relative Luciferase Activities of p53 Response Plasmids in the 4.4 128 Ashmg1/E and the cDNA3/F Cell lines.
Transcriptional Regulation of HMGB1 and p53 on the TP53 4.5 promoter in the MCF-7 (A), the Ashmg1/E (B) and the Saos-2 (C) 129 Cell Lines.
(A－C) Transcriptional Regulation of HMGB1 and p53 on the 4.6 MDM2 Promoter in the MCF-7 (A), the Ashmg1/E (B) and the 131 Saos-2 (C) Cell Lines. (D) The Dose Response of MDM2-luc to Increasing Amounts of HMGB1 Plasmid in the Saos-2 Cell Line.
Transcriptional Regulation of HMGB1 and p53 on the E2F1 4.7 Promoter in the MCF-7 (A), the Ashmg1/E (B) and the Saos-2 (C) 133 Cell Lines.
4.8 Possible Interactions between HMGB1, p53, MDM2 and E2F1. 136
XIII List of Tables
List of Tables
Table Page
1.1 Revised Nomenclatures of the HMG Chromosomal Proteins 2
1.2 Transcription Factors That Interact with HMGB1 16
2.1 Plasmids Used in Chapter 2 47
Amount of Plasmid DNA Used in Transient Transfection in a 2.2 49 12-well Plate
Amount of Plasmid DNA Used in Stable Transfection in a 6-well 2.3 49 Plate
Amount of Plasmid DNA and Reagents Used in Different Plate 2.4 49 Formats
2.5 Components of the Separating and Stacking Gels 53
2.6 Buffers Used in SDS-PAGE and Western Blotting 55
2.7 Primers Used in Real-time PCR 57
2.8 Primers Used in Normal PCR 60
Number of Living Cell Colonies in Wells Treated With Different 2.9 69 Concentrations of G418
Relative HMGB1 mRNA Level in the HMGB1 Suppressed MCF-7 2.10 72 Cell Line
3.1 Sequences of the Primers Used in Real-time PCR 85
3.2 Relative Expression Levels of the Selected Genes 87
3.3 Functional Classifications of the Differentially Expressed Genes 88
3.4 Interaction among the Nodes of the Networks 99
4.1 Primers Used for Construction of Expression and Reporter Plasmids 119
4.2 Expression and Reporter Plasmids 122
XIV List of Appendices
List of Appendices
Appendices Page
I Photos and Information on the MCF-7 and Saos-2 Cell Lines. 141
II Photos of the Stably Transfected MCF-7 Cells. 146
III Schematic Diagrams of the Vector Plasmids. 147
IV Standard Curves of Real-time PCR. 153
V Sequences of the Expression and Reporter Plasmids. 158
XV List of Abbreviations
List of Abbreviations
A adenine a.a. amino acid APS ammonium persulfate AR androgen receptor ATCC American Type Culture Collection BLU boehringer light unit bp base pair BSA bovine serum albumin C cytosine CD circular dichroism
CaCl2 calcium chloride cDNA complementary DNA cm centimeters CMV cytomegalovirus
CO2 carbon dioxide Ct threshold cycle CTF2 CCAAT binding transcription factor 2 D diversity Da dalton DC dendritic cell DEF differentiation enhancing factor DLR Dual-Luciferase® Reporter DMEM Dulbecco's Modified Eagle Medium DNA deoxyribonucleic acid DNase deoxyribonuclease dsRNA double-stranded RNA E. coli Escherichia coli EDTA ethylene diaminetetraacetic acid EMSA electrophoretic mobility shift assay ER estrogen receptors EST expressed sequence tag FBS fetal bovine serum g a unit of force equal to the force exerted by gravity; used to indicate the force to which a body is subjected when it is accelerated
XVI List of Abbreviations
G guanine GAA acid alpha-glucosidase GFP green fluorescent protein GR glucocorticoid receptor GRP tripeptide GlyArgPro HIFα hypoxia-inducible factor alpha HMBA hexamethylenebisacetamide HMG high mobility group HRP horseradish peroxydase HUVEC human umbilical venular endothelial cells IL interleukin J joining kDa kilodalton kb kilobase LAR II luciferase assay reagent II LB Luria Bertani LPC lysophosphatidylcholine LPS lipopolysaccharide M Molar, mol/L MCS multiple cloning sites MEL murine erythroleukemia mg microgram
MgCl2 magnesium chloride
MgSO4 magnesium sulfate MIA melanoma-inhibitory activity mL milliliter mm millimeter mRNA messenger ribonucleic acid Mw Melecular Weight MyD88 myeloid differentiation factor 88 NaCl sodium chloride NaOH sodium hydroxide NF-I nuclear factor I NF-κB nuclear factor kappa B nm nanometer NMR nuclear magnetic resonance OD optical density
XVII List of Abbreviations
PAGE polyacrymide gel PBS phosphate buffer saline PCR polymerase chain reaction PMSF phenylmethylsulphonyl fluoride poly-A polyadenylation PR progesterone receptors PRE paramagnetic relaxation enhancement PVDF polyvinylidene difluoride RAG recombination-activating genes RAGE receptor for advanced glycation end products RFC replication factor C RISC RNA-induced silencing complex RNA ribonucleic acid RNAi RNA interference ROS rod outer segment RPM revolution per minute or the number of full turns the crankshaft makes per minute RSSs recombination signal sequences RT room tempreture SBP-1 sulphoglucuronyl carbohydrate binding protein-1 SDS sodium dodecylsulfate SGGLs sulfoglucuronylglycolipids siRNA short (or small) interfering RNA sRAGE soluble RAGE T thymine TBE Tris-borate EDTA TBS Tris-buffered saline TBP TATA box binding protein TLR Toll-like receptor TE Tris-EDTA TF transcription factor TMEMD N,N,N’,N’-tetramethylethylenediamine TNF tumor necrosis factor Tris Tris (hydroxymethyl) aminomethane TTBS Tris-buffered saline with 0.05% Tween-20 Tween 20 polyoxyethylenesorbitan monolaurate, polyethylene glycol sorbitan monolaurate UTR untranslated region
XVIII List of Abbreviations
UV ultraviolet V variable Vol. volume V/V volume/volume V/W volume/weight W/V weight/volume µL microliter µM micromolar 3D three-dimensional
XIX Chapter 1
Chapter 1 Introduction
1.1 The HMG Family
1.1.1 History of the HMG Proteins
High mobility group (HMG) proteins are highly abundant non-histone chromosomal proteins that have been studied by scientists for more than 30 years.
In 1973, Johns’ group isolated these proteins from calf thymus chromatin by
CM-cellulose chromatography when they studied the chromatin-bound proteins.
They named these proteins the “HMG” proteins because these proteins have high mobilities in polyacrylamide gel electrophoresis (Goodwin et al., 1973; Goodwin and Johns, 1973).
Since then, a large number of homologous HMG proteins have been identified in a variety of mammals, including the human (Corfman, 1987), the mouse (Levy and Dixon, 1978), the rat (Kuehl, 1979), the pig (Yoshida and
Shimura, 1984) and the dog (Bucci et al., 1985). HMG proteins have also been found in other eukaryotes, including the chicken (Isackson et al., 1979), Xenopus laevis (Kleinschmidt et al., 1983), the fruit fly (Wagner et al., 1992),
Caenorhabditis elegans (Jiang and Sternberg, 1999), the yeast (Weber and Isenberg,
1980), the maize (Grasser and Feix, 1991) and the thale cress plants (Stemmer et al., 1997).
1.1.2 The HMG Proteins Classified by the Functional Motifs
Since the 1970s, numerous proteins have been found to contain functional motifs similar to those of the canonical HMG proteins. To distinguish these proteins, researchers have classified them into two major groups: the canonical
1 Chapter 1
HMG proteins and the HMG-motif proteins. The former are widely-expressed, abundant and non-specific DNA-binding proteins in higher eukaryotes while the latter are specifically-expressed, non-abundant and sequence-specific
DNA-binding proteins, usually containing additional non-HMG motifs (Bustin,
1999). So far, 12 canonical HMG proteins have been reported. They are further subdivided according to the characteristics and functions of the different HMG motifs into three different families: the HMGB family, the HMGN family and the
HMGA family, as shown in Table 1.1 (Bustin, 2001).
Table 1.1 Revised Nomenclatures of the HMG Chromosomal Proteins (Adopted from Bustin, 2001)
HMG PROTEINS
Old name HMG Motif New Name Functional Motif Root Symbol (Canonical Proteins (Canonical HMGs) HMGs) HMG-box HMG-Box HMGB HMGB1, 2, .., n HMG-1/-2 Proteins
NBD Nucleosome HMGN HMGN1, 2, .., n HMG-14/-17 Proteins Binding Domain
AT-hook AT-hook HMGA HMGA1, 2, .., n HMG-I/Y/C Proteins
The HMGB family consists of three members: HMGB1, HMGB2 and
HMGB3. They have similar molecular weights (Mw) of about 25 kDa and contain the “HMG box” a stretch of approximately 80 amino acid residues. The HMG box is responsible for the non-specific binding of HMGB proteins to the minor groove of DNA (Bustin et al., 1999).
2 Chapter 1
There are five members in the HMGN family: HMGN1, HMGN2, HMGN3,
HMGN3a and HMGN3b.They play a role in remodeling the higher order structure of chromatin by directly binding to the nucleosome via an approximately 30 amino acids long and positively charged domain. This domain is called the “Nucleosome
Binding Domain” (Bustin et al., 1995; Bustin et al., 1999).
The four members of the HMGA family are HMGA1a, HMGA1b, HMGA1c and HMGA2. They have the motif called the “AT hook”, a positively charged region containing 9 amino acids with the core tripeptide GlyArgPro (GRP). The
AT hooks bind nonspecifically to the minor groove of DNA (Reeves et al., 1990;
Bustin et al., 1999). Each canonical HMGA is usually composed of three AT hook motifs and some other functional domains. It is likely that HMGA proteins may bind to DNA through cooperation between the different domains (Frank et al.,
1998).
1.2 The HMGB1 Protein
1.2.1 History of the HMGB1 Protein
The HMGB1 protein, as the most abundant HMG proteins, has been extensively studied since 1973. The HMGB1 protein was initially isolated from calf thymus with chromatin and named the “high mobility group 1” (HMG-1) protein (Goodwin and Johns, 1973). In 2001, it was re-designated HMGB1 by the nomenclature committee (Bustin, 2001). Being identified from different origins,
HMGB1 had been called several aliases such as DKFZp686A04236, HMG3, amphoterin and sulphoglucuronyl carbohydrate binding protein-1 (SBP-1).
DKFZp686A04236 was sequenced from the cDNA clone DKFZp686A04236 of a
3 Chapter 1 human cDNA library constructed by the German cDNA Consortium (Koehrer, et al., 2004). HMG3 is a truncated protein of HMGB1. It lacks the acidic C-terminal domain (Stros et al., 1994). Amphoterin was originally isolated from the perinatal rat brain as a 30-kDa heparin-binding protein that enhances neurite outgrowth in the cytoplasmic processes in developing brain neurons and was later found to be identical to HMGB1 (Rauvala and Pihlaskari, 1987; Merenmies et al., 1991). The
SBP-1 protein was first purified from the neonatal rat brain as a protein that binds to sulfoglucuronylglycolipids (SGGLs) and was capable of promoting neuron growth in developing nervous system. It was later confirmed to be HMGB1 (Nair and Jungalwala, 1997; Nair et al., 1998; Chou et al., 2001).
1.2.2 The Human HMGB1 Gene
The human HMGB1 gene was found, using in situ hybridization, to be located on human chromosome 13 band q12 (Figure 1.1.A) (Ferrari et al., 1996).
Furthermore, it was reported that the HMGB1 gene spans 6017 bp and is composed of 5 exons and 4 introns (Figure 1.1). Several research groups have validated that there are three types of HMGB1 mRNAs with sizes of about 1.05,
1.45 and 2.45 kb respectively. They share the same coding region but contain different lengths of the 3’- untranslated region (UTR) generated from the use of three different polyadenylation (polyA) sites (Lee et al., 1987; Ferrari et al., 1994;
Spada et al., 1998). Wen et al. confirmed the existence of these three mRNAs in different animal tissues and cell lines using Northern blot analysis (Wen et al.,
1989), suggesting that the existence of diverse HMGB1 mRNAs may be commonly associated with the expression and function of the HMGB1 protein. In
4 Chapter 1 this study, they also reported that the cDNA of the human HMGB1 gene is 648 bases long and codes for a 215 amino acid (a.a.) long protein (Wen et al., 1989).
Figure 1.1 The Human HMGB1 Gene. A: The human HMGB1 gene is located on chromosome 13, at 13q12; B: The human HMGB1 gene is 6017 bp in length and is composed of 5 exons and 4 introns; C: The human HMGB1 mRNA. (Figures A and B were adopted from National Center for Biotechnology Information).
1.2.3 Structure of the HMGB1 Protein
As a ubiquitous and abundant protein in eukaryotes, HMGB1 is highly conserved through evolution and has 99% identity in amino acid sequence among all mammals. For example, only two residues are substituted between the rodent
(mouse and rat) and the human HMGB1 proteins (Bustin et al., 1990).
As shown in Figure 1.2, the 215 amino acid long HMGB1 protein is composed of two HMG boxes: the HMG A box (residues 1–79) and the HMG B box (residues 89–163), and a highly acidic C-terminal domain (also called the
“acidic tail”) (residues 186–215) (Thomas and Travers, 2001; Harris and
5 Chapter 1
Andersson, 2004). The N-terminus is rich in positively charged lysine residues, whereas the highly acidic C-terminal tail is composed of an uninterrupted stretch of 20 to 30 negatively charged aspartic and glutamic acid residues (Johns et al.,
1982). The two HMG boxes, with approximately 30% sequence similarity, are responsible for the non-sequence-specific DNA binding property (Thomas, 2001).
In contrast, the acidic tail does not directly bind to DNA but influences the DNA binding affinity of the HMGB1 protein through its interaction with the HMG boxes (Stros et al., 1994; Knapp et al., 2004).
Figure 1.2 The Human HMGB1 Protein. The DNA-binding domains — A-box and B-box — are highlighted in yellow. The acidic C-terminal tail is highlighted in pink. Acidic amino acids are indicated with red letters and basic amino acids are indicated with blue letters. The shortest peptide with demonstrated cytokine-inducing capacity is denoted with bold letters. (Figure adopted from Harris and Andersson, 2004).
By using nuclear magnetic resonance (NMR) spectroscopy, the three-dimensional (3D) structure of the HMG box has been revealed to be a characteristic, twisted, L-shaped fold consisting of three α-helices (Kraulis, 1991;
Bustin et al., 1999; Thomas and Travers, 2001). The 3D structures of the HMG A
6 Chapter 1 and B boxes are shown in Figure 1.3 (Thomas and Travers, 2001). However, little data is available on the 3D structure of the whole HMGB1 protein.
Figure 1.3 3D structure of the HMG A and B Boxes. (a) Amino acid sequences of the HMG A and B boxes of rat HMGB1 protein. (b) Solution structures of the A and B HMG boxes of HMGB1, determined by NMR spectroscopy. The structures are oriented to show the differences in the relative dispositions of helices I and II between the A type HMG-box (A domain from HMGB1) and the B type HMG-box (B domain from HMGB1 and HMG box from HMG-D). In the A-type box, helix I is essentially straight whereas in the B type box it is bent, and the loop between helices I and II is longer in the A-type than in the B-type box. The structures are displayed using MOLSCRIPT. (Figures adopted from Thomas and Travers, 2001).
1.3 The Expression and Localization of HMGB1
1.3.1 Regulation of HMGB1 Expression
Although HMGB1 protein exists in almost all the mammalian cells, it is
7 Chapter 1 considered to be a precisely and flexibly regulated gene and not just a housekeeping gene (Müller et al., 2004). The expression level of HMGB1 fluctuates in different cell types and is correlated with development stages and cell cycle phases. Müller et al. proposed that HMGB1 is highly expressed in differentiating tissues and actively dividing cells (Müller et al., 2004). Consistently higher HMGB1 levels have been identified in most tumor types compared to the normal original tissues (Zeh and Lotze, 2005).
In special cases, expression of HMGB1 could be regulated by hormones.
Both estrogen and progesterone are capable of enhancing the expression of
HMGB1 proteins in breast cancer MCF-7 cells (Chau et al., 1998; He et al., 2000).
Further studies revealed that two estrogen response elements are located within the intron 1 of the human HMGB1 gene, indicating that the regulation of HMGB1 by estrogen occurs at the transcriptional level (Borrmann et al., 2001).
In addition, the 5’-upstream region of the human HMGB1 gene was analyzed and a silencer is located upstream to a strong core promoter and an enhancer were identified in the first intron (Lum and Lee, 2001). In cisplatin-resistant cells,
HMGB1 is transcriptionally up-regulated by CCAAT binding transcription factor 2
(CTF2), a member of the CTF/nuclear factor I (NF-I) family (Nagatani et al.,
2001). Later, from the results that the HMGB1 promoter activity in both the A2780 human ovarian cancer cells and the Saos-2 osteosarcoma cells is up-regulated by p73α but down-regulated by p53, Uramoto et al. speculated that these regulations might be accomplished through their interaction with the CTF2 protein (Uramoto et al., 2003).
Another type of regulation on functional HMGB1 occurs at the protein level, which is to modify the synthesized HMGB1 protein by acetylation (Bonaldi et al.,
8 Chapter 1
2003), phosphorylation (Kimura et al., 1985), methylation (Boffa et al., 1979),
ADP-ribosylation (Tanuma et al., 1985) and glycosylation (Chao et al., 1994).
These modifications influence the stability as well as DNA binding affinity of
HMGB1 (Wisniewski et al., 1999; Bonaldi et al., 2003). Interestingly, hyperacetylation of HMGB1 in resting macrophages leads to the accumulation of
HMGB1 in cytosol and this is an important step in the HMGB1 secretion process
(Bonaldi et al., 2003).
1.3.2 Localization of HMGB1
Other than just a nuclear protein, HMGB1 is localized both intranuclearly and extranulearly, and could even be transported out of the cell. In earlier studies,
HMGB1 was defined as a nuclear protein because it was originally isolated together with the chromatin (Levy and Dixon, 1978). Further studies showed that
HMGB1 is mainly localized in the nucleus as a component of the chromatin and is involved in many nuclear processes as a DNA binding protein (Agresti and
Bianchi, 2003). However, even in the early studies, it had been observed that
HMGB1 is present in the cytoplasm of cultured cells, including the Chinese hamster V-79, the rat liver TR-12 and the bovine trachea EBTr-NBL-4 cells
(Bustin and Neihart, 1979). Later, fluorescein-labeled HMGB1 microinjected into the living fibroblasts was observed in both the nucleus and the cytoplasm (Einck et al., 1984). Müller et al. proposed that HMGB1 has a dynamic equilibrium between the nucleus and the cytoplasm in all cells and prefers to accumulate in the nucleus in the steady state (Müller et al., 2004). However, this distribution of HMGB1 is associated with the cell cycle and differs in different cell types. For example, when
HeLa cells were transfected with HMGB1-GFP (green fluorescent protein) plasmid, the HMGB1-GFP protein was observed in both the cytoplasm and the
9 Chapter 1 nucleus of cells undergoing mitosis. In contrast, the HMGB1-GFP protein was only present in the nucleus of resting cells (Scaffidi et al., 2002). Another finding is that HMGB1 is present in both the nucleus and the cytoplasm of lymphoid tissues and testis, whereas in the brain and the liver, HMGB1 exists mainly in the cytosol (Muller et al., 2004).
HMGB1 could even be transported from the cytoplasm onto the external surface of the cell membrane when specific types of cells, including the embryonic rat brain cells and the human platelets, are activated by particular stimuli
(Merenmies et al., 1991; Rouhiainen et al., 2000). Furthermore, HMGB1 could be released out of the cell and consequently perform its extracellular function.
1.4 Intracellular Functions of the HMGB1 Protein
The HMGB1 protein is abundant in all mammalian nuclei with approximate
106 molecules per a typical mammalian cell (Bustin et al., 1999; Bonaldi et al.,
2003). Previous studies defined HMGB1 as a nuclear protein involved in nuclear processes mainly by binding to DNA. More recently, HMGB1 protein has also been reported to play multiple roles in diverse extracellular processes (Muller et al.,
2001; Erlandsson Harris and Andersson, 2004).
1.4.1 Binding to DNA
By using thermal denaturation and circular dichroism (CD) spectroscopy, Yu et al. found that each HMGB1 molecule binds to about 20 bp of DNA (Yu et al.,
1977). This interaction between HMGB1 and DNA was further confirmed by using both crystallography and NMR spectroscopy (Ohndorf et al., 1999; Thomas and Travers, 2001; Stott et al., 2006). Data from crystallography showed that the
HMGB1 A box binds to the minor groove of a cisplatin modified DNA fragment
10 Chapter 1 and the 3D structure of this HMGB1 A-DNA complex is presented in Figure 1.4.A
(Ohndorf et al., 1999; modified by Iwahara et al., 2004). Later, results from intermolecular 1H paramagnetic relaxation enhancement (PRE) analysis demonstrated that the HMGB1 A box binds to multiple sites of a 14-bp DNA fragment with multiple orientations (Iwahara et al., 2004). In 2006, the 3D structure of the HMGB1 B box-DNA complexes (Figure 1.4.B and 1.4.C) has also been reported in an SRY-B/DNA model by using NMR spectroscopy (Stott et al.,
2006). In this study, the SRY-B peptide, constituted from the HMG box of the sequence-specific transcription factor SRY, was linked to the HMGB1 B box to simulate the two tandem HMGB1 A and B domains. These results also provide information on the 3D structure of an HMG box bi-domain/DNA complex (Stott et al., 2006).
It is known that both the HMG A and B boxes of HMGB1 bind to the minor groove of DNA without sequence preference. Although the binding is non-sequence-specific, these two domains do have high preference for bent DNA structures. Their binding affinity increases from the linear to the supercoiled and to the distorted DNA (Teo et al., 1995).
However, the DNA binding affinities of the HMGB1 A and B boxes are not same. The bending ability of the B Box for the supercoiled and the linear DNA is higher than that of the A box whereas the A Box binds the distorted DNA structures such as four-way junctions more effectively than the B box (Teo et al.,
1995; Hardman et al., 1995; Stros et al., 1998). The molecular basis of the discrimination lies in the structural difference between the orientation and angle of the three α-helices in the A box and the B box (Hardman et al., 1995).
11 Chapter 1
Figure 1.4 3D Structure of HMG Box/DNA Complexes.
(A) Crystal structure of the complex between HMGB-1A and cisplatin-modified DNA. The cisplatin molecule, Pt(NH3)2, cross-linking two guanine bases is depicted in yellow (Adopted from Ohndorf, et al., 1999 and Iwahara, et al., 2004). (B) and (C) The lowest-energy structures of the SRY.B/DNA complex (two views at 90°). Protein is shown in ribbon form (SRY box in red, linker in green and B box in blue) and bonds between DNA heavy-atoms are shown as continuous grey lines; the side-chains of the three intercalating residues are shown in stick form. (Figures adopted from Stott et al., 2006).
A very interesting finding is that recombinant rat HMGB1 can bind specifically to DNA that has been bent and damaged by the anticancer compound cisplatin and the binding inhibits repair of the damaged DNA (Pil and Lippard,
12 Chapter 1
1992; Zamble and Lippard, 1995). The binding of the full-length HMGB1 protein to cisplatin damaged DNA is mainly accomplished by the HMGB1 A box. The acidic C-terminal tail may also contribute to this binding (Jung and Lippard 2003;
Mitkova et al., 2005). This specific recognition and binding of HMGB1 to damaged DNA fragments provides new insights into the design of and screening for new cisplatin analogues for cancer therapy (Pasheva et al., 2002).
1.4.2 Facilitating Nucleosome Remodeling
Nucleosome is the basic unit of eukaryote chromatin organization. The core particle containing 146 or 147 base pairs of DNA packaged with the histone octamer (two molecules each of H2A, H2B, H3 and H4) together with the linker
DNA and one molecule of histone H1 or H5 form the complete nucleosome (Luger,
2006). Unwrapping and remodeling of the nucleosome are essential for the transcription process. HMGB1 is considered to be the key molecule involved in the nucleosome disrupting or remodeling process (Travers et al., 2003). In Figure
1.5.A, one possible mechanism of nucleosome remodeling is described. In this model, the HMGB protein binds to the DNA at the edge of the complex, alters the nucleosome structure and consequently makes it more accessible to other transcription factor or chromatin remodeling complexes (Travers et al., 2003). In addition to the proposed bending of DNA at the nucleosome core particle site, the
HMGB1 protein may compete with histone H1 at the linker sites of the nucleosome and induces a less compact nucleosome structure. In contrast, H1 linker histone plays the opposite role by keeping a tighter nucleosome structure.
This model provides an interpretation of how a nucleosome alternates between conformations with different accessibilities (Figure 1.5.B) (Travers et al., 2003).
13 Chapter 1
Figure 1.5 Mechanisms of the Involvement of HMGB1 in Nucleosome Remodeling. (A) Proposed mechanism for priming of nucleosomes by the HMGB proteins. A, In an intact nucleosome the DNA is tightly wrapped, entering and leaving the structure at sites marked E. The dyad (X), or midpoint, is at the centre of the wrapped DNA. Histone H2A/H2B dimers and H3/H4 dimers are indicated in green and blue, respectively. B, Binding of an HMGB protein just outside one exit/entry point creates an untwisted bend in the DNA that alters the nucleosome structure. C, Previously inaccessible regions are exposed, which are potentially accessible to (D) transcription factors (TF) or to (E) chromatin remodelling complexes (RC). F, When associated with RNA polymerase II (as the FACT/SPN complex), the HMG-induced destabilization of nucleosomal structure could result in the dissociation of an H2A/H2B dimer (Kireeva et al., 2002). (B) A general Model for the Function of HMGB Proteins. An HMGB protein bound in the vicinity of an exit/entry point induces increased access to both DNA gyres in a spatially restricted patch. Elsewhere the HMGB protein lessens accessibility. The alternative, less accessible conformation of the nucleosome is stabilized by histone H1. Accessible and bound segments of DNA are indicated in orange and red, respectively. (Figure adopted from Travers et al., 2003).
14 Chapter 1
1.4.3 Interacting with Other Transcription Factors
As a DNA-binding factor without sequence specificity, HMGB1 targets DNA through its interaction with other sequence-specific DNA-binding proteins.
Through this type of cooperation, HMGB1 is involved in both the activation and repression of diverse genes (Thomas and Travers, 2001). One well-studied example is the interaction between HMGB1 and p53, an important tumor suppressor protein. Jayaraman et al. demonstrated that HMGB1 interacts directly with p53 in vitro and it also enhances p53 mediated transcriptional activation in vivo (Jayaraman et al., 1998). Mckinney and Prives observed in electrophoretic mobility shift assay (EMSA) that HMGB1 enhances p53 binding to the linear
66-bp DNA but not its minicircle structure and they proposed that HMGB1 provides prebent DNA for p53 binding to its target gene (Mckinney and Prives,
2002). Data from transient transfection assays also indicate that both the A box and C-tail of HMGB1 are crucial for its transactivation of p53 (Banerjee and
Kundu, 2003).
HMGB1 also interacts with many steroid hormone receptors, including the progesterone receptor (PR), the glucocorticoid receptor (GR) and the androgen receptor (AR) to enhance their sequence-specific DNA-binding in vitro and their transcriptional activation of downstream genes in vivo (Boonyaratanakornkit et al.,
1998). Similarly, HMGB1 facilitates estrogen receptor binding to its response element both in vitro and in vivo (Romine et al., 1998；Zhang et al., 1999；Das et al., 2004). It was also reported that HMGB1 knocked-out mouse cells have lower expression level of glucocorticoid-dependent genes, suggesting the involvement of
HMGB1 in the glucocorticoid receptor activated downstream pathways (Calogero et al., 1999). In Table 1.2, transcription factors of which the DNA-binding ability
15 Chapter 1
Table 1.2 Transcription Factors That Interact with HMGB1
Protein-protein Protein Functions in vivo References Interactions in vitro HMGB1 increases HOXD9 HMGB1 increases sequence-specific HOXD9 transcriptional Zappavigna et al., HOXD9 DNA-binding using activation (transient 1996 EMSA and DNase I transfection). footprinting. Interact with HMGB1 in HMGB1 enhances the EMSA when long distance Butteroni et al., Oct-4 co-expressed in transactivation of Oct-4 2000 mammalian cells using in transient transfection. phage display. HMGB1 enhances p53 HMGB1 directly interacts mediated transcriptional Jayaraman et al., p53 with p53 (far western activation (transient 1998 analysis). transfection). HMGB1 enhances the HMGB1 physically transactivation of p73 to interacts with p53 the p73-dependent Bax p73 (pull-down assay) and Stros et al., 2002 promoter in H1299 cells, enhances DNA-binding but inhibits this of p73 (EMSA). activation in Saos-2 cells. HMGB1 enhances DNA-binding of p65/p50 HMGB1 is crucial for the Rel family and p50/p50, while expression of VCAM-1, (including reduces DNA-binding of which is an Agresti et al., 2003 NF-κB) p65/p65, c-Rel/c-Rel, NF-κB-dependent p65/c-Rel, and p50/c-Rel molecule. (EMSA). aOnate et al., 1994; Steroid a,b,cBoonyaratanakor hormone HMGB1 enhances their HMGB1 increases the nk-it et al., 1998; receptors sequence-specific transcriptional activations dRomine et al., (PRa, GRb, DNA-binding (EMSA, to downstream genes 1998; ARc and etc). (transient transfection). dZhang et al., 1999; ERd) dDas et al., 2004; b Agresti et al., 2005 HMGB1 interacts with Sterol SREBP-1and-2 (far regulatory HMGB1 enhances the western blotting analysis, element-bi transcriptional activation pull-down and in vivo Najima et al., 2005 nding of SREBPs (transient coimmunoprecipitation) proteins transfection). and potentiates SREBP (SREBPs) binding to DNA (EMSA).
16 Chapter 1 is either up-regulated or down-regulated by the interaction with the HMGB1 protein are listed. The possible mechanism on how the HMGB1 protein facilitates transcription by prebending DNA or enhancing the DNA-binding affinity of other
DNA-binding proteins is shown in Figure 1.6 (Agresti and Bianchi, 2003).
Figure 1.6 Alternative Successions of Steps for HMGBs’ Architectural Activities. HMGB1 binds rather weakly to the B form of DNA, and has practically no sequence specificity. (i) But once bound, it bends the DNA molecule, and the distorted structure is now a substrate (ii) for efficient binding by several transcription factors. (iii) Often, HMGB1, after having provided an active architectural participation, leaves the complex. In the case of p53 binding, the succession of steps (i–iii) was suggested by the mechanistic analysis of Mckinney and Prives, 2002. (iv) Several factors, such as the class I steroid receptors, TBP and RAG1, bind rather inefficiently to their targets on DNA but the result is often a moderately distorted DNA. HMGB1 recognizes these structures with high affinity, binds to the DNA minor groove, thus (ii) cooperating to stabilize the prebent structures. (iii) HMGB1 can leave the complex after having provided its architectural activity. The succession (iv–ii–iii) was suggested by the analysis of steroid receptor binding. In some circumstances (ii), as in the enhanceosome on the BHLF-1 promoter, HMGB1 stays as part of the complex. (Figure adopted from Agresti and Bianchi, 2003).
17 Chapter 1
1.4.4 Promoting Enhanceosome Assembly
To adapt to the diverse environment rapidly, eukaryotes make use of a series of delicate modules to regulate transcription of target genes. For example, the enhanceosome, a multiprotein/DNA complex, is formed through the recognition and targeting of transcription factors cooperatively to their multiple sites in an enhancer sequence. In the enhanceosome assembly, non-sequence-specific
DNA-binding proteins are often required since they could prebend the DNA and thereby enhance the accessbilility of other proteins. For example, HMGB1 facilitates the assembly of two enhanceosomes on the Epstein-Barr virus BHLF-1 gene: one on its promoter and another on its enhancer (Agresti and Bianchi, 2003).
Figure 1.7 An Enhanceosome That Contains Multilayer Proteins Binding to the Target Sequence. (Figure adopted from the website of the Biology department, Occidental College. The website address is http://departments.oxy.edu/biology/ Stillman/bi221/110300/rna_polymerases.htm).
Figure 1.7 represents an enhanceosome that contains multilayer of proteins binding to the target sequence (http://departments.oxy.edu/biology/Stillman/bi221
18 Chapter 1
/110300/rna_polymerases.htm). In the multiprotein/DNA complex, HMGB1 reduces the rigidity of the DNA and allows easier binding of other transcriptonal factors.
1.4.5 Stimulating V(D)J Recombination
By interacting with recombination activation proteins (RAG1 and RAG2),
HMGB1 facilitates V(D)J recombination, a mechanism of site-specific DNA rearrangement, in which diverse antigen receptor genes are assembled through recognition and recombination of V (variable), D (diversity) and J (joining) heavy chain genes. These genes are flanked by recombination signal sequences (RSS).
Each RSS is composed of a conserved heptamer DNA element, a 12 or 23 bp long spacer and a conserved nonamer DNA element. The RSSs are present on the 3’ side of each of the V coding regions, the 5’ side of each of the J coding regions and both ends of each of the D coding regions (Sadofsky, 2001). In activated lymphocytes, the RSSs are initially recognized by RAG1 and RAG2 to form protein-DNA complexes. Then the cleavage of the RSS produces a blunt end on the RSS elements and an hairpinned end on the coding region. Finally, the coding regions are linked together to generate a rejoined fragment (Sadofsky, 2001). In vitro, the formation and cleavage of the RAG/RSS complexes are found to be stimulated by HMGB1 (Bergeron et al., 2005). HMGB1 could promote the assembly of RAG on both the 12-RSS and 23-RSS and assist in the cleavage of the individual 23-RSS in vitro (Swanson, 2002). However, the function of HMGB1 in
V(D)J recombination in vivo has not been revealed and the mechanism of HMGB1 involvement in this process still remains unclear.
19 Chapter 1
1.5 Extracellular Functions of the HMGB1 Protein
In recent years, it has been discovered that HMGB1 could be released from cells and play multiple extracellular functions in a variety of physical processes such as the innate and adaptive immunities, tissue repair and cancer progression
(Harris and Raucci, 2006). The discovery of the extracellular functions of HMGB1 has evoked a great deal of research interest and has brought new insights into the therapies of related diseases.
1.5.1 Extracellular Release of HMGB1
It has been identified that HMGB1 could be released mainly through two different ways: passively released from damaged or necrotic cells as a “necrotic marker” or actively secreted from cells of the innate immune system, especially macrophages and monocytes, upon stimulation by inflammatory signals such as lipopolysaccharide (LPS), interleukin-1 (IL-1) or tumor necrosis factor (TNF)
(Figure 1.8) (Harris and Andersson, 2004; Bianchi and Manfredi, 2004; Ulloa and
Messmer, 2006). Although the HMGB1 protein could not be transported via the
Golgi/endoplasmic reticulum pathway because it lacks a typical secretion signal, its secretion from activated monocytes could be carried out through relocalization of hyperacetylated HMGB1 from the nucleus into special cytoplasmic vesicles called the secretory lysosomes (Gardella et al., 2002; Bonaldi et al., 2003).
Consequently, the exocytosis of HMGB1-containing secretory lysosomes is induced by lysophosphatidylcholine (LPC), a lipid that is produced from phosphatidylcholine by phospholipase A2 several hours after stimulation (Gardella et al., 2002). Besides monocytes, macrophages could also actively release
HMGB1 in a similar way (Bonaldi et al., 2003; Chen et al., 2004). It has been
20 Chapter 1 reported that HMGB1 could also be secreted by other cells, including natural killer cells (Semino et al., 2005), primary osteoblasts and osteoblast-like cells
(Charoonpatrapong et al., 2006), pituicytes (Wang et al., 1999b), endothelial human umbilical venular endothelial cells (HUVEC) (Mullins et al., 2004), enterocytes (Liu et al., 2005) and murine erythroleukemia (MEL) cells (Sparatore et al., 2001). The secretion mechanism of HMGB1 in macrophages has been confirmed to be similar to that of monocytes (Gardella et al., 2002), but how
HMGB1 is transported out of cells in the other types of cells still needs to be clarified (Charoonpatrapong et al., 2006).
In addition to active secretion, HMGB1 could be passively released from the nuclei of damaged or necrotic cells (Scaffidi et al., 2002). This type of release broadcasts the signal of unprogrammed cell death to nearby cells and thereby stimulates compensative responses to tissue damage (Bianchi, 2004). In contrast,
HMGB1 firmly binds to chromatin of apoptotic cells, probably as a result of histone hypoacetylation (Scaffidi et al., 2002). Some researchers speculated that
HMGB1 might serve as an immune adjuvant in innate immunity triggered by injury or infection since it is passively released from necrotic but not apoptotic cells (Scaffidi et al., 2002; Rovere-Querini, et al., 2004).
However, Bell et al. recently argued that HMGB1 could also be released from apoptotic cells in some special situations (Bell et al., 2006). They observed the release of HMGB1 from cultured Jurkat cells (human T cell leukemia), Panc-1 cells (human pancreas carcinoma), U937 cells (human promonocytic) and HeLa
S6 cells (human cervix carcinoma) that were undergoing late apoptosis after chemical stimulation. These findings have increased the complexity on the release mechanism of HMGB1 and evoked further investigations in this area.
21 Chapter 1
Figure 1.8 Intracellular and Extracellular States of HMGB1. In most types of normal, healthy cells, HMGB1 (small green spheres) is nuclear but undergoes rapid cycles of binding and detachment from chromatin. When a cell undergoes necrosis, its membranes lose their integrity, HMGB1 is no longer constrained in the nucleus and passively diffuses out of the cell. On the contrary, when the cell activates its apoptosis program, as a late event its chromatin collapses and HMGB1 becomes tightly attached to the nuclear remnants. Thus, apoptotic cells do not signal their own death, because they retain HMGB1. Resting, non-activated inflammatory cells, such as monocytes or macrophages, contain HMGB1 in the nuclear compartment. When activated by lipopolysaccharide or inflammatory cytokines, they translocate the nuclear HMGB1 into the cytoplasm, and from here into specialized organelles, the secretory lysosomes; HMGB1 is then exocytosed. Thus, HMGB1 can be released either passively by necrotic cells, or actively by inflammatory cells. Extracellular HMGB1 then reaches responsive cells (green in the drawing), either by diffusion in the immediate vicinity or via the blood stream to more distant compartments. Extracellular HMGB1 binds to specific receptors (so far, the only validated receptor for HMGB1 is RAGE, but others are likely to exist). Signal transduction through RAGE activates several responses, depending on the cell type: inflammatory cells are activated, stem cells proliferate, and several cell types migrate towards the source of HMGB1. Antibodies against HMGB1 abrogate these responses, and also reduce the dispersal of highly metastatic lung carcinoma cells. (Figure adopted from Bianchi and Manfredi, 2004).
22 Chapter 1
1.5.2 Multiple Receptors of HMGB1
After release from the cells, HMGB1 plays its extracellular functions via interactions with its receptors on the membrane of target cells. Recently, it has been identified that receptor for advanced glycation end products (RAGE) and
Toll-like receptors (TLR2 and TLR4) can be stimulated by extracellular HMGB1.
The extracellular HMGB1-related pathways are described in Figure 1.9 (Yang et al., 2005).
Figure 1.9 HMGB1 Signal Transduction Pathways. HMGB1 binds RAGE, TLR2, possibly TLR4 and other receptors. Activation of RAGE has two main consequences: One activates CDC42 and Rac, which regulate neurite outgrowth during neuron development, and the other activates Ras, MAPK pathways, and subsequently, NF-κB nuclear translocation. Activation of TLR2 (and/or TLR4) by HMGB1 causes recruiting of MyD88 and IL-1 receptor-associated kinase (IRAK), subsequently activates MAPK pathway and NF-κB translocation, and
triggers inflammatory responses. Erk1/2, Extracellular signal- regulated kinase 1/2 (Figure adopted from Yang, et al., 2005).
23 Chapter 1
Among the HMGB1 receptors, the most widely studied one is RAGE (Hori et al., 1995). As a member of the immunoglobulin superfamily, RAGE is expressed in a variety of cells including the endothelial cells, vascular smooth muscle cells, neurons, and macrophages/monocytes (Yang et al., 2005). It acts as a membrane-bound receptor for multiple ligands such as the advanced glycation end products that accumulate in diabetes, the S100/calgranulins in chronic inflammation, and the amyloid beta-peptide in the neurodegenerative Alzheimer’s disease (Fages et al., 2000). Extracellular HMGB1 has been confirmed to be a novel ligand of RAGE in inflammation, cell mobility and proliferation (Taguchi et al., 2000; Kokkola et al., 2005). Data from binding assays revealed that the motif responsible for the binding of HMGB1 to RAGE is its COOH-terminus (residues
150–183) (Huttunen et al., 2002). Several studies demonstrated that the
HMGB1/RAGE interaction activates diverse downstream signaling pathways, such as the Rac and Cdc42 pathway, the Ras and NF- B pathway, the ERK1/2,
JNK, and p38 MAP kinases pathways (Huttunen et al., 1999; Taguchi et al., 2000).
Although Kokkola et al. proclaimed that RAGE is the main receptor of
HMGB1 in stimulated rodent macrophages (Kokkola et al., 2005), some researchers argued that it is TLRs but not RAGE that play a major role in macrophage activation (Park et al., 2004; Park et al., 2006; Yu et al., 2006). As a group of membrane glycoproteins that play important roles in innate immune system induction to defend against the invading microbes, TLRs have been detected in diverse immune cells such as the macrophages, monocytes, neutrophils, dendritic cells (DCs), B cells and T cells, as well as in some non-immune cells
24 Chapter 1 such as the fibroblasts and epithelial cells (Akira et al., 2006). Previous studies showed that TLR2 and TLR4 bind to lipid and LPS of microbes, respectively, and consequently activate downstream cytoplasmic molecules such as the myeloid differentiation factor 88 (MyD88) (Yang et al., 2005). Recent studies have confirmed the direct interaction between HMGB1 and TLR2 or TLR4, consistent with the former opinion that HMGB1 is also a ligand of TLR2 and TLR4 (Park et al., 2006). HMGB1 also stimulates the MyD88 pathway, in a mechanism that mimics the innate immune activation by LPS (Yu et al., 2006). Interestingly, Yu et al. also reported that HMGB1 preferably binds TLR4 in primary macrophage cells in contrast to its higher usage of TLR2 in the established human embryonic kidney
293 and mouse macrophage-like RAW 264.7 cell lines, indicating that further investigations on the different roles of HMGB1 through TLR receptors are necessary (Yu et al., 2006). Nowadays, researchers are searching for other potential receptors of HMGB1. For example, Rauvala et al. have identified the receptor-type tyrosine phosphataseβ/ζ, a transmembrane protein mediating migration of bone cells, as another receptor for HMGB1 (Rauvala et al., 2000;
Harris and Raucci, 2006).
1.5.3 HMGB1 as a Cytokine
In 1999, Wang’s group reported the pro-inflammatory cytokine function of
HMGB1 in an endotoxemia mice model and proposed that HMGB1 is a potential late mediator in inflammation (Wang et al., 1999a). In this report, they observed that in cultured RAW 264.7 cells, HMGB1 was released 6－8 hours after the addition of the bacterial endotoxin LPS. In the mouse model, serum HMGB1 was identified at 8 hours and maintains at the peak level between 16 to 32 hours after
25 Chapter 1
LPS administration. HMGB1 release from RAW 264.7 cells was also detected after stimulation with the early acute cytokines TNF or IL-1. In addition, lethality of mice after the injection of HMGB1 revealed that HMGB-1 itself is also toxic to the mouse. Based on the late release of HMGB1 compared to the early cytokines,
Wang et al. speculated that in most inflammatory conditions, the release of
HMGB1 might be induced by the release of the early acute cytokines but not LPS directly. They also suggested the potential mediating role of HMGB1 in other inflammatory diseases such as rheumatoid arthritis and the inflammatory bowel disease (Wang et al., 1999a).
From then on, a growing number of studies have demonstrated the cytokine activity of HMGB1 in a variety of cell types, including the macrophages, monocytes, neutrophils, endothelial cells, dendritic cells and smooth muscle cells, as well as in diverse tissues such as the brain, the lung, the gastrointestinal tract, the joints and the heart (Yang et al., 2005). Through interaction with its receptor on the target cell, HMGB1 triggers the RAGE and TLR pathways, the release of other inflammatory cytokines, such as interferon gamma from NK cells, IL-12 from dendritic cells, functional Th1 polarization of T cells, and consequently a series of immune responses leading to inflammation and even death (DeMarco et al., 2005; Dumitriu et al., 2005).
Several independent studies showed that the molecular basis for the cytokine function of HMGB1 is in its HMG-B box. Sappington et al. observed that either the HMG-B box or the full-length HMGB1 protein can impair the gut barrier function of wild-type mice (Sappington et al., 2002). Treutiger et al. also reported that the recombinant HMG-B box of the human HMGB1 protein could activate the
HUVEC cells in the same way as the full-length HMGB1 protein (Treutiger et al.,
26 Chapter 1
2003). Truncation studies have revealed that a 20 amino acids long fragment of the
HMG-B box (residues 89-108) is responsible for inducing the release of TNF from macrophages (Li et al., 2003).
1.5.4 HMGB1 in Inflammation and Sepsis
Consistent with the role of HMGB1 as a late cytokine, extracellular HMGB1 has been found to be present in a variety of inflammation and sepsis. It plays a pathogenic role in various chronic inflammatory diseases. For example, higher
HMGB1 levels were detected in the synovial fluid from human rheumatoid arthritis patients and in the experimental collagen-induced rat arthritis model
(Taniguchi et al., 2003; Andersson and Erlandsson-Harris, 2004). Extranuclear
HMGB1 was also detected in muscle biopsies from chronic myositis patients
(Ulfgren et al., 2004). Higher levels of HMGB1 and RAGE were also found in the ileal mucosa of the intestinal injury rat model, indicating the association between
HMGB1 and chronic intestinal inflammation (Zamora et al., 2005). In addition,
HMGB1 plays an important role in sepsis, severe sepsis and septic shocks caused by injury or infection. Increased expression levels of HMGB1 were detected in the liver and lung of the thermal injury (burn) rat model as well as in the liver injury mouse model (Sass et al., 2002; Fang et al., 2002). It was also reported that the serum HMGB1 level of the mouse sepsis model is higher than that of healthy controls (Yang et al., 2004). In clinical conditions, although no correlation between the HMGB1 concentration in serum and the severity of infection has been established, higher concentrations of HMGB1 with delayed kinetics were reported in sera of patients with severe sepsis and septic shock (Sunden-Cullberg et al.,
1999).
27 Chapter 1
Figure 1.10 HMGB1 Inhibitors as Potential Therapeutics in the Treatment of Sepsis.
Bacterial toxins (i.e., LPS, toxic shock syndrome toxin 1 (TSST-1)) activate macrophages to release proinflammatory cytokines including HMGB1. Small amounts of cytokine are beneficial to the host by enhancing the innate-immune response to pathogens and leading to recovery from infection. Large amounts of proinflammatory cytokine (i.e., HMGB1) are toxic and could cause tissue damage, septic shock, and death. Anti-HMGB1 polyclonal or monoclonal antibodies, inhibitors (e.g., ethyl pyruvate) or antagonist (e.g., A box), protect against sepsis lethality, even when the first dose of treatment was given at 24 h after cecal perforation. Therefore, anti-HMGB1 treatment may have therapeutic potential in treatment of sepsis and gives a wider window for the treatment opportunity. (Figure adopted from Yang, et al., 2005).
According to its proinflammatory cytokine role in cultured cells, animal models and human diseases, HMGB1 is considered to be a potential target for clinical therapy. Because of their release at the very early stage, early inflammatory mediators such as TNF and IL-1βhave limited therapeutic efficacy as targets in emergency clinical applications. However, this problem could be solved by targeting HMGB1 instead since it is released late (Wang et al., 2004b).
In Figure 1.10, potential clinical applications using HMGB1 inbibitors such as
28 Chapter 1 antibodies, antagonists and chemical reagents, in inflammation and sepsis treatment are summarized (Yang et al., 2005). For example, rabbit polyclonal antiserum against recombinant HMGB-1 is capable of attenuating LPS-induced lethality in the mouse model (Wang et al., 1999a). Another example is that either using the HMGB1 A box peptide as an antagonist or using polyclonal antibodies against the HMGB1 B box could reduce the severity of experimental arthritis in mice and rats (Kokkola et al., 2003). HMGB1 antagonist treatment was effective in reducing sepsis lethality in the mouse peritonitis model even administered 24 hours after cecal injury (Yang et al., 2004). Recently, anti-HMGB1 monoclonal antibodies have been developed to attenuate organ damage in animal models (Qin et al., 2006). Moreover, inhibitors, such as ethyl pyruvate and acetylcholine, which prevent HMGB1 release from endotoxin-stimulated macrophages, have also been studied in both cultured cells and mouse model (Ulloa et al., 2002; Wang et al.,
2004a).
1.5.5 HMGB1 in Cell Proliferation and Migration
HMGB1 has been demonstrated to be involved in cell proliferation and migration processes such as neurite outgrowth and monocyte migration. In 1980s, a 30-kDa protein isolated from the rat brain was detected to be capable of stimulating neurite outgrowth in rat brain neurons and it was designated “P30”
(Rauvala and Pihlaskari, 1987; Rauvala et al., 1988). Later, P30 was confirmed to be identical to HMGB1 (Merenmies et al., 1991). HMGB1 also promotes the interaction between the Schwann cell and neurons in proliferating rat peripheral nerves (Daston and Ratner, 1991) and stimulates neurite outgrowth in explant-cultured cerebellar cells (Chou et al., 2001). After secretion form the cell,
HMGB1 binds to RAGE on the membrane of target cells and activates a series of
29 Chapter 1 downstream responses. In HMGB1/RAGE activated neurites, the Rho family small
GTPases Rac and Cdc42 have been discovered to act as members in the RAGE signaling pathway (Huttunen et al., 1999).
HMGB1 released from mononuclear cells could also induce monocytes to spread and migrate through the endothelium (Rouhiainen et al., 2004). Antibodies against RAGE or soluble RAGE (sRAGE) significantly inhibit this migration, which suggests that RAGE is the receptor for HMGB1 in this process. However, other molecules such as proteoglycans and sulfoglycolipids could also be potential
HMGB1 receptors in the transendothelial migration of monocytes (Rouhiainen et al., 2004).
1.5.6 HMGB1 in Cell Differentiation
In the early 1980s, HMGB1 was proposed to be a potential mediator in cell differentiation by several groups. Seyedin et al. reported that the levels of HMGB1 and HMGB2 were lowered in mouse neuroblastoma and friend erythroleukemia cells after differentiation (Seyedin et al., 1981). Tan et al. have also shown that murine teratocarcinoma-derived stem cells contained higher amounts of HMGB1 and HMGB2 than their differentiated counterparts (Tan et al., 1982). Moreover, in differentiating T-cells of different functional stages, fluctuating amounts of
HMGB1 were detected (Russanova and Ando, 1985). However, the actual role of
HMGB1 in cell differentiation had not been revealed in these experiments.
In the 1990s, Pontremoli’s group discovered that a new enhancer of human promyelocytic leukemia cell differentiation, the differentiation enhancing factor
(DEF) was secreted into the culture medium by hexamethylenebisacetamide
30 Chapter 1
(HMBA) induced MEL cells and they found that DEF is identical to amphoterin
(Sparatore et al., 1993; Melloni et al., 1995a and b). These results suggest that
HMGB1 is involved in cell differentiation through an extracellular pathway. It was observed that the release of HMGB1 from HMBA-stimulated MEL cells is positively or negatively affected by compounds that enhanced or inhibited cell calcium homoeostasis, respectively (Sparatore et al., 1996). Further studies demonstrated that the secretion of HMGB1 and its binding to the membrane of
MEL cells are necessary for the differentiation of MEL cells (Passalacqua et al.,
1997). HMGB1 interacts with RAGE to activate downstream pathways in some processes such as cytoskeletal reorganization and cell motility. However, in differentiating MEL cells, HMGB1 binds to a 65-kDa protein on the cell membrane instead of RAGE (Sparatore et al., 2002), but the identity of this protein has yet to be found.
HMGB1 also promotes erythroid maturation in erythropoiesis. The proliferation and enucleation of erythroid cells require erythroblast-macrophage and erythroblast-erythroblast interactions. In these processes, membrane-bound
HMGB1 was proposed to enhance the contact of these cells (Hanspal and Hanspal,
1994). In addition, extracellular HMGB1 has been reported to promote rat L6 myoblast differentiation through its interaction with RAGE via a
Cdc42-Rac-1-MAPK kinase 6-p38 MAPK pathway as shown in Figure 1.11 (Sorci et al., 2004; Riuzzi et al., 2006). Sorci et al. also speculated that the
HMGB1/RAGE pair might play a potential role in myogenesis and skeletal muscle regeneration-repair, although this pair of molecules is not vital to myogenic differentiation (Sorci et al., 2004).
31 Chapter 1
Figure 1.11 Schematic Representation of the Putative Mechanisms by Which Amphoterin Regulates Myogenic Differentiation via RAGE Engagement. Signals generated by amphoterin binding to RAGE converge on Cdc42-Rac-1 -MKK6-p38 MAPK to up-regulate myogenin and MHC expression, induce MCK in L6 myoblasts, and accelerate myotube formation (Figure adopted from Guglielmo et al., 2004).
1.5.7 HMGB1 in Tissue Repair
Based on its potent ability to induce cell proliferation, migration and differentiation, HMGB1 is considered to be a modulator of tissue repair. The higher synthesis rate of HMGB1 compared to the histones in regenerating rat liver cells after partial hepatectomy was observed in earlier studies (Kuehl, 1979). Later,
HMGB1 was proposed to promote the regeneration of the rat peripheral nerves
(Daston and Ratner, 1991). Consistently, higher HMGB1 mRNA level was detected in mouse cerebral cortex after experimental impact injury (Kobori et al.,
2002) and the important role of HMGB1 in peripheral nerve regeneration was later
32 Chapter 1 confirmed in the mouse model (Rong et al., 2004). When studying the myocardial infarction mouse model, Limana et al. observed that hearts of the HMGB1-treated mice recovered much better than those of control ones through the induction of cardiac C-kit+ cells to form new myocytes, suggesting the enhancing role of
HMGB1 in myocardial regeneration (Limana et al., 2005). Kalinina et al. proposed that the main role of HMGB1 in tissue repair after damage is to promote the migration of precursor cells to the damage sites and their differentiation into suitable mature cells (Kalinina et al., 2006).
1.5.8 HMGB1 in Cancer
Higher amounts of HMGB1 have been detected in many tumors compared to their normal origins, including breast cancers, cervical cancers, prostate cancers, gastric cancers, colorectal cancers, pancreatic cancers, thyroid cancers, hepatomas, lymphomas, melanomas and neuroblastic malignancies (Evans et al., 2004; Zeh and Lotze, 2005). In addition, higher HMGB1 levels are associated with transformation of normal cells and the cancer metastatic potential (Evans et al.,
2004). These evidences suggest that HMGB1 may play an important role in cancer metastasis; however, information is not enough for judging whether HMGB1 is metastasis-inducing or just metastasis-associated (Evans et al., 2004). Some studies revealed that HMGB1/RAGE is correlated with the progression of some cancers such as lung cancers in vivo (Huttunen et al., 2002). Since HMGB1 could be released extracellularly and is capable of promoting cell migration and proliferation through the RAGE pathway, it is possible that the release of HMGB1 might be associated with cancer progression, and HMGB1 might be a new potential target in cancer therapy.
33 Chapter 1
1.6 Outline of This Project
HMGB1 has dual roles as both a DNA binding factor in the cell and a signal molecule outside the cell. Its intracellular functions include the role of a transcription factor. Pevious studies showed that the HMGB1 protein could interact and cooperate with diverse transcription factors, including p53, p73, the
Rel /NF-κB family and the steroid hormone receptors. It is reasonable to expect that HMGB1 may affect the expression of genes that require these specific transcription factors. However, information on these genes and how HMGB1 regulates these genes is still limited.
This study is designed to investigate whether other genes are regulated by the
HMGB1 protein in the cell and how these genes are regulated by HMGB1. The objectives of this study are: (1) to find out the genes that are regulated by HMGB1 in the cell; (2) to classify these genes according to their functions; (3) to deduce the HMGB1-associated intracellular network; (4) to analyze the role of HMGB1 in regulation of these genes.
To achieve these objectives, the HMGB1 level in the MCF-7 breast cancer cell line was suppressed to establish an HMGB1-suppressed or down-regulated
MCF-7 cell line. The expression profile of this cell line was then compared with the control MCF-7 cell line using cDNA microarray and the differentially expressed genes were identified. These differentially expressed genes were classified into different groups according to their functions. The relationships among these differentially expressed genes were analyzed and HMGB1-associated networks were deduced. Finally, the role of HMGB1 on the promoters of three of these differentially expressed genes, namely p53, MDM2 and E2F1, were studied.
An anti-sense strategy was used to establish a stably HMGB1-suppressed
34 Chapter 1
MCF-7 cell line, which contains only half the HMGB1 level of the original cell line. The differentally expressed genes in these two cell lines were identified form the cDNA microarray data. A total of 96 genes were found to be down-regulated and 76 genes up-regulated in the HMGB1 down-regulated MCF-7 cells. These genes were classified into 11 functional groups and the differential expression level of selected genes was analyzed by real-time RT-PCR. In addition, HMGB1 was found to be associated with a p53-centered network containg 16 proteins, including MDM2 and E2F1 and the regulation of the MDM2 and E2F1 genes by
HMGB1 was confirmed using reporter gene constructs with the MDM2 and E2F1 promoters. HMGB1 is found to be an important regulatory factor in the p53-MDM2-E2F1 network.
This study has provided new information in the HMGB1-regulated genes and the molecular mechanisms of transcriptional regulation of these genes by HMGB1.
It has also allowed us to elucidate the HMGB1-associated intracellular networks.
35 Chapter 2
Chapter 2 Establishment of an HMGB1
Down-Regulated MCF-7 Cell line
2.1 Introduction
As a DNA-binding factor, HMGB1 has been identified to play an important role in transcriptional regulation during a variety of physiological processes such as development and metabolism. Calogero et al. reported that HMGB1 knockout mice died within 24 hours after birth because their glucose metabolism pathway was impaired. Even after the HMGB1−/− mice were rescued by glucose treatment, abnormal phenomena, such as arched backs, still occurred in the developmental process (Calogero et al., 1999). At the same time, it was found that the expression level of genes regulated by GR was lowered in the HMGB1−/− fibroblast cell lines derived from the mice. The HMGB1 knockout mouse model provided some information associated with HMGB1 deficiency, but the information available is still very limited. Many questions on the molecular mechanisms behind these phenomena remain unanswered. For example, what are the GR-regulated genes that are down regulated by HMGB1 deficiency? Will the deficiency of HMGB1 result in down-regulation and up-regulation of other genes in the cell? How does the HMGB1 protein regulate these genes? In order to find out answers to these questions, a comparison of the gene expression profiles between the cells with a normal HMGB1 level and cells with a down-regulated HMGB1 level will be performed.
36 Chapter 2
Figure 2.1 A Comparison of the Different Antisense Strategies.
While most of the conventional drugs bind to proteins, antisense molecules pair with their complementary target RNA. Antisense-oligonucleotides block translation of the mRNA or induce its degradation by RNase H, while ribozymes and DNA enzymes with catalytic activity cleave their target RNA. RNA interference approaches are performed with siRNA molecules that are bound by the RISC and induce degradation of the target mRNA. (Figure adopted from Kurreck, 2003).
To suppress the endogenous expression level of a specific gene, antisense oligonucleotides, ribozymes or RNA interference may be used (Kurreck, 2003;
Scherer and Rossi, 2003). The principles of these techniques are briefly described in Figure 2.1 (Kurreck, 2003). In the antisense strategy, the antisense oligonucleotide hybridizes to the mRNA to inhibit its translation or to promote its degradation by RNase H. In the ribozyme and RNA interference (RNAi) strategies, the target mRNA is degraded by the ribozyme itself and the RNA-induced
37 Chapter 2 silencing complex (RISC), respectively. Researchers have also found that the functional intermediate in RNAi response is the short (or small) interfering RNA
(siRNA), which could be produced from double-stranded RNA (dsRNA) or short hairpin RNA in vivo (Figure 2.2).
Figure 2.2 Gene Silencing by RNA Interference (RNAi). RNAi is triggered by siRNAs, which can be generated in three ways. (I)
Long double-stranded RNA molecules are processed into siRNA by the Dicer enzyme; (II) chemically synthesized or in vitro transcribed siRNA
duplexes can be transfected into cells; (III) the siRNA molecules can be generated in vivo from plasmids, retroviral vectors or adenoviruses. The siRNA is incorporated into the RISC and guides a nuclease to the target RNA. (Figure adopted from Kurreck, 2003).
In this project, both the RNAi and the antisense RNA strategies were applied to suppress the HMGB1 expression level in the MCF-7 cells. In the RNA
38 Chapter 2 interference method, an HMGB1 siRNA-coding plasmid was used. In the antisense RNA strategy, a plasmid expressing the anti-HMGB1 cDNA sequence was used. The HMGB1 siRNA-coding plasmid and the anti-HMGB1 plasmid were separately transfected into MCF-7 cells. In transient transfection, western blotting was used to examine the HMGB1 protein level in the MCF-7 cells 48 hours after transfection. In addition, stably-transfected MCF-7 cell lines, which were transfected with the two types of plasmids separately, were established by G418 selection. Western blotting was also used to check the HMGB1 level in the stably-transfected cells. Finally, a stable HMGB1 down-regulated MCF-7 cell line was established and used in subsequent studies.
2.2 Materials and Methodologies
2.2.1 Materials
Rapid Plasmid Miniprep System was purchased from Marligen Biosciences,
Inc. QIAprep Spin Miniprep Kit, RNeasy Mini Kit and QIAshredder (mini spin column) were purchased from Qiagen. Aurum Total RNA Mini Kit was purchased from Bio-Rad Laboratories, Inc. Wizard® Genomic DNA Purification Kit was purchased from Promega. IMG-800 kit was purchased from Imgenex.
Restriction enzymes were purchased from Amersham Biosciences or
Promega. T4 DNA ligase, RQ1 RNase-Free Dnase, loading buffer and DNA ladders were purchased from Promega. iScript cDNA Synthesis Kit and iQ SYBR
Green Supermix were purchased from Bio-Rad Laboratories, Inc.
LipofectamineTM 2000 was purchased from Invitrogen. Cell Lysis Buffer was purchased from Cell Signaling Technology. Anti-HMGB1 antibody (mouse, monoclonal), anti-beta actin antibody (mouse, monoclonal), and goat anti-mouse
IgG (H+L) (Horseradish Peroxidase (HRP) Conjugated) were purchased from
39 Chapter 2
Stressgen, Abcam and Zymed Laboratories, Inc. respectively. HybondTM-P hydrophobic polyvinylidene difluoride (PVDF) transfer membrane (0.45-µm pore size) was purchased from Amersham Biosciences. Low Molecular Weight Protein
Standards and prestained SDS-PAGE Standards (low range), Quick Start Bradford
Protein Assay Kit, filter papers and Blotting Grade Blocker non-fat dry milk were purchased from Bio-Rad Laboratories, Inc. SuperSignal® West Pico chemiluminescent substrate was purchased from Perbio Science Company.
Dulbecco's Modified Eagle Medium (DMEM) (1×) (liquid, high glucose, with 4,500 mg/L D-glucose, L-glutamine, and 25 mM HEPES buffer, but without sodium pyruvate), Opti-MEM® I Reduced Serum Medium (1×) (liquid, with
HEPES buffer, sodium bicarbonate, hypoxanthine, thymidine, sodium pyruvate,
L-glutamine, trace elements, growth factors, and phenol red), Fetal Bovine Serum
(FBS) (US, Certified), Penicillin-Streptomycin (liquid, with 10,000 units of penicillin (base) and 10,000 µg of streptomycin (base)/mL) and Trypsin-EDTA
(0.05%) were purchased from Invitrogen. DMEM (1×) (liquid, high glucose, with
L-Glutamine, Sodium Pyruvate) and FBS (Research Grade-EU approved) were also purchased from Perbio Science Company. Antibiotics G418 (sulfate solution, aseptically filtered) was purchased from Promega.
Cell culture flasks (25 cm2 and 75 cm2), tissue culture dishes (35 mm) and cell culture plates (6-well, 12-well, 24-well and 96-well) were purchased from
NUNC or IWAKI. Sterile centrifuge tubes (15 mL and 50 mL) were purchased from IWAKI.
2.2.2 Cell Line
The cell line MCF-7 was purchased from American Type Culture Collection
(ATCC). MCF-7 is a Homo sapiens (human) breast epithelial adenocarcinoma cell
40 Chapter 2 line, which was established from the pleural effusion of a 69-year-old Caucasian female. Photos and detailed information of the MCF-7 cells are indicated in
Appendix I.
2.2.3 Plasmid Preparation
2.2.3.1 Preparation of Escherichia coli (E. coli) Competent Cells
A single bacterial colony (E. coli of DH5α or JM109 strain) was inoculated into 1.5 mL of Luria Bertani (LB) medium. The cells were cultured in a shaker incubator at 37℃, 250 RPM overnight. Then 250 µL of the overnight culture was inoculated into 25 mL of LB medium and incubated at 37℃ for about 3 hours until they reached an optical density (OD) at 600 nm of about 0.4 (1 cm pathlength). The culture was transferred into a 50 mL centrifuge tube and centrifuged at 4,000 RPM at 4℃ for 10 minutes. After centrifugation, the supernatant was discarded and the cell pellets were gently resuspended on ice in 15 mL of a pre-chilled solution of 20 mM CaCl2 and 80 mM MgCl2. Then the cell suspension was centrifuged at 4,000 RPM at 4℃ for 10 minutes. The pellet was then resuspended in 1.5 mL of prechilled 100 mM CaCl2 solution. The suspension was chilled on ice for at least 15 minutes and then aliquoted (200 µL each) into chilled microcentrifuge tubes. For later use, sterile glycerol was added to the competent cell suspension to a final concentration of 15% (V/V) and the competent cell aliquots were stored at –80℃.
2.2.3.2 DNA Ligation
The general condition for cohesive end ligation of foreign DNA into a linearized vector was as follow. 50–100ng of vector DNA, insert DNA (equimolar
41 Chapter 2 or 2 or 3 × molar concentration of vector), 10 × ligation buffer, 1 unit of T4 DNA ligase (Promega), distilled water were added into a sterile microcentrifuge tube to a final volume of 10 µL to 20 µL. The mixture was incubated at 4℃ overnight.
5–10 µL of the ligation mixture was used to transform the E. coli competent cells.
2.2.3.3 Chemical Transformation of Plasmid into E. coli
Competent Cells
The frozen competent cells were thawed on ice for 10–15 minutes. Then the plasmid DNA or the ligation mixture was added into the cells, gently mixed by pipette tips and incubated on ice for 45–60 minutes. The cells were then heat shocked at 42℃ for 90 seconds and chilled on ice for 2–3 minutes. 500–800 µL of
LB medium was added into the cells and the cells were incubated at 37℃, 250
RPM for 45–60 minutes. Appropriate volumes of transformed cells were spread onto LB agar plates containing the appropriate antibiotics and cultured at
37℃ overnight until single colonies were formed.
2.2.3.4 Isolation of Plasmid DNA
Plasmid DNA was prepared by the Rapid Plasmid Miniprep System
(Marligen Biosciences) or QIAprep Spin Miniprep Kit (Qiagen) according to the manufacturers’ instructions. The procedures for using the Rapid Plasmid Miniprep
System are described below. A single bacterial colony was inoculated into LB medium containing the appropriate antibiotic and incubated at 37℃, 250 RPM for
16–20 hours. The bacterial cells were collected by centrifugation at 8,000 g for 5 minutes. After the pellet was resuspended in 250 µL of G1 Buffer (50 mM
Tris-HCl (pH 8.0) and 10 mM EDTA), 250 µL of G2 solution (200 mM NaOH
42 Chapter 2 and 1% SDS (W/V)) was added into the tube. The tube was inverted five times to mix the solution and incubated at room temperature (RT) for 5 minutes. 350 µL of
G3 buffer (Contains acetate and guanidine hydrochloride, detailed formulation not provided by the manufacturer) was added to neutralize the mixture and the tube was inverted five times. Then the tube was centrifuged at 12,000 g for 10 minutes.
The supernatant was transferred to the spin column and centrifuged at 12,000 g for
1 minute. 500 µL of GX buffer (Contains acetate, guanidine hydrochloride, EDTA and ethanol, detailed formulation not provided by the manufacturer) was added into the column. Then the column was incubated at RT for 1 minute and centrifuged at 12,000 g for 1 minute to wash the column. 700 µL of G4 buffer
(Contains NaCl, EDTA and Tris-HCl (pH 8.0), detailed formulation not provided by the manufacturer) was added into the column followed by centrifugation at
12,000 g for 1 minute to wash the column again. Then the column was centrifuged at 12,000 g for 2 minutes and transferred into a new 1.5 mL microcentrifuge tube.
50–70 µL of pre-warmed TE buffer (10 mM Tris-HCl (pH 8.0) and 0.1 mM EDTA) was added into the column and incubated at RT for 2 minutes. Finally, the plasmid
DNA was eluted by centrifugation at 12,000 g for 2 minutes.
2.2.3.5 Quantification of DNA and RNA
The concentration of DNA or RNA was determined by a spectrophotometer
(GeneQuant, Amersham-Pharmacia). An OD at 260 nm of 1 was considered approximately 50 µg/mL of double-stranded DNA or 40 µg/mL of RNA. The purity of DNA or RNA was determined by the ratio of the absorbance at 260 nm and 280 nm. The OD260/OD280 ratio of pure DNA and RNA are 1.8 and 2.0, respectively. When the DNA or RNA was diluted, the final concentration of the
DNA or RNA was calculated by multiplying with the dilution factor. DNA was
43 Chapter 2 stored at –20℃ and RNA was stored at –80℃ for later use.
2.2.3.6 Restriction Endonuclease Digestion of DNA
Restriction endonuclease digestion of DNA was carried out according to the manufacturers’ instructions. In brief, appropriate amounts of 10 × Buffer, distilled water, DNA and restriction enzymes were added into a sterile microcentrifuge tube to a final volume of 10 µL to 20 µL. Then the mixture was incubated at 37℃ for at least one hour. After incubation, the mixture was analyzed by agarose gel electrophoresis.
2.2.3.7 Agarose Gel Electrophoresis
0.8 to 2% agarose (W/V) was dissolved in 0.5 × TBE (44.5 mM Tris base,
44.5 mM boric acid and 1 mM EDTA) by boiling and ethidium bromide was added into the cooled gel solution to a final concentration of 0.5 µg/mL. The gel solution was poured onto the gel plate and the comb was inserted immediately. When the gel was set, it was placed into the electrophoresis tank and immersed in 0.5 × TBE.
The DNA samples were mixed with 6 × loading buffer (Promega) to a 1 × final concentration, loaded alongside the DNA ladder (Promega) into slots of the gel and run at a voltage of about 8 V/cm. After bromophenol blue had migrated for an appropriate distance, the gel was observed under ultraviolet (UV) and images were taken by Lumi-Imager (Roche).
2.2.4 Plasmid Construction
2.2.4.1 Design of Human HMGB1-specific siRNA
The human HMGB1-specific siRNA was designed according to the manufacturer’s guidelines (Imgenex). The strategy was to express siRNAs in vivo
44 Chapter 2 from short hairpin structures (Figure 2.3). According to the guidelines, a pair of oligonucleotides targeting the human HMGB1 mRNA was designed as follow:
F1 5’- tcgaaaggcccgttatgaaagagagagtactgtctctttcataacgggccttttttt -3’ and R1 5’- ctagaaaaaaaggcccgttatgaaagagacagtactctctctttcataacgggcctt -3’. The targeting sequence is 5’-aaggcccgttatgaaagaga -3’, the 202–221 base of the HMGB1 cDNA.
The oligonucleotide F1 could form a hairpin structure with a 7-nucleotide spacer loop.
Figure 2.3 Schematic Diagram Showing Design of Oligonucleotide for Generation of Hairpin RNA in the Cell. The spacer sequence may range from 4-10 nucleotides (Figure adopted from Imgenex).
Xho I Sense Sca I Antisense
F1 5’-tcgaAAGGCCCGTTATGAAAGAGAgagtactgTCTCTTTCATAACGGGCCTTttttt-3’ R1 3’- TTCCGGGCAATACTTTCTCTctcatgacAGAGAAGTATTGCCCGGAAaaaaagatc-5’ Xba I
Figure 2.4 The Double-stranded Oligonucleotide Used to Create the HMGB1-specific siRNA Construct.
The Xho I and Xba I overhang sites are underlined. The nucleotides in the loop structure are in italics. HMGB1 specific sequences (sense and antisense) are in capitals. A Sca I site, AGTACT was incorporated in the stem loop sequence for easy identification of the insert. Digestion with Sca I will linearize the vector, which will run as a band at approximately 3.4 kb. As shown in this figure, the two oligonucleotide primers contain Xho I and Xba I overhangs respectively. The pSuppressor vector DNA was linearized with Sal I and Xba I. The Xho I restriction site is compatible with the Sal I site and allows cloning into the Sal I site. However, after cloning into the Sal I site, both the Sal I and Xho I sites will be lost.
45 Chapter 2
2.2.4.2 Annealing of Complementary Oligonucleotides (siRNA
Insert)
According to the manufacturer’s instructions (Imgenex), 1 µg of oligonucleotide F1, 1 µg of oligonucleotide R1, 2 µL of annealing buffer and distilled water were added into a sterile microcentrifuge tube to a final volume of
20 µL. The mixture was incubated at 95℃ for 10 minutes and then gradually cooled down to RT. The annealed siRNA insert was used immediately or stored at
–20℃ for later use.
2.2.4.3 Construction of siRNA-coding Plasmid
50 ng of linearized vector, 100 ng of annealed siRNA insert DNA, 1 µL of 10
× ligation buffer, 1 unit of T4 DNA ligase (Promega) and distilled water were added into a sterile microcentrifuge tube to a final volume of 10 µL. A negative control ligation mixture containing distilled water instead of the DNA insert was prepared at the same time. The mixtures were incubated at 4℃ overnight.
Following the ligation reaction, 10 µL of the ligation mixture was added into E. coli competent cells. Transformation was performed as described in Section
2.2.3.3. The transformed E. coli cells were spread onto LB agar plates containing
50 µg/mL of kanamycin and cultured at 37℃ overnight.
A single bacterial colony from the plate was inoculated into 5 mL of LB medium and incubated at 37℃, 250 RPM overnight. Plasmid DNA was extracted and concentration was determined by spectrophotometer. After digestion with appropriate enzymes, the constructed plasmids were screened by gel electrophoresis. Then the selected plasmid was sequenced to check whether the inserted fragment was identical to the designed one. The recombinant plasmid was
46 Chapter 2 named PI-1.
2.2.4.4 Description of Plasmids
Four types of plasmids were used in this chapter, namely pNCP, PI-1, pAshmg1 and pcDNA3. PI-1 is the siRNA-coding anti-HMGB1 plasmid constructed by ligation of siRNA insert and linearized pSuppressorNeo plasmid. pNCP is purchased from the Imgenex Company, used as the negative control plasmid of PI-1. The plasmids pAshmg1 containing antisense sequence to the human HMGB1 cDNA (4-648bp) and pcDNA3 were gifts from Dr. A.K.
Bosserhoff (Poser et al., 2003). These four plasmids are listed in Table 2.1 and their maps are shown in Appendix III.
Table 2.1 Plasmids Used in Chapter 2
Name Origins Purpose
IMG-800-6, called Negative control plasmid of pNCP in this Imgenex Company PI-1 chapter siRNA-coding anti-HMGB1 PI-1 Construction plasmid
A gift from Prof. Dr. pAshmg1 Anti-HMGB1 plasmid A.K. Bosserhoff
A gift from Prof. Dr. Negative control plasmid of pcDNA3 A.K. Bosserhoff pAshmg1
2.2.5 Cell Culture
MCF-7 Cells were incubated in DMEM (Invitrogen) with 10% fetal calf
47 Chapter 2 serum (FBS, Invitrogen), 100 units/mL penicillin and 100 µg/mL streptomycin
(Invitrogen) at 37℃ in 5% CO2, 80% humidity condition. Cells were continuously cultured and splitted every 3 to 4 days as follow. Firstly, the culture medium was removed and discarded. The cell layer was then briefly rinsed with PBS buffer. 0.5 mL of Trypsin-EDTA solution was added into the 25-cm2 flask and cells were observed under an inverted microscope until the cell layer was dispersed. 1-2 mL of complete growth medium was added to the flask and cells were dispersed by pipetting up and down gently. Then appropriate aliquots of the cell suspension were transferred into new culture flasks and incubated at 37℃, 5% CO2. The subculturing ratio of MCF-7 cells was 1:3 to 1:6.
2.2.6 Transfection of DNA
The following procedure was for transfection in a 12-well format cell culture plate and all amounts given were on a per well basis. The amounts for other formats of cell culture plate were adjusted accordingly and shown in Table 2.4.
One day before transfection, cells were trypsinized, transferred into 15 mL centrifuge tube and collected by centrifugation at 800 RPM for 5 minutes. Then cells were resuspended in DMEM 10% FBS media. 40 µL of cells were stained by adding 1/4 volume of 0.4% trypan blue for 5–10 minutes. Then the concentration and the ratio of the living cells were determined with the hemocytometer
(Marienfeld Laboratory Glassware) (After staining, living cells were transparent while dead cells were blue). 3–5 × 105 cells were plated in 1 mL of DMEM 10%
FBS media without antibiotics in a 12-well plate and incubated at 37℃, 5% CO2 till about 70–90% confluence at the time of transfection.
48 Chapter 2
Table 2.2 Amount of Plasmid DNA Used in Transient Transfection in a 12-well Plate
Transient Functional Control Plasmid Transfection Plasmid Antisense pAshmg1, 1.6 µg pcDNA3, 1.6 µg
siRNA PI-1, 1.6 µg PNCP, 1.6 µg
Table 2.3 Amount of Plasmid DNA Used in Stable Transfection in a 6-well Plate
Stable Functional Plasmid Control Plasmid Control Wells Transfection
pAshmg1, 3.2 µg Antisense pcDNA3, 0.8 µg + pcDNA3, 0.8 µg Cells without Plasmid siRNA PI-1, 4 µg pNCP, 4 µg
Table 2.4 Amount of Plasmid DNA and Reagents Used in Different Plate Formats (Table adopted from Invitrogen)
Relative Vol. of DNA(µg) LipofectamineTM Transfection Culture Surf. Area Plating in Media 2000 (µL) in Medium Vessel vs. 1 Medium Vol. (µL) Media Vol.(µL) Vol. 24-well 96-well 0.15 125 µL 0.2; 25 0.5; 25 50 µL 24-well 1 500 µL 0.8; 50 2; 50 100 µL 12-well 2 1 mL 1.6; 100 4; 100 200 µL 6-well 5 2 mL 4; 250 10; 250 500 µL 35-mm 5 2 mL 4; 250 10; 250 500 µL 1: Surface areas may vary depending on the manufacturer.
49 Chapter 2
For each transfection sample, the amount of DNA mixtures was prepared as shown in Table 2.2 and 2.3. The plasmid DNA mixture was diluted in 100 µL of
Opti-MEM® I Reduced Serum Medium and mixed gently by pipetting. Then
LipofectamineTM2000 was mixed gently before use and 4 µL of
LipofectamineTM2000 was diluted in100 µL of Opti-MEM® I Medium. The diluted
LipofectamineTM2000 was incubated at RT for about 7 minutes. After incubation, the diluted DNA was combined with the diluted LipofectamineTM2000, mixed gently and incubated at RT for 25 minutes. After incubation, the about 200 µL of the complexes were added into each well containing cells and medium. The complexes were mixed in the well by gently rocking the plate back and forth. Then the cells were incubated at 37℃ in 5% CO2 for 48 hours for assay or for selection of stable cell line.
2.2.7 Establishment of Stable Cell Lines
2.2.7.1 Killing Curve Experiment
To determine the appropriate concentration of antibiotic for selection of stable cell line, killing curve experiment were performed as follow. 1,000 cells were plated into each well of a 6-well dish containing 2 mL culture medium with
100–1,100 µg/mL G418 (Promega) and then cultured for 10–14 days. The plates were examined for viable cells every 2 days. At the end of the selection, the wells were washed with PBS twice and stained with 2% methylene blue in 50% ethanol.
The blue spots of each well were counted under an inverted microscope. The lowest G418 concentration at which massive cell death appeared in approximately
7–9 days and all cells were dead within 2 weeks was identified. This was the G418 concentration with which cells were selected after transfection.
50 Chapter 2
2.2.7.2 Selection of Stable Cell Lines
48 hours after transfection, DMEM 10% FBS media with the appropriate concentration of G418 was added into the wells to select for stable cell lines. The selection medium was changed every 3 to 4 days till cell colonies were visible in the well whereas all the cells in the control wells (containing no plasmid) were dead. Then the cells were trypisinized and transferred into a new well or flask to continue culturing.
2.2.8 Detection of HMGB1 Protein Level by Western Blotting
2.2.8.1 Protein Extraction from Cultured Cells
48 hours after transfection, the medium was removed from the wells and PBS buffer was used to wash the wells to remove residual medium. Then cells were trypisinized and incubated at 37℃ for 5–15 minutes until most of the cells had detached from the bottom of the well. Medium was added into each well to stop trypsinization. Cells were transferred into 1.5 mL sterile microcentrifuge tubes and collected by centrifugation at 4℃, 800–1000 RPM for 5 minutes. The pellets were washed with pre-cooled PBS twice. Then 1 × lysis buffer (Cell Signaling) containing 1mM PMSF was added into each tube and pipetted up and down several times. Then the cells were incubated on ice for 10 minute and centrifuged at 4℃ 12,000 g for 10 minutes. The supernatant was transferred into a sterile microcentrifuge tube and stored at –80℃ for later use.
2.2.8.2 Determination of Protein Concentration
Protein concentrations were determined by Bradford Assay using the Quick
Start Bradford Protein Assay Kit according to the manufacturer’s instructions.
51 Chapter 2
Normally, samples were assayed in duplicates. Bovine serum albumin (BSA) protein solutions of known concentrations were used as standards. Standards and samples were pipetted separately into 96-well microplate wells. Dye reagent was added to the wells and mixed gently. Then the plate was incubated at RT for at least 5 minutes and OD of each well was measured at 595 nm by a microplate reader (Bio-Rad). A standard curve was generated by plotting the OD595nm values
(y-axis) versus their respective concentrations in mg/mL (x-axis). The sample concentrations were then calculated using the standard curve. For diluted samples, the final concentrations of the samples were adjusted by multiplying with the dilution factors.
2.2.8.3 SDS-PAGE
SDS-PAGE was performed using the Mini-PROTEAN 3 System (Bio–Rad).
The glass plates and spacers (0.75 mm thick) were assembled and polyacrylamide gel was prepared as follow. The separating gel was added till about 1 cm below the comb (~3 mL) and sealed with about 0.5 mL distilled water. When the separating gel was set, water was poured off and the gel was rinsed with distilled water to remove the residual solution. Then the stacking gel (~1.5 mL) was poured and the comb was inserted immediately. When the stacking gel was set, the gel was assembled in gel frame and placed in running buffer (0.025 M Tris [pH 8.3], 0.192
M Glycine, 0.1% SDS). 15 µg of cell lysate was used as sample. The samples was mixed with 5 × loading dye and boiled for 5–10 minutes. After brief centrifugation, the samples and 5 µL of pre-stained SDS-PAGE standards (Bio-Rad) were separately loaded into the wells. The voltages were 100 V in the stacking gel for
52 Chapter 2 about 20 minutes and 200 V in the separating gel for a further 50–60 minutes. The components of the gels were listed in Table 2.5.
Table 2.5 Components of the Separating and Stacking Gels
Separating Stacking Component Gel Gel Distilled water 1.34 mL 1.22 mL Tris·Cl(1.5 M, pH 8.8 for separating gel; 1 mL 500 mL 0.5 M, pH 6.8 for stacking gel)
10% SDS 40 µL 20 µL 36.5:1 acrylamide/bisacrylamide (30%, W/V) 1.6 mL 260 µL 10% APS (ammonium persulfate) 24 µL 10 µL
TEMED (N, N, N´N´, -tetramethyl-ethylenediamine) 4µL 2 µL Total 4 mL 2 mL
2.2.8.4 Western Blotting
A piece of PVDF membrane (Amersham) was wet completely in methanol and then soaked in 1 × Blotting buffer before use. The filter papers (Bio-Rad) and the gel were also soaked in 1 × Blotting buffer at 4℃ for about 15 minutes. Then the sandwich was set up in the following sequence: filter paper - gel - membrane - filter paper and placed onto the Trans-Blot® SD Semi-Dry Electrophoretic
Transfer Cell (Bio-Rad). Blotting was performed at 15 V for about 30 minutes.
TTBS (TBS with 0.05% Tween 20) was prepared and mixed thoroughly before use.
When blotting was finished, membrane was immersed in blocking buffer (TTBS containing 5% non-fat milk) on a rocking platform at 4℃ overnight or at RT for at least 2 hours. Then the membrane was rinsed with TTBS twice and washed with
53 Chapter 2 rocking in TTBS at RT for 4 × 10 minutes.
2.2.8.5 Antibody Treatment and Detection
TTBS buffer containing 3% BSA was used to prepare all the antibodies. The final concentrations of the primary antibodies against HMGB1 (Stressgen) and
β-actin (Abcam) were 1 µg/mL and 0.4 µg/mL respectively. The final concentration of the secondary antibody, HRP-conjugated anti-mouse IgG (Zymed) was 0.2 µg/mL. The PVDF membrane was incubated with rocking in the primary antibody working solution at RT for at least 2 hours. Then the membrane was rinsed with TTBS twice and washed with rocking in TTBS at RT for 4 × 10 minutes. The next step was to incubate the PVDF membrane in the secondary antibody, with rocking on a rocker at RT for at least 1 hour. Then the membrane was rinsed with TTBS twice and washed in TTBS, with rocking at RT for 4 × 10 minutes. The signal was detected by SuperSignal® West Pico Chemiluminescent
Substrate (Pierce) working solution, which was prepared by mixing the Stable
Peroxide Solution and the Luminol/Enhancer Solution at a 1:1 (V/V) ratio. The membranes were then placed in the Lumi-Imager and chemiluminescence signals were detected. Data were analyzed with the software Lumi Analyst Version 3.10
(Roche). The signal of each band was quantified in Boehringer Light Unit (BLU), an absolute measurement unit expressing the area under the peak of each band.
Buffers used in SDS-PAGE and Western blotting were listed in Table 2.6.
54 Chapter 2
Table 2.6 Buffers Used in SDS-PAGE and Western Blotting
Buffer Component Storage Filtered and 30% Acrylamide 14.6 g, Bis 0.4 g, Water 50 mL stored at 4℃ Acrylamide/Bis in the dark Tris Base 27.23 g in distilled water ~80 mL; 1.5 M Tris-HCl, Adjust pH to 8.8 and make to 150 mL with 4℃ pH 8.8 distilled water
Tris base 6.0 g in fistilled water ~80 mL; 0.5 M Tris-HCl, Adjust to pH 6.8 and make to 100 mL with 4℃ pH 6.8 distilled water SDS Running 0.025 M Tris (pH 8.3), 0.192 M Glycine, RT Buffer 0.1% SDS 10×Blotting 0.25 M Tris (pH 8.3), 1.92M Glycine RT Buffer 200 mL Methanol, 100 mL 10x Blotting Freshly Blotting Buffer buffer, 700 mL distilled water (Total volume prepared 1L) TBS 50 mM Tris-HCl (pH 7.4), 0.15 M NaCl RT
Freshly TTBS TBS with 0.05% Tween 20 prepared Freshly Blocking Buffer 5% non-fat milk powder in TTBS prepared Buffer for Freshly 3% BSA in TTBS Antibodies prepared
2.2.9 Detection of the HMGB1 mRNA level by Real-time RT-PCR
2.2.9.1 Total RNA Isolation
Total RNA was isolated from cells using the AurumTM Total RNA Mini Kit
(Bio-Rad) or the RNeasy Mini Kit (Qiagen) according to the manufacturers’ instructions. The procedures for using the RNeasy Mini Kit are described below.
55 Chapter 2
Cells (no more than 1 ×107) were trypisinized, transferred into RNase-free microcentrifuge tubes and collected by centrifugation at 300 g for 5 minutes. The pellet was washed with pre-cooled PBS twice. Then 350 or 600 µL of lysis buffer
RLT containing 1/100 volume of β-mercaptoethanol (β-ME) was added into each tube and pipetted up and down several times. The lysate was transferred into a QIAshredder spin column and centrifuged at 13,000 g for 2 min. Then the homogenized lysate was mixed with 1 volume of 70% ethanol by pipetting up and down. The mixture was transferred into an RNeasy spin column and centrifuged for at 8,000 g for 1 minute. Then 700 µL of Buffer RW1 was used to wash the column by centrifugation at 8,000 g for 1 minute. Next, 500 µL of Buffer RPE was used to wash the column and centrifuged at 8,000 g for 1 minute. Then 500 µL of
Buffer RPE was used to wash the column again and centrifuged at 8,000 g for 2 minute. After the column was placed into a new 1.5 ml collection tube, 30–50 µL
RNase-free water was added onto the spin column membrane and centrifuged at
8,000 g for 1 minute to elute the RNA. The concentration and quality of RNA were analyzed using the spectrophotometer. RNA was stored at –80℃ for later use.
2.2.9.2 DNase Treatment
According to the manufacturer’s instruction (Promega), 2.5 µg of total RNA,
2.5 µL of 10 × reaction buffer (400mM Tris-HCl (pH 8.0), 100mM MgSO4 and
10mM CaCl2), 2.5 µL of RQ1 RNase-Free DNase and nuclease-free water were added into a sterile nuclease-free microfuge tube to a final volume of 25 µL. Then the mixture was incubated at 37℃ for 30-45 minutes. Finally, 2.5 µL of stop solution was added to terminate the reaction followed by incubating at 65℃ for
10 minutes to inactivate the DNase.
56 Chapter 2
2.2.9.3 Reverse Transcription
According to the instruction of the iScriptTM cDNA Synthesis Kit (Bio-Rad),
400 ng of DNase treated RNA was reverse transcribed into cDNA in 20-µL mixture containing 4 µL of 5 × iScript reaction mix, 1 µL of iScript reverse transcriptase and an appropriate amount of nuclease-free water. Then the reaction mixture was incubated at 25℃ for 5 minutes, 42℃ for 30 minutes and 85℃ for 5 minutes, followed by an optional hold at 4℃. For later use, it could be stored at
–80℃.
2.2.9.4 Real-time PCR
Each synthesized cDNA was diluted 1:20 (V/V) in distilled water. Each real-time PCR mixture contained 5 µL of the diluted cDNA, 12.5 µL of iQTM
SYBR® Green Supermix (Bio-Rad), an appropriate amount of the gene specific forward and reverse PCR primers and distilled water to a final volume of 25 µL.
The primers of the human HMGB1 gene were designed using the on-line software
Primer3 (Rozen and Skaletsky, 2000). The primers of the human β-actin gene were adopted from Abbott et al (Abbott et al, 2002). The sequences and concentrations of the primers for the human HMGB1 gene and β-actin gene are listed in Table
2.7. Table 2.7 Primers Used in Real-time PCR
Final Primer Target Gene Sequence Concentra Name tion (nM)
The human SF4 5’-GGGAGTTGTCAAGGCTGAAA-3’ 400 HMGB1 gene SR4 5’-AAAACTGCGCTAGAACCAAC-3’ 400
The human ActF 5’-AGTACTCCGTGTGGATCGGC-3’ 270 β-actin gene ActR 5’-GCTGATCCACATCTGCTGGA-3’ 270
57 Chapter 2
Real-time PCR reactions were carried out in the Smart Cycler® (Cepheid).
The PCR conditions were as follow: 5 minutes at 95℃ and then 45 cycles of 20 s at 94℃, 30 s at 59℃ and 30 s at 72℃. The melting curve detection procedure was performed at the end of the reaction. Each sample was assayed in duplicate.
Using the human beta-actin gene as the internal control, the relative expression level of the human HMGB1 gene was calculated using the 2-∆∆Ct method and normalized with beta-actin (Livak and Schmittgen, 2001). The threshold cycles (Ct) value is the cycle number at which the fluorescence intensity of the PCR product reaches the threshold. It represents the concentration of the specific template in the original PCR mixture. Half of the concentration of the primary template leads to one more Ct. The ∆∆Ct value is calculated by subtracting the difference between sample Cts of the control gene (∆Ctcontrol) from the difference between sample Cts of the target gene (∆Cttarget). The relative expression level of the target gene in sample A compared to that in sample B is given as:
∆∆Ct A to B = △Ct target –△Ct control
= (△Ct target A–△Ct target B) – (△Ct control A–△Ct control B).
2.2.10 Detection of Genomic Integration and Expression of
Plasmid pAshmg1 in the Transformed Cells
2.2.10.1 Genomic DNA Purification
Genomic DNA was purified by the Wizard® Genomic DNA Purification Kit
(Promega) according to the manufacturer’s instruction as follow. Firstly, cells from one 25-cm2 flask were trypsinized and collected by briefly centrifuging at 800
58 Chapter 2
RPM for 5 minutes. Then the cells were washed gently with PBS twice, transferred into a 1.5 mL microcentrifuge tube and pelleted by centrifugation at 800 RPM for
5 minutes. After the supernatant was discarded, cell pellets were resuspended by vigorous vortexing. Then 600µL of Nuclei Lysis Solution was added into the tube and pipetted up and down several times to lyse the cells till no visible cell clumps remained. Next, 3µL of RNase Solution was added into the nuclear lysate and mixed by inverting the tube for about 5 times. Then the mixture was incubated at
37℃ for about 30 minutes and cooled down to RT. The next step was to add
200µL of Protein Precipitation Solution to the mixture and to vigorously vortex for about 20 seconds. After chilling on ice for 5 minutes, the mixture was centrifuged at 13,000 g for 4 minutes to pellet the precipitated protein. The supernatant was transferred into a clean tube and mixed with 600µL of isopropanol by gently inverting for about 5 times till the white thread-like strands of DNA became visible. The DNA was pelleted by centrifugation at 13000 g for 1 minute. After the supernatant was gently decanted by hand, the white DNA sample was washed by
600µL of 70% ethanol and pelleted by centrifugation at 13000 g for 1 minute.
Then the ethanol was gently discarded using a pipette tip and the tube was dried in air for about 15 minutes. Finally, the DNA sample was dissolved in 100 µL of
DNA Rehydration Solution by incubating at 65℃ for 1 hour or at 4℃ overnight.
The quality and concentration of the genomic DNA were determined by spectrophotometer and the genomic DNA was stored at 4℃ for later use.
2.2.10.2 Detection for Genomic Integration of the Plasmid pAshmg1
To check whether the plasmid pAshmg1 was integrated into the genome of the stably-transfected MCF-7 cell lines, genomic DNA was extracted from these
59 Chapter 2 cell lines and used as templates in PCR. Each PCR mixture included 5 ng of the genomic DNA, 5 µL of 2 × PCR Master Mix (Promega), 0.5 µL of forward primer
GasF (10 µM), 0.5 µL of reverse primer GasR primer (10 µM) and an appropriate amount of distilled water to a final volume of 10 µL. 10 fg of the pAshmg1 plasmid and an appropriate amount of distilled water were used as templates of the positive and the negative controls separately. The PCR reaction conditions were as follow: 10 minutes at 95℃ and then 35 cycles of 1 minutes at 94℃, 1 minute at
55℃ and 1 minute at 72℃, followed by 5 minutes at 72℃. The sequence of the primers and the size of the PCR product were listed in Table 2.8.
Table 2.8 Primers Used in Normal PCR Purpose Primer Sequence Expected Size of Name PCR Products
Integration GasR 5’-TATTGCTGCATATCGAG 361 bp of pAshmg1 CTAAAGG-3’ GasF 5’-ACGGTGGGAGGTCTATA TAAGCAG-3’ Expression pAshmg1 5’-CGAGAAGCTTCACCAT 695 bp
of pAshmg1 _cDNA_F GGAC-3’ pAshmg1 5’-TTCGGCAAAGGAGATC _cDNA_R CTAA-3’
2.2.10.3 Detection for the Expression of Integrated pAshmg1
To investigate whether the inserted pAshmg1 was successfully transcribed into mRNA in the stably-transfected cell lines, 5 µL of the diluted cDNA was used as template in a 25 µL PCR reaction. Each PCR mixture contained 5 µL of the diluted cDNA, 12.5 µL of 2 × PCR Master Mix (Bio-Rad), 1 µL of forward primer
60 Chapter 2 pAshmg1_cDNA_F (10 µM), 1 µL of reverse primer pAshmg1_cDNA_R primer
(10 µM) and distilled water to a final volume of 25 µL. 10 fg of the pAshmg1 plasmid, 100 fg of the pAshmg1 plasmid and an appropriate amount of distilled water were used as templates of the positive and the negative controls separately.
The PCR reaction conditions were as follow: 5 minutes at 94℃ and then 30 cycles of 30 sec at 94℃, 30 sec at 55℃ and 1minute at 72℃, followed by 7 minutes at
72℃. The sequence of the primers and the size of the PCR product were listed in
Table 2.8.
2.3 Results
Western blotting used to detect the HMGB1 level revealed that in transient transfection assays, the HMGB1 protein level in cells transfected with either PI-1
(the HMGB1-targeting siRNA inserted plasmid) or pAshmg1 (the anti-HMGB1 antisense plasmid) was lower than that in the corresponding control cells. These results demonstrated that the introduction of both PI-1 and pAshmg1 into the
MCF-7 cells could suppress the expression of HMGB1 within 48 hours after transfection.
To study the long-lasting effect of a lower HMGB1 level in the MCF-7 cells, stable MCF-7 cell lines transfected with either the PI-1 or pAshmg1 plasmid were established by G418 selection. Western blotting was also used to examine the
HMGB1 level in the stably-transfected cells. The HMGB1 level in one stable pAshmg1 transfected MCF-7 cell line (designated “Ashmg1/E”) was found to be about half of the corresponding control cell line (designated “cDNA3/F”). By
61 Chapter 2 contrast, the HMGB1 level of the two PI-1 transfected stable cell lines remained similar to the corresponding control cell lines. Therefore, the Ashmg1/E and the cDNA3/F MCF-7 cell lines were selected for further study.
Moreover, real-time RT-PCR used to determine the mRNA level of HMGB1 in the Ashmg1/E and the cDNA3/F MCF-7 cell lines has revealed that the HMGB1 mRNA level in Ashmg1/E cells was about half of that in the cDNA3/F cells, correlating well with the lower HMGB1 protein level.
Finally, PCR was used to check the genomic integration of pAshmg1 in the
Ashmg1/E MCF-7 cells and the expression of pAshmg1 in this cell line. The results showed that the pAshmg1 plasmid has been integrated into the genomic
DNA and was successfully transcribed into mRNA in the Ashmg1/E cells.
2.3.1 Construction of the HMGB1-targeting siRNA Plasmid
Recombinant plasmid DNA (designated PI-1) purified from E. coli transformed with the ligation mixture of annealed siRNA oligonucleotides and the linearilized vector was analyzed by restriction digestion.
Restriction digestion with Sca I and then agarose gel electrophoresis carried out to check for insertion of the siRNA coding sequence showed that the control plasmid pNCP, which carries no Sca I site, was not cut by the restriction enzyme
Sca I (Lanes 2 and 3, Figure 2.5). On the other hand, the recombinant plasmid PI-1 was cut by the restriction enzyme (Lanes 4 and 5, Figure 2.5), indicating the presence of the Sca I site and thus the insertion of the siRNA encoding sequence.
62 Chapter 2
Figure 2.5 Gel Electrophoresis of PI-1 and pNCP after Digestion with Sca I. 1 µL of the plasmid PI-1 or pNCP was digested with Sca I at 37℃ for about two hour. After digestion, the mixtures were run in a 1% agarose gel. Lane 1-5 are 1 kb DNA Ladder (Promega), the control plasmid pNCP, Sca I digested pNCP, the recombinant plasmid PI-1 and Sca I digested PI-1 respectively.
The insertion of the siRNA encoding sequence was further confirmed by sequencing using the sequencing primer 5’-AATACGTGACGTAGAAAGTA-3’ provided by the kit. Sequencing was carried out by Tech Dragon Limited. The sequencing result of PI-1 is shown in Figure 2.6. The inserted sequence is underlined and is identical to the designed sequence. Therefore, construction of the siRNA-coding plasmid was successful.
63 Chapter 2
5’-TTTCTTGGGAGTTTGCAGTTTTAAATTATGTTTTAAATGGACTATC ATATGCTTACCGTAACTTGAAAGTA TTTCGATTTCTTGGCTTTATATA
TCTTGTGGAAAGGACGAAACACCGTGCTCGCTTCGGCAGCACATAT ACTAGTCGAAAGGCCCGTTATGAAAGAGAGAGTACTGTCTCTTTCA TAACGGGCCTT TTTTTCTAGAGCGGACTTCGGTCCGCTTTTTACTAG GACCTGCAGGCATGCAAGCTTGGGAGATCTGCGGATATCACATGTG
AGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTT GCTGGCGTTTTTCCATAGGCTCCG CCCCCCTGACGAGCATCACAAA AATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAA
GATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGT TCCGACCCTGCCGCTTACCGGAT ACCTGTCCGCCTTTCTCCCTTCG GGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTT CGGTGTAGGTCGTTCGCTCCA AGCTGGGCTGTGTGCACGAACCCC CCGTTCAGCCCGACCGCT GCGCCTTATCCGGTAACTATCGTCTTGA GTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACT GGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGT TCTTGGAGTGGTGG -3’
Figure 2.6 Sequencing Result of Plasmid PI-1. The insert sequence is underlined. The rest is vector sequence. The Xho I overhang site is in red. The nucleotides for the stem loop structures are in blue. The termination signal is in green.
2.3.2 Identification of Plasmids pAshmg1 and pcDNA3
Both plasmids pAshmg1 and pcDNA3 were transformed into competent E. coli cells and the plasmids extracted were with EcoR I and analyzed by agarose gel electrophoresis.
64 Chapter 2
Figure 2.7 Gel Electrophoresis of pAshmg1 and pcDNA3 after Digestion with EcoR I. 1 µL of the plasmid pcDNA3 or pAshmg1 was digested with EcoR I at 37℃ for about two hours. After digestion, the mixtures were run in a 1% agarose gel. Lane 1-5 are 100 bp DNA Ladder (Promega), pAshmg1, EcoR I digested pAshmg1, pcDNA3, EcoR I digested PI-1 and 1 kb DNA Ladder (Promega) respectively.
The pcDNA3 plasmid showed one linearized band after EcoR I digestion, indicating that it contains one single EcoR I site, most probably in the multiple cloning sites (MCS) region (Lanes 5, Figure 2.7). The size of this band of pcDNA3 is between 5–6 kb, corresponding to its expected size of 5.4 kb. The EcoR I digested pAshmg1 plasmid showed two bands (Lanes 3, Figure 2.7). Since the anti-HMGB1 cDNA sequence was inserted into the EcoR I site of the vector, these two bands of sizes 4–5 kb and 600–700 bp respectively, corresponding to the size of the vector and the antisense HMGB1 insert were as expected.
65 Chapter 2
Figure 2.8 Sequencing Result of Plasmid pAshmg1. The antisense human HMGB1 cDNA insert sequence is in red. The multiple cloning sites are underlined and the EcoR I site is in green. The restriction enzyme sites in the MCS are EcoR V, Acc65 I, Kpn I, Apa I, Xho I, Hind III, Nco I, EcoR I, Pst I, Xma I, Sma I, BamH I, Msc I, Nhe I and Bmt I repectively. The others are vector sequences: the sequence upstream of the MCS in purple is part of a CMV promoter and the sequence downstream of the MCS is shown in blue. The sequencing primers are marked by arrows.
The pAshmg1 plasmid was sequenced by Tech Dragon Limited using double strand strategy with the sequencing primers: pAshmg1-Sense-SPAs 5’- aagaagttcaaggatcccaatg -3’ and pAshmg1-Antisense-SPAs 5’- ttccacatctctcccagtttct
-3’. The sequencing result is shown in Figure 2.8. The inserted sequence, represented in red, is exactly the complementary sequence of the human HMGB1
66 Chapter 2 cDNA from nucleotide number 4 to 648. The multiple cloning sites are underlined and the two EcoR I sites flanking the anti-HMGB1 cDNA are shown in green. The restriction enzyme sites in the MCS are: EcoR V, Acc65 I, Kpn I, Apa I, Xho I,
Hind III, Nco I, EcoR I, Pst I, Xma I, Sma I, BamH I, Msc I, Nhe I and Bmt I, sequentially. The vector sequence upstream of the MCS in purple color is part of the human cytomegalovirus (CMV) promoter and the vector sequence downstream of the MCS is shown in blue.
2.3.3 HMGB1 Protein Levels in Transiently Transfected Cells
Western blotting results of the cells transfected with the plasmids PI-1, pNCP, pcDNA3 and pAshmg1 are shown in Figure 2.9. For Western blotting analysis, transiently transfected MCF-7 cells in 12-well plates were cultured for 48 hours after transfection. Then cells in each well were lysed with 35 µL of lysis buffer.
The concentration of protein samples was determined by Bradford assay. 15 µg of each sample was loaded into a well of the SDS-PAGE gel and run for about 80 minutes. Then the proteins were transferred onto a PVDF membrane, blocked at
4℃ overnight and detected on the following day.
For data analysis of Western blotting results, the HMGB1 expression level was defined as the BLU ratio between the HMGB1 band and the β-actin band in the same lane. The mean value of the HMGB1 expression level of each sample was calculated and used for comparison. Figure 2.9.B and 2.9.D respectively shows the relative HMGB1 expression level in cells transfected with the siRNA-coding plasmid PI-1 and the anti-HMGB1 cDNA plasmid pAshmg1. The
HMGB1 level in their respective control cells was defined as 100%.
67 Chapter 2
Figure 2.9 Western Blotting Results of Transient Transfection. A: Lane 1 and 2 are samples from cells transfected with plasmid PI-1; Lane 3 and 4 are samples from cells transfected plasmid pNCP. B: HMGB1 expression level of cells transfected with PI-1 and pNCP respectively. C: Lane 1 and 2 are samples from cells transfected with plasmid pAshmg1; lane 3 and 4 are samples from cells transfected with plasmid pcDNA3. D: HMGB1 expression level of cells transfected with pAshmg1 and pcDNA3 respectively.
Western blotting results showed that both the siRNA and the antisense strategies were capable of suppressing the HMGB1 protein expression level down to about sixty percent. However, this suppression was found to be short-lived and could not last for more than several days after transfection. Most probably, the plasmids were diluted through cell passages as well as being degraded during cell culture. In addition, the suppression efficacy was found to be highly dependent on the transfection efficiency, causing results to be rather irreproducible in repeated experiments. To overcome these problems inherent of transient transfections, establishment of stable HMGB1-suppressed MCF-7 cell lines became necessary.
68 Chapter 2
2.3.4 G418 Killing Curve of MCF-7 Cells
1,000 MCF-7 cells were plated into each well of 6-well plates containing 2 mL of culture medium with 0 to 1,100 µg/mL of G418 and were cultured for 2 weeks. The number of living colonies in each well of duplicate experiments was recorded and the average values are shown in Table 2.9.
It was found that at least 600 µg/mL of G418 was required to kill all the cells in 2 weeks. Therefore, 600 µg/mL of G418 was added to the culture medium to select for the stably-transfected cells.
Table 2.9 Number of Living Cell Colonies in Wells Treated With Different Concentrations of G418
G418 (µg/mL) 0 100 200 300 400 500 Colony 01 388 256 142 71 23 6 Colony 02 384 275 124 70 40 11 Average 386 265.5 133 70.5 31.5 8.5 G418 (µg/mL) 600 700 800 900 1,000 1,100 Colony 01 0 0 0 0 0 0 Colony 02 0 0 0 0 0 0 Average 0 0 0 0 0 0
Figure 2.10 Results of the G418 Killing Curve Experiment for MCF-7 Cells
69 Chapter 2
2.3.5 Establishment of Stably-Transfected MCF-7 Cell Lines
Stable transfected cells were established by selection in the selection medium
(DMEM, 10% FBS medium containing 600 µg/mL of G418) 48 hours after transfection. The medium was changed every 3–4 days. In about one month, cell colonies at eye-visible level (about 1mm diameter) were observed from some of the wells. These cells in each well were transferred into a new dish or flask and continuously cultured with the selection medium. Photos of the MCF-7 cell colonies transfected with the plasmid pcDNA3 or the plasmid pAshmg1 plus pcDNA3 are shown in Appendix II, respectively. After transfected MCF-7 cells formed visible G418 resistant clones, two pNCP-transformed clones (designated
NCP/1 and NCP/2), two PI-1-transformed clones (designated PI-1/3 and PI-1/4), four clones transformed with a combination of pAshmg1 and pcDNA3 plasmids
(designated Ashmg1/E, Ashmg1/H, Ashmg1/I and Ashmg1/J) and two pcDNA3-transformed clones (designated cDNA3/F and cDNA3/G) were transferred into new flasks and continuously cultured.
2.3.6 HMGB1 Protein Levels in the Established Stable Cell Lines
HMGB1 protein levels of the above stably-transfected cells were determined by Western blotting and the results showed that there is no significant difference between the HMGB1 protein levels in the PI-1-transformed and the pNCP-transformed cell lines (Figure 2.11 A and B), indicating that the transformed
PI-1 plasmid did not suppress HMGB1 expression in these two cell lines.
Therefore the RNA interference strategy was not successful in establishing a stable
HMGB1 down-regulated cell line.
70 Chapter 2
Figure 2.11 Western Blotting Results of the Stably Transfected MCF-7 Cells. A: Lane 1-4 are samples extracted from MCF-7 cell lines NCP/1, NCP/2, PI-1/3 and PI-1/4 respectively. B: HMGB1 expression level of cell lines NCP/1, NCP/2, PI-1/3 and PI-1/4 respectively. C: Lane 4 is protein marker; the other lanes are samples extracted from MCF-7 cell lines Ashmg1/E, Ashmg1/H, Ashmg1/I, Ashmg1/J, cDNA3/F and cDNA3/G respectively. D: HMGB1 expression level of cell lines Ashmg1/E, Ashmg1/H, Ashmg1/I, Ashmg1/J, cDNA3/F and cDNA3/G respectively.
71 Chapter 2
In contrast, in the four pAshmg1-transfected cell lines, Ashmg1/E exhibited the lowest HMGB1 protein level, at about 50% of the control cDNA3/F cells
(Figure 2.11 C and D), indicating that the pAshmg1 plasmid had suppressed
HMGB1 expression in this cell line. Therefore the antisense strategy was successful in establishing the stable cell line with suppressed HMGB1 level. The
Ashmg1/E and cDNA3/F MCF-7 cell lines were chosen for subsequent studies.
2.3.7 HMGB1 mRNA Level in the HMGB1-Suppressed MCF-7
Cell Line
Real-time RT-PCR was used to compare the HMGB1 mRNA levels between the Ashmg1/E and cDNA3/F cell lines. The relative HMGB1 mRNA level was calculated using the 2-∆∆Ct method. It was found that the HMGB1 mRNA level in the Ashmg1/E cell line was about half of that in the cDNA3/F cell line (Table 2.10), correlating well with its lowered HMGB1 protein level.
Table 2.10 Relative HMGB1 mRNA Level in the HMGB1 Suppressed MCF-7 Cell Line
∆∆Ct Relative △Ct Gene CtE CtF [△Ct target– Expression [CtE –CtF] -∆∆Ct △Ct control] Level [2 ] Beta-actin 22.925±0.065 23.64±0.02 – 0.715 0 1 HMGB1 22.12±0.01 21.69±0.03 0.43 1.145 0.452190
2.3.8 Genomic Integration of the pAshmg1 Plasmid in the Stably
Transfected MCF-7 Cell Lines
To check whether the pAshmg1 plasmid was integrated into the genomes
72 Chapter 2 of the transformed cells, the genomic DNA samples of the stably-transfected
MCF-7 cell lines Ashmg1/E, Ashmg1/H, Ashmg1/I, Ashmg1/J, cDNA3/F and cDNA3/G cells were prepared and used as templates in PCR. The PCR products were analyzed by agarose gel electrophoresis.
Figure 2.12 Gel Electrophoresis of the PCR Products Amplified from the Genomic DNA of the Stably Transfected MCF-7 Cell Lines. Lane 1: 100 bp DNA Ladder (Promega). Lanes 2-7: PCR products using 5 ng of genomic DNA from the pAshmg1/E, pAshmg1/H, pAshmg1/I, pAshmg1/J, pcDNA3 /F and pcDNA3/G cell lines as templates respectively. Lanes 8-9: the positive and negative controls using 10 fg of the pAshmg1 plasmid and distilled water as templates respectively.
The PCR product using 10 fg of the pAshmg1 plasmid as template showed one band of size 300 – 400 bp (Lane 8, Figure 2.12), which is the same size as the positive control band. The PCR products amplified from the genomic DNA of the
Ashmg1/E, Ashmg1/H and Ashmg1/I cells also contained one band with the same size as the positive control band (Lanes 2, 3 and 4, respectively, Figure 2.12), indicating that the pAshmg1 plasmid has most likely been integrated into the genomes of the Ashmg1/E, Ashmg1/H and Ashmg1/I cell lines. No band was
73 Chapter 2 detected in PCR amplification of the genomic DNA from the Ashmg1/J cells (Lane
5, Figure 2.12), indicating that the pAshmg1 plasmid was not integrated into the genome of the Ashmg1/J cell line. In addition, there was no PCR product from the genomic DNA of the cDNA3/F or cDNA3/G cell lines (Lanes 6 and 7, Figure 2.12) as no pAshmg1 plasmid was transfected into these cells.
2.3.9 Expression of the Integrated pAshmg1 Plasmid in the
HMGB1 Suppressed MCF-7 Cell Line
To investigate whether the integrated pAshmg1 plasmid in the genomic DNA of the Ashmg1/E cell line was transcribed to mRNA successfully, the cDNA of
Ashmg1/E and cDNA3/F cell lines were used as templates in PCR. The PCR products were analyzed by agarose gel electrophoresis.
Figure 2.13 Gel Electrophoresis of RT-PCR Products to Investigate the mRNA Expression of the Integrated pAshmg1 Plasmid.
Lane 1 was 100 bp DNA Ladder (Promega). Lane 2-4 are samples using 10 fg of pAshmg1, 100 fg of pAshmg1 and distilled water as positive and negative controls respectively. Lane 5-6 are samples using 5 µL of the diluted cDNA from the pAshmg1/E and the pcDNA3/F cell lines respectively.
74 Chapter 2
The PCR products using 10 fg and 100 fg of the pAshmg1 plasmid as templates contained one band of size 700 – 800 bp (Lanes 2 and 3, Figure 2.13), which is the same size as the positive control band. The PCR products amplified from cDNA of the Ashmg1/E cell line contained one band and its size is identical to that of the positive control band (Lane 5, Figure 2.13), indicating that the integrated pAshmg1 plasmid has been transcribed into mRNA successfully in this cell line. As expected, no band was present in the PCR products produced from the cDNA of the cDNA3/F cell line (Lane 6, Figure 2.13).
2.4 Discussion
In recent studies, several strategies are widely used to identify gene functions.
One technology is to induce or increase the gene expression level in cells and animal models and thereby to find out the corresponding phenomena. Sometimes this technology may work ineffectively when the endogenous target protein level is enough to maintain its function. Another strategy is to knockout the gene, which is to delete or deactivate the target gene in animal models, usually in mice, and consequently study the difference between knockout and normal animals.
Although the knockout method could provide in vivo functional information, it is time-consuming, expensive and inapplicable in therapeutic purposes (Kurreck,
2003). In contrast, antisense strategy, which suppresses the target protein expression by inhibiting the translation of mRNA, is fast and easy to administer in both experimental and clinical applications. So the antisense strategy has been developed rapidly and widely used since the discovery of oligonucleotides as antisense agents in 1978 (Zamecnik and Stephenson, 1978).
In the case of HMGB1, the knockout mouse model has been developed by
Dr. Bianchi’s group (Calogero et al., 1999). However, information of genes
75 Chapter 2 affected by HMGB1 deficiency at the whole cell level is still unclear. To reveal the intracellular function of the HMGB1 protein, antisense strategy was carried out in our study. Another advantage of the antisense strategy was that it could be applied to human cell lines so that it would provide relevant information on the human
HMGB1 gene.
Recently, anti-sense HMGB1 plasmids have been used to transfect cultured cells. For example, Poser et al. transformed melanoma cell lines with plasmid pAshmg1 to investigate the regulatory influence of HMGB1 on melanoma-inhibitory activity (MIA) in melanoma cells (Poser et al., 2003). Also short hairpin RNA expression plasmids targeting the human HMGB1 gene were used in transient co-transfection with SREBP expression plasmids into human embryonic kidney 293 cells and luciferase assay was used to study the interaction between the HMGB1 and SREBP proteins (Misawa et al., 2003). However, these studies focused on the influence of HMGB1 to one or two specific genes but not on a genome wide scale.
In this study, both siRNA-coding plasmid PI-1 and anti-HMGB1 cDNA coding plasmid pAshmg1 were used in transfection of the MCF-7 cells to down-regulate HMGB1. The results showed that in transient transfections, the
HMGB1 protein level in cells transfected with either the PI-1 plasmid or the pAshmg1 plasmid was decreased to about 60% of that of the corresponding control cells. Therefore, both the RNAi and the antisense strategies were successful in suppressing HMGB1 expression in the MCF-7 cells within 48 hours after transfection. Most probably, both the PI-1 and the pAshmg1 plasmids entered the cells and targeted endogenous HMGB1 mRNA successfully.
By contrast, in stably-transfected cell lines, the HMGB1 protein level
76 Chapter 2 decreased only in cells transfected with the pAshmg1 plasmid, but not in cells transfected with PI-1. Therefore, stable HMGB1 down-regulated MCF-7 cell lines were successfully established only with the antisense strategy.
A variety of parameters may affect the inhibiting efficacy of the antisense plasmid and the siRNA-encoding plasmid, including their specificity to target genes, their stability in the procedure, the uptake by the cells and the copy number in cytoplasm (Kurreck, 2003; Achenbach et al., 2003). In this investigation, the inhibiting efficacy of the PI-1 plasmid was found to be different between the transient transfection and the stable transfection experiments. It may be explained by the difference in the parameters mentioned above. For example, the copy number of the siRNA-encoding plasmid in cytoplasm may be much higher in the transient transfected cells than in the stably transfected cells.
In conclusion, both the RNAi and the antisense strategies were adopted in this study to suppress HMGB1 expression in the MCF-7 cells. A stable HMGB1 down-regulated MCF-7 cell line was established using the antisense strategy.
HMGB1 expression, at both the protein and mRNA levels, in this cell line is about half of that in the control cell line. PCR results suggested that the down regulation of HMGB1 expression in the Ashmg1/E cell line was most likely a result of the successful integration of the pAshmg1 plasmid into the DNA genome and the successful expression of this plasmid. This HMGB1 down-regulated MCF-7 cell line and the control MCF-7 cell line were used in the subsequent expression profiling experiments.
77 Chapter 3
Chapter 3 Expression Profile of the HMGB1
Down-Regulated MCF-7 Cells
3.1 Introduction
Since the complete sequence of the 3 billion DNA bases of the human chromosomes was revealed in 2003 (Collins et al., 2003), a great number of studies have been focused on the identification of all the human genes and the interpretion of the biological roles of these genes (Snyder and Gerstein, 2003). In order to understand the function of genes in the content of the whole genome, it is essential to identify the interactions and regulations among all the human genes.
At present, two types of tools are widely used in bioinformatics to investigate the complex networks: one approach is through experiments on the cell as a whole, such as cDNA microarray, two-dimensional gel electrophoresis of proteins and mass spectrometry for protein sequence analysis; another approach is by computational analysis, through database setup, statistical analysis and modeling
(Hrkal 2003; Lisacek et al., 2006; Palagi et al., 2006).
Previous studies have demonstrated that HMGB1 is an important transcription factor through its interaction and cooperation with a variety of transcription factors including p53, p73, Oct-4, the Rel family and the steroid hormone receptors (Table 1.2). However, these works were limited to specific genes only. We wanted to perform a genome-wide screening of genes regulated by
HMGB1, directly or indirectly. An HMGB1 down-regulated MCF-7 cell line
Ashmg1/E has been established and cDNA microarray was performed to compare the expression profiles between the Ashmg1/E and the control cDNA3/F cell lines.
78 Chapter 3
The differentially expressed genes, up-regulated or down-regulated, were identified from the microarray data. Then real-time RT-PCR was carried out to check the expression level of the selected genes. The differentially expressed genes were then classified into different functional groups using the bioinformatics software DAVID. Furthermore, the potential networks among the differentially expressed genes were analyzed by the PathwayassistTM software and thereby
HMGB1-associated networks were obtained.
3.2 Materials and Methodologies
3.2.1 Materials
TRI REAGENT® was purchased from Molecular Research Center, Inc.
SuperScript™ III Reverse Transcriptase, oligo(dT)12－18 and RNA inhibitor were purchased from Invitrogen. Low T dNTP mixture (20% dT) was purchased from
Promega. RNA-secureTM Reagent was purchased from Ambion. Cy3-dUTP and
Cy5-dUTP labeling dyes were purchased from Perkin-Elmer Life Scienses.
Microcon 30 columns were purchased from Millipore. Microarray slides containing 9984 human cDNAs and ESTs (with 9182 sequences human genes and
ESTs) were provided by Dr. Yang’s group (Zhang et al., 2003; Hu et al., 2004;
Wang et al., 2004c).
Other materials used were the same as those described in Section 2.2.1.
3.2.2 Cell lines
The MCF-7 cell line was purchased from ATCC. The stably-transfected
MCF-7 cell lines Ashmg1/E and cDNA3/F were established as described in
Section 2.3.5.
79 Chapter 3
3.2.3 Cell Culture
The MCF-7 Cells were incubated in DMEM (Invitrogen) with 10% FBS
(Invitrogen) and 100 units/mL penicillin and 100 µg/mL streptomycin (Invitrogen) at 37℃ in 5% CO2, 80% humidity condition. The stably-transfected MCF-7 cells were incubated in DMEM (Invitrogen) with 10% FBS (Invitrogen) and 600 µg/mL
G418 (Promega) at 37℃ in 5% CO2, 80% humidity condition. Cells were continuously cultured and subcultured every 3 to 4 days as described in Section
2.2.5. The subculturing ratio of MCF-7 cells was 1:3 to 1:6.
3.3.4 RNA Isolation
The stably transfected MCF-7 cell lines Ashmg1/E and cDNA3/F were cultured in 75-cm2 flasks till 70-80% confluence. Total RNA was isolated from the cells using TRI REAGENT® (Molecular Research Center, Inc.) according to the manufacturer’s instructions. 8－10 mL of TRI REAGENT® was added into each culture flask and incubated at RT for 5 minutes to lyse the cells. The cell lysate was pipetted several times. An appropriate amount of chloroform was added into the lysates at a ratio of 1:5 (V/V) to TRI REAGENT® and mixed by shaking vigorously for 15 seconds. After incubation at RT for 2－3 minutes, the mixture was centrifuged at 12,000 g, 4℃ for 15 minutes. After centrifugation, the mixture was separated into three layers: a lower red phenol-chloroform phase, an interphase, and a colorless upper aqueous phase. Then, the upper phase containing
RNA was transferred into a new microcentrifuge tube and mixed with an equal volume of 75% ethanol by vortexing. After centrifugation at 12,000 g, 4℃ for 10 minutes, RNA was precipitated from the mixture and the supernatant was gently decanted by hand. Then the white RNA sample was washed by 1 mL of 75%
80 Chapter 3 ethanol and pelleted again by centrifugation at 7500 g, 4℃ for 5 minutes. After the tube was dried in air for about 15 minutes, the RNA sample was dissolved by
RNA-secureTM Reagent (Ambion) at 60℃ for 5 minutes. The concentrations of total RNA were determined by the corresponding absorbance at 260 nm and the quality of RNA samples was verified by examining the integrity of 28S and 18S rRNA using 1% agarose gel electrophoresis.
3.2.5 cDNA microarray
The procedures of cDNA microarray were carried out as described as follow
(Zhang et al., 2003). Briefly, 75 µg each of total RNA from the sample (the
Ashmg1/E cell line) and the control (the cDNA3/F cell line) were separately used as template for synthesizing cDNA probes. Firstly, 8 µL of oligo(dT)12－18 (1
µg/µL) (Invitrogen) and an appropriate amount of distilled water were added into
150 µg of total sample RNA to a final volume of 38 µL and the solution was incubated at 70℃ for 10 minutes followed by chilling on ice for 5 minutes. Then
16 µL of 5 × first-strand buffer, 8 µL of low T dNTP mixture (20% dT) (Promega),
8 µL of 0.1 M DTT, 4 µL of SuperScript™ III Reverse Transcriptase, 2 µL of
RNA inhibitor (Invitrogen) and 4 µL of fluorescent dyes (Cy5-dUTP)
(Perkin-Elmer Life Scienses) were mixed with the sample solution and incubated at 50℃ for about 2 hours. 20 µL of denaturing buffer (0.5 M NaOH and 100 mM
EDTA) was added into the mixture and incubated at 65℃ for 10 minutes. Then the mixture was neutralized by adding 20 µL of neutralization buffer (1 M Tris
(pH 7.4) and 0.5 M HCl). cDNA probes from the control was synthesized as above using total RNA from the control cell line and the Cy3-dUTP. The next step was to purify the synthesized cDNA probes. After the cDNA probes from the sample
81 Chapter 3 were mixed with the same volume of the cDNA probes from the control, the mixed cDNA probes were loaded to Microcon 30 columns (Millipore) and centrifuged at
14,000 g for about 5 minutes. Then 400 µL of TE buffer (pH 7.5) was used to wash the column followed by continuous wash with 200 µL of TE buffer (pH 7.5) until the flow-through was colorless. Then the column was inverted, placed into a new microcentrifuge tube and centrifuged at 1000 g for 3 minutes to collect the labeled cDNA probes. Then an appropriate amount of TE buffer (pH 7.5) was added into the purified cDNA probes to a final volume of 32 µL. After 8 µL of 5 × hybridization solution (1.66 µg/µL of Cotl DNA, yeast tDNA, 1.33 µg/µL of polydA and 10 × SSC) and 0.4 µL of 10% SDS were added into the mixed cDNA probes, the mixture was denatured at 100℃ for 2 minutes followed by chilling on ice for 2 minutes and then 20 µL of the mixture was hybridized with one microarray slide at 65℃ overnight. The next day, the slides were washed at 37℃ with gentle shaking in 2 × SSC (with 0.1% SDS) for 10 minutes, 0.2 × SSC for 10 minutes, 2 × SSC (with 0.1% SDS) for 10 minutes and 0.2 × SSC for 10 minutes.
Then the slides were scanned with ScanArrayR 4000 confocal laser scanner
(Packard Bioscience) and the initial images were captured by the GenePix Pro 4.1 software (Axon Instruments). The experiment was repeated once with cDNA probes synthesized from RNA of the sample and the control reversely labeled with
Cy3-dUTP and Cy5-dUTP, respectively.
3.2.6 Microarray Data Analysis
The GenePix Pro 4.1 software was used to analyze data of the cDNA microarray. Cy5/Cy3 ratio represents the relative expression level of each gene.
Spots with small diameters (﹤120 µm), low signal strengths (﹤300 fluorescence
82 Chapter 3 intensity units) and low signal-to-noise ratio (﹤1.5) were regarded as null data and ignored. Genes exhibiting at least 1.5-fold change (Cy5/Cy3 ratios above 1.5 or below 0.67 in either experiment) were chosen for further analysis.
3.2.7 Functional Classification
To functionally analyze the differentially expressed genes, an online free software DAVID was used to classify the 1.5-fold changed genes into different functional groups. DAVID is an integrated software to annotate and analyze high-throughput datasets extracted from microarray or proteomic platforms. It is developed by the Laboratory of Immunopathogenesis and Bioinformatics at
SAIC-Frederick, Inc. for the National Institute of Allergy and Infectious Diseases of the National Institutes of Health. According to the instructions, the list of the
1.5-fold changed genes with suitable identifiers was pasted into the input area and they were analyzed using appropriate parameters. After analysis, they were classified into different functional groups according to their functions (Dennis G Jr, http://david.abcc.ncifcrf.gov/).
3.2.8 Pathway Analysis
Furthermore, the bioinformatics software PathwayassistTM (trial version, http://www.stratagene.com/) was used to identify the potential HMGB1-associated pathways. PathwayassistTM extracts the relevant genes from known database and draws potential networks among these genes. According to the instructions, the list of the 1.5-fold changed genes with suitable identifiers were input into the software and these genes were then analyzed using the “Build Pathway” function conjugated with a human genomic database Res-Net3.0 (Ariadne Genomics). After analysis, the network representing known interactions among the recognized genes
83 Chapter 3 was drawn by the software. The nodes of the network and the interaction between the nodes were also provided.
3.2.9 Real-time RT-PCR
Total RNA extracted using TRI REAGENT® or RNA purification kits were used as template in reverse transcription. As described in Section 2.2.9, 3 µg of each total RNA, 3 µL of 10 × reaction buffer, 3 µL of RQ1 RNase-Free DNase and an appropriate amount of nuclease-free water were added into a sterile nuclease-free microcentrifuge tube to a final volume of 30 µL. After an incubation at 37℃ for 30 minutes, 3 µL of stop solution was added into the mixture and the reaction was terminated at 65℃ for 10 minutes. 800 ng of DNase treated RNA was then reverse transcribed into cDNA using iScriptTM cDNA Synthesis Kit
(Bio-Rad) in the following conditions: 25℃ for 5 minutes, 42℃ for 30 minutes and 85℃ for 5 minutes and hold at 4℃. The cDNA products were diluted 1:20
(V/V) in distilled water and used as templates for real-time PCR. Each real-time
PCR reaction contained a final volume of 25µL, consisting of 5 µL of the diluted cDNA, 12.5 µL of iQTM SYBR® Green Supermix (Bio-Rad), an appropriate amount of gene specific forward and reverse PCR primers and an appropriate amount of distilled water.
The primers of the human HMGB1 and β-actin genes were identical to those in Table 2.7. The other primers for the human genes were designed using the on-line software Primer3 (Rozen and Skaletsky, 2000). Sequence of the primers for real-time PCR is listed in Table 3.1. The final concentration of the primers
ActF and ActR was 270 nM. The final concentration of all the other primers was
400 nM. Real-time PCR reactions were carried out in the Smart Cycler® (Cepheid).
84 Chapter 3
The PCR conditions were as follow: 5 minutes at 95℃ and then 45 cycles of 20 s at 94℃, 30 s at 59℃ and 30 s at 72℃. The melting curve detection procedure was performed at the end of the reaction. Each sample was assayed in duplicate. The standard curves of these genes are listed in Appendix IV.
Table 3.1 Sequences of the Primers Used in Real-time PCR
Target Gene Primer Name Sequence ActF 5’-AGTACTCCGTGTGGATCGGC-3’ Beta-actin ActR 5’-GCTGATCCACATCTGCTGGA-3’ ANXA2-F 5’- TCGGCTGTATGACTCCATGA-3’ ANXA2 ANXA2-R 5’- CAGGGACTTGCCGTACTTTC –3
CIB1-F 5’- TGATGATGACGGAACCTTGA –3’ CIB1 CIB1-R 5’- ACTCCTCCAGGATGTTGTCG –3’ CTSD-F 5’- GACACAGGCACTTCCCTCAT –3’ CTSD CTSD-R 5’- CCTCCCAGCTTCAGTGTGAT –3’
E2F1-F 5’- GAGGAGTTCATCAGCCTTTCC –3’ E2F1 E2F1-R 5’- CCCCAAAGTCACAGTCGAAG –3’
GAA-F 5’-TGCAGAAGGTGACTGTCCTG–3’ GAA GAA-R 5’- AGATGTCCAGGACCTTGGTG–3’
GANAB -F 5’-ACCAGATGGGTGCTTACCAG –3’ GANAB GANAB -R 5’-GTACCAGAAGGGCAGCAAAG–3’ GFPT1-F 5’- TGCTCTTCAGCAAGTGGTTG –3’ GFPT1 GFPT1-R 5’- AAGGGATCACGCTGAGAATG –3’
ME1-F 5’- TTCCTACGTGTTCCCTGGAG –3’ ME1 ME1-R 5’- GATAAAGCCGACCCTCTTCC –3’ MDM2-F’ 5’- ATGCCATTGAACCTTGTGTG –3’ MDM2 MDM2-R 5’- GGCAGGGCTTATTCCTTTTC –3 NDUFS2-F: 5’- GTTCCTCCAGGAGCCACATA –3' NDUFS2 NDUFS2-R 5’- CTTGTCCAAACCAGCCAGAT –3’ TP53-F 5’-AGGCCTTGGAACTCAAGGAT -3’ TP53 TP53-R 5’-TGAGTCAGGCCCTTCTGTCT -3’
85 Chapter 3
3.3 Results
3.3.1 Differential Expression Profiles in HMGB1 Down-Regulated
MCF-7 Cells Compared to the Control Cells
To examine the differential expression profiles of HMGB1 down-regulated
MCF-7 cells at a genome wide scale, total RNA were extracted from both the
Ashmg1/E cell line and the control cDNA3/F cell line. The total RNA was then transcribed into cDNA probes labeled with Cy5 and Cy3, respectively. The labeled cDNA probes were used in the cDNA microarray assay. Data from the cDNA microarray of 9984 human genes and ESTs were analyzed, showing that 96 genes were down-regulated while 76 genes were up-regulated more than 1.5 fold (Table
3.3).
3.3.2 Relative Expression Level of Selected Genes
To confirm the differential expression profile, the relative expression level of
13 selected genes was checked by real-time RT-PCR (Table 3.2). The Ct value of each gene in the Ashmg1/E and the cDNA3/F cell lines were obtained. Using the beta-actin mRNA as the internal control, the relative expression level of the other
12 genes in the Ashmg1/E cell line, compared to the cDNA3/F cell line, was calculated using the 2-∆∆Ct method described in Section 2.2.9.4. The relative expression levels of these genes are listed in Table 3.2. It was found that in 8 of the
12 genes, the relative expression level found correlated well the cDNA microarray data.
86 Chapter 3
Table 3.2 Relative Expression Levels of the Selected Genes
∆∆Ct Relative Expression △Ct [△Ct target Gene CtE CtF Level [Ct －Ct ] －△Ct E F [2-∆∆Ct] control] Beta-actin 22.975±0.015 23.92±0.01 -0.945 0 1 HMGB1 23.12±0.12 23.185±0.035 – 0.065 0.88 0.543367 ANXA2 23.865±0.105 24.45±0.01 -0.585 0.36 0.779165 CIB1 26.055±0.055 26.295±0.015 -0.24 0.705 0.613442 CTSD 21.32±0.1 22.31±0.13 -0.99 -0.045 1.031683 E2F1 28.71±0.11 30.21±0.14 -1.5 -0.555 1.469169
GAA 27.675±0.075 27.06±0.34 0.615 1.56 0.339151 GANAB 24.345±0.025 23.655±0.145 0.69 1.635 0.32197 GFPT1 27.29±0.01 25.86±0.07 1.43 2.375 0.192776 ME1 28.655±0.105 29.27±0.01 -0.615 0.33 0.795536 MDM2 25.3±0.15 24.69±0.03 0.61 1.555 0.340329 NDUFS2 28.325±0.115 28.15±0.02 0.175 1.12 0.460094 TP53 27.44±0.04 26.645±0.065 0.795 1.74 0.29937
3.3.3 Functional Classification of the Differentially Expressed
Genes
All the genes with 1.5-fold or higher change in the expression level were analyzed using the DAVID software. Among the 172 genes, 79 could be classified and they fell into 11 functional groups. 93 of the 172 genes could not be classified
(designated unclustered). These 172 differentially expressed genes and the functional groups to which they belong are listed in Table 3.3.
87 Chapter 3
Table 3.3 Functional Classifications of the Differentially Expressed Genes
Reporter BioSequence Related No. Database Entry Gene Designation E/F* F/E* [GenBank/EM Symbol BL/DDBJ ]
Group1 Transcription Factor
polymerase (RNA) III (DNA directed) polypeptide 1 AL558755 RPC62 1.04918 0.595116 C (62kD)
2 NM_004349 CBFA2T1 myelodysplasia syndrome 1 1.54971 0.825683
3 AW853012 BAZ1B bromodomain adjacent to zinc finger domain, 1B 1.58036 0.758335
4 AL121906 E2F1 E2F transcription factor 1 0.53655 1.29028
MCM7 minichromosome maintenance deficient 7 5 NM_005916 MCM7 1.57378 (S. cerevisiae)
6 AW303433 CEACAM6 zinc finger protein 37a (KOX 21) 1.72506
7 BG110393 LOC51329 ADP-ribosylation-like factor 6 interacting protein 4 1.77979 0.569286
8 BF343807 CEBPA CCAAT/enhancer binding protein (C/EBP), alpha 0.664453
9 M96740 NHLH2 nescient helix loop helix 2 0.3065
Mdm2, transformed 3T3 cell double minute 2, p53 10 NM_006878 MDM2 0.542133 binding protein (mouse)
general transcription factor IIH, polypeptide 3, 11 NM_001516 GTF2H3 1.51227 0.526739 34kDa
v-rel reticuloendotheliosis viral oncogene homolog 12 BG748809 RELB B, nuclear factor of kappa light polypeptide gene 1.36761 0.585914 enhancer in B-cells 3 (avian)
13 NM_003482 MLL2 myeloid/lymphoid or mixed-lineage leukemia 2 0.144465 5.6308
14 AA960998 NRBF-2 nuclear receptor binding factor 2 1.69908
15 NM_016264 GIOT-2 zinc finger protein 44 (KOX 7) 0.547601
SWI/SNF related, matrix associated, actin 16 NM_139045 SMARCA2 0.327181 dependent
88 Chapter 3
Reporter BioSequence Related No. Database Entry Gene Designation E/F* F/E* [GenBank/EM Symbol BL/DDBJ ]
TAF2 RNA polymerase II, TATA box binding 17 NM_003184 TAF2 0.65446 1.25394 protein (TBP)-associated factor, 150kDa
18 AF307851 TP53 tumor protein p53 (Li-Fraumeni syndrome) 0.368223
Group2 Protein Complex Assembly
19 NM_001809 CENPA centromere protein A, 17kDa 1.77679 0.565823
20 NM_153757 DRLM nucleosome assembly protein 1-like 5 1.67958 0.648751
Group3 Metabolism-related
21 NM_004969 IDE insulin-degrading enzyme 0.644802
22 AI031979 CTSD cathepsin D (lysosomal aspartyl protease) 0.379389
23 AU137033 HYAL2 hyaluronoglucosaminidase 2 1.726 0.7034
glucosidase, alpha; acid (Pompe disease, glycogen 24 X55079 GAA 0.583942 storage disease type II)
25 BG914051 VHL von Hippel-Lindau tumor suppressor 0.605216
26 AI123671 PCL1 prenylcysteine oxidase 1 0.364268
proteasome (prosome, macropain) subunit, alpha 27 NM_148976 PSMA1 0.297135 2.77843 type, 1
proteasome (prosome, macropain) subunit, beta 28 NM_002793 PSMB1 0.567427 type, 1
proteasome (prosome, macropain) subunit, beta 29 BC000268 PSMB2 1.11628 0.594878 type, 2
phosphate regulating gene with homologies to 30 Y08111 PHEX endopeptidases on the X chromosome 0.497292 2.07172 (hypophosphatemia, vitamin D resistant rickets)
31 NM_012486 PSEN2 presenilin 2 (Alzheimer disease 4) 5.86966 0.268556
Group4 Nucleic Acid Binding
32 NM_001358 DDX15 DEAH (Asp-Glu-Ala-His) box polypeptide 15 0.66752
89 Chapter 3
Reporter BioSequence Related No. Database Entry Gene Designation E/F* F/E* [GenBank/EM Symbol BL/DDBJ ]
33 AK025432 KIAA0564 KIAA0564 protein 0.657244
DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, 34 AU125885 DDX3 0.633531 X-linked
35 NM_004260 RECQL4 RecQ protein-like 4 0.493797
36 AA287923 WRN Werner syndrome 0.611293
Group5 Kinase
transforming growth factor, beta receptor I (activin 37 NM_004612 TGFBR1 1.95816 0.437126 A receptor type II-like kinase, 53kD)
38 AL022069 RPS6KA2 ribosomal protein S6 kinase, 90kDa, polypeptide 2 0.618872
39 BG506561 PRKY protein kinase, Y-linked 0.563421
40 BE080188 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1.69839 0.807201
41 NM_002314 LIMK1 LIM domain kinase 1 0.537366
PRP4 pre-mRNA processing factor 4 homolog B 42 NM_003913 PRP4 0.640288 (yeast)
43 BE278206 STK25 serine/threonine kinase 25 (STE20 homolog, yeast) 0.650519
Group6 Metal Ion or Lipid Binding
44 AL121929 KIAA0418 KIAA0418 gene product 1.19607 0.623839
45 BF934583 CA10 carbonic anhydrase X 1.13099 0.59781
46 NM_014717 KIAA0390 zinc finger protein 536 0.725212 1.52784
Group7 Protease
ATG4 autophagy related 4 homolog A (S. 47 AL031177 AUTL2 1.51506 0.836711 cerevisiae)
Group8 Cell Cycle Related
Homo sapiens, hypothetical protein FLJ20400, 48 AB038162 CTF8 clone MGC:4613 IMAGE:3504183, mRNA, 0.592913 1.6351 complete cds
90 Chapter 3
Reporter BioSequence Related No. Database Entry Gene Designation E/F* F/E* [GenBank/EM Symbol BL/DDBJ ]
49 AA654793 ACPP acid phosphatase, prostate 1.1468 0.632642
Group9 Apoptosis Regulator
50 AA129678 BNIP2 BCL2/adenovirus E1B 19kDa interacting protein 2 0.398061
51 BE408610 MCL1 myeloid cell leukemia sequence 1 (BCL2-related) 0.667052
52 AA932166 TEGT testis enhanced gene transcript (BAX inhibitor 1) 0.610797 1.26319
Group10 Solute Carrier Family
solute carrier family 1 (glial high affinity glutamate 53 NM_004172 SLC1A3 1.10667 0.56012 transporter), member 3
solute carrier family 29 (nucleoside transporters), 54 AI500247 SLC29A2 0.591481 1.291 member 2
solute carrier family 7 (cationic amino acid 55 AL553162 SLC7A7 0.496151 transporter, y+ system), member 7
solute carrier family 24 (sodium/ potassium/ 56 AW337854 ESTs 0.546513 calcium exchanger), member 4
solute carrier family 15 (H+/peptide transporter), 57 NM_021082 SLC15A2 0.543218 member 2
solute carrier family 6 (neurotransmitter 58 NM_016615 SLC6A13 1.55135 transporter, GABA), member 13
solute carrier family 7 (cationic amino acid 59 AB018009 SLC7A5 0.463722 1.93955 transporter, y+ system), member 5
Group11 Membrane component
60 NM_006953 UPK3 uroplakin 3A 0.52285
complement component (3d/Epstein Barr virus) 61 J03565 CR2 0.609537 receptor 2
62 BF689099 UGT2B7 UDP glycosyltransferase 2 family, polypeptide B7 0.443442 2.00997
63 K02766 C9 complement component 9 0.729357 1.70912
91 Chapter 3
Reporter BioSequence Related No. Database Entry Gene Designation E/F* F/E* [GenBank/EM Symbol BL/DDBJ ]
64 NM_001766 CD1D CD1D antigen, d polypeptide 0.714793 1.58757
tumor necrosis factor (ligand) superfamily, member 65 AF053712 TNFSF11 1.50802 0.852848 11
66 AL571972 FCGRT Fc fragment of IgG, receptor, transporter, alpha 1.53155
67 AI733487 CDH16 cadherin 16, KSP-cadherin 0.521801
68 NM_004338 C18orf1 chromosome 18 open reading frame 1 1.62708
transmembrane 7 superfamily member 1 69 NM_003272 TM7SF1 0.734098 1.94979 (upregulated in kidney)
70 AA524523 KIAA0475 family with sequence similarity 20, member B 1.7456 0.531604
71 NM_005724 TSPAN-3 transmembrane 4 superfamily member 8 0.566562
72 M28825 CD1A CD1A antigen, a polypeptide 0.505375 1.25676
73 AW084810 ESTs CD63 antigen (melanoma 1 antigen) 0.654519
74 AI674944 ESTs anthrax toxin receptor 2 2.36781
75 L08176 CCR7 chemokine (C-C motif) receptor 7 0.430542
76 NM_004872 C1orf8 chromosome 1 open reading frame 8 0.526627
77 NM_002499 NEO1 neogenin homolog 1 (chicken) 0.557343
78 AI935615 ESTs discoidin, CUB and LCCL domain containing 1 3.82308 0.173974
integrin, alpha E (antigen CD103, human mucosal 79 BG030569 ITGAE 0.635 1.32229 lymphocyte antigen 1; alpha polypeptide)
Un-Clustered
80 AI949200 ESTs hypothetical protein LOC339005 0.637553 1.4617
sparc/osteonectin, cwcv and kazal-like domains 81 AC005213 SPOCK 1.59803 0.587816 proteoglycan (testican)
82 N62332 ESTs malignant T cell amplified sequence 1 0.403753
83 AW968237 KIAA1915 KIAA1915 protein 1.22303 0.434403
84 NM_000928 PLA2G1B phospholipase A2, group IB (pancreas) 1.69666
92 Chapter 3
Reporter BioSequence Related No. Database Entry Gene Designation E/F* F/E* [GenBank/EM Symbol BL/DDBJ ]
85 Z82215 APOL1 apolipoprotein L, 1 1.67456 0.748414
pleckstrin homology domain containing, family C 86 BI088121 MIG2 1.35411 0.646197 (with FERM domain) member 1
87 W07797 EBNA1BP2 LOC440585 0.548363
88 AB007875 KIAA0415 KIAA0415 protein 0.62937
89 AI475246 SC65 synaptonemal complex protein SC65 0.68562 1.55077
90 AA044052 ESTs DnaJ (Hsp40) homolog, subfamily D, member 1 1.62343
91 BG621010 TFPI2 tissue factor pathway inhibitor 2 0.647439
spastic paraplegia 21 (autosomal recessive, Mast 92 NM_016630 ACP33 0.714242 1.53274 syndrome)
93 NM_002844 PTPRK protein tyrosine phosphatase, receptor type, K 0.657302
94 AA811728 ESTs hypothetical protein FLJ31952 0.647938 1.91521
95 AA831946 HMMR hyaluronan-mediated motility receptor (RHAMM) 0.584421
96 NM_005125 CCS copper chaperone for superoxide dismutase 0.437668 2.28317
97 W56891 KIAA0277 Rap guanine nucleotide exchange factor (GEF) 5 0.472392
98 AU148702 FLJ00005 similar to hypothetical protein 1.70617 0.647626
neurofibromin 1 (neurofibromatosis, von 99 AK026658 ESTs 0.954743 1.55468 Recklinghausen disease, Watson disease)
100 NM_173177 C1D nuclear DNA-binding protein 2.10257
neuroblastoma RAS viral (v-ras) oncogene 101 AI740449 ESTs 1.62793 homolog
102 NM_002430 MN1 meningioma (disrupted in balanced translocation) 1 1.88642 0.368136
KH domain containing, RNA binding, signal 103 AA007604 T-STAR 0.558468 1.56929 transduction associated 3
104 AL049699 ME1 malic enzyme 1, NADP(+)-dependent, cytosolic 0.376027 2.38107
93 Chapter 3
Reporter BioSequence Related No. Database Entry Gene Designation E/F* F/E* [GenBank/EM Symbol BL/DDBJ ]
amyloid beta precursor protein (cytoplasmic tail) 105 D86981 APPBP2 0.564645 binding protein 2
pleckstrin homology domain containing, family G 106 N70181 KIAA1209 0.404025 (with RhoGef domain) member 1
107 AI970199 PCNT1 pericentrin 1 0.560355 2.21384
epidermal growth factor receptor pathway substrate 108 NM_004447 EPS8 1.6692 0.749712 8
109 NM_001819 CHGB chromogranin B (secretogranin 1) 1.40663 0.614239
110 BF002799 PDGFC platelet derived growth factor C 0.64368
serine (or cysteine) proteinase inhibitor, clade B 111 BG186517 SERPINB6 1.72629 0.803125 (ovalbumin), member 6
ATPase, H+ transporting, lysosomal (vacuolar 112 NM_001692 ATP6B1 proton pump), beta polypeptide, 56/58kD, isoform 0.625294 1.39819 1 (Renal tubular acidosis with deafness).
113 AV717451 KYNU kynureninase (L-kynurenine hydrolase) 1.645
114 AB051514 KIAA1727 KIAA1727 protein 0.567228 1.23821
115 BF663123 IGHM hypothetical protein MGC27165 1.53246 0.327576
NADH dehydrogenase (ubiquinone) Fe-S protein 2, 116 NM_004550 NDUFS2 1.82203 0.326055 49kDa (NADH-coenzyme Q reductase)
117 AL359403 ESTs mitochondrial malonyltransferase 0.338448
solute carrier family 9 (sodium/hydrogen 118 AA578802 SLC9A3R1 1.28124 0.600318 exchanger), isoform 3 regulator 1
119 NM_006322 TUBGCP3 tubulin, gamma complex associated protein 3 0.669178 1.33223
120 BG214706 MGC2817 chromosome 6 open reading frame 168 0.645428 1.44629
pleckstrin homology, Sec7 and coiled-coil domains 121 NM_004227 PSCD3 1.92381 0.830905 3
122 AW172295 LRP4 low density lipoprotein receptor-related protein 4 1.8546
94 Chapter 3
Reporter BioSequence Related No. Database Entry Gene Designation E/F* F/E* [GenBank/EM Symbol BL/DDBJ ]
123 NM_000365 TPI1 triosephosphate isomerase 1 2.70987
124 NM_004339 PTTG1IP pituitary tumor-transforming 1 interacting protein 0.369853 1.96669
125 BF594783 KIAA0450 phospholipase C-like 4 1.86521
126 NM_014610 G2AN alpha glucosidase II alpha subunit (G2AN) 0.666523 1.2801
127 AI308071 TIMM10 chromosome 10 open reading frame 9 1.74458 0.685588
128 NM_002220 ITPKA inositol 1,4,5-trisphosphate 3-kinase A 1.40279 0.48547
129 NM_020300 MGST1 microsomal glutathione S-transferase 1 0.61822 1.4388
small glutamine-rich tetratricopeptide repeat 130 AI420520 LOC54557 1.22156 0.580165 (TPR)-containing, beta
131 NM_006417 MTAP44 interferon-induced protein 44 0.540247
132 AI915271 KIAA0500 KIAA0500 protein 0.468335 1.55553
protein disulfide isomerase related protein 133 NM_004911 ERP70 0.647582 (calcium-binding protein, intestinal-related)
134 NM_004374 COX6C cytochrome c oxidase subunit VIc 1.60569 0.765876
135 AA442833 LC27 lysosomal associated protein transmembrane 4 beta 1.5826
136 AI224509 SCYA19 chemokine (C-C motif) ligand 19 0.599386 1.70316
137 BE298183 TREX2 three prime repair exonuclease 2 0.592946
138 NM_012383 OSTF1 osteoclast stimulating factor 1 0.598705
139 BF792323 CTBP1 C-terminal binding protein 1 1.54159
140 NM_001631 ALPI alkaline phosphatase, placental-like 2 0.546421 1.10833
141 AL138078 FLJ12707 chromosome 14 open reading frame 133 1.88768 0.574438
142 NM_006393 NEBL nebulette 0.608801 1.52232
143 M91029 AMPD2 adenosine monophosphate deaminase 2 (isoform L) 0.688637 1.64654
TNFRSF10 tumor necrosis factor receptor superfamily, member 144 BC001281 3.94551 0.23244 B 10b
95 Chapter 3
Reporter BioSequence Related No. Database Entry Gene Designation E/F* F/E* [GenBank/EM Symbol BL/DDBJ ]
145 NM_003003 SEC14L1 SEC14-like 1 (S. cerevisiae) 0.45162
cytochrome P450, family 2, subfamily A, 146 AW577399 CYP2A7 1.74161 0.682756 polypeptide 7
147 AV660068 ID2 ribosomal protein L10a 0.39196
148 AW673080 KIAA0157 KIAA0157 1.17664 0.600507
149 NM_002056 GFPT1 glutamine-fructose-6-phosphate transaminase 1 2.94932
protein tyrosine phosphatase, non-receptor type 22 150 AA401425 ESTs 1.51988 (lymphoid)
151 NM_006336 ZYG chromosome 9 open reading frame 60 2.30261 0.447622
152 AI138733 RP4-622L5 hypothetical protein RP4-622L5 0.669493
tumor necrosis factor (ligand) superfamily, member 153 NM_003810 TNFSF10 0.531543 1.11642 10
potassium large conductance calcium-activated 154 BI084703 KCNMA1 0.668955 1.16608 channel, subfamily M, alpha member 1
155 R13843 ESTs carnitine O-octanoyltransferase 0.625168
156 BF685744 SIP2-28 calcium and integrin binding 1 (calmyrin) 3.17533
157 AB032974 KIAA1148 putative ankyrin-repeat containing protein 1.5033 0.520876
158 NM_002024 FMR1 fragile X mental retardation 1 0.576182 1.27371
159 AI580135 ESTs CDA02 protein 1.25219 0.662501
160 M62958 RDS retinal degeneration, slow (retinitis pigmentosa 7) 0.523858 1.71143
161 NM_014888 FAM3C family with sequence similarity 3, member C 0.368377
162 AW513199 CRH corticotropin releasing hormone 0.473504
163 NM_000880 IL7 interleukin 7 0.23226
164 NM_022746 FLJ22390 hypothetical protein FLJ22390 0.612002 1.78521
165 NM_000329 RPE65 retinal pigment epithelium-specific protein 65kDa 0.783886 1.59009
166 BF131935 DC2 DC2 protein 0.814363 1.77971
96 Chapter 3
Reporter BioSequence Related No. Database Entry Gene Designation E/F* F/E* [GenBank/EM Symbol BL/DDBJ ]
167 NM_004039 ANXA2 annexin A2 1.68944 0.638843
168 NM_003375 VDAC2 voltage-dependent anion channel 2 1.31635 0.605203
pescadillo homolog 1, containing BRCT domain 169 NM_014303 PES1 0.582199 (zebrafish)
BAC clone RP11-498M11 from 2, complete 170 AC018891 ESTs 0.494941 1.75071 sequence
Homo sapiens cDNA clone IMAGE:2935104 3-, 171 AW592246 ESTs 1.84752 0.56252 mRNA sequence
Homo sapiens cDNA clone IMAGE:491135 5', 172 AA114849 ESTs 1.79402 0.582737 mRNA sequence
* E/F: expression level in the Ashmg1/E cell line / expression level in the cDNA3/F cell line.
F/E: expression level in the cDNA3/F cell line / expression level in the Ashmg1/E cell line. The blank cells in the E/F and the F/E columns represent suboptimal signals.
3.3.4 Potential HMGB1-Associated Pathway
All the genes with 1.5-fold or higher differential expression level were
analyzed by the Pathwayassist software using “Build Pathway”. Among these 172
genes, 91 genes could be recognized by the software and 16 proteins were found to
be connected into one network as shown in Figure 3.1. The interactions among the
nodes of the network are listed in Table 3.4. In this network, p53 is the key node,
indicating that the p53 protein may play a key role in these related proteins. It is
possible that the HMGB1 protein may influence the expression levels of the other
genes in this network via its interaction with the p53 protein.
97 Chapter 3
Figure 3.1 Putative Interacting Pathways among the Differentially Expressed Genes. Genes identified by the PathwayassistTM software as nodes of direct interacting pathways are shown. The differentially expressed genes identified through the microarray analysis are indicated in red; other genes and target molecules are in gray. The elliptical nodes represent normal proteins; the berry-shaped nodes represent transcriptional factors; the rod-shaped nodes represent trans-membrane proteins and the diamonds represent signal molecules.
98 Chapter 3
Table 3.4 Interaction among the Nodes of the Networks
Type Nodes Effect
Binding CBFA2T1 ---- CBFA2T2
Binding MDM2 ---- E2F1
Binding SMARCA2 ---- E2F1
Binding TNFSF10 ---- TNFRSF10B
Binding TNFSF10 ---- TNFSF11
Binding TP53 ---- CBFA2T1
Binding TP53 ---- CR2
Binding TP53 ---- E2F1
Binding TP53 ---- HMGB1
Binding TP53 ---- MDM2
Binding TP53 ---- TNFSF10
Direct Regulation E2F1 ---| MDM2 negative
Direct Regulation MDM2 ---| TP53 negative
Direct Regulation SMARCA2 ---| E2F1 negative
Direct Regulation TNFSF10 --+> TNFRSF10B positive
Direct Regulation MDM2 ---> E2F1 unknown
Expression E2F1 ---| MDM2 negative
Expression MDM2 ---| TP53 negative
Expression SMARCA2 ---| E2F1 negative
Expression TP53 ---| E2F1 negative
Expression E2F1 --+> TP53 positive
Expression HMGB1 --+> MDM2 positive
Expression IL7 --+> TNFSF11 positive
Expression TNFSF10 --+> TNFRSF10B positive
Expression TP53 --+> MDM2 positive
99 Chapter 3
Type Nodes Effect
Expression TP53 --+> TNFRSF10B positive
Expression CD1A ---> CD1D unknown
Expression MDM2 ---> E2F1 unknown
Expression MDM2 ---> TP53 unknown
Expression TNFRSF10B ---> TNFSF10 unknown
Expression TP53 ---> MDM2 unknown
Expression TP53 ---> PSEN2 unknown
Mol Synthesis* MDM2 ---| TP53 negative
Mol Synthesis E2F1 --+> TP53 positive
Mol Synthesis MDM2 --+> TP53 positive
Mol Transport* MDM2 ---- TP53 negative
Mol Transport E2F1 ---> TP53 unknown
Mol Transport MDM2 ---> TP53 unknown
Mol Transport TP53 ---> MDM2 unknown
Mol Transport E2F1 ---- TP53
Mol Transport MDM2 ---- TP53
Mol Transport MDM2 ---> E2F1
Mol Transport TP53 ---> TNFRSF10B
Promoter Binding TP53 ---> MDM2 unknown
Regulation CBFA2T1 ---| TP53 negative
Regulation E2F1 ---| CD1A negative
Regulation MDM2 ---| TP53 negative
Regulation MDM2; g1 phase; TP53 negative
Regulation SMARCA2 ---| E2F1 negative
Regulation TNFRSF10B ---| TNFSF10 negative
Regulation TP53; MDM2; FHIT negative
100 Chapter 3
Type Nodes Effect
Regulation CBFA2T2 --+> CBFA2T1 positive
Regulation E2F1 --+> TP53 positive
Regulation HMGB1 --+> TP53 positive
Regulation IL7 --+> TNFSF11 positive
Regulation MDM2 --+> E2F1 positive
Regulation MDM2 --+> TP53 positive
Regulation TNFRSF10B --+> TNFSF10 positive
Regulation TNFSF10 --+> TNFRSF10B positive
Regulation TNFSF10 --+> TP53 positive
Regulation TNFSF11 --+> TNFSF10 positive
Regulation TP53 --+> ANXA2 positive
Regulation TP53 --+> MDM2 positive
Regulation TP53 --+> TNFRSF10B positive
Regulation TP53 --+> TNFSF10 positive
Regulation E2F1 ---> MDM2 unknown
Regulation IL7 ---> TNFSF11 unknown
Regulation MDM2 ---> TP53 unknown
Regulation TNFRSF10B ---> TNFSF10 unknown
Regulation TNFRSF10B ---> TP53 unknown
Regulation TNFSF11 ---> CCR7 unknown
Regulation TP53 ---> E2F1 unknown
Regulation TP53 ---> MDM2 unknown
Regulation TP53 ---> TNFRSF10B unknown
Prot Modification* MDM2 ---> TP53 unknown
Prot Modification TP53 ---> MDM2 unknown
Prot Modification EP300; TP53; MDM2; MDM4
101 Chapter 3
Type Nodes Effect
GSK3B; TNFSF10; GADD45A; Phosphatidylinositol 3-kinase; IL7; Prot Modification CTGF; caffeine
TP53; GSK3B; HDAC5; PTCH; MAPK14; MMS; YY1; PPP1R15A; Prot Modification CHEK2; cadmium; cisplatin; EP300; MDM2; MDM4; histone deacetylase; ATM
AKT1; FcgammaRI; wortmannin; TGFB1; INS; GEF; heme; Orthovanadate; PTEN; PDPK1; LGI1; MST1R; ANGPT4; TNFSF10; RIPK1; CTF1; cytochalasin B; IGF1; PTK2; carbachol; pyrvinium pamoate; PDGFRA; VEGF; BTC; c2-ceramide; okadaic acid; calyculin a; THBS1; ly294002; PRL; finasteride; UCN; RAS small monomeric GTPase; EGF; FGF2; E2; Phosphatidylinositol 3-kinase; IFNB1; IFNG; cilostazol; L_NAME; 5-hydroxydecanoate; palmitate; channel inhibitor; Prot Modification NGFB; estradiol; ARG2; RHOA; platelet-derived growth factor; insulin receptor; MAP2K1; MAPK3; protein tyrosine kinase; GDNF; IL7; radicicol; PRKCI; andrographolide; PD 98,059; capsaicin; 5-fluoro-2-methyl-1-(4-methylthiobenzylidene)inden- 3-ylacetic acid; SMC2L1; map kinase; AMP; IL1B; MPA; Roscovitine; aspirin; LPS; MAP2K2; GH1; CSF2; Ganoderma lucidum; DTNBP1; polysaccharides; ETV6; PDGFB; choline phosphatase; caffeine; HSPCA; piceatannol; ANGPT1; EGFR
* Mol Synthesis: molecule synthesis; Mol Transport: molecule transport; Prot Modification: protein modification.
3.4 Discussion
In this study, the expression profile the HMGB1 down-regulated MCF-7 cell line was analyzed in comparison to the control MCF-7 cell line. Among the total
9182 known human genes and ESTs tested in the microarray, 96 genes were down-regulated and 76 genes were up-regulated in the HMGB1 suppressed
MCF-7 cells. In addition, 79 of the genes with 1.5 fold or higher expression level change are found to be in 11 functional groups, namely the transcription factor,
102 Chapter 3 protein complex assembly, nucleic acid binding, proteasome, cell cycle related, apoptosis regulator, metabolism-related, kinase, metal ion or lipid binding, membrane fragment and solute carrier families. Analysis using the
PathwayassistTM software showed that 16 proteins among the 172 differently expressed genes are connected into a network with p53 as the key node. These findings indicate the scale of influence of HMGB1 has on the expression of other genes in the cell and provided the first step to understand the intracellular
HMGB1-associated networks.
3.4.1 Functional Classification of the Differentially Expressed
Genes
In the present study, it has been demonstrated that in the HMGB1 down-regulated MCF-7 cell line, the expression level of 172 genes are perturbed by 1.5-fold or more. 79 out of the 172 genes are classified into 11 different functional groups. These findings indicate that the lowered HMGB1 level leads to a wide-spread expression profile change in the MCF-7 cells. These up-regulated or down-regulated genes encode proteins that are involved in many diverse intracellular processes from metabolism to transcriptional regulation. Most probably, the changed expression profile is caused by an alteration in the transcription-regulatory activity resulted from a decrease level of the HMGB1 protein. Although HMGB1 binds to DNA without sequence preference, HMGB1 could precisely regulate a variety of transcriptional processes through its interaction and cooperation with other sequence-specific DNA-binding proteins
(Thomas and Travers, 2001). As introduced in Section 1.4.3, HMGB1 is involved in diverse transcription processes of specific genes through its physical interaction with different transcriptional factors such as HOXD9, Oct-4, p53, p73, the Rel
103 Chapter 3 family, the steroid hormone receptors and the sterol regulatory element-binding proteins. So it is not surprising that the lowered HMGB1 level has lead to the changed expression of a great number of genes.
To understand the intracellular processes influenced by the lowered HMGB1 level in the MCF-7 cell line, the genes of the 11 functional groups as well as the unclustered genes were analyzed as follow.
Group 1: Transcription Factors
This first group includes 18 genes, with 11 of them being down-regulated and
7 up-regulated. These include both general transcription factor genes and specific transcription factor genes. For example, GTF2H3 is a 34-KD component of the general transcription complex TFIIH involved in the basal transcription of protein coding genes (Fukuda et al., 2001). TAF2 gene encodes a protein that interacts with the TATA box binding protein (TBP) and consequently involves in the assembly of the transcription factor IID (TFIID) complex (Martin et al., 1999).
Since the TFIID complex is one of the basal transcription complexes in the initiation of transcription by RNA polymerase II, HMGB1 is probably capable of influencing the RNA polymerase II transcription through the TAF2 protein.
Another up-regulated gene is RELB, a member of the Rel/ NF-κB specific transcription factor family. The RelB protein could form heterodimers with p50 and p52 (processed forms of NF-κB1 and NF-κB2) (Weih and Caamano, 2003) and the RelB/ NF-κB complexes play important regulatory roles in the differentiation and maturation of immune organs, including dendritic cells (Zanetti et al., 2003) and lymph nodes (Weih and Caamano, 2003). Previous studies have identified that HMGB1 interacts and cooperates with the Rel family proteins
(Agresti et al., 2003). Therefore, it is important to investigate the molecular
104 Chapter 3 mechanism via which HMGB1 regulates the expression of the RELB protein in future studies.
Group 2: Genes Related to Protein Complex Assembly
There are two genes, CENPA and DRLM, in this group. They were both up- regulated. The CENPA protein is a member of the centromere protein family, a component of the protein complex maintaining the centromere structure (Black et al., 2004). The changed expression of CENPA suggests that HMGB1 may affect the centromere formation.
Group 3: Genes Related to Metabolism
This group consists of 11 genes; 7 genes were down-regulated while 4 genes were up-regulated.
Several genes in this group are related to tumor pathogenesis, such as CTSD,
VHL, PSMA1, PSMB1, PSMB1 and HYAL2. The CTSD protein is an aspartic protease that ubiquitously degrades protein in lysosomes (de Duve, 1983). Recent studies have revealed that CTSD is a stimulator of tumor angiogenesis and metastasis (Liaudet-Coopman et al., 2006). The wild type VHL protein is one of the ubiquitin ligases, which target a variety of proteins for proteasome degradation.
One main target of the VHL protein is hypoxia-inducible factor alpha (HIFα), a key regulator in hypoxia responses and other cellular processes. Mutation of the
VHL protein causes the pathogenesis of clear cell renal cell carcinoma (An and
Rettig, 2005). PSMA1, PSMB1 and PSMB1 are subunits of the 20S proteosome, a large protein complex that functions as a proteinase to degrade proteins in a non-lysosomal manner (Nandi et al., 1997). It plays an essential role in cell cycle control by degrading the various cell cycle control and tumor suppressor proteins.
105 Chapter 3
Dysfunctional proteosome may cause abnormal cell proliferation (Gillessen et al.,
2002; Delcros et al., 2003). HYAL2 is a member of the family of hyaluronoglucosaminidases, which could degrade hyaluronan, a component of the extracellular matrix. Hyaluronan and hyaluronoglucosaminidases have been found to be cell proliferation and tumor invasion related (Stern, 2005). The observed altered expression level of these tumor-related genes in this experiment supports the suggestion that HMGB1 has a potential regulation role in the pathogenesis of cancer (Evans et al., 2004; Zeh and Lotze, 2005).
Another interesting finding is that the GAA (acid alpha-glucosidase) mRNA level decreased to less than half in the HMGB1 down-regulated MCF-7 cells. This was confirmed by real-time RT-PCR (Table 3.2). As a key enzyme in carbohydrate metabolism, GAA degrades glycogen, maltose, and isomaltose. GAA dysfunction leads to accumulation of glycogen and finally deficient glycogen metabolism
(Raben et al., 2002). Abundant glycogen was revealed in the liver of dead
HMGB1−/− mice while little or no glycogen was contained in the control ones.
The accumulation of glycogen may be due to the lowered GAA level and thus inefficient glycogen metabolism. This inability to use glycogen may result in hypoglycaemia and eventually the death of the HMGB1−/− mice in 24 hours after birth (Calogero et al., 1999).
Group 4: Nucleic Acid Binding Proteins
Five genes are in this group. Three were up-regulated, including DDX3,
DDX15 and KIAA0564 while two, RECQL4 and WRN, were down-regulated.
DDX3 and DDX15 are members of the DDX protein family, a group of RNA helicases containing conserved DEAH (Asp-Glu-Ala-His) boxes (Abdelhaleem,
2005). The functions of DDX3 and DDX15 may be RNA splicing related (Fouraux
106 Chapter 3 et al., 2002; Abdelhaleem, 2005).
In contrast, RECQL4 and WRN are members of the DNA helicase superfamily, which have functions in various DNA processes, including replication, transcription and DNA repair. Mutations of RECQL4 and WRN cause the autosomal recessive disorder Rothmund-Thomson syndrome and Werner syndrome, respectively (Kellermayer, 2004; Lee et al., 2005).
Group 5: Kinases
This group consists of 3 down-regulated genes and 4 up-regulated genes.
Interestingly, all the four up-regulated kinases (TGFBR1, RPS6KA2, PRKY and
MAP3K7) are nodes of the human MAPK signaling pathway (KEGG: Kyoto
Encyclopedia of Genes and Genomes; http://www.genome.jp/kegg/pathway/hsa/ hsa04010.html). It has been demonstrated that extracellular HMGB1 could trigger
RAGE or TLR receptors and cause the activation of downstream MAPK signaling pathway (Sorci et al., 2004;Yang et al., 2005). However, the influence of intracellular HMGB1 on the MAPK signaling pathway has not been revealed.
Thus the molecular mechanism on how intracellular HMGB1 affects MAPK signaling pathway needs further study.
Group 6: Metal Ion or Lipid Binding Proteins
There are three genes in this group. KIAA0418 and CA10 were up-regulated while KIAA0390 were down-regulated. CA10 is a zinc ion-binding enzyme of the zinc metal enzyme family with the ability of reversible hydration and dehydration of CO2 (Taniuchi et al., 2005). The down-regulated KIAA0390 gene also encodes a zinc ion-binding protein (Nagase et al., 1997), but its function is unclear.
Group 7: Proteases
107 Chapter 3
Only one up-regulated gene AUTL2 is classified into this group. As a member of the APG4 family of cysteine proteases, AUTL2 could cleave its target proteins, for example, the C-terminus of the GATE-16 protein (Scherz-Shouval et al., 2003).
Group 8: Cell Cycle Related Proteins
Two genes exist in this group. The down-regulated CTF8 gene encodes one subunit of the CTF18 replication factor C (RFC) complex which is involved in sister chromatid cohesion construction through its interaction with proliferating cell nuclear antigens (Merkle, et al., 2003). The up-regulated gene ACPP encodes an acidic protein phosphatase which acts as a negative regulator in prostate cancer cell cycle by degrading lysophosphatidic acid (Tanaka et al., 2004). Analysis of the
ACPP promoter revealed the existence of a non-consensus NF-κB biding site. This binding site is recognized in vitro by two members of the NF-κB family, the p65 and the p50 proteins. The p65 protein activates the expression of the ACPP promoter-driving reporter plasmid while the p50 protein suppresses its expression
(Zelivianski et al., 2004). At the same time, the binding of p65/p65 to DNA is decreased by HMGB1 but the binding of p50/p50 to DNA increases with the presence of HMGB1 (Agresti et al., 2003). Therefore, it is possible that HMGB1 functions as a negative regulator in ACPP expression by decreasing the binding of the p65/p65 activator and increasing the binding of the p50/p50 repressor to the
ACPP promoter. A lowered HMGB1 level will thus result in an increase in ACPP expression.
Group 9: Apoptosis Regulators
There are three genes in this group; BNIP2 and TEGT were down-regulated while MCL1 was up-regulated.
108 Chapter 3
The BNIP2 protein belongs to the adenovirus E1B 19 KD-interacting protein
(BNIP) family and acts a regulator through its interaction with the bcl-2, E1B or
Cdc42GAP proteins (Zhou et al., 2005). The TEGT protein functions as the inhibitor of the BAX protein and plays a role in anti-apoptosis in both proper and pathogenic processes (Huckelhoven 2004). As a member of the BCL2 protein family, the MCL1 protein is an essential regulator in apoptosis; the up-regulation of MCL1 leads to survival whereas the down-regulation or degradation of MCL1 results in apoptosis (Michels et al., 2005; Yang-Yen, 2006).
Group10 Solute Carrier Family
There are seven genes in this group, among which 3 genes were up-regulated.
The solute carrier family is composed of a large number of transmembrane proteins. They are capable of transporting various molecules into the cell and play important roles in a variety of physiological processes (Saier, 2000). The expression level of the solute carriers is influenced by a variety of molecules, such as steroid and glucose. For example, it has been demonstrated that SLC29A2 level was reduced by D-glucose treatment in full-term normal pregnancies derived human umbilical vein endothelial cells (Aguayo et al., 2005). Another example is that the expression of SLC1A3 was activated with estrogen treatment in mouse brain derived astrocytes (Pawlak et al., 2005). Previous studies have revealed the interaction and cooperation between HMGB1 and estrogen receptors (Romine et al., 1998; Zhang et al., 1999; Das et al., 2004). Therefore, most probably, HMGB1 may regulate the expression level of SLC1A3 through its interaction with the estrogen receptor and the estrogen response element.
Group11 Membrane component
109 Chapter 3
This group is composed of 20 genes; 13 were down-regulated and 7 genes were up-regulated.
As an important member of the TNF ligand-receptor superfamily, TNFSF11 is a membrane-bound or extracellular protein that functions as a cytokine
(Maruyama et al., 2005). A variety of inflammatory factors such as TNF, IL-1,
IL-6 and IL-17 could induce the expression of TNFSF11. After being released from the cell, TNFSF11 interacts with its receptor protein RANK and triggers a variety of intercellular pathways, including the p38 (MAPK)–MK2 pathway and the c-Src/PI3K/AKT signaling complexes, to activate the transcription of downstream genes (Schett et al., 2005).
As a component of the UDP glucuronosyltransferase2 family, the UGT2B7 protein is located in the endoplasmic reticulum and the nuclear membrane
(Radominska-Pandya et al., 2002). It plays an important role in estrogen metabolism (Turgeon et al., 2001). It has been found that there are several potential transcription factor binding sites, including Oct-1 and C/EBP, in the promoter region of the human UGT2B7 gene (Carrier et al., 2002). The microarray data showed that CEBPA was also down-regulated in the HMGB1 suppressed
MCF-7 cell line. Since HMGB1 could cooperate with the Oct family proteins in transcriptional regulation processes (Butteroni et al., 2000), a possible explanation of the lowered UGT2B7 level in the HMGB1 suppressed MCF-7 cell line may be less cooperation between the HMGB1 and Oct-1 or CEBPA proteins, resulting from lowered HMGB1 and CEBPA protein levels.
Unclustered Genes
This group consists of 93 genes; 52 were down-regulated while 41 were up-regulated.
110 Chapter 3
Importantly, the microarray data showed that lower expression levels of the
RDS and RPE65 genes were found in the HMGB1 down-regulated cells. RDS encodes a transmembrane glycoprotein, which exists at rod outer segment (ROS) disk rims and is involved in disk morphogenesis (Tam et al., 2004). The RPE65 protein is located in the retinal pigment epithelium and plays a role in the vitamin
A regeneration in the chromophore cycle (Bok, 2005). Previous studies have demonstrated that both RDS and RPE65 genes are related to the pathogenesis of retinal degeneration (Bok, 2005).
Given that an Oct-1 site exists in the promoter region of the human RPE65 gene (Boulanger et al., 2000) and HMGB1 cooperates with Oct family proteins
(Butteroni et al., 2000), it is possible that HMGB1 may regulate RPE65 expression through its interaction with Oct-1. HMGB1 may therefore function as a regulator in retinal development and maintenance.
3.4.2 Potential HMGB1-Assocated Network
To find out the potential interactions among the differentially expressed genes,
PathwayassistTM Software was applied to analyze the 172 genes. A complex network with p53 as the key node was drawn by the software, correlating with the previous view that HMGB1 is an important co-activator of p53. The p53 protein is a tumor suppressor and plays an essential role in the G0/G1 phase transition in the cell cycle. In response to a variety of cell stress signals, p53 activates a group of downstream genes and causes cell cycle arrest or apoptosis. The mutation or dysfunction of p53 usually leads to tumor formation (Lu, 2005; Harris and Levine,
2005; Steele and Lane, 2005).
Previous studies demonstrated that HMGB1 is a unique co-activator of p53 and this activation is accomplished through bending of the DNA and enhancing
111 Chapter 3 binding of p53 to its target sequence (Jayaraman et al., 1998; McKinney and
Prives, 2002). In this activation process, both the HMG-A box and the acidic C-tail of the HMGB1 protein are crucial for the interaction between HMGB1 and p53
(Banerjee and Kundu, 2003).
In the HMGB1 suppressed MCF-7 cells, the expression level of the p53 gene decreased to about 1/3 of the original level, which was confirmed by quantitive real-time RT-PCR (Table 3.3). Probably, HMGB1 may regulate the expression of p53 gene and also affect the expression of other genes via its binding to and co-activation of p53.
In summary, 172 genes are differentially expressed in the HMGB1 down-regulated MCF-7 cell line. These genes could be classified into 11 different groups according to their functions in the cell. For example, 18 genes fall into the transcription factor group, 11 genes are involved in the metabolism-related group and 20 genes are in the membrane component group. These findings suggested that
HMGB1 are involved in diverse cellular processes. Moreover, it is found that
HMGB1 is a key member in a network with p53 as the key node.
112 Chapter 4
Chapter 4 The HMGB1/p53/MDM2/E2F1 Network
4.1 Introduction
Sixteen of the genes differentially expressed in the HMGB1 down-regulated
MCF-7 cells (Ashmg1/E) form a network with p53 as the key node. In the
Ashmg1/E cells, the p53 mRNA level decreased to about 1/3 that of the control cells. Since HMGB1 is a co-activator of p53 (Jayaraman et al., 1998), it is likely that HMGB1 may affect expression of other genes through its interaction with the p53 protein.
p53 is one of the most widely studied tumor suppressor proteins. It plays an essential role in the G0/G1 phase transition in the cell cycle. Loss of p53 function usually results in dysfunction of cell cycle control and consequently leads to tumorigenesis (Steele and Lane, 2005). In the cell cycle checkpint control process, p53 functions as a transcription factor. It could induce expression of many downstream genes in response to various cell stress signals (Lu, 2005; Harris and
Levine, 2005; Steele and Lane, 2005). p53 binds to DNA in a sequence specific manner and activates promoters containing the consensus sequence:
5’-PuPuPuC(A/T)(T/A)GpyPyPyN0-13PuPuPuC(A/T)(A/T)GpyPyPy-3’ (el-Deiry et al., 1992).
HMGB1 may regulate binding of p53 to its target DNA sequence by bending the DNA (McKinney and Prives, 2002). For example, HMGB1 suppresses p53 transactivation of the Bax promoter in the Saos-2 cells, but it enhances activation of the same promoter in the lung cancer cell line H1299 (Stros et al., 2002). Both the A box and acidic C-tail of the HMGB1 protein are crucial in its interaction with p53 (Banerjee and Kundu, 2003).
113 Chapter 4
In the p53-centered network, another two genes may also play important roles; one is MDM2, which could be transactivated by the p53 protein and in turn could promote p53 protein to degrade rapidly in a feedback loop (Figure 4.1)
(Zauberman et al., 1995; Iwakuma and Lozano, 2003); the other is E2F1 which up-regulates the p53 protein level both directly and indirectly (Figure 4.2) (Bell and Ryan, 2004; Stanelle and Putzer, 2006).
Figure 4.1 Major Activities Implicated for p53 and MDM2. (Figure adopted from Alarcon-Vargas and Ronai, 2002).
To rapidly respond to cell damage signals, p53 is usually regulated at the post-transcriptional level by stabilizing and activating the protein (Fu et al., 1996;
Oren, 1999). The half-life of the wild type human p53 protein is only about 20–30 minutes (Hinds et al., 1990), making p53 stability control crucial in regulation of p53 activity. The MDM2 protein, an E3 ubiqutin ligase, plays the role of a repressor in this control. It directly binds to the N terminus of the p53 protein and leads p53 to proteasomal degradation (Iwakuma and Lozano, 2003). On the other hand, the intrinsic P2 promoter of the human MDM2 gene contains two p53
114 Chapter 4 response elements and the p53 protein could directly up-regulate MDM2 expression at the transcriptional level (Zauberman et al., 1995). Thus, the p53 and
MDM2 proteins form a negative feed back loop that precisely regulates p53 activity (Figure 4.1) (Alarcon-Vargas and Ronai, 2002; Kohn and Pommier, 2005).
Figure 4.2 E2F1 Promotes Apoptosis in Both p53-dependent and p53-independent Manners.
In the p53-dependent pathway, E2F1 activates p14ARF, which in turn stabilizes p53 by inhibiting its proteosomal degradation by mouse double minutes 2 (MDM2). The p53-independent apoptosis induced by E2F1 occurs via direct upregulation of other downstream genes such as p73 (Figure adopted from Stanelle and Putzer, 2006).
The E2F1 protein belongs to the E2F transcription factor family (E2F1-6) which plays a crucial role in the cell cycle control through forming heterodimer with DP1 or DP2 protein (Trimarchi and Lees, 2002; Ginsberg, 2002; Bell and
Ryan, 2004). E2F1 is capable of inducing apoptosis via both p53-dependent and independent pathways (Figure 4.2) (Stanelle and Putzer, 2006). E2F1 could transcriptionally activate the production of the ARF (aliases p14ARF and p19ARF )
115 Chapter 4 proteins which interact with the MDM2 protein and thereby prevent MDM2 from binding and degrading the p53 protein. Thus, E2F1 stabilizes and activates the p53 protein indirectly. Moreover, E2F1 could up-regulate p53 through direct interaction with it (Trimarchi and Lees, 2002; Ginsberg, 2002; Bell and Ryan,
2004). E2F1 could also induce p53-independent apoptosis by activation of other downstream genes such as p73 (Figure 4.2) (Stanelle and Putzer, 2006).
Since the p53 level is decreased in the HMGB1 down-regulated cells, it is important to study the role of HMGB1 on p53 expression. The MDM2 and E2F1 proteins are also important members of the p53 network. Therefore, it is important to investigate the regulatory role of HMGB1 on MDM2 and E2F1 expression as well. In this study, the MCF-7, the Ashmg1/E and the Saos-2 cells were co-transfected with the HMGB1-encoding plasmid and the luciferase reporter gene plasmids driven by the human p53, MDM2 or E2F1 promoters to study the regulatory role of HMGB1 on these genes. In addition, the p53-encoding plasmid was also used in parallel experiments to check the effect of p53 on the regulatory role of HMGB1.
4.2 Materials and Methodologies
4.2.1 Materials
Wizard SV Gel and PCR Clean-up System and Dual-Luciferase® Reporter
(DLR) Assay System were purchased from Promega. Other materials used were the same as those described in Section 2.2.1.
4.2.2 Cell lines
MCF-7 and Saos-2 cells were purchased from ATCC. Saos-2 is a Homo
116 Chapter 4 sapiens (human) bone epithelial osteosarcoma cell line, which was established from an 11-year-old Caucasian female. The photos and detailed information of
MCF-7 and Saos-2 cells are listed in Appendix I.
4.2.3 Cell Culture
MCF-7 Cells were incubated in DMEM (Invitrogen) with 10% FBS
(Invitrogen) and 100 units/mL penicillin and 100 µg/mL streptomycin (Invitrogen) at 37℃ in 5% CO2, 80% humidity condition. Saos-2 cells were cultured in DMEM
(Invitrogen or Hyclone) with 10% FBS (Invitrogen or Hyclone) and 100 units/mL penicillin and 100 µg/mL streptomycin (Invitrogen) at 37℃ in 5% CO2, 80% humidity condition. The transformed Ashmg1/E MCF-7 cells were cultured in
DMEM (Invitrogen) with 10% FBS (Invitrogen) and 0.6 mg/mL G418 (Promega) at 37℃ in 5% CO2 , 80% humidity condition. Cells were continuously cultured and subcultured every 3 to 4 days as described in Section 2.2.5. The subculturing ratio of MCF-7 cells was 1:3 to 1:6. The subculturing ratio of Saos-2 cells was 1:2 to
1:4.
4.2.4 Genomic DNA Purification
Genomic DNA was purified by the Wizard® Genomic DNA Purification Kit
(Promega) as described in Section 2.2.10.1. The quality and concentration of the genomic DNA were determined by spectrophotometry and the genomic DNA samples were stored at 4℃ for later use.
4.2.5 Purification of PCR Products and DNA from Agarose Gels
DNA was purified from PCR or agarose gels by Wizard SV Gels and PCR
Clean-up System (Promega) according to the manufacturer’s instruction. Briefly,
DNA was loaded into standard agarose gels and separated by electrophoresis. The
117 Chapter 4 gel slice containing the DNA fragment was cut by a clean razor blade under a long-wavelength UV lamp and weighed in a new 1.5 mL microcentrifuge tube. An approximate amount of membrane binding solution was added into the gel slice at a ratio of 1:1000 (V/W) and mixed by vortexing. The mixture was incubated at
50–65℃ for about 10 minutes and mixed vigorously by vortexing every 3 minutes until the gel slice was completely dissolved. The dissolved gel mixture was loaded onto the SV Minicolumn followed by incubation at RT for 1 minute. Then the column was centrifuged at 13,000 g for 1 minute and the flow-through liquid was discarded. 700 µL of membrane wash solution diluted with 95% ethanol was added to the column and the column was centrifuged at 13,000 g for 1 minute.
After the liquid was discarded, the column was washed again with 500 µL of membrane wash solution and centrifuged at 13,000 g for 5 minutes, followed by centrifugation at 13,000 g for 1 minute. The column was inserted into a clean 1.5 mL microcentrifuge tube and 50 µL of Nuclease-Free water was loaded onto the center of the column followed with incubation at RT for 1 minute. Finally, DNA was collected from the column by centrifugation at 13,000 g for 1 minute and stored at –20℃ for later use. For PCR products, gel purification is not required.
The PCR reaction mixtures were mixed with an equal volume of membrane binding solution by inverting up and down several times and then loaded onto the
SV Minicolumn directly.
4.2.6 Plasmids Preparation
4.2.6.1 Construction of Expression Plasmids
To clone the HMGB1 coding region (1-648 base), total RNA extracted from the MCF-7 cells was reversely transcribed into a human cDNA pool as described in Section 2.2.9 and the cDNA pool was used as template in the following PCR
118 Chapter 4 reaction. The PCR mixture for HMGB1 cDNA contained 10 µL of 2 × PCR Master
Mix (Promega or Bio-Rad), 1 µL of forward primer TP53_cDNA_F (10 µM), 1 µL of reverse primer TP53_cDNA_R (10 µM), 2 µL of the 1:20 diluted cDNA mixture and an appropriate amount of distilled water to a final volume of 20 µL.
The PCR reaction conditions were 5 minutes at 95℃ and then 30 cycles of 30 seconds at 94℃, 30 seconds at 55℃ and 90 seconds at 72℃, followed by 5 minutes at 72℃.
Table 4.1 Primers Used for Construction of Expression and Reporter Plasmids
Purpose Gene Primer Name Sequence 5’-CATAAGCTTATGGAGGAGCCGC TP53_cDNA_F p53 AGTCAGATCCTAG–3’ (TP53) 5’-GCCGAATTCCTAGTCTGAGTCA TP53_cDNA_R Expression GGCCCTTCTGTCT–3’ vector HMGB1_cDNA_ 5’-CATAAGCTTATGGGCAAAGGA F GATCCTAAGAAG –3’ HMGB1 HMGB1_cDNA_ 5’-GCCGAATTCTTAATCATCATCAT R CATCTTCTTCTTCATC–3’ Firefly 5'-GCGGGTACCGATCCAGCTGAGA TP53_Pro_F luciferase GCAAACGCAA-3' p53 reporter 5’-GCGCCCGGGCCAATCCAGGGA TP53_Pro_R plasmid AGCGTGTCAC-3’ *Restriction Enzyme Sites: AAGCTT (Hind III), GAATTC (EcoR I), CTCGAG (Xho I), GGTACC (Kpn I), CCCGGG (Sma I).
To clone the coding region of p53 (base 1-1182), total RNA extracted from
MCF-7 cells was used as template in one step RT-PCR reactions. Each PCR mixture contained 12.5 µL of 2 × reaction mix (Promega or Bio-Rad), 1 µL of forward primer (10 µM), 1 µL of reverse primer (10 µM), 1 µL of Taq DNA
Polymerase, 400 ng (for p53 gene) of DNase-treated total RNA and an appropriate amount of distilled water to a final volume of 25 µL. The PCR reaction conditions were 30 minutes at 55℃, 2 minutes at 94℃ and then 40 cycles of 15 seconds at
119 Chapter 4
94℃, 30 seconds at 55℃ and 90 seconds at 68℃, followed by 5 minutes at 68℃.
The corresponding primers used in these PCR procedures are listed in Table 4.1.
The PCR products were separated by gel electrophoresis and purified from the agarose gel using the Wizard SV Gel and PCR Clean-up System. To construct the expression plasmids of the human HMGB1 and p53 genes, the purified fragments of the PCR products were digested with the appropriate restriction enzymes as shown in Table 4.1 (enzyme sites are underlined). The digested DNA fragments were then inserted into the linearized pcDNA3 vectors. The ligation reactions were performed as described in Section 2.2.3.2. Then competent E. coli cells were transformed with the ligation mixtures, spread onto LB agar plates containing 50 µg/mL of ampicillin and cultured at 37 ℃ overnight. The constructed plasmids were extracted from the transformed bacterial colonies, digested with appropriate enzymes and screened by agarose gel electrophoresis.
The selected plasmids were sequenced to check whether the inserted sequences were identical to the expected ones. The recombinant HMGB1-encoding and p53-encoding plasmids were designated pcDNA3-HMGB1 and pcDNA3-TP53 respectively (Table 4.2).
4.2.6.2 Construction of Promoter-containing Reporter Plasmids
To construct the p53 luciferase reporter plasmid TP53-luc, the promoter sequence of the human p53 gene (–345 to + 114 bases) (Attwooll et al., 2002) was amplified from the genomic DNA of the MCF-7 cells using PCR. The PCR mixture contained 20 µL of 2 × PCR Master Mix (Promega or Bio-Rad), 2 µL of forward primer TP53_Pro_F (10 µM), 2 µL of reverse primer TP53_Pro_R (10
µM), 65 ng of the genomic DNA and distilled water to a final volume of 40 µL.
120 Chapter 4
The PCR reaction conditions were 5 minutes at 95℃ and then 35 cycles of 30 seconds at 94℃, 30 seconds at 55℃ and 90 seconds at 72℃, followed by 5 minutes at 72℃. The PCR products were separated by gel electrophoresis and purified from the agarose gel using the Wizard SV Gel and PCR Clean-up System.
Then the p53 promoter DNA fragment was treated with appropriate restriction enzymes as shown in Table 4.1 (enzyme sites were underlined). The digested fragment was ligated with the linearized pGL3-Basic plasmid. The ligation was carried out as described in Section 2.2.3.2. The competent E. coli cells were transformed with the ligation mixture, spread onto LB agar plates containing 50
µg/mL of ampicillin and cultured at 37℃ overnight. The constructed plasmids extracted from the transformed bacterial colonies were digested with appropriate enzymes and screened by gel electrophoresis. The selected plasmid was then sequenced to check whether the inserted fragment was identical to the designed one. The recombinant p53 promoter-containing plasmid was designated TP53-luc
(Table 4.2).
The MDM2 luciferase reporter plasmid MDM2-luc was a gift from Dr. J. M.
Shohet and named as the MDM2-luc WT luciferase reporter plasmid in their study.
MDM2-luc contained an 898-bp fragment of the human MDM2 P2 promoter
(bases –602 to +296 of the MDM2 human promoter; the first nucleotide of exon 2 being +1) ligated into the pGL3-Basic plasmid (Slack et al., 2005). The luciferase reporter plasmid E2F1-luc was a gift from Dr. W. D. Cress and contained a 315-bp fragment of the human E2F1 promoter inserted into the pGL2-Basic plasmid
(Johnson et al., 1994). Plasmids pGL3-Basic and pRL-TK were purchased from
Promega.
121 Chapter 4
Table 4.2 Expression and Reporter Plasmids
Name Origins Description
Invitrogen, A gift
pcDNA3 from Prof. Dr. A.K. Expression cloning vector Bosserhoff Constructed in this Expression plasmid containing the pcDNA3-HMGB1 study human HMGB1 gene
Constructed in this Expression plasmid containing the pcDNA3-TP53 study human p53 gene
pGL3-Basic Promega Firefly luciferase reporter vector
Constructed in this Human p53 promoter-driving TP53-luc study firefly luciferase reporter plasmid A gift from Dr. J. M. Human MDM2 promoter-driving MDM2-luc Shohet firefly luciferase reporter plasmid
A gift from Dr. W. D. Human E2F1 promoter-driving E2F1-luc Cress firefly luciferase reporter plasmid Stratagene, A gift p53 response reporter plasmid p53-luc from Dr. R. containing 14 direct repeats of p53 Fukunaga response elements A gift from Dr. B. p53-dependent promoter driving PG13-luc Vogelstein firefly luciferase reporter plasmid Negative control plasmid of A gift from Dr. B. MG15-luc PG13-luc with mutated Vogelstein p53-binding elements
pRL-TK Promega Renilla luciferase reporter plasmid
4.2.5.3 p53 Response Reporter Plasmid
The p53 response reporter plasmid p53-luc, containing 14 direct repeats of the transcription recognition sequences for the p53 protein, was a gift from Dr. R.
122 Chapter 4
Fukunaga (Watanabe-Fukunaga et al., 2005). The plasmids PG13-luc and
MG15-luc were gifts from Dr. B. Vogelstein. The PG13-luc plasmid contains a p53-dependent promoter driving the firefly luciferase reporter gene and the
MG15-luc plasmid is the negative control plasmid for PG13-luc with mutated p53-binding elements (el-Deiry et al., 1993).
All the plasmids used in this chapter are listed in Table 4.2 and the schematic maps of pcDNA3, pGL3-Basic, pGL2-Basic, p53-luc and pRL-TK are listed in
Appendix III.
4.2.7 Transient Transfection
3 × 104 each of the original MCF-7 cells, the stably-transfected Ashmg1/E and cDNA3/F MCF-7 cells, and 2 × 104 of the Saos-2 cells were separately plated in
0.125 mL of DMEM, 10% FBS media without antibiotics in each well of a 96-well plate and incubated at 37℃ , 5% CO2, one day before transfection.
To study the endogenous p53 activity in HMGB1 down-regulated MCF-7 cells, 125 ng of the first reporter plasmid (p53-luc, PG13-luc, MG-15 or pGL3-Basic) and 10ng of the second reporter plasmid pRL-TK were co-transfected into the Ashmg1/E and cDNA3/F cells in each well, respectively, using LipofectamineTM2000.
To investigate the effect of exogenous HMGB1 on the TP53, MDM2 or E2F1 promoters in the MCF-7, the Ashmg1/E and the Saos-2 cell lines, 50 ng or 100 ng of the expression plasmid (pcDNA3-HMGB1 or pcDNA3-TP53), 125 ng of the first reporter plasmid (TP53-luc, MDM2-luc, E2F1-luc) and 10ng of the second reporter plasmid pRL-TK were co-transfected into cells in each well using
LipofectamineTM2000. In each transfection, an appropriate amount of the pcDNA3 plasmid was added into the mixture so that the total amount of plasmid DNA
123 Chapter 4 added into each well was constant.
To investigate the dose response of exogenous HMGB1 on the MDM2 promoter in Saos-2 cells, increasing amounts of pcDNA3-HMGB1 (12.5 ng, 25 ng,
50 ng, 125 ng or 250 ng), 25 ng of pcDNA3-TP53, 125 ng of MDM2-luc and 10ng of pRL-TK plasmids were co-transfected into each well using
LipofectamineTM2000. Similarly, appropriate amounts of pcDNA3 plasmid were added into the mixtures so that the total amount of plasmid DNA added into each comparable well was constant.
The transfection processes were carried out as described in Section 2.2.6.
After transfection, cells were incubated at 37℃ in 5% CO2 for about 48 hours before the luciferase assay.
4.2.8 Luciferase Reporter Assay
At about 48 hours after transfection, cells were washed with PBS twice and lysed with 30 µL of passive lysis buffer. Luciferase activity of cell lysate was assayed using the Dual-Luciferase® Reporter (DLR) Assay System (Promega) and the TD 20/20 luminometer (Turner BioSystems). Briefly, 20 µL of lysate was mixed with 35 µL of luciferase assay reagent II (LAR II). The firefly luminescence was measured and 35 µL of stop & Glo® reagent was then added to the same tube to quantify the Renilla luciferase activity. The activity of firefly luciferase was divided by the activity of Renilla luciferase to normalize the difference in transfection efficiency. Each transfection was performed in duplicate for at least two times.
124 Chapter 4
4.2.9 Statistical Analysis
The data from luciferase assay were analyzed by the student t-test using the unpaired two-tail mode. Results of P＜0.05 was labeled with * in figures and considered as significant difference. The columns in the figures indicate the mean values with the error bars representing SEM.
4.3 Results
In this study, expression plasmids containing the coding region of the human
HMGB1 and p53 genes, and luciferase reporter plasmid containing the promoter region of human p53 gene were constructed. Firstly, to detect whether there was a change in the p53 activity in the HMGB1 down-regulated MCF-7 cells, the luciferase reporter plasmids containing p53 response elements were transfected into the Ashmg1/E and cDNA3/F cells. The luciferase activities in these two cell lines were compared. Secondly, to study whether HMGB1 could regulate transcription of the human TP53, MDM2 and E2F1 genes, the effect of exogenous
HMGB1 on the activity of these three promoters was examined. Since MDM2 and
E2F1 have been found to be involved in the p53 network (Figure 3.1), the p53 expression plasmid was also introduced into cells to detect whether an increased p53 level could enhance or inhibit the effect of HMGB1 on these promoters. At the same time, the human osteosarcoma cell line Saos-2 that completely lacks endogenous p53 protein (Chen et al., 1990) was also used in the study.
4.3.1 Plasmid Construction
The digested PCR products of the coding region of the human HMGB1 and p53 genes were respectively inserted into the linearized pcDNA3 vector while the digested PCR product of the promoter of human p53 gene was inserted into the
125 Chapter 4 linearized pGL3-Basic vector. Then the ligation mixtures were transformed into E. coli competent cells and single bacterial colonies of each transformed bacteria plate were inoculated and cultured overnight. Plasmid DNA from each plate was extracted and their concentrations were measured by spectrophotometer. The extracted plasmids were digested with the corresponding restriction enzymes and analyzed by agarose gel electrophoresis.
The pcDNA3 plasmid showed one linearized band after double-digestion with
EcoR I and Hind III (Lane 4, Figure 4.3 A), indicating that the EcoR I and Hind III sites are very close to one another and most probably in the MCS region. The size of the pcDNA3 band is between 5–6 kb, corresponding to the expected size of 5.4 kb. Both the digested pcDNA3-HMGB1 and pcDNA3-TP53 plasmids contained two bands (Lanes 6 and 8, Figure 4.3 A). The size of the larger band is the same as that of the linearized pcDNA3 while the sizes of the smaller ones are 600–700 bp and 1000–1500 bp, corresponding to the expected sizes of the human HMGB1 cDNA (648 bp) and the human p53 cDNA (1182 bp), respectively.
The pGL3-Basic plasmid showed one linearized band after Kpn I and Sma I double-digestion (Lane 3, Figure 4.3 B), indicating that the Kpn I and Sma I sites are very close to one another and most probably in the MCS region. The size of the pGL3-Basic band is between 4–5 kb, corresponding to its expected size of 4.8 kb.
The digested TP53-luc plasmid contained two bands (Lane 5, Figure 4.3 B). The sizes of the two bands are 4–5 kb and about 500 bp, corresponding to the expected sizes of the linearized vector (4.8 kb) and the p53 promoter (459 bp), respectively.
126 Chapter 4
Figure 4.3 Gel Electrophoresis of the Plasmids pcDNA3, pcDNA3-HMGB1, pcDNA3-TP53, pGL3-Basic and TP53-luc after Digestion. 1 µg of the plasmids pcDNA3, pcDNA3-HMGB1, pcDNA3-TP53, pGL3-Basic and TP53-luc was digested with corresponding endonucleases at 37℃ for about two hour. After digestion, the mixtures were run in agarose gels. (A) Lanes 1-8 are 1 Kb DNA Ladder (Promega), 100 bp DNA Ladder (Promega), pcDNA3, pcDNA3 (digested with EcoR I and Hind III), pcDNA3-HMGB1, pcDNA3-HMGB1(digested with EcoR I and Hind III), pcDNA3-TP53 and pcDNA3-TP53 (digested with EcoR I and Hind III), respectively. (B) Lanes 1-6 are 1 Kb DNA Ladder (Promega), pGL3-Basic, pGL3-Basic (digested with Kpn I and Sma I), TP53-luc, TP53-luc (digested with Kpn I and Sma I) and PCR Marker (Promega), respectively.
The plasmids pcDNA3-HMGB1, pcDNA3-TP53 and TP53-luc were sequenced by Tech Dragon Limited. The sequencing results of the inserts of these three plasmids confirm that the plasmids pcDNA3-HMGB1, pcDNA3-TP53 and
TP53-luc are correctly constructed. The sequences are listed in Appendix V.
4.3.2 Decreased p53 Activity in the HMGB1 Down-regulated
MCF-7 Cell Line
The relative luciferase activities of plasmids p53-luc and PG13-luc in the
Ashmg1/E cells were about 40% of their corresponding activities in the cDNA3/F cells (Figure 4.4). In contrast, there was no difference on the relative luciferase activities of plasmids MG15-luc (negative control of PG13) and pGL3-Basic
127 Chapter 4 between the Ashmg1/E and cDNA3/F cells (Figure 4.4). Since both the p53-luc and PG13-luc plasmids contain p53 response elements while no functional p53-binding site exists in the MG15 and pGL3-Basic plasmids, these results confirmed that the activity of p53 in the Ashmg1/E cells decreased to about 40% of that in the cDNA3/F cells. This finding is consistent with the results that the mRNA level of p53 in the Ashmg1/E cells was about 1/3 of that in the cDNA3/F cells.
Fig ure 4.4 Relative Luciferase Activities of p53 Response Plasmids in the Ashmg1/E and the cDNA3/F Cell lines.
* indicates significant difference (P＜0.05).
4.3.3 The Effect of Exogenous HMGB1 and p53 on the p53
Promoter
In the MCF-7 cells, the addition of exogenous HMGB1 and p53 proteins by transfecting with the respective expression plasmid showed no significant influence on the TP53 promoter activity (Figure 4.5A). In the Ashmg1/E cells,
128 Chapter 4 exogenous HMGB1 alone did not influence the TP53 promoter activity, but one dose of the p53 plasmid activated the TP53 promoter to about 150% with or without exogenous HMGB1. However, the addition of two doses of the p53 expression plasmid did not show enhancement of the TP53 promoter activity
(Figure 4.5B).
In the Saos-2 cells, regulation on the TP53 promoter was similar to that in the
Ashmg1/E cells. Exogenous HMGB1 alone has no effect on the TP53 promoter activity, but one dose of the p53 plasmid activated the TP53 promoter activity to about 175%. Two doses of the p53 plasmid, however, did not enhance the TP53 promoter activity (Figure 4.5C).
Figure 4.5 Transcriptional Regulation of HMGB1 and p53 on the TP53 promoter in the MCF-7 (A), the Ashmg1/E (B) and the Saos-2 (C) Cell Lines. + indicates one dose of expression plasmid while ++ represents two doses of expression plasmid. * indicates significant difference (P＜0.05).
129 Chapter 4
From these results, it can be shown that the TP53 promoter activity cannot be enhanced by the addition of extra HMGB1 proteins. However, replenishing p53 to its normal level by the addition of p53 expression plasmid can enhance the TP53 promoter activity. This enhancement is abolished when too much of the p53 expression plasmid are used. It indicates that there might be a feedback mechanism that regulates p53 expression and too much p53 might in turn suppress its own expression.
4.3.4 The Effect of Exogenous HMGB1 and p53 on the MDM2
Promoter
In the MCF-7 cells, the addition of one dose of the HMGB1 expression plasmid did not influence the MDM2 promoter activity, but two doses of the
HMGB1 plasmid activated the MDM2 promoter to about 150%. On the other hand, one dose of the p53 expression plasmid alone activated the MDM2 promoter to about 160% while two doses of the p53 expression plasmid did not enhance the
MDM2 promoter activity (Figure 4.6A).
In the Ashmg1/E cells, exogenous HMGB1 has no effect on the MDM2 promoter activity but exogenous p53 enhanced the MDM2 promoter activity. The addition of one dose or two doses of the p53 plasmid activated the MDM2 promoter to about 145% and 160%, respectively (Figure 4.6B). However, one dose of the p53 plasmid in combination with one dose of the HMGB1 plasmid did not show this enhancement.
In the Saos-2 cells, exogenous HMGB1 did not affect the MDM2 promoter activity but the extra p53 proteins induced the MDM2 promoter activity to a high level. One dose and two doses of the p53 plasmid activated the MDM2 promoter
130 Chapter 4 to about 12-fold and 24-fold, respectively. One dose of the p53 plasmid with one dose of the HMGB1 plasmid also activated the MDM2 promoter to about 14-fold
(Figure 4.6C).
Figure 4.6 (A－C) Transcriptional Regulation of HMGB1 and p53 on the MDM2 Promoter in the MCF-7 (A), the Ashmg1/E (B) and the Saos-2 (C) Cell Lines. (D) The Dose Response of MDM2-luc to Increasing Amounts of HMGB1 Plasmid in the Saos-2 Cell Line. + indicates one dose of plasmid while ++ represents two doses of plasmid. — indicates no HMGB1 plasmid and the triangle represents the increased amounts of HMGB1 plasmid. * indicates significant difference (P＜0.05).
The MDM2 promoter activity cannot be influenced by exogenous HMGB1 proteins in the p53-null Saos-2 cells, indicating that HMGB1 cannot regulate the
MDM2 P2 promoter by itself. However, in MCF-7 cells with sufficient amounts of p53, the MDM2 promoter activity was enhanced by extra HMGB1 proteins, suggesting that HMGB1 activates the MDM2 promoter in a p53-dependent manner in the MCF-7 cells. Increasing p53 proteins to its normal level by adding the expression plasmid can enhance the MDM2 promoter activity. However, the addition of too much p53 plasmid in the MCF-7 cells counteracted this
131 Chapter 4 enhancement. Probably, this abolishment results from the negative feed-back loop of p53 expression.
Based on the above findings, dose response of exogenous HMGB1 expression plasmid on the MDM2 promoter was investigated in the Saos-2 cells. The MDM2 promoter activity was not affected by the HMGB1 plasmid at low HMGB1/p53 ratios (W/W), but decreased to about half when the ratio was higher than 5 (Figure
4.6D). It is possible that the HMGB1 protein forms a complex with the p53 protein and, in consequence, prevents p53 from binding to the p53 response elements on the MDM2 promoter. It is also possible that the endogenous MDM2 promoter is activated by the extra HMGB1 and p53 proteins. This may results in a higher level of MDM2 in the cell and consequently more p53 are degraded.
4.3.5 The Effect of Exogenous HMGB1 and p53 on the E2F1
Promoter
In the MCF-7 cells, exogenous HMGB1 and p53 proteins had no significant influence on the E2F1 promoter (Figure 4.7A). In the Ashmg1/E cells, exogenous
HMGB1 alone enhanced the E2F1 promoter to about 140% and 150% with the addition of one dose or two doses of expression plasmid, respectively. One dose of the p53 plasmid had no effect on the E2F1 promoter activity, but two doses of the p53 plasmid suppressed the E2F1 promoter to about 80%. One dose of the
HMGB1 plasmid with one dose of the p53 plasmid showed no significant effect on the E2F1 promoter activity (Figure 4.7B).
In the Saos-2 cells, exogenous HMGB1 alone enhanced the E2F1 promoter activity. The addition of one dose or two doses of the HMGB1 expression plasmid activated the E2F1 promoter to about 180% and 235%, respectively. One dose of the p53 plasmid did not influence the E2F1 promoter activity, but two doses of the
132 Chapter 4 p53 plasmid enhanced the E2F1 promoter to about 125%. One dose of the
HMGB1 plasmid in combination with one dose of the p53 plasmid also activated the E2F1 promoter to about 180% (Figure 4.7C).
These results demonstrated that the E2F1 promoter could be activated by extra HMGB1 proteins. This enhancement exists in the p53-null Saos-2 cells, suggesting that this activation by HMGB1 is p53-independent. The E2F1 promoter activity was suppressed by exogenous p53 proteins in the Ashmg1/E cells while it was enhanced by p53 in the Saos-2 cells. A possible explanation is that p53 could regulate E2F1 expression either downwards or upwards and the effect is cell line-dependent.
Figure 4.7 Transcriptional Regulation of HMGB1 and p53 on the E2F1 Promoter in the MCF-7 (A), the Ashmg1/E (B) and the Saos-2 (C) Cell Lines. + indicates one dose of plasmid while ++ represents two doses of plasmid. * indicates significant difference (P＜0.05).
133 Chapter 4
4.4 Discussion
4.4.1 HMGB1 Does Not Regulate the p53 Promoter Directly
Exogenous HMGB1 alone has no effect on the TP53 promoter activity in any of the MCF-7, Ashmg1/E and Saos-2 cell lines. Probably, HMGB1 regulates p53 expression indirectly through its cooperation with other transcription factors. An
NF-κB binding site 5’-GGGGTTTTCC-3’ is present in the promoter region of the human p53 gene (Wu and Lozano, 1994). Two members of the Rel/NF-κB family, p50 and p65, could bind to this site (Wu and Lozano, 1994; Kirch et al., 1999).
Both the p65/p65 homodimer and the p65/p50 heterodimer can activate p53 expression via the NF-κB binding site (Wu and Lozano, 1994). HMGB1 could enhance binding of p65/p50 to DNA (Agresti et al., 2003). Therefore, it is possible that the lower HMGB1 level reduces p65/p50 binding to DNA and consequently results in lowered p53 expression.
It has been reported that p53 could self-activate via a p53 binding site on its own promoter (Deffie et al., 1993; Wu and Lozano, 1994). Our results confirmed that replenishment of p53 to the normal level enhances the TP53 promoter activity in both the Ashmg1/E and the Saos-2 cells.
4.4.2 HMGB1 Regulates the MDM2 Promoter in a p53-dependent
Manner
Exogenous HMGB1 did not affect the MDM2 promoter activity in the p53-null cells, indicating that the regulatory effect of HMGB1 on MDM2 expression is p53-dependent. High level of exogenous HMGB1 enhanced the
MDM2 P2 promoter activity in the MCF-7 cells, but inhibited the activity in the
Saos-2 cells. These results suggested that the transcriptional influence of HMGB1
134 Chapter 4 on the MDM2 promoter varies in different cell lines. This finding is consistent with the results of an earlier study that transactivation of the MDM2 promoter by p53 was reduced by extra HMGB1 to about 80% in the Saos-2 cells but enhanced in the H1299 cells (Stros et al., 2002). Through its regulation on MDM2 expression, HMGB1 plays an important role in the p53-MDM2 feedback regulatory loop. However, the mechanism of how HMGB1 regulates the MDM2
P2 promoter still needs further investigation.
p53 activates the MDM2 promoter activity directly in the p53-null Saos-2 cells, the p53 down-regulated Ashmg1/E cells and the MCF-7 cells, confirming the previous findings that p53 activates MDM2 expression via the p53 response elements. Intriguingly, in the MCF-7 cells, the activation is abolished by the addition of excess p53 expression plasmids. A possible explanation is that level of endogenous p53 protein in the MCF-7 cells is sufficient for MDM2 expression.
Too much p53 may result in too much MDM2 and this may trigger the rapid degradation of p53 through the negative feed-back loop.
4.4.3 HMGB1 Activates the E2F1 Promoter in a p53-independent
Manner
The E2F1 promoter activity was enhanced by exogenous HMGB1 in both the
Ashmg1/E and the Saos-2 cells, suggesting that HMGB1 activates the E2F1 promoter in a p53-independent manner. This is a novel finding. No transactivation of E2F1 expression by HMGB1 has been reported before. Since, E2F1 is capable of increasing p53 activity through both direct and indirect pathways (Stanelle and
Putzer, 2006), HMGB1 may regulate p53 activity by regulating E2F1 expression.
135 Chapter 4
Probably, when HMGB1 level decreases, less E2F1 protein will be produced and p53 will consequently be down-regulated.
4.4.4 The HMGB1/p53/MDM2/E2F1 Network
In summary, HMGB1 did not regulate the p53 promoter directly. It influences
MDM2 expression in a p53-dependent manner. In addition, HMGB1 activates the
E2F1 promoter activity in a p53-independent manner. On the basis of the present findings and the known regulatory roles of MDM2 and E2F1 on p53 activity, an interactive network can be drawn. It represents the possible relationships between
HMGB1, TP53, MDM2 and E2F1 (Figure 4.8). In this HMGB1/p53/MDM2/E2F1 network, HMGB1 is a very important member.
Figure 4.8 Possible Interactions between HMGB1, p53, MDM2 and E2F1. Arrows indicate stimulation while the horizontal bars represent inhibition.
136 Chapter 5
Chapter 5 Summary
As the most abundant non-histone chromosomal protein in higher eukaryotes, the HMGB1 protein plays an important role in diverse intracellular processes.
Previous studies showed that HMGB1 binds to DNA without sequence specificity but it interacts and cooperates with many different transcription factors such as p53, p73, the Oct family proteins, the Rel/NF-κB family proteins and the steroid hormone receptors. It is possible that HMGB1 affects expression of genes that require these transcription factors. However, information on genes transcriptionally regulated by HMGB1 is still limited. Therefore, this genome wide scale study is focused on genes regulated by the HMGB1 protein.
Firstly, to suppress the HMGB1 expression level, both the siRNA and the anti-sense strategies were used in the breast cancer MCF-7 cells. In transient transfections, both methods could inhibit the HMGB1 expression to about 60% within 48 hours after transfection. In stable transfections, only the anti-sense method could successfully suppress the HMGB1 protein level to about 50% whereas the siRNA method did not influence its expression. Thus, a stable
HMGB1 down-regulated cell line was successfully established with the anti-sense strategy. Real-time RT-PCR showed that the HMGB1 mRNA level in this cell line is also about half of the control, consistent with the lowered protein level.
Integration of the anti-HMGB1 plasmid into the genome of the HMGB1 down-regulated cells and the expression of this anti-HMGB1 gene were confirmed by PCR. The HMGB1 down-regulated MCF-7 cell line along with its control cell line was used in subsequent studies.
Secondly, the expression profiles of these two cell lines were compared using
137 Chapter 5 cDNA microarray that contains a total of 9182 known human genes and ESTs. In the HMGB1 down-regulated MCF-7 cells, 96 genes were down-regulated while 76 genes were up-regulated, indicating the large scale of the influence HMGB1 has on expression of genes in general. Real-time RT-PCR was then used to examine the mRNA expression levels of a selected number of genes.
To analyze these differentially expressed genes, the DAVID software was then used to classify the 172 genes according to their functions. 79 of these genes can be classified into 11 different functional groups, including the transcription factor, protein complex assembly, nucleic acid binding, proteasome, cell cycle related, apoptosis regulator, metabolism-related, kinase, metal ion or lipid binding, membrane fragment and solute carrier families. The remaining 93 genes could not be classified and they form the unclustered group. Possible mechanisms on how
HMGB1 regulates some of these genes may be deduced through our known knowledge on transcription factors that interact with HMGB1. For example,
HMGB1 may induce expression of ACPP, a negative regulator in prostate cancer, through its cooperation with the Rel/NF-κB transcription factors. Through interaction with estrogen receptors, HMGB1 may regulate the expression level of
SLC1A3, one component of the glial high affinity glutamate transporter. UGT2B7, an important regulator in estrogen metabolism pathways, was also down-regulated in the HMGB1 suppressed MCF-7 cells. This down-regulation may result from the cooperation between the HMGB1 and Oct-1 or CEBPA proteins. The HMGB1/Oct complex may also influence the expression of the RPE65 gene, encoding a protein that functions in the maintenance of normal retinal chromophore cycle. Moreover, the analysis has resulted in several important findings: (1) HMGB1 may be involved in tumor pathogenesis through its regulation on a group of tumor
138 Chapter 5 metastasis related genes; (2) Four kinases in the MAPK signaling pathway are up-regulated in the HMGB1 suppressed cells, suggesting the regulatory role of
HMGB1 in this pathway; (3) The expression of the GAA gene, which encodes an enzyme involved in the glycogen metabolism pathway, was also down-regulated with the decrease in HMGB1 expression, indicating the regulatory role of HMGB1 in glycogen/glucose metabolism.
Next, the Pathwayassist software was used to investigate possible interactions among the 172 differentally expressed genes. It shows that 16 proteins are connected into a network with p53 as the key node. The p53 mRNA level in the
HMGB1 down-regulated cell line deceases to about 1/3 of that in the control cells.
Consistently, the p53 activity in this cell line is about 40% of that in the control cell line. This finding indicates that HMGB1 is an important member in the p53 network. Another two genes, MDM2 and E2F1 that function as regulators of p53 activity, are also differentially expressed in the HMGB1 down-regulated cells. It suggests an important regulatory role of HMGB1 in MDM2 and E2F1 expression.
Finally, to study the possible role of HMGB1 in the p53 network, the regulatory effect of HMGB1 on the human p53, MDM2 and E2F1 promoters were investigated. The original MCF-7, the HMGB1 down-regulated MCF-7 and the p53-null Saos-2 cells were transfected with an HMGB1 expression plasmid in combination with the p53, the MDM2 or the E2F1 promoter-containing reporter plasmids. A p53 expression plasmid was also used to study whether the p53 protein could influence the regulation of HMGB1 on these promoters. The results showed that the regulatory effect of HMGB1 on the p53 activity might be achieved through its regulation on MDM2 and E2F1 expression. The regulatory effect of
HMGB1 on the MDM2 promoter is p53-dependent whereas its activation on the
139 Chapter 5
E2F1 promoter is p53-independent. HMGB1 is therefore a very important member of the HMGB1/p53/MDM2/E2F1 network.
In summary, through this study, information on genes influenced by the down-regulated HMGB1 level in the MCF-7 cells is obtained. The possible mechanism on how HMGB1 regulates a selected number of these genes has also been discussed. At the same time, an HMGB1-associated network has been elucidated and the role of HMGB1 in the p53 network has also been studied. These findings will be very essential in understanding the role of HMGB1 in gene expression in general and have paved the way for further studies to pinpoint the function of HMGB1 on expression of specific genes as well as its role in cell proliferation, apoptosis and tumorigenesis.
140 Appendices
Appendices
Appendix I Photos and Information on the MCF-7 and Saos-2 Cell
Lines.
I.1 Photos and Information of the MCF-7 Cells (HTB-22™) Adopted from American Type Culture Collection (ATCC). A: Photos of the MCF-7 cells; B: Detailed Information of the MCF-7 cells.
A:
B: Information of the MCF-7 Cell Lines
ATCC® Number: HTB-22™ Designations: MCF-7 (MCF7)
Depositors: CM McGrath Biosafety level: 1
Organism: Homo sapiens (human)
Growth Properties: adherent Morphology: epithelial
141 Appendices
Source: Organ: mammary gland; breast Cell type: epithelial Disease: adenocarcinoma Derived from metastatic site: pleural effusion
Cellular Products: insulin-like growth factor binding proteins (IGFBP) BP-2; BP-4; BP-5
Permits/Forms: In addition to the Material Transfer Agreement (MTA) mentioned above, other ATCC and/or regulatory permits may be required for the transfer of this ATCC material. Anyone purchasing ATCC material is ultimately responsible for obtaining the permits.
Applications: transfection host
Receptors: estrogen receptor, expressed
Antigen Expression: Blood Type O; Rh+
Age: 69 years adult Gender: female
Ethnicity: Caucasian Comments: The cells express the WNT7B oncogene [PubMed: 8168088]. The MCF-7 line retains several characteristics of differentiated mammary epithelium including ability to process estradiol via cytoplasmic estrogen receptors and the capability of forming domes. Contains the Tx-4 oncogene. Growth of MCF-7 cells is inhibited by tumor necrosis factor alpha (TNF alpha). Secretion of IGFBP's can be modulated by treatment with anti-estrogens.
Propagation: ATCC complete growth medium: Minimum essential medium (Eagle) with 2 mM L-glutamine and Earle's BSS adjusted to contain 1.5 g/L sodium bicarbonate, 0.1 mM non-essential amino acids and 1 mM sodium pyruvate and supplemented with 0.01 mg/ml bovine insulin, 90%; fetal bovine serum, 10% Temperature: 37.0℃ Atmosphere: air, 95%; carbon dioxide (CO2), 5%
Subculturing: Protocol: Remove and discard culture medium. I. Briefly rinse the cell layer with 0.25% (W/V) Trypsin- 0.53 mM EDTA solution to remove all traces of serum which contains trypsin inhibitor. II. Add 2.0 to 3.0 ml of Trypsin-EDTA solution to flask and observe cells under an inverted microscope until cell layer is dispersed (usually within 5 to 15 minutes).
142 Appendices
Note: To avoid clumping do not agitate the cells by hitting or shaking the flask while waiting for the cells to detach. Cells that are difficult to detach may be placed at 37℃ to facilitate dispersal. III. Add 6.0 to 8.0 ml of complete growth medium and aspirate cells by gently pipetting. IV. Add appropriate aliquots of the cell suspension to new culture vessels. V. Incubate cultures at 37℃. Subcultivation ratio: A subcultivation ratio of 1:3 to 1:6 is recommended Medium renewal: 2 to 3 times per week
Preservation: Freeze medium: Complete growth medium supplemented with 5% (v/v) DMSO Storage temperature: liquid nitrogen vapor phase
Doubling Time: 29 hrs
143 Appendices
I.2 Photos and Information of the Saos-2 Cells (HTB-85™) Adopted from American Type Culture Collection (ATCC). A: Photos of the Saos-2 cells; B: Detailed Information of the Saos-2 cells.
A:
B: Information of the Saos-2 Cell Lines
ATCC® Number: HTB-85™ Designations: Saos-2
Depositors: J Fogh, G Trempe. Biosafety level: 1
Organism: Homo sapiens (human)
Growth Properties: adherent Morphology: epithelial
Source: Organ: bone Disease: osteosarcoma
Permits/Forms: In addition to the Material Transfer Agreement (MTA) mentioned above, other ATCC and/or regulatory permits may be required for the transfer of this ATCC material. Anyone purchasing ATCC material is ultimately responsible for obtaining the permits.
144 Appendices
Applications: transfection host
Receptors: epidermal growth factor (EGF); transforming growth factor beta (type 1 and type 2).
Tumorigenic: No, The cells were not tumorigenic in immunosuppressed mice, but did form colonies in semisolid medium.
Antigen Expression: Blood Type B, Rh+; HLA A2, A3, Bw16, Bw47.
Age: 11 years adult Gender: female
Ethnicity: Caucasian
Comments: This is one of an extensive series of human tumor lines isolated and characterized by J. Fogh and G. Trempe. The patient was treated with RTG, methotrexate, adriamycin, vincristine, cytoxan, and aramycin-C.
Propagation: ATCC complete growth medium: McCoy's 5a medium (modified) with 1.5 mM L-glutamine adjusted to contain 2.2 g/L sodium bicarbonate, 85%; fetal bovine serum, 15% Temperature: 37.0℃ Atmosphere: air, 95%; carbon dioxide (CO2), 5%.
Subculturing: Protocol: Remove medium, and rinse with 0.25% trypsin, 0.03% EDTA solution. Remove the solution and add an additional 1 to 2 ml of trypsin-EDTA solution. Allow the flask to sit at room temperature (or at 37℃) until the cells detach. Add fresh culture medium, aspirate and dispense into new culture flasks. Subcultivation ratio: A subcultivation ratio of 1:2 to 1:4 is recommended. Medium renewal: 1 to 2 times per week
Preservation: Freeze medium: Culture medium, 95%; DMSO, 5%
145 Appendices
Appendix II Photos of the Stably-Transfected MCF-7 Cells.
The MCF-7 cell colonies transfected with either pcDNA3 only or pAshmg1 plus pcDNA3. A and B are pcDNA3 transfected MCF7 cells: A : 40 ×; B : 100 ×; C and D are pAshmg1 and pcDNA3 co-transfected MCF7 cells: C : 40 ×; D : 100 ×. Photos were taken by a Nikon camera under an invert microscope (Nikon, Japan).
146 Appendices
Appendix III Schematic Diagrams of the Vector Plasmids.
III.1 Schematic Diagram of pSuppressorNeo Vector (Imgenex). The negative control plasmid contains a scrambled sequence that does not show significant homology to rat, mouse or human gene sequences. The sequence of the insert in the control plasmid is: 5’-TCGATCAGTCACGTTAATGGTCGTTttcaagagaAACGACCATTAACGTGACTGATTTTT -3’ 3’-AGTCAGTGCAATTACCAGCAAaagttctctTTGCTGGTAATTGCACTGACTAAAAAGATC-5’
147 Appendices
III.2 Schematic Diagram of pcDNA3 (Invitrogen). This plasmid has been compiled from information in sequence databases, p ublished sequences, and other sources. This vector has not yet been completely sequenced.
148 Appendices
III.3 Schematic Diagram of pGL3-Basic (Promega). The pGL3 Luciferase Reporter Vectors provide a basis for the quantitative analysis of factors that potentially regulate mammalian gene expression. These factors may be cis-acting, such as promoters and enhancers, or trans-acting, such as various DNA-binding factors. The backbone of the pGL2 Luciferase Reporter Vectors was redesigned for the pGL3 Vectors for increased expression, and contains a modified coding region for firefly (Photinus pyralis) luciferase that has been optimized for monitoring transcriptional activity in transfected eukaryotic cells. The assay of this genetic reporter is rapid, sensitive and quantitative. In addition, the Luciferase Reporter Vectors contain numerous features aiding in the structural characterization of the putative regulatory sequences under investigation (adopted from Promega).
149 Appendices
III.4 Schematic Diagram of pGL2-Basic (Promega). The pGL2 Luciferase Reporter Vectors provide a basis for the quantitative analysis of factors that potentially regulate mammalian gene expression. These factors may be cis-acting, such as promoters and enhancers, or trans-acting, such as various DNA-binding factors. The pGL2 Vectors carry the coding region for firefly (Photinus pyralis) luciferase, used to monitor transcriptional activity in transfected eukaryotic cells. The assay of this genetic reporter is rapid, sensitive and quantitative. In addition, the pGL2 Vectors contain numerous features that aid the characterization and mutagenesis of the putative regulatory sequences (adopted from Promega).
150 Appendices
III.5 Schematic Diagram of pRL-TK (Promega). The pRL-TK Vector is intended for use as an internal control reporter and may be used in combination with any experimental reporter vector to co-transfect mammalian cells. All of the pRL Reporter Vectors contain a cDNA (Rluc) encoding Renilla luciferase, which was originally cloned from the marine organism Renilla reniformis (sea pansy). As described in TB240, the Renilla luciferase cDNA contained within the pRL Vectors has been modified slightly to provide greater utility. The pRL-TK Vector contains the herpes simplex virus thymidine kinase (HSV-TK) promoter to provide low to moderate levels of Renilla luciferase expression in cotransfected mammalian cells. Renilla luciferase is a 36kDa monomeric protein that does not require post-translational modification for activity. Therefore, like firefly luciferase, the enyzme may function as a genetic reporter immediately following translation (adopted from Promega).
151 Appendices
III.6 Schematic Diagram of p53-luc (Stratagene). The firefly luciferase gene of this plasmid is drived by a synthetic promoter that contains direct repeats of the transcription recognition sequences for the tumor suppressor protein p53 (cited from Stratagene).
152 Appendices
Appendix IV Standard Curves of Real-time PCR.
153 Appendices
154 Appendices
155 Appendices
156 Appendices
157 Appendices
Appendix V Sequences of the Expression and Reporter Plasmids
V.1 The Sequencing Result of the Coding Region of the Plasmid pcDNA3- HMGB1. ATGGGCAAAGGAGATCCTAAGAAGC CGAGAGGCAAAATGTCATCATATG CATTTTTTGTGCAAACTTGTCGGGAGGAGCATAAGAAGAAGCACCCAGA TGCTTCAGTCAACTTCTCAGAGTTTTCTAAGAAGTGCTCAGAGAGGTGG AAGACCATGTCTGCTAAAGAGAAAGGAAAATTTGAAGATATGGCAAAA GCGGACAAGGCCCGTTATGAAAGAGAAATGAAAACCTATATCCCTCCCA AAGGGGAGACAAAA AAGAAGTTCAAGGATCCCAATGCACCCAAGAGG CCTCCTTCGGCCTTCTTCCTCTTCTGCTCTGAGTATCGCCCAAAAATCAA AGGAGAACATCCTGGCCTGTCCATTGGTGATGTTGCGAAGAAACTGGG AGAGATGTGGAATAACACTGCTGCAGATGACAAGCAGCCTTATGAAAA GAAGGCTGCGAAGCTGAAGGAAAAATACGAAAAGGATATTGCTGCATAT CGAGCTAAAGGAAAGCCTGATGCAGCAAAAAAGGGAGTTGTCAAGGCT GAAAAAAGCAAGAAAAAGAAGGAAGAGGAGGAAGATGAGGAAGATG AAGAGGATGAGGAGGAGGAGGAAG ATGAAGAAGATGAAGATGAAGAA GAAGATGATGATGATGATTAA
V.2 The Sequencing Result of the Coding Region of the Plasmid pcDNA3- TP53.
ATGGAGGAGCCGCAGTCAGATCCT AGCGTCAAGCCCCCTCTGAGTCAGG AAACATTTTCAGACCTATGGAAACTACTTCCTAAAAACAACGTTCTGTCCC CCTTGCCGTCCCAAGCAATGGATGATTTGATGCTGTCCCCGGACGATATTG AACAATGGTTCACTGAAGACCCAGGTCCAGATGAAGCTCCCAGAATGCC AGAGGCTGCTCCCCGCGTGGCCCCTGCACCAGCAGCTCCTACACCGGCG GCCCCTGCACCAGCCCCCTCCTGGCCCCTGTCATCTTCTGTCCCTTCCCAG AAAACCTACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCTTGCATTCTGG GACAGCCAAGTCTGTGAC TTGCACGTACTCCCCTGCCCTCAACAAGATGT TTTGCCAACTGGCCAAGACCTGCCCTGTGCAGCTGTGGGTTGATTCCACA CCCCCGCCCGGCACCCGCGTCCGCGCCATGGCCATCTACAAGCAGTCACA GCACATGACGGAGGTTGTGAGGCGCTGCCCCCACCATGAGCGCTGCTCA GATAGCGATGGTCTGGCCCCTCCTCAGCATCTTATCCGAGTGGAAGGAAA TTTGCGTGTGGAGTATTTGGATGACA GAAACACTTTTCGACATAGTGTGGT GGTGCCCTATGAGCCGCCTGAGGTTGGCTCTGACTGTACCACCATCCACT ACAACTACATGTGTAACAGTTCCTGCATGGGCGGCATGAACCGGAGGCCC ATCCTCACCATCATCACACTGGAAGACTCCAGTGGTAATCTACTGGGACG GAACAGCTATGAGGTGCGTGTTTGTGCCTGTCCTGGGAGAGACCGGCGC ACAGAGGAAGAGAATCTCCGCAAGAAAGGGGAGCCTCACCACGAGCTG CCCCCAGGGAGCACTAAGCGAGCACTGCCCAACAACACCAGCTCCTCTC CCCAGCCAAAGAAGAAACCACTGGATG GAGAATATTTCACCCTTCAGATC CGTGGGCGTGAGCGCTTCGAGATGTTCCGAGAGCTGAATGAGGCCTTGG AACCCAAGGATGCCCAGGCTGGGA AGGAGCCAGGGGGGAGCAGGGCTC ACTCCAGCCACCTGAAGTCCAAAAAGGGTCAGTCTACCTCCCGCCATAAA AAACTCATGTTCAAGACAGAAGGGCCTGACTCAGACTAG
158 Appendices
V.3 The Sequencing Result of the Insertion of the Plasmid TP53.
GATCCAGCTGAGAGCAAACGCAAAAGCTTTCTTCCTTCCACCCTTCAT ATTTGGCACAATGCAGGATTCCTCCAAAATGATTTCCACCAATTCTGCC CTCACAGCTCTGGCTTGCAGAATTTTCCACCCCAAAATGTCAGTATCTA CGGCACCAGGTCGGCGAGAATCCTGACTCTGCACCCTCCTCCCCAACT CCATTTCCTTTGCTTCCTCCGGCAGGCGGATTACTTGCCCTTACTTGTC ATGGCGACTGTCCAGCTTTGTGCCAGGAGCCTCGCAGGGGTTGATGG GATTGGGGTTTTCCCCTCCCATGTGCTCAAGACTGGCGCTAAAAGTTT TGAGCTTCTCAAAAGTCTAGAGCCACCGTCCAGGGAGCAGGTAGCTG CTGGGCTCCGGGGACACTTTGCGTTCGGGCTGGGAGCGTGCTTTCCA CGACGGTGACACGCTTCCCTGGATTGG
159 Reference
References
Journals: Abbott BL, Colapietro AM, Barnes Yuxiao, Marini F, Andreeff M, Sorrentino BP. (2002). "Low levels of ABCG2 expression in adult AML blast samples." Blood 100(13): 4594-601.
Abdelhaleem M. (2005). "RNA helicases: regulators of differentiation." Clin Biochem. 38(6): 499-503.
Achenbach TV, Brunner B, Heermeier K. (2003). "Oligonucleotide-based knockdown technologies: antisense versus RNA interference." Chembiochem. 4(10): 928-35.
Agresti A, Bianchi ME. (2003). "HMGB proteins and gene expression." Curr Opin Genet Dev. 13(2): 170-8.
Agresti A, Lupo R, Bianchi ME, Muller S. (2003). "HMGB1 interacts differentially with members of the Rel family of transcription factors." Biochem Biophys Res Commun. 302(2): 421-426.
Agresti A, Scaffidi P, Riva A, Caiolfa VR, Bianchi ME. (2005). "GR and HMGB1 interact only within chromatin and influence each other's residence time." Mol Cell Biol. 18(1): 109-21.
Aguayo C, Casado J, Gonzalez M, Pearson JD, Martin RS, Casanello P, Pastor-Anglada M, Sobrevia L. (2005). "Equilibrative nucleoside transporter 2 is expressed in human umbilical vein endothelium, but is not involved in the inhibition of adenosine transport induced by hyperglycaemia." Placenta 26(8-9):
Akira S, Uematsu S, Takeuchi O. (2006). "Pathogen recognition and innate immunity." Cell 124(4): 783-801.
Alarcon-Vargas D, Ronai Z. (2002). "p53-Mdm2--the affair that never ends." Carcinogenesis 23(4): 541-7.
An J, Rettig MB. (2005). "Mechanism of von Hippel-Lindau protein-mediated suppression of nuclear factor kappa B activity." Mol Cell Biol. 25(17): 7546-56.
Andersson U, Erlandsson-Harris H. (2004). "HMGB1 is a potent trigger of
160 Reference arthritis." J Intern Med. 255(3): 344-50.
Attwooll CL, McGown G, Thorncroft M, Stewart FJ, Birch JM, Varley JM. (2002). "Identification of a rare polymorphism in the human TP53 promoter." Cancer Genet Cytogenet 135(2): 165-72.
Banerjee S, Kundu TK. (2003). "The acidic C-terminal domain and A-box of HMGB-1 regulates p53-mediated transcription." Nucleic Acids Res. 31(12): 3236-47.
Bell CW, Jiang W, Reich CF, Pisetsky DS. (2006). "The Extracellular Release of HMGB1 during Apoptotic Cell Death." Am J Physiol Cell Physiol. Jul 19; [Epub ahead of print]:
Bell LA, Ryan KM. (2004). " Life and death decisions by E2F-1." Cell Death Differ. 11(2): 137-142.
Bergeron S, Madathiparambil T, Swanson PC. (2005). "Both high mobility group (HMG)-boxes and the acidic tail of HMGB1 regulate recombination-activating gene (RAG)-mediated recombination signal synapsis and cleavage in vitro." J Biol Chem. 280(35): 31314-24.
Bianchi ME. (2004). "Significant (re)location: how to use chromatin and/or abundant proteins as messages of life and death." Trends Cell Biol. 14(6): 287-93.
Bianchi ME, Manfredi A. (2004). "Chromatin and cell death." Biochim Biophys Acta. 1677(1-3): 181-6.
Black BE, Foltz DR, Chakravarthy S, Luger K, Woods VL Jr, Cleveland DW. (2004). "Structural determinants for generating centromeric chromatin." Nature 430(6999): 578-82.
Boffa LC, Sterner R, Vidali G, Allfrey VG. (1979). "Post-synthetic modifications of nuclear proteins. High mobility group proteins are methylated." Biochem Biophys Res Commun. 89(4): 1322-7.
Bok D. (2005). "Cellular mechanisms of retinal degenerations: RPE65, ABCA4, RDS, and bicarbonate transporter genes as examples." Retina 25(8 Suppl): S18-20.
Bonaldi T, Talamo F, Scaffidi P, Ferrera D, Porto A, Bachi A, Rubartelli A, Agresti A, Bianchi ME. (2003). "Monocytic cells hyperacetylate chromatin protein
161 Reference
HMGB1 to redirect it towards secretion." EMBO J. 22(20): 5551-60.
Boonyaratanakornkit V, Melvin V, Prendergast P, Altmann M, Ronfani L, Bianchi M E, Taraseviciene L, Nordeen SK, Allegretto EA, Edwards DP. (1998). "High-mobility group chromatin proteins 1 and 2 functionally interact with steroid hormone receptors to enhance their DNA binding in vitro and transcriptional activity in mammalian cells." Mol.Cell Biol. 18(8): 4471-87.
Borrmann L, Kim I, Schultheiss D, Rogalla P, Bullerdiek J. (2001). "Regulation of the expression of HMG1, a co-activator of the estrogen receptor." Anticancer Res. 21(1A): 301-5.
Boulanger A, Liu S, Henningsgaard AA, Yu S, Redmond TM. (2000). "The upstream region of the Rpe65 gene confers retinal pigment epithelium-specific expression in vivo and in vitro and contains critical octamer and E-box binding sites." J Biol Chem. 275(40): 31274-82.
Bucci LR, Brock WA, Meistrich ML. (1985). "Heterogeneity of high-mobility-group protein 2. Enrichment of a rapidly migrating form in testis." Biochem J. 229(1): 233-40.
Bustin M. (1999). "Regulation of DNA-dependent activities by the functional motifs of the high-mobility-group chromosomal proteins." Mol Cell Biol. 19(8): 5237-46.
Bustin M. (2001). "Revised nomenclature for high mobility group (HMG) chromosomal proteins." Trends Biochem Sci. 26(3): 152-3.
Bustin M, Neihart NK. (1979). "Antibodies against chromosomal HMG proteins stain the cytoplasm of mammalian cells." Cell 16(1): 181-9.
Bustin M, Trieschmann L, and Postnikov YV. (1995). "The HMG-14/-17chromosomal protein family: architectural elements that enhance transcription from chromatin templates." Semin. Cell Biol. 6(4): 247-55.
Butteroni C, De Felici M, Scholer HR, Pesce M. (2000). "Phage display screening reveals an association between germline-specific transcription factor Oct-4 and multiple cellular proteins." J Mol Biol. 304(4): 529-40.
Calogero S, Grassi F, Aguzzi A, Voigtlander T, Ferrier P, Ferrari S and Bianchi ME. (1999). "The lack of chromosomal protein Hmg1 does not disrupt cell growth
162 Reference but causes lethal hypoglycaemia in newborn mice." Nat. Genet. 22(3): 276-80.
Carrier JS, Turgeon D, Journault K, Hum DW, Belanger A. (2000). "Isolation and characterization of the human UGT2B7 gene." Biochem Biophys Res Commun. 272(2): 616-21.
Chao YB, Scovell WM, Yan SB. (1994). "High mobility group protein, HMG-1, contains insignificant glycosyl modification." Protein Sci. 3(12): 2452-4.
Charoonpatrapong K, Shah R, Robling AG, Alvarez M, Clapp DW, Chen S, Kopp RP, Pavalko FM, Yu J, Bidwell JP. (2006). "HMGB1 expression and release by bone cells." J Cell Physiol. 207(2): 480-90.
Chau KY, Lam HY, Lee KL. (1998). "Estrogen treatment induces elevated expression of HMG1 in MCF-7 cells." Exp Cell Res. 241(1): 269-72.
Chen G, Li J, Ochani M, Rendon-Mitchell B, Qiang X, Susarla S, Ulloa L, Yang H, Fan S, Goyert SM, Wang P, Tracey KJ, Sama AE, Wang H. (2004). "Bacterial endotoxin stimulates macrophages to release HMGB1 partly through CD14- and TNF-dependent mechanisms." J Leukoc Biol. 76(5): 994-1001.
Chen PL, Chen YM, Bookstein R, Lee WH. (1990). "Genetic mechanisms of tumor suppression by the human p53 gene." Science 250(4987): 1576-80.
Chou DK, Evans JE, Jungalwala FB. (2001). "Identity of nuclear high-mobility-group protein, HMG-1, and sulfoglucuronyl carbohydrate-binding protein, SBP-1, in brain." J Neurochem. 77(1): 120-31.
Collins FS, Morgan M, Patrinos A. (2003). "The Human Genome Project: lessons from large-scale biology." Science 300(5617): 286-90.
Corfman RS, Reeck GR, Cook AS, Kenny L, Abdul-Razzak KK, Roberts DK. (1987). "Analysis of chromatin proteins from human placenta." Placenta 8(5): 503-13.
Das D, Peterson RC, Scovell WM. (2004). "High mobility group B proteins facilitate strong estrogen receptor binding to classical and half-site estrogen response elements and relax binding selectivity." Mol Endocrinol 18(11): 2616-32.
Daston MM, Ratner N. (1991). "Expression of P30, a protein with adhesive properties, in Schwann cells and neurons of the developing and regenerating
163 Reference peripheral nerve." J Cell Biol. 112(6): 1229-39. de Duve C. (1983). "Lysosomes revisited." Eur J Biochem. 137(3): 391-7.
Deffie A, Wu H, Reinke V, Lozano G. (1993). “The tumor suppressor p53 regulates its own transcription.” Mol Cell Biol. 13(6): 3415-23.
Delcros JG, Floc'h MB, Prigent C, Arlot-Bonnemains Y. (2003). "Proteasome inhibitors as therapeutic agents: current and future strategies." Curr Med Chem. 10(6): 479-503.
DeMarco RA, Fink MP, Lotze MT. (2005). "Monocytes promote natural killer cell interferon gamma production in response to the endogenous danger signal HMGB1." Mol Immunol 42(4): 433-44.
Dumitriu IE, Baruah P, Valentinis B, Voll RE, Herrmann M, Nawroth PP, Arnold B, Bianchi ME, Manfredi AA, Rovere-Querini P. (2005). "Release of high mobility group box 1 by dendritic cells controls T cell activation via the receptor for advanced glycation end products." J Immunol 174(12): 7506-15.
Einck L, Soares N, Bustin M. (1984). "Localization of HMG chromosomal proteins in the nucleus and cytoplasm by microinjection of functional antibody fragments into living fibroblasts." Exp Cell Res. 152(2): 287-301. el-Deiry WS, Kern SE, Pietenpol JA, Kinzler KW, Vogelstein B. (1992). "Definition of a consensus binding site for p53." Nat Genet. 1(1): 45-9. el-Deiry WS, Tokino T, Velculescu VE, Levy DB, Parsons R, Trent JM, Lin D, Mercer WE, Kinzler KW, Vogelstein B. (1993). "WAF1, a potential mediator of p53 tumor suppression." Cell 75(4): 817-25.
Erlandsson Harris H, Andersson U. (2004). "Mini-review: The nuclear protein HMGB1 as a proinflammatory mediator." Eur J Immunol 34(6): 1503-12.
Evans A, Lennard TW, Davies BR. (2004). "High-mobility group protein 1(Y): metastasis-associated or metastasis-inducing." J Surg Oncol. 88(2): 86-99.
Fages C, Nolo R, Huttunen HJ, Eskelinen E, Rauvala H. (2000). "Regulation of cell migration by amphoterin." J Cell Sci. 113(Pt 4): 611-20.
Fang WH, Yao YM, Shi ZG, Yu Y, Wu Y, Lu LR, Sheng ZY. (2002). "The significance of changes in high mobility group-1 protein mRNA expression in rats
164 Reference after thermal injury." Shock 17(4): 329-33.
Ferrari S, Finelli P, Rocchi M, Bianchi ME. (1996). "The active gene that encodes human high mobility group 1 protein (HMG1) contains introns and maps to chromosome 13." Genomics 35(2): 367-71.
Ferrari S, Ronfani L, Calogero S, Bianchi ME. (1994). "The mouse gene coding for high mobility group 1 protein (HMG1)."J Biol Chem 269(46): 28803-8.
Fouraux MA, Kolkman MJ, Van der Heijden A, De Jong AS, Van Venrooij WJ, Pruijn GJ. (2002). "The human La (SS-B) autoantigen interacts with DDX15/hPrp43, a putative DEAH-box RNA helicase." RNA 8(11): 1428-43.
Frank O, Schwanbeck R, Wisniewski JR. (1998). "Protein footprinting reveals specific binding modes of a high mobility group protein I to DNAs of different conformation." J Biol Chem. 273(32): 20015-20.
Fu L, Minden MD, Benchimol S. (1996). "Translational regulation of human p53 gene expression." EMBO J. 15(16): 4392-401.
Fukuda A, Yamauchi J, Wu SY, Chiang CM, Muramatsu M, Hisatake K. (2001). "Reconstitution of recombinant TFIIH that can mediate activator-dependent transcription." Genes Cells 6(8): 707-19.
Gardella S, Andrei C, Ferrera D, Lotti LV, Torrisi MR, Bianchi ME, Rubartelli A. (2002). "The nuclear protein HMGB1 is secreted by monocytes via a non-classical, vesicle- mediated secretory pathway." EMBO Rep. 3(10): 995-1001.
Gillessen S, Groettup M, Cerny T. (2002). "The proteasome, a new target for cancer therapy." Onkologie 25(6): 534-9.
Ginsberg D. (2002). "E2F1 pathways to apoptosis." FEBS Lett. 529(1): 122-5.
Goodwin GH, Johns EW. (1973). "Isolation and characterisation of two calf-thymus chromatin non-histone proteins with high contents of acidic and basic amino acids." Eur J Biochem. 40(1): 215-9.
Goodwin GH, Sanders C, Johns EW. (1973). "A new group of chromatin-associated proteins with a high content of acidic and basic amino acids." Eur J Biochem. 38(1): 14-9.
Grasser KD, Feix G. (1991). "Isolation and characterization of maize cDNAs
165 Reference encoding a high mobility group protein displaying a HMG-box." Nucleic Acids Res. 19(10): 2573-7.
Hanspal M, Hanspal JS. (1994). "The association of erythroblasts with macrophages promotes erythroid proliferation and maturation: a 30-kD heparin-binding protein is involved in this contact." Blood 84(10): 3494-504.
Hardman CH, Broadhurst RW, Raine AR, Grasser KD, Thomas JO, Laue ED. (1995). "Structure of the A-domain of HMG1 and its interaction with DNA as studied by heteronuclear three- and four-dimensional NMR spectroscopy." Biochemistry 34(51): 16596-607.
Harris HE, Andersson U. (2004). "The nuclear protein HMGB1 as a proinflammatory mediator." Eur. J. Immunol. 34(6): 1503-12.
Harris HE, Raucci A. (2006). "Alarmin(g) news about danger: workshop on innate danger signals and HMGB1." EMBO Rep. 7(8): 774-8.
Harris SL, Levine AJ. (2005). "The p53 pathway: positive and negative feedback loops." Oncogene 24(17): 2899-908.
He Q, Liang CH, Lippard SJ. (2000). "Steroid hormones induce HMG1 overexpression and sensitize breast cancer cells to cisplatin and carboplatin." Proc Natl Acad Sci U.S.A. 97(11): 5768-72.
Hinds PW, Finlay CA, Quartin RS, Baker SJ, Fearon ER, Vogelstein B, Levine AJ. (1990). "Mutant p53 DNA clones from human colon carcinomas cooperate with ras in transforming primary rat cells: a comparison of the "hot spot" mutant phenotypes." Cell Growth Differ. 1(12): 571-580.
Hori O, Brett J, Slattery T, Cao R, Zhang J, Chen JX, Nagashima M, Lundh ER, Vijay S, Nitecki D, et al. (1995). "Mediation of neurite outgrowth and co-expression of rage and amphoterin in the developing nervous system." J Biol Chem. 270(43): 25752-61.
Hrkal Z. (2003). "On the way to functional genomics." Sb Lek. 104(2): 217-22.
Hu L, Lau SH, Tzang CH, Wen JM, Wang W, Xie D, Huang M, Wang Y, Wu MC, Huang JF, Zeng WF, Sham JS, Yang M, Guan XY. (2004). "Association of Vimentin overexpression and hepatocellular carcinoma metastasis." Oncogene 23(1): 298-302.
166 Reference
Huckelhoven R. (2004). "BAX Inhibitor-1, an ancient cell death suppressor in animals and plants with prokaryotic relatives." Apoptosis 9(3): 299-307.
Huttunen HJ, Fages C, Rauvala H. (1999). "Receptor for advanced glycation end products (RAGE)-mediated neurite outgrowth and activation of NF-kappaB require the cytoplasmic domain of the receptor but different downstream signaling pathways." J Biol Chem. 274(28): 19919-24.
Huttunen HJ, Fages C, Kuja-Panula J, Ridley AJ, Rauvala H. (2002). "Receptor for advanced glycation end products-binding COOH-terminal motif of amphoterin inhibits invasive migration and metastasis." Cancer Res. 62(16): 4805-11.
Isackson PJ, Fishback JL, Bidney DL, Reeck GR. (1979). "Preferential affinity of high molecular weight high mobility group non-histone chromatin proteins for single-stranded DNA." J Biol Chem. 254(13): 5569-72.
Iwahara J, Schwieters CD, Clore GM. (2004). "Characterization of nonspecific protein-DNA interactions by 1H paramagnetic relaxation enhancement." J Am Chem Soc. 126(40): 12800-8.
Iwakuma T, Lozano G. (2003). "MDM2, an introduction." Mol Cancer Res. 1(14): 993-1000.
Jayaraman L, Moorthy NC, Murthy KG, Manley JL, Bustin M, Prives C. (1998). "High mobility group protein-1 (HMG-1) is a unique activator of p53." Genes Dev. 12(4): 462-72.
Jiang LI, Sternberg PW. (1999). "An HMG1-like protein facilitates Wnt signaling in Caenorhabditis elegans." Genes Dev. 13(7): 877-89.
Johnson DG, Ohtani K, Nevins JR. (1994). "Autoregulatory control of E2F1 expression in response to positive and negative regulators of cell cycle progression." Genes Dev. 8(13): 1514-25.
Jung Y, Lippard SJ. (2003). "Nature of full-length HMGB1 binding to cisplatin-modified DNA." Biochemistry 42(9): 2664-71.
Kalinina NI, Bobik A, Tkachuk VA. (2006). "Participation of the DNA-binding cytokine amphoterine in triggering the processes of tissue reparation." Ross Fiziol Zh Im I M Sechenova, Russian 92(1): 39-48.
167 Reference
Kellermayer R. (2006). "The versatile RECQL4." Genet Med. 8(4): 213-6.
Kimura K, Katoh N, Sakurada K, Kubo S. (1985). "Phosphorylation of high mobility group 1 protein by phospholipid-sensitive Ca2+-dependent protein kinase from pig testis." Biochem J. 227(1): 271-6.
Kirch HC, Flaswinkel S, Rumpf H, Brockmann D, Esche H. (1999). “Expression of human p53 requires synergistic activation of transcription from the p53 promoter by AP-1, NF-kappaB and Myc/Max.” Oncogene. 18(17): 2728-38.
Kireeva ML, Walter W, Tchernajenko V, Bondarenko V, Kashlev M, Studitsky VM. (2002). "Nucleosome remodeling induced by RNA polymerase II: loss of the H2A/H2B dimer during transcription." Mol Cell Biol. 9(3): 541-52.
Kleinschmidt JA, Scheer U, Dabauvalle MC, Bustin M, Franke WW. (1983). "High mobility group proteins of amphibian oocytes: a large storage pool of a soluble high mobility group-1-like protein and involvement in transcriptional events." J Cell Biol. 97(3): 838-48.
Knapp S, Muller S, Digilio G, Bonaldi T, Bianchi ME, Musco G. (2004). "The long acidic tail of high mobility group box 1 (HMGB1) protein forms an extended and flexible structure that interacts with specific residues within and between the HMG boxes." Biochemistry 43(38): 11992-7.
Kobori N, Clifton GL, Dash P. (2002). "Altered expression of novel genes in the cerebral cortex following experimental brain injury." Brain Res Mol Brain Res. 104(2): 148-58.
Kohn KW, Pommier Y. (2005). "Molecular interaction map of the p53 and Mdm2 logic elements, which control the Off-On switch of p53 in response to DNA damage." Biochem Biophys Res Commun. 331(3): 816-827.
Kokkola R, Andersson A, Mullins G, Ostberg T, Treutiger CJ, Arnold B, Nawroth P, Andersson U, Harris RA, Harris HE. (2005). "RAGE is the major receptor for the proinflammatory activity of HMGB1 in rodent macrophages." Scand J Immunol 61(1): 1-9.
Kokkola R, Li J, Sundberg E, Aveberger AC, Palmblad K, Yang H, Tracey KJ, Andersson U, Harris HE. (2003). "Successful treatment of collagen-induced arthritis in mice and rats by targeting extracellular high mobility group box
168 Reference chromosomal protein 1 activity." Arthritis Rheum 48(7): 2052-8.
Kraulis PJ. (1991). "MOLSCRIPT: a program to produce both detailed and schematic plots of protein structures." J. Appl. Cryst. 24: 946-50.
Kuehl L. (1979). "Synthesis of high mobility group proteins in regenerating rat liver." J Biol Chem. 254(15): 7276-81.
Kurreck J. (2003). "Antisense technologies. Improvement through novel chemical modifications." Eur J Biochem. 270(8): 1628-44.
Lee JW, Harrigan J, Opresko PL, Bohr VA. (2005). "Pathways and functions of the Werner syndrome protein." Mech Ageing Dev. 126(1): 79-86.
Lee KL, Pentecost BT, D'Anna JA, Tobey RA, Gurley LR, Dixon GH. (1987). "Characterization of cDNA sequences corresponding to three distinct HMG-1 mRNA species in line CHO Chinese hamster cells and cell cycle expression of the HMG-1 gene." Nucleic Acids Res. 15(13): 5051-68.
Levy WB, Dixon GH. (1978). "A study of the localization of high mobility group proteins in chromatin." Can J Biochem. 56(6): 480-91.
Li J, Kokkola R, Tabibzadeh S, Yang R, Ochani M, Qiang X, Harris HE, Czura CJ, Wang H, Ulloa L, Wang H, Warren HS, Moldawer LL, Fink MP, Andersson U, Tracey KJ, Yang H. (2003). "Structural basis for the proinflammatory cytokine activity of high mobility group box 1." Mol Med. 9(1-2): 37-45.
Liaudet-Coopman E, Beaujouin M, Derocq D, Garcia M, Glondu-Lassis M, Laurent-Matha V, Prebois C, Rochefort H, Vignon F. (2006). "Cathepsin D: newly discovered functions of a long-standing aspartic protease in cancer and apoptosis." Cancer Lett. 237(2): 167-79.
Limana F, Germani A, Zacheo A, Kajstura J, Di Carlo A, Borsellino G, Leoni O, Palumbo R, Battistini L, Rastaldo R, Muller S, Pompilio G, Anversa P, Bianchi ME, Capogrossi MC. (2005). "Exogenous high-mobility group box 1 protein induces myocardial regeneration after infarction via enhanced cardiac C-kit+ cell proliferation and differentiation." Circ Res. 97(8): e73-83.
Lisacek F, Cohen-Boulakia S, Appel RD. (2006). "Proteome informatics II: Bioinformatics for comparative proteomics." Proteomics 6(20): 5445-66.
169 Reference
Liu S, Stolz DB, Sappington PL, Macias CA, Killeen ME, Tenhunen JJ, Delude RL, Fink MP. (2006). "HMGB1 is secreted by immunostimulated enterocytes and contributes to cytomix-induced hyperpermeability of Caco-2 monolayers." Am J Physiol Cell Physiol. 290(4): C990-9.
Livak KJ, Schmittgen TD. (2001). "Analysis of relative gene expression data using real-time quantitative PCR and the 2-∆∆CT method." Methods 25(4): 402-8.
Lu X. (2005). "p53: a heavily dictated dictator of life and death." Curr Opin Genet Dev. 15 (1): 27-33.
Luger K. (2006). "Dynamic nucleosomes." Chromosome Res. 14(1): 5-16.
Lum HK, Lee KL. (2001). "The human HMGB1 promoter is modulated by a silencer and an enhancer-containing intron." Biochim Biophys Acta. 1520(1): 79-84.
Martin J, Halenbeck R, Kaufmann J. (1999). "Human transcription factor hTAF(II)150 (CIF150) is involved in transcriptional regulation of cell cycle progression." Mol Cell Biol. 19(8): 5548-56.
Maruyama K, Takada Y, Ray N, Kishimoto Y, Penninger JM, Yasuda H, Matsuo K. (2006). "Receptor activator of NF-kappa B ligand and osteoprotegerin regulate proinflammatory cytokine production in mice." J Immunol 177(6): 3799-805.
McKinney K, Prives C. (2002). "Efficient specific DNA binding by p53 requires both its central and C-terminal domains as revealed by studies with high-mobility group 1 protein." Mol Cell Biol. 22(19): 6797-808.
Melloni E, Sparatore B, Patrone M, Pessino A, Passalacqua M, Pontremoli S. (1995). "Extracellular release of the 'differentiation enhancing factor', a HMG1 protein type, is an early step in murine erythroleukemia cell differentiation." FEBS Lett. 368(3): 466-70.
Melloni E, Sparatore B, Patrone M, Pessino A, Passalacqua M, Pontremoli S. (1995). "Identity in molecular structure between "differentiation enhancing factor" of murine erythroleukemia cells and the 30 kD heparin-binding protein of developing rat brain." Biochem Biophys Res Commun. 210(1): 82-9.
Merenmies J, Pihlaskari R, Laitinen J, Wartiovaara J, Rauvala H. (1991). "30-kDa heparin-binding protein of brain (amphoterin) involved in neurite outgrowth.
170 Reference
Amino acid sequence and localization in the filopodia of the advancing plasma membrane." J Biol Chem. 266(25): 16722-9.
Merkle CJ, Karnitz LM, Henry-Sanchez JT, Chen J. (2003). "Cloning and characterization of hCTF18, hCTF8, and hDCC1. Human homologs of a Saccharomyces cerevisiae complex involved in sister chromatid cohesion establishment." J Biol Chem. 278(32): 30051-6.
Michels J, Johnson PW, Packham G. (2005). "Mcl-1." Int J Biochem Cell Biol. 37(2): 267-71.
Misawa K, Horiba T, Arimura N, Hirano Y, Inoue J, Emoto N, Shimano H, Shimizu M, Sato R. (2003). "Sterol regulatory element-binding protein-2 interacts with hepatocyte nuclear factor-4 to enhance sterol isomerase gene expression in hepatocytes." J Biol Chem. 278(38): 36176-82.
Mitkova E, Ugrinova I, Pashev IG, Pasheva EA. (2005). "The inhibitory effect of HMGB-1 protein on the repair of cisplatin-damaged DNA is accomplished through the acidic domain." Biochemistry 44(15): 5893-8.
Muller S, Ronfani L and Bianchi ME. (2004). "Regulated expression and subcellular localization of HMGB1, a chromatin protein with a cytokine function." J. Intern. Med. 255(3): 332-43.
Muller S, Scaffidi P, Degryse B, Bonaldi T, Ronfani L, Agresti A, Beltrame M, Bianchi ME. (2001). "New EMBO members' review: the double life of HMGB1 chromatin protein: architectural factor and extracellular signal." EMBO J. 20(16): 4337-40.
Mullins GE, Sunden-Cullberg J, Johansson AS, Rouhiainen A, Erlandsson-Harris H, Yang H, Tracey KJ, Rauvala H, Palmblad J, Andersson J, Treutiger CJ. (2004). "Activation of human umbilical vein endothelial cells leads to relocation and release of high-mobility group box chromosomal protein 1." Scand J Immunol 60(6): 566-73.
Nagase T, Ishikawa K, Nakajima D, Ohira M, Seki N, Miyajima N, Tanaka A, Kotani H, Nomura N, Ohara O. (1997). "Prediction of the coding sequences of unidentified human genes. VII. The complete sequences of 100 new cDNA clones from brain which can code for large proteins in vitro." DNA Res. 4(2): 141-50.
171 Reference
Nagatani G., Nomoto M, Takano H, Ise T, Kato K, Imamura T, Izumi H, Makishima K, Kohno K. (2001). "Transcriptional activation of the human HMG1 gene in cisplatin-resistant human cancer cells." Cancer Research 61(4): 1592-7.
Nair SM, Jungalwala FB. (1997). "Characterization of a sulfoglucuronyl carbohydrate binding protein in the developing nervous system." J Neurochem. 68(3): 1286-97.
Nair SM, Zhao Z, Chou DK, Tobet SA, Jungalwala FB. (1998). "Expression of HNK-1 carbohydrate and its binding protein, SBP-1, in apposing cell surfaces in cerebral cortex and cerebellum." Neuroscience 85(3): 759-71.
Najima Y, Yahagi N, Takeuchi Y, Matsuzaka T, Sekiya M, Nakagawa Y, Amemiya-Kudo M, Okazaki H, Okazaki S, Tamura Y, Iizuka Y, Ohashi K, Harada K, Gotoda T, Nagai R, Kadowaki T, Ishibashi S, Yamada N, Osuga J, Shimano H. (2005). "High mobility group protein-B1 interacts with sterol regulatory element-binding proteins to enhance their DNA binding." J Biol Chem. 280(30): 27523-32.
Nandi D, Woodward E, Ginsburg DB, Monaco JJ. (1997). "Intermediates in the formation of mouse 20S proteasomes: implications for the assembly of precursor beta subunits." EMBO J. 16(17): 5363-75.
Ohndorf UM, Rould MA, He Q, Pabo CO, Lippard SJ. (1999). "Basis for recognition of cisplatin-modified DNA by high-mobility-group proteins." Nature 399(6737): 708-12.
Onate SA, Prendergast P, Wagner JP, Nissen M, Reeves R, Pettijohn DE, Edwards DP. (1994). "The DNA-bending protein HMG-1 enhances progesterone receptor binding to its target DNA sequences." Mol Cell Biol. 14(5): 3376-91.
Oren M. (1999). "Regulation of the p53 tumor suppressor protein." J. Biol. Chem. 274(51): 36031-4.
Palagi PM, Hernandez P, Walther D, Appel RD. (2006). "Proteome informatics I: Bioinformatics tools for processing experimental data." Proteomics 6(20): 5435-44.
Park JS, Gamboni-Robertson F, He Q, Svetkauskaite D, Kim JY, Strassheim D, Sohn JW, Yamada S, Maruyama I, Banerjee A, Ishizaka A, Abraham E. (2006).
172 Reference
"High mobility group box 1 protein interacts with multiple Toll-like receptors." Am J Physiol Cell Physiol. 290(3): C917-24.
Park JS, Svetkauskaite D, He Q, Kim JY, Strassheim D, Ishizaka A, Abraham E. (2004). "Involvement of toll-like receptors 2 and 4 in cellular activation by high mobility group box 1 protein." J Biol Chem. 279(9): 7370-7.
Pasheva EA, Ugrinova I, Spassovska NC, Pashev IG. (2002). "The binding affinity of HMG1 protein to DNA modified by cis-platin and its analogs correlates with their antitumor activity." Int J Biochem Cell Biol. 34(1): 87-92.
Passalacqua M, Zicca A, Sparatore B, Patrone M, Melloni E, Pontremoli S. (1997). "Secretion and binding of HMG1 protein to the external surface of the membrane are required for murine erythroleukemia cell differentiation." FEBS Lett. 400(3): 275-9.
Pawlak J, Brito V, Kuppers E, Beyer C. (2005). "Regulation of glutamate transporter GLAST and GLT-1 expression in astrocytes by estrogen." Brain Res Mol Brain Res. 138(1): 1-7.
Pil PM, Lippard SJ. (1992). "Specific binding of chromosomal protein HMG1 to DNA damaged by the anticancer drug cisplatin." Science 256(5054): 234-7.
Poser I, Golob M, Buettner R, Bosserhoff AK. (2003). "Upregulation of HMG1 leads to melanoma inhibitory activity expression in malignant melanoma cells and contributes to their malignancy phenotype." Mol Cell Biol. 23(8): 2991-8.
Qin S, Wang H, Yuan R, Li H, Ochani M, Ochani K, Rosas-Ballina M, Czura CJ, Huston JM, Miller E, Lin X, Sherry B, Kumar A, Larosa G, Newman W, Tracey KJ, Yang H. (2006). "Role of HMGB1 in apoptosis-mediated sepsis lethality." J Exp Med. 203(7): 1637-42.
Raben N, Plotz P, Byrne BJ. (2002). "Acid alpha-glucosidase deficiency (glycogenosis type II, Pompe disease)." Curr Mol Med. 2(2): 145-166.
Radominska-Pandya A, Pokrovskaya ID, Xu J, Little JM, Jude AR, Kurten RC, Czernik PJ. (2002). "Nuclear UDP-glucuronosyltransferases: identification of UGT2B7 and UGT1A6 in human liver nuclear membranes." Arch Biochem Biophys 399(1): 37-48.
Rauvala H, Huttunen HJ, Fages C, Kaksonen M, Kinnunen T, Imai S, Raulo E,
173 Reference
Kilpelainen I. (2000). "Heparin-binding proteins HB-GAM (pleiotrophin) and amphoterin in the regulation of cell motility." Matrix Biol. 19(5): 377-87.
Rauvala H, Merenmies J, Pihlaskari R, Korkolainen M, Huhtala ML, Panula P. (1988). "The adhesive and neurite-promoting molecule p30: analysis of the amino-terminal sequence and production of antipeptide antibodies that detect p30 at the surface of neuroblastoma cells and of brain neurons." J Cell Biol. 107(6 Pt 1): 2293-305.
Rauvala H, Pihlaskari R. (1987). "Isolation and some characteristics of an adhesive factor of brain that enhances neurite outgrowth in central neurons." J Biol Chem. 262(34): 16625-35.
Reeves R, and Nissen MS. (1990). "The A.T-DNA-binding domain of mammalian high mobility group I chromosomal proteins: A novel peptide motif for recognizing DNA structure." J. Biol. Chem. 265(15): 8573-82.
Riuzzi F, Sorci G, Donato R. (2006). "The amphoterin (HMGB1)/receptor for advanced glycation end products (RAGE) pair modulates myoblast proliferation, apoptosis, adhesiveness, migration, and invasiveness. Functional inactivation of RAGE in L6 myoblasts results in tumor formation in vivo." J Biol Chem. 281(12): 8242-53.
Romine LE, Wood JR, Lamia LA, Prendergast P, Edwards DP, Nardulli AM. (1998). "The high mobility group protein 1 enhances binding of the estrogen receptor DNA binding domain to the estrogen response element." Mol Endocrinol 12(5): 664-74.
Rong LL, Trojaborg W, Qu W, Kostov K, Yan SD, Gooch C, Szabolcs M, Hays AP, Schmidt AM. (2004). "Antagonism of RAGE suppresses peripheral nerve regeneration." FASEB J. 18(15): 1812-7.
Rouhiainen A, Imai S, Rauvala H, Parkkinen J. (2000). "Occurrence of amphoterin (HMG1) as an endogenous protein of human platelets that is exported to the cell surface upon platelet activation." Thromb. Haemost. 84(6): 1087-94.
Rouhiainen A, Kuja-Panula J, Wilkman E, Pakkanen J, Stenfors J, Tuominen RK, Lepantalo M, Carpen O, Parkkinen J, Rauvala H. (2004). "Regulation of monocyte migration by amphoterin (HMGB1)." Blood 104(4): 1174-82.
174 Reference
Rovere-Querini P, Capobianco A, Scaffidi P, Valentinis B, Catalanotti F, Giazzon M, Dumitriu IE, Muller S, Iannacone M, Traversari C, Bianchi ME, Manfredi AA. (2004). "HMGB1 is an endogenous immune adjuvant released by necrotic cells." EMBO Rep. 5(8): 825-30.
Russanova VR, Ando I. (1985). "A study on the amount of high-mobility-group chromatin proteins in T-cells at different stages of differentiation." Biochim Biophys Acta. 825(4): 405-10.
Sadofsky MJ. (2001). "The RAG proteins in V(D)J recombination: more than just a nuclease." Nucleic Acids Res. 29(7): 1399-409.
Saier MH Jr. (2000). "A functional-phylogenetic classification system for transmembrane solute transporters." Microbiol Mol Biol Rev. 64(2): 354-411.
Sappington PL, Yang R, Yang H, Tracey KJ, Delude RL, Fink MP. (2002). "HMGB1 B box increases the permeability of Caco-2 enterocytic monolayers and impairs intestinal barrier function in mice." Gastroenterology 123(3): 790-802.
Sass G, Heinlein S, Agli A, Bang R, Schumann J and Tiegs G. (2002). "Cytokine expression in three mouse models of experimental hepatitis." Cytokine 19(3): 115-20.
Scaffidi P, Misteli T, Bianchi ME. (2002). "Release of chromatin protein HMGB1 by necrotic cells triggers inflammation." Nature 418(6894): 191-5.
Scherer LJ, Rossi JJ. (2003). "Approaches for the sequence-specific knockdown of mRNA." Nat Biotechnol. 21(12): 1457-65.
Scherz-Shouval R, Sagiv Y, Shorer H, Elazar Z. (2003). "The COOH terminus of GATE-16, an intra-Golgi transport modulator, is cleaved by the human cysteine protease HsApg4A." J Biol Chem. 278(16): 14053-8.
Schett G, Hayer S, Zwerina J, Redlich K, Smolen JS. (2005). "Mechanisms of Disease: the link between RANKL and arthritic bone disease." Nat Clin Pract Rheumatol 1(1): 47-54.
Semino C, Angelini G, Poggi A, Rubartelli A. (2005). "NK/iDC interaction results in IL-18 secretion by DCs at the synaptic cleft followed by NK cell activation and release of the DC maturation factor HMGB1." Blood 106(2): 609-16.
175 Reference
Seyedin SM, Pehrson JR, Cole RD. (1981). "Loss of chromosomal high mobility group proteins HMG1 and HMG2 when mouse neuroblastoma and Friend erythroleukemia cells become committed to differentiation." Proc Natl Acad Sci U.S.A. 78(10): 5988-92.
Slack A, Chen Z, Tonelli R, Pule M, Hunt L, Pession A, Shohet JM. (2005). "The p53 regulatory gene MDM2 is a direct transcriptional target of MYCN in neuroblastoma." PNAS 102(3): 731-6.
Snyder M, Gerstein M. (2003). "Genomics. Defining genes in the genomics era." Science 300(5617): 258-60.
Sorci G, Riuzzi F, Arcuri C, Giambanco I, Donato R. (2004). "Amphoterin stimulates myogenesis and counteracts the antimyogenic factors basic fibroblast growth factor and S100B via RAGE binding." Mol Cell Biol 24(11): 4880-94.
Spada F, Brunet A, Mercier Y, Renard JP, Bianchi ME, Thompson EM. (1998). "High mobility group 1 (HMG1) protein in mouse preimplantation embryos." Mech. Develop 76(1-2): 57-66.
Sparatore B, Passalacqua M, Patrone M, Pessino A, Melloni E, Pontremoli S. (1993). "Differentiation of HL60 promyelocytic cells is promoted by a 'differentiation enhancing factor' produced by erythroleukemia cells." FEBS Lett. 334(2): 198-202.
Sparatore B, Passalacqua M, Patrone M, Melloni E, Pontremoli S. (1996). "Extracellular high-mobility group 1 protein is essential for murine erythroleukaemia cell differentiation." Biochem J. 320 ( Pt 1): 253-6.
Sparatore B, Patrone M, Passalacqua M, Pedrazzi M, Gaggero D, Pontremoli S, Melloni E. (2001). "Extracellular processing of amphoterin generates a peptide active on erythroleukaemia cell differentiation." Biochem. J. 357(Pt 2): 569-74.
Sparatore B, Pedrazzi M, Passalacqua M, Gaggero D, Patrone M, Pontremoli S, Melloni E. (2002). "Stimulation of erythroleukaemia cell differentiation by extracellular high-mobility group-box protein 1 is independent of the receptor for advanced glycation end-products." Biochem J. 363(Pt 3): 529-35.
Stanelle J, Putzer BM. (2006). "E2F1-induced apoptosis: turning killers into therapeutics." Trends Mol Med. 12(4): 177-85.
176 Reference
Steele RJ, Lane DP. (2005). "P53 in cancer: a paradigm for modern management of cancer." Surgeon 3(3): 197-205.
Stern R. (2005). "Hyaluronan metabolism: a major paradox in cancer biology." Pathol Biol (Paris) 53(7): 372-82.
Stemmer C, Ritt C, Igloi GL, Grimm R, Grasser KD. (1997). "Variability in Arabidopsis thaliana chromosomal high-mobility-group-1-like proteins." Eur J Biochem. 250(3): 646-52.
Stott K, Tang GS, Lee KB, Thomas JO. (2006). "Structure of a complex of tandem HMG boxes and DNA." J Mol Biol. 360(1): 90-104.
Stros M, Ozaki T, Bacikova A, Kageyama H, Nakagawara A. (2002). "HMGB1 and HMGB2 cell-specifically down-regulate the p53- and p73-dependent sequence-specific transactivation from the human Bax gene promoter." J Biol Chem. 277(9): 7157-64.
Stros M, Reich J. (1998). "Formation of large nucleoprotein complexes upon binding of the high-mobility-group (HMG) box B-domain of HMG1 protein to supercoiled DNA." Eur J Biochem. 251(1-2): 427-34.
Stros M, Stokrova J, Thomas JO. (1994). "DNA looping by the HMG-box domains of HMG1 and modulation of DNA binding by the acidic C-terminal domain." Nucleic Acids Res. 22(6): 1044-51.
Sunden-Cullberg J, Norrby-Teglund A, Rouhiainen A, Rauvala H, Herman G, Tracey KJ, Lee ML, Andersson J, Tokics L, Treutiger CJ. (2005). "Persistent elevation of high mobility group box-1 protein (HMGB1) in patients with severe sepsis and septic shock." Crit Care Med. 33(3): 564-73.
Swanson PC. (2002). "A RAG-1/RAG-2 tetramer supports 12/23-regulated synapsis, cleavage, and transposition of V(D)J recombination signals." Mol Cell Biol. 22(22): 7790-801.
Taguchi A, Blood DC, del Toro G, Canet A, Lee DC, Qu W, Tanji N, Lu Y, Lalla E, Fu C, Hofmann MA, Kislinger T, Ingram M, Lu A, Tanaka H, Hori O, Ogawa S, Stern DM, Schmidt AM. (2000). "Blockade of RAGE-amphoterin signalling suppresses tumour growth and metastases." Nature 405(6784): 354-60.
Tam BM, Moritz OL, Papermaster DS. (2004). "The C terminus of peripherin/rds
177 Reference participates in rod outer segment targeting and alignment of disk incisures." Mol Biol Cell 15(4): 2027-37.
Tan KB, Huebner K, Croce CM. (1982). "Chromosomal proteins of mouse teratocarcinoma cells." J Cell Physiol Suppl. 2: 51-9.
Tanaka M, Kishi Y, Takanezawa Y, Kakehi Y, Aoki J, Arai H. (2004). "Prostatic acid phosphatase degrades lysophosphatidic acid in seminal plasma." FEBS Lett. 571(1-3): 197-204.
Taniguchi N, Kawahara K, Yone K, Hashiguchi T, Yamakuchi M, Goto M, Inoue K, Yamada S, Ijiri K, Matsunaga S, et al. (2003). "High mobility group box chromosomal protein 1 plays a role in the pathogenesis of rheumatoid arthritis as a novel cytokine." Arthritis Rheum 48(4): 971-81.
Taniuchi K, Nishimori I, Takeuchi T, Fujikawa-Adachi K, Ohtsuki Y, Onishi S. (2002). "Developmental expression of carbonic anhydrase-related proteins VIII, X, and XI in the human brain." Neuroscience 112(1): 93-9.
Tanuma S, Kawashima K, Endo H. (1985). "Comparison of ADP-ribosylation of chromosomal proteins between intact and broken cells." Biochem Biophys Res Commun. 127(3): 896-902.
Teo SH, Grasser KD, Thomas JO. (1995). "Differences in the DNA-binding properties of the HMG-box domains of HMG1 and the sex-determining factor SRY." Eur J Biochem. 230(3): 943-50.
Thomas JO. (2001). "HMG1 and 2: architectural DNA-binding proteins." Biochem Soc Trans. 29(Pt 4): 395-401.
Thomas JO, Travers AA. (2001). "HMG1 and 2, and related 'architectural' DNA-binding proteins." Trends Biochem Sci. 26(3): 167-74.
Travers AA. (2003). "Priming the nucleosome: a role for HMGB proteins." EMBO Rep. 4(2): 131-6.
Treutiger CJ, Mullins GE, Johansson AS, Rouhiainen A, Rauvala HM, Erlandsson-Harris H, Andersson U, Yang H, Tracey KJ, Andersson J, Palmblad JE. (2003). "High mobility group 1 B-box mediates activation of human endothelium." J Intern Med. 254(4): 375-85.
178 Reference
Trimarchi JM, Lees JA. (2002). "Sibling rivalry in the E2F family." Nat Rev Mol Cell Biol. 3(1): 11-20.
Turgeon D, Carrier JS, Levesque E, Hum DW, Belanger A. (2001). "Relative enzymatic activity, protein stability, and tissue distribution of human steroid-metabolizing UGT2B subfamily members." Endocrinology 142(2): 778-87.
Ulfgren AK, Grundtman C, Borg K, Alexanderson H, Andersson U, Harris HE, Lundberg IE. (2004). "Down regulation of the aberrant expression of the pro-inflammatory mediator High Mobility Group Box Chromosomal protein 1 in tissue of patients with polymyositis and dermatomyositis treated with corticosteroids." Arthritis and Rheumatism 50 (5): 1586-94.
Ulloa L, Messmer D. (2006). "High-mobility group box 1 (HMGB1) protein: friend and foe." Cytokine Growth Factor Rev. 17(3): 189-201.
Ulloa L, Ochani M, Yang H, Tanovic M, Halperin D, Yang R, Czura CJ, Fink MP, Tracey KJ. (2002). "Ethyl pyruvate prevents lethality in mice with established lethal sepsis and systemic inflammation." Proc Natl Acad Sci U.S.A. 99(19): 12351-6.
Uramoto H, Izumi H, Nagatani G, Ohmori H, Nagasue N, Ise T, Yoshida T, Yasumoto K, Kohno K. (2003). "Physical interaction of tumour suppressor p53/p73 with CCAAT-binding transcription factor 2 (CTF2) and differential regulation of human high-mobility group 1 (HMG1) gene expression." Biochem.J. 371(Pt 2): 301-10.
Wagner CR, Hamana K, Elgin SC. (1992). "A high-mobility-group protein and its cDNAs from Drosophila melanogaster." Mol Cell Biol. 12(5): 1915-23.
Wang H, Bloom O, Zhang M, Vishnubhakat JM, Ombrellino M, Che J, Frazier A,Yang H, Ivanova S, Borovikova L, et al. (1999a). "HMG-1 as a late mediator of endotoxin lethality in mice." Science 285(5425): 248-51.
Wang H, Liao H, Ochani M, Justiniani M, Lin X, Yang L, Al-Abed Y, Wang H, Metz C, Miller EJ, Tracey KJ, Ulloa L. (2004a). "Cholinergic agonists inhibit HMGB1 release and improve survival in experimental sepsis." Nat Med. 10(11): 1216-21.
Wang H, Vishnubhakat JM, Bloom O, Zhang M, Ombrellino M, Sama A, Tracey
179 Reference
KJ. (1999b). "Proinflammatory cytokines (tumor necrosis factor and interleukin 1) stimulate release of high mobility group protein-1 by pituicytes." Surgery 126(2): 389-92.
Wang H, Yang H, Tracey KJ. (2004b). "Extracellular role of HMGB1 in inflammation and sepsis." J Intern Med. 255(3): 320-31.
Wang J, Tzeng CH, Huang MH, Fang HX, Xiao PG, Han R, Yang MS. (2004c). "Molecular mechanism of granulocytic differentiation of human promyelocytic leukemia HL-60 cells induced by all-trans retinoic acid." Yao Xue Xue Bao 39(1): 22-8.
Watanabe-Fukunaga R, Iida S, Shimizu Y, Nagata S, Fukunaga R. (2005). "SEI family of nuclear factors regulates p53-dependent transcriptional activation." Genes Cells 10(8): 851-60.
Weber S, Isenberg I. (1980). "High mobility group proteins of Saccharomyces cerevisiae." Biochemistry 19(10): 2236-40.
Weih F, Caamano J. (2003). "Regulation of secondary lymphoid organ development by the nuclear factor-kappaB signal transduction pathway." Immunol Rev. 195: 91-105.
Wen L, Huang JK, Johnson BH, Reeck GR. (1989). "A human placental cDNA clone that encodes nonhistone chromosomal protein HMG-1." Nucleic Acids Res. 17(3): 1197-214.
Wisniewski JR, Szewczuk Z, Petry I, Schwanbeck R, Renner U. (1999). "Constitutive phosphorylation of the acidic tails of the high mobility group 1 proteins by casein kinase II alters their conformation, stability, and DNA binding specificity." J Biol Chem. 274(29): 20116-22.
Wu H, Lozano G. (1994). “NF-kappa B activation of p53. A potential mechanism for suppressing cell growth in response to stress.” J Biol Chem. 269(31): 20067-74.
Yang H, Wang H, Czura CJ, Tracey KJ. (2005). "The cytokine activity of HMGB1." J Leukoc Biol. 78(1): 1-8.
Yang H., Ochani M, Li J, Qiang X, Tanovic M, Harris H E, Susarla SM, Ulloa L, Wang H, DiRaimo R, et al. (2004). "Reversing established sepsis with antagonists
180 Reference of endogenous high-mobility group box 1." Proc. Natl. Acad. Sci. U.S.A. 101(1): 296-301.
Yang-Yen HF. (2006). "Mcl-1: a highly regulated cell death and survival controller." J Biomed Sci. 13(2): 201-4.
Yoshida M, Shimura K. (1984). "Unwinding of DNA by nonhistone chromosomal protein HMG(1 + 2) from pig thymus as determined with endonuclease." J Biochem (Tokyo) 95(1): 117-24.
Yu M, Wang H, Ding A, Golenbock DT, Latz E, Czura CJ, Fenton MJ, Tracey KJ, Yang H. (2006). "HMGB1 signals through toll-like receptor (TLR) 4 and TLR2." Shock 26(2): 174-9.
Yu SS, Li HJ, Goodwin GH, Johns EW. (1977). "Interaction of non-histone chromosomal proteins HMG1 and HMG2 with DNA." Eur J Biochem. 78(2): 497-502.
Zamble DB, Lippard SJ. (1995). "Cisplatin and DNA repair in cancer chemotherapy." Trends Biochem Sci. 20(10): 435-9.
Zamecnik PC, Stephenson ML. (1978). "Inhibition of Rous sarcoma virus replication and cell transformation by a specific oligodeoxynucleotide." Proc Natl Acad Sci U.S.A. 75(1): 280-4.
Zamora R, Grishin A, Wong C, Boyle P, Wang J, Hackam D, Upperman JS, Tracey KJ, Ford HR. (2005). "High-mobility group box 1 protein is an inflammatory mediator in necrotizing enterocolitis: protective effect of the macrophage deactivator semapimod." Am J Physiol Gastrointest Liver Physiol. 289(4): G643-52.
Zanetti M, Castiglioni P, Schoenberger S, Gerloni M. (2003). "The role of relB in regulating the adaptive immune response." Ann N Y Acad Sci. 987: 249-57.
Zappavigna V, Falciola L, Helmer-Citterich M, Mavilio F, Bianchi ME. (1996). " HMG1 interacts with HOX proteins and enhances their DNA binding and transcriptional activation." EMBO J. 15(18): 4981-91.
Zauberman A, Flusberg D, Barak Y, Oren M. (1995). "A functional p53-responsive intronic promoter is contained within the human mdm2 gene." Nucleic Acids Res. 23(14): 2584-92.
181 Reference
Zeh HJ, Lotze MT. (2005). "Addicted to death: invasive cancer and the immune response to unscheduled cell death." J Immunother 28(1): 1-9.
Zelivianski S, Glowacki R, Lin MF. (2004). "Transcriptional activation of the human prostatic acid phosphatase gene by NF-kappaB via a novel hexanucleotide-binding site." Nucleic Acids Res. 32(12): 3566-80.
Zhang CC, Krieg S, Shapiro DJ. (1999). "HMG-1 stimulates estrogen response element binding by estrogen receptor from stably transfected HeLa cells." Mol Endocrinol 13(4): 632-43.
Zhang Y, Song S, Fong CC, Tsang CH, Yang Z, and Yang M. (2003). "cDNA Microarray Analysis of Gene Expression Profiles in Human Fibroblast Cells Irradiated with Red Light." J Invest Dermatol 120(5): 849-57.
Zhou YT, Guy GR, Low BC. (2005). "BNIP-2 induces cell elongation and membrane protrusions by interacting with Cdc42 via a unique Cdc42-binding motif within its BNIP-2 and Cdc42GAP homology domain." Exp Cell Res. 303(2): 263-74.
Books:
Johns EW. (1982) History, definitions and problems. In: Johns EW. (eds) (1982) The HMG Chromosomal Proteins. Academic Press, London, pages 1-8.
Rozen S, Skaletsky HJ. (2000) Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S. (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pages 365-86.
Websites:
Biology Department, Occidental College Website http://departments.oxy.edu /biology/Stillman/bi221/110300/rna_polymerases.htm
KEGG: (Kyoto Encyclopedia of Genes and Genomes) website http:// www .genome .jp /kegg/pathway/hsa/hsa04010.html
Koehrer K, Beyer A, Mewes HW, Weil B, Amid C, Osange A, Fobo G , Han M, Wiemann S. Submitted (17-AUG-2004) to the EMBL/GenBank/DDBJ databases. MIPS, Ingolstaedter Landstr.1, D-85764 Neuherberg, GERMANY. http://www. rzpd.de/cgi-bin/products/cl.cgi?CloneID=DKFZp686A04236.
182