See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/316316844

Mitochondrial genome of Abraxas suspecta (Lepidoptera: Geometridae) and comparative analysis with other Lepidopterans

Article in Zootaxa · April 2017 DOI: 10.11646/zootaxa.4254.5.1

CITATIONS READS 7 192

10 authors, including:

Yu Sun Muhammad Nadeem Abbas Bengbu Medical College Southwest University in Chongqing

47 PUBLICATIONS 356 CITATIONS 93 PUBLICATIONS 814 CITATIONS

SEE PROFILE SEE PROFILE

Cen Qian Guoqing Wei Anhui Agricultural University (AHAU) 54 PUBLICATIONS 437 CITATIONS 123 PUBLICATIONS 1,388 CITATIONS SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

microbiolgy View project

Silkworm/Mulberry/Silk and Health View project

All content following this page was uploaded by Yu Sun on 30 March 2018.

The user has requested enhancement of the downloaded file. Zootaxa 0000 (0): 000–000 ISSN 1175-5326 (print edition) http://www.mapress.com/j/zt/ Article ZOOTAXA Copyright © 2017 Magnolia Press ISSN 1175-5334 (online edition) https://doi.org/10.11646/zootaxa.0000.0.0 http://zoobank.org/urn:lsid:zoobank.org:pub:00000000-0000-0000-0000-00000000000 Mitochondrial genome of Abraxas suspecta (Lepidoptera: Geometridae) and comparative analysis with other Lepidopterans

YU SUN1, JIAWEI ZHANG1, QINGQING LI1, DAN LIANG1, MUHAMMAD NADEEM ABBAS1, CEN QIAN1, LEI WANG1, GUOQING WEI1, BAO-JIAN ZHU1,2 & CHAO-LIANG LIU1,2 1College of Life Sciences, Anhui Agricultural University, Hefei, 230036, China 2Corresponding authors. E-mail: [email protected] (B.-J. Zhu); [email protected] (C.-L. Liu)

Abstract

In this study, a complete mitochondrial genome (mitogenome) sequence of Abraxas suspecta (Lepidoptera: Geometridae) is isolated and characterized. The complete DNA is 15,547 bp length and contains 2 ribosomal RNA genes, 23 putative transfer RNA (tRNA) genes including an extra tRNAAsn (AUU), 13 protein-coding genes and an adenine (A) + thymine (T)-rich region. The nucleotide composition and gene organization are identical to those of other lepidopteran, except for the presence of an extra copy of trnN (AUU). Of the 38 genes, twenty-five genes (9 PCGs and 16 tRNAs) are encoded by heavy strand (H-strand), while thirteen are encoded by light strand (L-strand). Among the 13 PCGs, 12 PCGs employ ATN as initiation codon, while cytochrome c oxidase subunit 1 (cox1) utilizes CGA as initiation codon. Four of the 13 PCGs have the incomplete termination codon T, while the remainder terminated with the canonical stop codon. All tRNA genes are folded into the typical clover-leaf structure of mitochondrial tRNAs, except for the tRNASer (AGN) gene, in which the DHU arm fails to form a stable stem-loop structure. The A+T-rich region is 532 bp long, and contains some conserved regions, including ‘ATAGA’ motif followed by a 17bp poly-T stretch, a microsatellite-like element (AT)8(AAT)3 and also a poly-A element. A short Phylogenetic analysis based on 13 PCGs using maximum likelihood (ML) and Bayesian infer- ence (BI) revealed that A. suspecta resides in the Geometridae family. We present the method and approach to use moths as model organisms for further genetic and evolutionary biology studies.

Key words: mitogenome, geometrid moth, phylogenetic analysis, evolution

Introduction

The complete mitogenome DNA of an insect is a compact, double stranded and closed circular molecule that ranges almost 14–16 kbp in length. The gene arrangement and organization of mitogenome in insects and especially in Lepidoptera is fairly conserved. With a few exceptions, e.g. Ctenoptilum vasava (Lepidoptera) and Bombus ignites (Hymenoptera), an insect mitogenome contains a variable number of tRNA genes (Cha et al. 2007; Hao et al. 2012) and usually encodes 37 genes including 13 protein-coding genes (PCGs), two ribosomal-RNA- coding genes (rRNAs), 22 transfer-RNA-coding genes (tRNAs), and an A + T rich displacement loop (D-loop) control region (Cameron 2014; Liu et al. 2016). Because of their maternal inheritance, compact structure, lack of genetic recombination, and relatively fast evolutionary rate, mitogenomes have been extensively used in molecular, phylogenetics and evolutionary studies (Cameron 2014). Abraxas suspecta (Warren, 1894) (Lepidoptera: Geometridae: Ennominae), is considered a most damaging pest of the medicinally important plant Euonymus japonicas Thunb. The larvae of this species extensively feed on young leaves and cause death of small branches (Yingqi 1999). The A. suspecta is widely distributed in the northern parts of China. It belongs to Geometridae, the second largest family of Lepidoptera that includes approximately 23,000 described species worldwide (Scoble & Hausmann 2007). The management of this devastating species is extremely important, despite this importance, only a few studies are available on this species (Yang et al. 2009, 2013; Liu et al. 2014; Chen et al. 2016). Hence, to improve the management of A. suspecta, it is enormously important to know more about this pest, particularly its genetic characteristics and phylogenetic position.

Accepted by J.De Prins: 13 Mar. 2017; published: ?? Month 2017 1 Here, we analyzed the genomic organization, gene arrangement, codon usage of A. suspecta, and the complete mitogenome of A. suspecta was compared its sequence to selected Lepidoptera species, particularly Geometridae. The use of molecular phylogenetic studies based on the mitochondrial genome can provide a strong support to the taxonomic study and make it more accurate. Moreover, a reconstructed phylogeny of the superfamily Geometroidea based on the concatenated nucleotide sequences of 13 PCGs of moth mitogenome enables to characterize A. suspecta among its relatives within the family Geometridae.

Materials and methods

Sampling and DNA extraction. The A. suspecta specimens were collected from Anhui Agricultural University, Anhui Province, China. The collected specimens were identified as A. suspecta based on the morphological characters by the taxonomist of the Department of Entomology, Anhui Agricultural University, Hefei, China (AHAU). After a careful examination of the morphological characters and the comparison of voucher specimens to the referenced publications of Chinese moths published by the Institute of Zoology, Chinese Academy of Sciences we are confident that the species under our study is identified correctly. The samples were preserved in 100% ethanol and stored at -80°C. A single specimen was used to extract total genomic DNA using the Genomic DNA Extraction Kit, according to the manufacturer's instructions (Aidlab Co., Beijing, China). The quality of extracted DNA was determined by 1% agarose gel electrophoresis (w/v) and used to amplify the complete mitogenome of A. suspecta. The Abraxas suspecta specimens were collected on the Buxus megistophylla H.Lév. (Buxaceae) plants in the campus of Anhui Agricultural University, Hefei city, China. The owner of the land gave permission to conduct the study on this site. Our field studies did not involve endangered or protected species. The voucher specimens are preserved at the collection of the Department of Entomology, Anhui Agricultural University, Hefei, China (AHAU). Design of primers, PCR amplification and sequencing. To determine the mitogenome of A. suspecta (Liu et al. 2013; Dai et al. 2014), we designed twelve pairs of primers from the conserved nucleotide sequences of known mitogenome of several lepidopteran species and then synthesized them following the methods presented in Dai et al. (2015) and Sun et al. (2016) (Sangon Biotech Co., hanghai, China) (Table 2). All amplifications were performed on an Eppendorf Mastercycler and Mastercycler gradient in 50 µL reaction volumes, which contained 35 µL sterilized distilled water, 5 µL 10 Taq buffer (Mg2+ plus), 4 µL dNTP (25 mM), 1.5 µL extracted DNA as a template, forward and reverse primers 2 µL each (10 µM) and 0.5 µL (1 unit) Taq DNA polymerase (Takara Co., Dalian, China). The PCR amplification conditions were as follows: an initial denaturation one cycle at 94°C for 4 min followed by 38 cycles, one cycle at 94°C for 30s, one cycle at 48–59 °C for 1–3 min (depending on the putative length of the fragments), and a final extension one cycle at 72°C for 10 min. The PCR products were resolved by 1% agarose gel electrophoresis (w/v), and were purified using a DNA gel extraction kit (Transgen Co., Beijing, China), and directly sequenced with PCR primers. Sequence assembly and gene annotation. Sequence annotation was performed using blast tools available from NCBI (http://blast.ncbi.nlm.nih.gov/Blast), and SeqMan II program from the Lasergene software package (DNASTAR Inc.; Madison, USA). The protein-coding sequences were translated into putative proteins on the basis of the Invertebrate Mitochondrial Genetic Code. The skewness was measured by the method given by Junqueira et al. (2004), and the base composition of nucleotide sequences were described as: AT skew = [A−T]/[A+T], GC skew = [G−C]/[G+C]. The relative synonymous codon usage (RSCU) values were calculated using MEGA version 5.1 program (Tamura et al. 2011). The tRNA genes were determined using the tRNAscan-SE software (http://lowelab.ucsc.edu/tRNAscan-SE/) (Lowe & Eddy 1997), or predicted by sequence features of being capable of folding into the typical clover-leaf secondary structure with legitimate anticodon. The tandem repeats in the A+T-rich region were determined by the tandem repeats finder program (http://tandem.bu.edu/trf/trf.html) (Benson 1999). Phylogenetic analysis. To reconstruct the phylogenetic relationship among Lepidopterans 36 complete mitogenome sequences were downloaded from the GenBank database (Table 1). Further, the mitogenomes of Drosophila melanogaster (U37541.1) (Lewis et al. 1995) and Anopheles gambiae (L20934.1) (Beard et al. 1993) were used as outgroup. The multiple alignments of the 13 PCGs concatenated nucleotide sequences were

2 · Zootaxa 0000 (0) © 2017 Magnolia Press SUN ET AL. conducted using ClustalX version 2.0. (Thompson et al. 1997), and then was used for phylogenetic analyses. Two analytical approaches, Maximum Likelihood (ML) with the MEGA version 5.1 program (Tamura et al. 2011) and Bayesian Inference (BI) with MrBayes 3.2 version program (Ronquist et al. 2012) were used to infer phylogenetic tree. The ML analysis was used to infer phylogenetic trees with 1000 bootstrap replicates and BI analysis as the following conditions: the Markov chains were run for 100,000 generations with trees being sampled every 100 generations. The consensus trees were visualized by FigTree v1.4.2 (http://tree.bio.ed.ac.uk/software/figtree/) program with adjustable settings.

TABLE 1. The lepidopteran mitogenomes used in this study. Superfamily Family Species Size (bp) GenBank Reference accession no. Hepialoidea Hepialidae Ahamus yunnanensis 15,816 NC_018095 (Cao et al. 2012) Thitarodes pui 15,064 NC_023530 (Yi et al. 2016) Thitarodes renzhiensis 16,173 NC_018094 (Cao et al. 2012) Yponomeutoidea Plutellidae Plutella xylostella 16,179 JF911819 (Wei et al. 2013) Lyonetiidae Leucoptera malifoliella 15,646 NC_018547 (Wu et al. 2012b) Gelechioidea Elachistidae Promalactis suzukiella 15,507 NC_026697 (Park et al. 2016) Tortricoidea Tortricidae Acleris fimbriana 15,933 NC_018754 Unpublished Adoxophyes orana 15,343 JX872403 (Wu et al. 2013) Choristoneura longicellana 15,759 HQ452340.1 Unpublished Cydia pomonella 15,253 JX407107.2 (Shi et al. 2013) Grapholita dimorpha 15,813 NC_024582.1 (Niu et al. 2016) Papilionoidea Papilionidae Parnassius bremeri 15,389 NC_014053 (Kim et al. 2009) Papilio syfanius 15,359 NC_023978 (Dong et al. 2016) Papilio maraho 16,094 NC_014055 (Wu et al. 2010) Parnassius bremeri 15,389 NC_014053 (Kim et al. 2009) Teinopalpus aureus 15,242 NC_014398 Unpublished Hesperiidae Carterocephalus silvicola 15,765 KJ629163.1 (Kim et al. 2014) Hasora vitta 15,282 NC_027170.1 Unpublished Nymphalidae Apatura ilia 15,242 NC_016062.1 (Chen et al. 2012) Pyraloidea Pyralidae Artogeia melete 15,140 EU597124 (Hong et al. 2009) Corcyra cephalonica 15,273 NC_016866.1 (Wu et al. 2012a) Crambidae Chilo suppressalis 15,395 NC_015612 (Yin et al. 2011; Chai et al. 2012) Diatraea saccharalis 15,490 NC_013274 (Li et al. 2011) Elophila interruptalis 15,351 NC_021756 (Park et al. 2014) Bombycoidea Bombycidae Bombyx mandarina 15,682 NC_003395 (Yukuhiro et al. 2002) Bombyx mori 15,643 NC_002355 Direct submission Saturniidae Antheraea pernyi 15,566 AY242996 (Liu et al. 2008) Antheraea yamamai 15,338 NC_012739 (Kim et al. 2009) Eriogyna pyretorum 15,327 FJ685653.1 (Jiang et al. 2009) Sphingidae Manduca sexta 15,516 NC_010266 (Cameron & Whiting 2008) Sphinx morio 15,299 NC_020780.1 (Kim et al. 2013) Geometroidea Geometridae Abraxas suspecta 15,547 KY095828 This study Apocheima cinerarium 15,722 KF836545 (Liu et al. 2014) ...... continued on the next page

MITOGENOME OF ABRAXAS SUSPECTA (LEPIDOPTERA) Zootaxa 0000 (0) © 2017 Magnolia Press · 3 TABLE 1. (Continued) Superfamily Family Species Size (bp) GenBank Reference accession no. Biston panterinaria 15,517 NC_020004 (Yang et al. 2013) Biston perclara 15,493 KU325536.1 In press Biston suppressaria 15,628 KP278206 (Chen et al. 2015) Biston suppressaria 15,628 KP278206 (Chen et al. 2015) Phthonandria atrilineata 15,499 NC_010522 (Yang et al. 2009) Noctuoidea Erebidae Amata formosae 15,463 KC513737 (Lu et al. 2013) Hyphantria cunea 15,481 NC_014058 (Liao et al. 2010) Lymantria dispar 15,569 NC_012893 Unpublished Noctuidae Agrotis ipsilon 15,377 KF163965 (Wu et al. 2015) Helicoverpa armigera 15,347 GU188273 (Yin et al. 2010)

TABLE 2. Primers used to amplify the mitogenome of A. suspecta. Primer pair Primer sequences ( 5’-3’ ) F1 TAAAAATAAGCTAAATTTAAGCTT R1 TATTAAAATTGCAAATTTTAAGGA F2 AAACTAATAATCTTCAAAATTAT R2 AAAATAATTTGTTCTATTAAAG F3 TGGAGCAGGAACAGGATGAAC R3 GAGACCADTACTTGCTTTCAG F4 ATTTGTGGAGCTAATCATAG R4 GGTCAGGGACTATAATCTAC F5 TCGACCTGGAACTTTAGC R5 GCAGCTATAGCCGCTCCTACT F6 TAAGCTGCTAACTTAATTTTTAGT R6 CCTGTTTCAGCTTTAGTTCATTC F7 CCTAATTGTCTTAAAGTAGATAA R7 TGCTTATTCTTCTGTAGCTCATAT F8 TAATGTATAATCTTCGTCTATGTAA R8 ATCAATAATCTCCAAAATTATTAT F9 ACTTTAAAAACTTCAAAGAAAAA R9 TCATAATAAATTCCTCGTCCAATAT F10 GGAGCTTCTACATGAGCTTTTGG R10 GTTTGCGACCTCGATGTTG F11 GGTCCCTTACGAATTTGAATATATCCT R11 AAACTAGGATTAGATACCCTATTAT F12 CTCTACTTTGTTACGACTTATT R12 TCTAGGCCAATTCAACAACC

Results and discussion

Genome structure, organization and composition. The complete mitogenome of A. suspecta (KY095828) is

4 · Zootaxa 0000 (0) © 2017 Magnolia Press SUN ET AL. 15,547 bp in size (Fig. 1), including 13 protein-coding genes (PCGs: atp6, atp8, cox1-3, cob, nad1-6, and nad4L), 2 ribosomal RNA (rrnL and rrnS) genes, 23 putative transfer RNA (tRNA) genes with an extra copy of tRNAAsn(AUU) and an A+T-rich region (Table 3) as that documented in other animal mitogenomes. The mitogenome organization and gene order are similar to other arthropod species, except for the presence of an extra copy of trnN (AUU). Twenty-five genes (9 PCGs and 16 tRNAs) are encoded by heavy strand (H-strand), while the other ones (4 PCGs, 7 tRNAs, and 2 rRNA genes) are encoded by light strand (L-strand) similar to several other arthropods mitogenomes. The gene arrangement and orientation of A. suspecta is trnM-trnI-trnQ, which differs from the ancestral gene order trnI-trnQ-trnM (Boore 1999).

FIGURE 1. Map of the mitogenome of A. suspecta. The tRNA genes are labeled according to the IUPAC-IUB single-letter amino acids: cox1, cox2 and cox3 refer to the cytochrome c oxidase subunits; cob refers to cytochrome b; nad1-nad6 refer to NADH dehydrogenase components; rrnL and rrnS refer to ribosomal RNAs.

MITOGENOME OF ABRAXAS SUSPECTA (LEPIDOPTERA) Zootaxa 0000 (0) © 2017 Magnolia Press · 5 TABLE 3. List of annotated mitochondrial genes of A. suspecta. Gene Direction Location Size Anti codon Start codon Stop codon Intergenic Nucleotides tRNAMet F1—6868CAT— — 1 tRNAIle F 70—135 66 GAT — — -3 tRNAGln R 133—201 69 TTG — — 64 nad2 F 266—1271 1006 ATA TAA -1 tRNATrp F 1271—1339 69 TCA — — -8 tRNACys R 1332—1399 68 GCA — — -1 tRNATyr R 1399—1464 66 GTA — — 3 cox1 F 1468—2998 1531 CGA T 0 tRNALeu(UUR) F 2999—3065 67 TAA — — 0 cox2 F 3066—3751 686 ATA T 0 tRNALys F 3752—3823 72 CTT — — -1 tRNAAsp F 3823—3891 69 GTC — — 0 atp8 F 3892—4062 171 ATT TAA -9 atp6 F 4056—4733 678 ATG TAA -1 cox3 F 4733—5538 806 ATA TAA -1 tRNAGly F 5538—5603 66 TCC — — -3 nad3 F 5601—5957 357 ATA TAA 3 tRNAAla F 5961—6027 67 TGC — — -1 tRNAArg F 6027—6087 61 TCG — — 0 tRNAAsn F 6088—6153 66 GTT — — -1 tRNASer(AGN) F 6153—6220 68 GCT — — -1 tRNAGlu F 6220—6284 65 TTC — — -2 tRNAPhe R 6283—6349 67 GAA — — 1 nad5 R 6351—8088 1738 ATT T 0 tRNAHis R 8089—8156 68 GTG — — 1 nad4 R 8158—9496 1339 ATG T 1 nad4L R 9498—9789 292 ATG TAA 2 tRNAThr F 9792—9855 64 TGT — — 1 tRNAPro R 9857—9923 67 TGG — — 2 nad6 F 9926—10469 544 ATA TAA 48 cytb F 10518—11672 1155 ATG TAA -1 tRNASer(UCN) F 11672—11736 65 TGA — — 18 nad1 R 11708—12644 937 ATG TAA 0 tRNALeu(CUN) R 12645—12711 67 TAG — — 53 rrnL R 12765—14173 1409 — — — 0 tRNAVal R 14174—14240 67 TAC — — 0 rrnS R 14241—15015 775 — — — 156 tRNAAsn-like F 15172—15237 66 ATT — — A+T-rich Region 15016—15547 532

6 · Zootaxa 0000 (0) © 2017 Magnolia Press SUN ET AL. FIGURE 2. Comparison of codon usage within the mitochondrial genome of members of the Lepidoptera. Lowercase letters (a, b, c, d and e) above species name represent the superfamily to which the species belongs (a: Geometroidea, b: Bombycoidea, c: Noctuoidea, d: Tortricoidea, e Hepialoidea:).

Base composition and skewness level of the A. suspecta mitogenome compared to other lepidopterans is shown in Table 4. The genome composition of the major strand in A. suspecta mitogenome is as follows: A= 40.88%, T= 39.99%, G= 7.87%, and C= 11.26%, with a total A+T content is 80.87%. Additionally, it exhibits positive AT skewness (0.011) and negative GC skewness (-0.177). A similar trend has been observed in several lepidopteran mitogenomes sequenced to date that the value of AT-skewness varies from -0.021 in Antheraea pernyi (Guérin-Méneville, 1855) (Saturniidae: Saturniinae) to 0.064 in Biston panterinaria (Bremer & Grey, 1853) (Geometridae: Ennominae), while the GC-skewness is always negative ranging from -0.260 (B. panterinaria) to - 0.177 (A. suspecta). Moreover the positive AT skewness (0.011) indicates the occurrence of more As than Ts, similar to some lepidopterans such as Apocheima cinerarium (Erschov, 1874) (0.027), Phthonandria atrilineata (Butler, 1881) (0.007) and Biston perclara (Warren, 1899) (0.062), all belong to Geometridae: Ennominae. Protein-coding genes and codon usage. The mitochondrial genome of A. suspecta encodes 13 protein-coding genes with 11,248 bp in length that accounts for 72.3% of the complete mitogenome. Base composition of PCGs is shown in Table 4. The twelve of 13 protein-coding genes employ ATN (ATT, ATG and ATA) as initiation codon, while cox1 utilizes CGA as start codon (Dai et al. 2015; He et al. 2015). Several researchers have maintained the problematic translational start at the cox1 locus in many insect species, with TTAG, ACG, and TTG proposed as start codons for cox1 (Lutz-Bonengel et al. 2004; Ogoh & Ohmiya 2004; Lee et al. 2006). Five PCGs (atp6, nad4L, cytb, nad6 and nad1) of the A. suspecta starts with ATG, two PCGs (nad5 and atp8) starts with ATT, and five PCGs (nad2, cox2, cox3, nad3 and nad6) starts with ATA. With regards to stop codon, nine PCGs use usual TAA termination codon, and the remaining four (cox1, cox2, nad5 and nad4) terminated with a T nucleotide. This characteristic feature has been well documented in other invertebrate mitogenomes, and is a common evolutionary feature shared by mtDNA. The structure of single T end codon is recognized by endonucleases processing the polycistronic pre-mRNA transcription, and produces functional stop codons by polyadenylation from its contiguous PCGs (Lu et al. 2002). We analyzed the codon usage among nine lepidopteran species, of the nine species; five belong to Geometroidea, while remaining four, one each from Bombycoidea, Noctuoidea, Tortricoidea and Hepialoidea (Fig. 2). The results revealed that 4 codon families (Asn, Ile, Lys and Phe) were the most frequently utilized with no less than 80 codons per thousand codons. The Arg family was least utilized codon family. Moreover, codon distribution

MITOGENOME OF ABRAXAS SUSPECTA (LEPIDOPTERA) Zootaxa 0000 (0) © 2017 Magnolia Press · 7 FIGURE 3. Codon distribution in members of the Lepidoptera. CDspT = codons per thousand codons.

8 · Zootaxa 0000 (0) © 2017 Magnolia Press SUN ET AL. TABLE 4. Composition and skewness of mitogenome in different Lepidopteran insects. Species Size(bp) A% G% T% C% A+T% ATskewness GCskewness Whole genome A. suspecta 15,547 40.88 7.87 39.99 11.26 80.87 0.011 -0.177 A.cinerarium 15,722 41.52 7.79 39.33 11.37 80.58 0.027 -0.187 P. atrilineata 15,499 40.78 7.67 40.24 11.31 81.02 0.007 -0.192 B. perclara 15,493 42.28 7.70 37.31 12.72 79.58 0.062 -0.246 B. panterinaria 15,517 42.32 7.56 37.23 12.88 79.55 0.064 -0.260 M. sexta 15,516 40.67 7.46 41.11 10.76 81.79 -0.005 -0.181 B. mandarina 15,682 43.11 7.40 38.48 11.01 81.59 0.057 -0.196 A. pernyi 15,566 39.22 7.77 40.94 12.07 80.16 -0.021 -0.216 L. dispar 15,569 40.58 7.57 39.30 12.55 79.88 0.016 -0.248 H. cunea 15,481 40.58 7.55 39.81 12.06 80.39 0.010 -0.230 C. pomonella 15,253 39.92 7.88 40.21 11.99 80.13 -0.004 -0.207 A. ilia 15,242 39.77 7.75 40.68 11.80 80.45 -0.011 -0.207 G. dimo r ph a 15,831 39.99 7.77 40.85 11.39 80.84 -0.011 -0.189 H. vitta 15,282 39.58 7.81 40.34 12.27 79.92 -0.010 -0.222 C. suppressalis 15,395 40.64 7.39 40.03 11.94 80.67 0.007 -0.235 A. ipsilon 15,377 40.38 7.71 40.87 11.04 81.25 -0.006 -0.178 PCG A. suspecta 11,248 39.99 8.78 39.05 12.18 79.04 0.012 -0.162 A.cinerarium 11,227 40.63 8.78 38.19 12.39 78.83 0.031 -0.171 P.atrilineata 11,203 40.23 8.59 38.87 12.31 79.10 0.017 -0.178 B. perclara 11,209 41.51 8.54 36.01 13.94 77.52 0.071 -0.240 B. panterinaria 11,215 41.54 8.43 35.84 14.18 77.39 0.074 -0.254 M. sexta 11,185 40.41 8.23 39.88 11.48 80.30 0.007 -0.165 B. mandarina 11,196 42.83 8.26 37.04 11.87 79.87 0.072 -0.179 A. pernyi 11,204 39.22 7.77 40.94 12.07 80.16 -0.021 -0.216 L. dispar 11,227 39.67 8.44 38.16 13.73 77.83 0.019 -0.239 H. cunea 11,198 39.98 8.35 38.61 13.06 78.59 0.017 -0.220 C. pomonella 11,199 39.55 8.69 39.00 12.76 78.55 0.007 -0.190 A. ilia 11,148 39.41 8.41 39.49 12.69 78.89 -0.001 -0.203 G. dimo r ph a 11,232 39.51 8.81 39.18 12.49 78.69 0.004 -0.173 H. vitta 11,202 38.76 8.61 39.43 13.20 78.19 -0.009 -0.210 C. suppressalis 11,230 40.42 8.16 38.48 12.95 78.90 0.025 -0.227 A. ipsilon 11,226 39.69 8.44 40.14 11.72 79.83 -0.006 -0.163 tRNA A. suspecta 1,540 42.79 7.60 40.13 9.48 82.92 0.032 -0.110 A.cinerarium 1,483 42.01 8.02 39.45 10.52 81.46 0.031 -0.135 P.atrilineata 1,476 41.40 8.20 40.04 10.37 81.44 0.017 -0.117 B. perclara 1,488 42.20 7.73 39.52 10.55 81.72 0.033 -0.154 B. panterinaria 1,475 42.31 7.66 39.32 10.71 81.63 0.037 -0.166 M. sexta 1,554 40.99 7.92 41.06 10.04 82.05 -0.001 -0.118 B. mandarina 1,472 41.78 7.81 39.95 10.46 81.73 0.022 -0.145 ...... continued on the next page

MITOGENOME OF ABRAXAS SUSPECTA (LEPIDOPTERA) Zootaxa 0000 (0) © 2017 Magnolia Press · 9 TABLE 4. (Continued) Species Size(bp) A% G% T% C% A+T% ATskewness GCskewness A. pernyi 1,459 39.22 7.77 40.94 12.07 80.16 -0.021 -0.217 L. dispar 1,459 41.60 7.95 39.48 10.97 81.08 0.026 -0.160 H. cunea 1,463 41.83 7.86 39.99 10.32 81.82 0.022 -0.135 C. pomonella 1,464 41.19 7.92 40.23 10.66 81.42 0.012 -0.147 A. ilia 1,433 40.61 8.30 40.96 10.12 81.58 -0.004 -0.099 G. dimo r ph a 1,451 41.01 8.06 40.52 10.41 81.53 0.006 -0.127 H. vitta 1,456 41.41 8.04 39.84 10.71 81.25 0.019 -0.142 C. suppressalis 1,482 40.89 7.89 40.89 10.32 81.78 0.000 -0.133 A. ipsilon 1,465 41.23 8.12 40.48 10.17 81.71 0.009 -0.112 rRNA A. suspecta 2,184 42.86 4.85 42.72 9.57 85.58 0.002 -0.327 A.cinerarium 2,179 43.97 4.77 41.17 10.10 85.13 0.033 -0.358 P.atrilineata 2,203 42.85 4.58 43.08 9.49 85.93 -0.003 -0.349 B. perclara 2,239 45.33 4.91 39.71 10.05 85.04 0.066 -0.344 B. panterinaria 2,261 45.33 4.64 39.94 10.08 85.27 0.063 -0.370 M. sexta 2,168 41.37 4.84 44.05 9.73 85.42 -0.031 -0.336 B. mandarina 2,134 43.86 4.78 41.05 10.31 84.91 0.033 -0.366 A. pernyi 2,144 39.22 7.77 40.94 12.07 80.16 -0.021 -0.217 L. dispar 2,150 42.79 4.79 41.81 10.60 84.60 0.012 -0.377 H. cunea 2,234 42.08 4.92 42.75 10.25 84.83 -0.008 -0.351 C. pomonella 2,147 40.48 5.03 43.92 10.57 84.40 -0.041 -0.355 A. ilia 2,109 40.11 4.98 44.86 10.05 84.97 -0.056 -0.337 G. dimo r ph a 2,181 41.13 4.95 43.83 10.09 84.96 -0.032 -0.342 H. vitta 2,194 41.43 4.88 43.25 10.44 84.69 -0.021 -0.363 C. suppressalis 2,171 41.27 4.97 43.67 10.09 84.94 -0.028 -0.340 A. ipsilon 2,162 41.58 5.00 43.57 9.85 85.15 -0.023 -0.327 A+T-rich region A. suspecta 532 46.99 2.44 46.62 3.95 93.61 0.004 -0.236 A.cinerarium 625 47.20 1.92 48.64 2.24 95.84 -0.015 -0.077 P.atrilineata 457 40.70 0.66 57.55 1.09 98.25 -0.172 -0.246 B. perclara 347 45.53 2.88 46.97 4.61 92.51 -0.016 -0.231 B. panterinaria 349 44.99 2.29 48.14 4.58 93.12 -0.034 -0.333 M. sexta 324 45.06 1.54 50.31 3.09 95.37 -0.005 -0.335 B. mandarina 484 46.49 2.69 47.93 2.89 94.42 -0.015 -0.036 A. pernyi 552 39.22 7.77 40.94 12.07 80.16 -0.021 -0.216 L. dispar 435 40.58 7.57 39.30 12.55 79.88 0.016 -0.248 H. cunea 357 45.66 1.12 49.30 3.92 94.96 -0.038 -0.556 C. pomonella 351 43.30 1.14 52.42 3.13 95.73 -0.095 -0.466 A. ilia 403 42.93 3.23 49.63 4.22 92.56 -0.072 -0.133 G. dimo r ph a 848 41.63 1.30 54.83 2.24 96.46 -0.137 -0.266 C. suppressalis 348 42.24 0.29 53.16 4.31 95.40 -0.114 -0.874 A. ipsilon 332 46.08 1.51 48.80 3.61 94.88 -0.029 -0.41

10 · Zootaxa 0000 (0) © 2017 Magnolia Press SUN ET AL. in the Geometroidea species was consistent (Fig. 3). The Relative Synonymous Codon Usage (RSCU) values of Lepidoptera are shown in Figure 4. Among the 64 available codons, the PCGs of A. suspecta utilized all possible codon combinations except for the CGG. The absence of codons containing high GC content is a common feature in several lepidopteran species such as Apocheima cinerarium (Erschoff, 1874) (GCG), Phthonandria atrilineata Butler, 1881 (CGG), all Biston species (Geometridae: Ennominae); Manduca sexta (Linnaeus, 1763) (Sphingidae: Sphinginae) (CGG & CGC); Hyphantria cunea (Drury, 1773) (Erebidae: Arctiinae) (GCG); Cydia pomonella (Linnaeus, 1758) (Tortricidae: Olethreutinae) (GCG); Hasora vitta (Butler, 1870) (Hesperiidae: Coeliadinae) (GCG) lack of (GCG). This feature is conserved in insect mitogenomes (Lu et al. 2013; Dai et al. 2015).

FIGURE 4. The Relative Synonymous Codon Usage (RSCU) of the mitochondrial genome of five superfamilies in the Lepidoptera. Codon families are plotted on the X axis. Codons indicated above the bar are not present in the mitogenome.

Ribosomal and transfer RNA genes. The complete mitogenome harbors two rRNA genes as in all other insect mitogenome sequences. The large ribosomal (rrnL) and small ribosomal (rrnS) genes are 1409 bp and 775 bp in length, respectively. They locate on the heavy (H) strand between tRNAVa l and A+T-rich region and contained a tRNAAsn-like (Table 3). The A+T content (85.58%) of two rRNAs fall well within the range from 80.16% in Antheraea pernyi (Guérin-Méneville, 1855) (Saturniidae: Saturniinae) to 85.93% (Phthonandria atrilineata Butler, 1881 (Geometridae: Ennominae). Further, the present analysis demonstrates that A+T content of Geometridae is

MITOGENOME OF ABRAXAS SUSPECTA (LEPIDOPTERA) Zootaxa 0000 (0) © 2017 Magnolia Press · 11 FIGURE 5. Putative secondary structures of the 23 tRNA genes of the A. suspecta mitogenome.

12 · Zootaxa 0000 (0) © 2017 Magnolia Press SUN ET AL. FIGURE 6. Alignment of overlapping region between atp8 and atp6 across Lepidoptera and other insects. The numbers on the right refer to intergenic nucleotides.

FIGURE 7. (A) Alignment of the intergenic spacer region between trnS2 (UCN) and nad1 of several Lepidopteran insects. The shaded ‘ATACTAA’ motif is conserved across the Lepidoptera order. (B) Features present in the A+T-rich region of A. suspecta. The sequence is shown in the reverse strand. The ATATG motif is shaded. The poly-T stretch is underlined while the poly-A stretch is double underlined. The single microsatellite T/A repeats sequence are indicated by dotted underlining. higher than most other families in Lepidoptera. The positive AT skewness (0.002) and negative GC skewness (- 0.327) of A. suspecta is similar to other sequenced Geometridae except P. atrilineata that has both negative AT skewness (-0.003) and GC skewness (-0.349). The mitogenome of A. suspecta contains 22 tRNAs and a tRNA-like gene (trnN (AUU)), which can fold into canonical clover-leaf secondary structure except the trnS (AGN) whose dihydrouridine (DHU) loop is missing, as reported in other insect mitogenomes sequenced to date (Cong & Grishin 2016; Liu et al. 2014). The incomplete trnS is considered as one of the common feature in most insect mitogenomes. These 23 tRNA genes are totally 1538 bp in length, range in size from 61 to 72 bp and intersperse throughout the whole genome (Fig. 5). A total of 19 mismatched base pairs are indentified in the A. suspecta tRNAs, and of the 13 are GU pairs, which form a weak bond in the tRNAs, the remaining 6 are a typical pairs, including 5 UU pairs, and 1 AA pairs (Fig. 5). Interestingly, an insertion of 66 bp (tRNA-like gene) is observed in the rrnL genes, and this remarkable feature has not been previously reported in any lepidopteran mitogenomes to date, despite that tRNA translocation is a frequent phenomenon in the evolution of lepidopteran mitogenomes (Taylor et al. 1993).

MITOGENOME OF ABRAXAS SUSPECTA (LEPIDOPTERA) Zootaxa 0000 (0) © 2017 Magnolia Press · 13 Overlapping and intergenic spacer regions. A total of 14 overlapping regions are identified in the mitogenome of A. suspecta with a total length of 34 bp. Eight of the 14 overlapping regions are resided between tRNA and tRNA (trnQ and trnI, trnW and trnC, trnC and trnY, trnK and trnD, trnA and trnR, trnN1 and trnS1, trnS1 and trnE, trnE and trnF), four between tRNA and protein (nad2 and trnW, cox3 and trnG, trnG and nad3, trnS2 and cytb), and two between protein and protein (atp6 and atp8, atp6 and cox3). The length of these sequences vary from 1 bp to 9 bp, and the longest overlapping region is located between atp6 and atp8 (Table 3) that is usually reported from sequenced lepidopteran (Wu et al. 2010; Zhu et al. 2013). This newly sequenced mitogenome includes 14 intergenic spacers in a total of 354 bp, ranging in size from 1 to 156 bp. Of the fourteen intergenic spacers, five are major intergenic spacers at least 10 bp in length (Table 3). The longest intergenic spacer (156 bp) is located between genes trnQ and nad2, with an extremely high A+T nucleotides content, this characteristic feature has been frequently reported in lepidopteran mitogenomes (He et al. 2015). The 19 bp spacer between trnS2 (UCN) and nad1 contains the motif ATACTAA (Fig. 7A) that is highly conserved region and found in most insect mitogenomes, and it seems to be a possible mitochondrial transcription termination peptide-binding site (mtTERM protein) (Taanman 1999). The A+T-rich region. The A + T-rich region of A. suspecta 532 bp long and locates between the rrnS and trnM. Additionally, this region contains tRNAAsn-like gene. Compared with other lepidoteran species, the A + T-rich regions of A. suspecta is longer than that of Manduca sexta (Linnaeus, 1763) (Sphingidae) (324bp), Cydia pomonella (Linnaeus, 1758) (Tortricidae) (351 bp) and Hyphantria cunea (Erebidae) (357 bp) while is shorter than that of Antheraea pernyi (Guérin-Méneville, 1855) (Saturniidae) (552 bp), Apocheima cinerarium (Erschoff, 1874) (Geometridae) (625 bp) and Grapholita dimorpha Komai, 1979 (848 bp) (Table 4). We identified several short repeating sequences scattered throughout the entire region, including the motif ATAGA followed by a 13 bp poly-

T stretch, a microsate-like (AT)8(AAT)3 element and a poly-A element upstream of trnM gene similar to other Lepidoptera mitogenomes (Fig. 7B). The length of poly-T stretch varies from species to species (Dai et al. 2015; Lu et al. 2013), while ATAGA region is conserved in Lepidoptera species (Cameron & Whiting 2008).

FIGURE 8. Tree showing the phylogenetic relationships among Lepidopteran insects, constructed using (A) Bayesian inference (BI). (B) Maximum Likelihood method (ML). Bootstrap values (1000 repetitions) of the branches are indicated. Drosophila melanogaster (U37541.1) and Anopheles gambiae (L20934.1) were used as outgroups.

14 · Zootaxa 0000 (0) © 2017 Magnolia Press SUN ET AL. FIGURE 8B.

Phylogenetic analyses. We used two analysis approaches, Bayesian Interference (BI) and Maximum Likelihood (ML) to reconstruct the phylogenetic tree. To infer phylogenetic relationship of Lepidoptera, the nucleotide sequences of the 13 PCGs were firstly aligned and then concatenated. The phylogenetic analyses depicted, as one could expect, that Antheraea suspecta has a close relationship to other geometrid species: Phthonandria atrilineata and Apocheima cinerarium that is well supported by both BI and ML methods (Figs 8A & B). The species A. suspecta, belonging to the Geometridae family, is clustered with other superfamilies, including the Hepialoidea, Yponomeutoidea, Gelechioidea, Tortricoidea, Papilionoidea, Pyraloidea, Bombycoidea, and Noctuoidea. The Geometridae were found closely related to Pyraloidea and Hepialoidea in ML analysis, while BI analysis revealed that it is closely related to Bombycoidea. In our study, the relationships at superfamily level are consistent with previously documented studies of lepidopterans (Chai et al. 2012; Liu et al. 2013; Regier et al. 2009, 2013). Further, we observed that in our study Pyralidae and Crambidae are separated by Elachistidae in ML

MITOGENOME OF ABRAXAS SUSPECTA (LEPIDOPTERA) Zootaxa 0000 (0) © 2017 Magnolia Press · 15 methods, but this phenomenon lack in BI analysis. Interestingly, both approaches (BI and ML) indicated that Apatura ilia ([Denis et Schiffermüller, 1775]) (Nymphalidae) is closely related to Hesperiidae. Both families following recent numerous morphological and molecular classification and phylogenetic studies of butterflies are assigned to the superfamily Papilionoidea (Regier et al. 2009, 2013; Heikkilä et al. 2011; Zhang 2011; Kawahara & Breinholt 2014; Timmermans et al. 2014). We inferred from the present study that more research on complete mitochondrial genomes of the diverse Lepidoptera species is needed in order to understand the complexity of phylogenetic relationships.

Acknowledgments

This work was supported by the earmarked fund for the modern Agroindustry Technology Research System (CARS-22 SYZ10), the Biology Key Subjects of Anhui Province, the National Natural Science Foundation of China (31301715), the Sericulture Biotechnology Innovation Team (2013xkdt-05), the National Natural Science Foundation of China (31472147), the Ph.D. Programs in Biochemistry and Molecular Biology (xk2013042), the National Natural Science Foundation of China (31402018), and the Graduate Student Innovation Fund of Anhui Agricultural University (2015-34).

References

Beard, C.B., Hamm, D.M. & Collins, F.H. (1993) The mitochondrial genome of the mosquito Anopheles gambiae: DNA sequence, genome organization, and comparisons with mitochondrial sequences of other insects. Insect Molecular Biology, 2, 103–124. https://doi.org/10.1111/j.1365-2583.1993.tb00131.x Benson, G. (1999) Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Research, 27, 573–580. https://doi.org/10.1093/nar/27.2.573 Boore, J.L. (1999) Animal mitochondrial genomes. Nucleic Acids Research, 27, 1767–1780. https://doi.org/10.1093/nar/27.8.1767 Cameron, S.L. (2014) Insect mitochondrial genomics: implications for evolution and phylogeny. Annual Review of Entomology, 59, 95–117. https://doi.org/10.1146/annurev-ento-011613-162007 Cameron, S.L. & Whiting, M.F. (2008) The complete mitochondrial genome of the tobacco hornworm, Manduca sexta, (Insecta : Lepidoptera : Sphingidae), and an examination of mitochondrial gene variability within butterflies and moths. Gene, 408, 112–123. https://doi.org/10.1016/j.gene.2007.10.023 Cao, Y.Q., Ma, C.A., Chen, J.Y. & Yang, D.R. (2012) The complete mitochondrial genomes of two ghost moths, Thitarodes renzhiensis and Thitarodes yunnanensis: the ancestral gene arrangement in Lepidoptera. BMC Genomics, 13, 276. https://doi.org/10.1186/1471-2164-13-276 Cha, S.Y., Yoon, H.J., Lee, E.M., Yoon, M.H., Hwang, J.S., Jin, B.R., Han,Y.S. & Kim, I. (2007) The complete nucleotide sequence and gene organization of the mitochondrial genome of the bumblebee, Bombus ignitus (Hymenoptera: Apidae). Gene, 392, 206–220. https://doi.org/10.1016/j.gene.2006.12.031 Chai, H.N., Du, Y.Z. & Zhai, B.P. (2012) Characterization of the complete mitochondrial genomes of Cnaphalocrocis medinalis and Chilo suppressalis (Lepidoptera: Pyralidae). International Journal of Biological Sciences, 8, 561–579. https://doi.org/10.7150/ijbs.3540 Chen, M., Tian, L.L., Shi, Q.H., Cao, T. W. & Hao, J.S. (2012) Complete mitogenome of the Lesser Purple Emperor Apatura ilia (Lepidoptera: Nymphalidae: Apaturinae) and comparison with other nymphalid butterflies. Dongwuxue Yanjiu, 33, 191–201. Chen, S.C., Wang, X.Q., Wang, J.J., Hu, X. & Peng, P. (2015) The complete mitochondrial genome of a tea pest looper, Buzura suppressaria (Lepidoptera: Geometridae). Mitochondrial DNA, Part A, DNA Mapping, Sequencing and Analysis, 1–2. https://doi.org/10.3109/19401736.2015.1007310 Chen, S.C., Wang, X.Q., Wang, J.J., Hu, X. & Peng, P. (2016) The complete mitochondrial genome of a tea pest looper, Buzura suppressaria (Lepidoptera: Geometridae). Mitochondrial DNA, Part A, DNA Mapping, Sequencing and Analysis, 27, 3153–3154. Cong, Q. & Grishin, N.V. (2016) The complete mitochondrial genome of Lerema accius and its phylogenetic implications. Peerj, 4, e1546. https://doi.org/10.7717/peerj.1546 Dai, L., Qian, C., Zhang, C., Wang, L., Wei, G., Li, J., et al. (2015) Characterization of the complete mitochondrial genome of

16 · Zootaxa 0000 (0) © 2017 Magnolia Press SUN ET AL. Cerura menciana and comparison with other lepidopteran insects. PLoS One, 10, e0132951. https://doi.org/10.1371/journal.pone.0132951 Dai, L. S., Zhu, B. J., Qian, C., Zhang, C. F., Li, J., Wang, L., Wei, G.Q. & Liu, C.L. (2014) The complete mitochondrial genome of the diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae). Mitochondrial DNA, Part A, DNA Mapping, Sequencing and Analysis, 27, 1512–1513. Dong, Y., Zhu, L. X., Ding, M. J., Wang, J. J., Luo, L. G., Liu, Y. & Ou, Y.Y. (2016) Complete mitochondrial genome of Papilio syfanius (Lepidoptera: Papilionidae). Mitochondrial DNA, Part A, DNA Mapping, Sequencing and Analysis, 27, 403–404. Hao, J., Sun, Q., Zhao, H., Sun, X., Gai, Y. & Yang, Q. (2012) The complete mitochondrial genome of Ctenoptilum vasava (Lepidoptera: Hesperiidae: Pyrginae) and its phylogenetic implication. Comparative and Functional Genomics, 2012, 328049. https://doi.org/10.1155/2012/328049 He, S.L., Zou, Y., Zhang, L.F., Ma, W.Q., Zhang, X.Y. & Yue, B.S. (2015) The complete mitochondrial genome of the beet webworm, Spoladea recurvalis (Lepidoptera: Crambidae) and its phylogenetic implications. PLoS One, 10, e0129355. https://doi.org/10.1371/journal.pone.0129355 Heikkilä, M., Kaila, L., Mutanen, M., Peña, C. & Wahlberg, N. (2011) Cretaceous origin and repeated Tertiary diversification of the redefined butterflies. Proceedings of the Royal Society B, Biological Sciences, 279, 1093–1099. https://doi.org/10.1098/rspb.2011.1430 Hong, G., Jiang, S., Yu, M., Yang, Y., Li, F., Xue, F. & Wei, Z. (2009) The complete nucleotide sequence of the mitochondrial genome of the cabbage butterfly, Artogeia melete (Lepidoptera: Pieridae). Acta Biochimica et Biophysica Sinica (Shanghai), 41, 446–455. https://doi.org/10.1093/abbs/gmp030 Jiang, S.T., Hong, G.Y., Yu, M., Li, N., Yang, Y., Liu, Y.Q. & Wei, Z.J. (2009) Characterization of the complete mitochondrial genome of the giant silkworm moth, Eriogyna pyretorum (Lepidoptera: Saturniidae). International Journal of Biological Sciences, 5, 351–365. https://doi.org/10.7150/ijbs.5.351 Junqueira, A.C., Lessinger, A.C., Torres, T.T., da Silva, F.R., Vettore, A.L., Arruda, P. & Azeredo Espin, A.M. (2004) The mitochondrial genome of the blowfly Chrysomya chloropyga (Diptera: Calliphoridae). Gene, 339, 7–15. https://doi.org/10.1016/j.gene.2004.06.031 Kawahara, A.Y. & Breinholt, J.W. (2014) Phylogenomics provides strong evidence for relationships of butterflies and moths. Proceedings of the Royal Society B, Biological Science, 281, 20140970. https://doi.org/10.1098/rspb.2014.0970 Kim, M.I., Baek, J.Y., Kim, M.J., Jeong, H.C., Kim, K.G., Bae, C.H., Han, Y.S., Jin, B.R. & Kim, I. (2009) Complete nucleotide sequence and organization of the mitogenome of the red-spotted apollo butterfly, Parnassius bremeri (Lepidoptera: Papilionidae) and comparison with other lepidopteran insects. Molecules and Cells, 28, 347–363. https://doi.org/10.1007/s10059-009-0129-5 Kim, M.J., Choi, S.W. & Kim, I. (2013) Complete mitochondrial genome of the larch hawk moth, Sphinx morio (Lepidoptera: Sphingidae). Mitochondrial DNA, Part A, DNA Mapping, Sequencing and Analysis, 24, 622–624. https://doi.org/10.3109/19401736.2013.772155 Kim, M.J., Wang, A.R., Park, J.S. & Kim, I. (2014) Complete mitochondrial genomes of five skippers (Lepidoptera: Hesperiidae) and phylogenetic reconstruction of Lepidoptera. Gene, 549, 97–112. https://doi.org/10.1016/j.gene.2014.07.052 Kim, S.R., Kim, M.I., Hong, M.Y., Kim, K.Y., Kang, P.D., Hwang, J.S., Han, Y.S., Jin, B.R. & Kim, I. (2009) The complete mitogenome sequence of the Japanese oak silkmoth, Antheraea yamamai (Lepidoptera: Saturniidae). Molecular Biology Reports, 36, 1871–1880. https://doi.org/10.1007/s11033-008-9393-2 Lee, E.S., Shin, K.S., Kim, M.S., Park, H., Cho, S. & Kim, C.B. (2006) The mitochondrial genome of the smaller tea tortrix Adoxophyes honmai (Lepidoptera: Tortricidae). Gene, 373, 52–57. https://doi.org/10.1016/j.gene.2006.01.003 Lewis, D.L., Farr, C.L. & Kaguni, L.S. (1995) Drosophila melanogaster mitochondrial DNA: completion of the nucleotide sequence and evolutionary comparisons. Insect Molecular Biology, 4, 263–278. https://doi.org/10.1111/j.1365-2583.1995.tb00032.x Li, W., Zhang, X., Fan, Z., Yue, B., Huang, F., King, E. & Ran, J. (2011) Structural characteristics and phylogenetic analysis of the mitochondrial genome of the sugarcane borer, Diatraea saccharalis (Lepidoptera: Crambidae). DNA and Cell Biology, 30, 3–8. https://doi.org/10.1089/dna.2010.1058 Liao, F., Wang, L., Wu, S., Li, Y. P., Zhao, L., Huang, G.M., Niu, C.-J., Liu, Y.-Q. & Li, M.-G. (2010) The complete mitochondrial genome of the fall webworm, Hyphantria cunea (Lepidoptera: Arctiidae). International Journal of Biological Sciences, 6, 172–186. https://doi.org/10.7150/ijbs.6.172 Liu, Q.N., Zhu, B.J., Dai, L.S. & Liu, C.L. (2013) The complete mitogenome of Bombyx mori strain Dazao (Lepidoptera: Bombycidae) and comparison with other lepidopteran insects. Genomics, 101, 64–73.

MITOGENOME OF ABRAXAS SUSPECTA (LEPIDOPTERA) Zootaxa 0000 (0) © 2017 Magnolia Press · 17 https://doi.org/10.1016/j.ygeno.2012.10.002 Liu, Q.N., Zhu, B.J., Dai, L.S., Wang, L., Qian, C., Wei, G.Q. & Liu C.L. (2016) The complete mitochondrial genome of the common cutworm, Spodoptera litura (Lepidoptera: Noctuidae). Mitochondrial DNA, Part A, DNA Mapping, Sequencing and Analysis, 27, 122–123. https://doi.org/10.3109/19401736.2013.873934 Liu, S., Xue, D., Cheng, R. & Han, H. (2014) The complete mitogenome of Apocheima cinerarius (Lepidoptera: Geometridae: Ennominae) and comparison with that of other lepidopteran insects. Gene, 547, 136–144. https://doi.org/10.1016/j.gene.2014.06.044 Liu, Y.Q., Li, Y.P., Pan, M.H., Dai, F.Y., Zhu, X.W., Lu, C. & Xiang, Z. (2008) The complete mitochondrial genome of the Chinese oak silkmoth, Antheraea pernyi (Lepidoptera : Saturniidae). Acta Biochimica et Biophysica Sinica, 40, 693–703. https://doi.org/10.1093/abbs/40.8.693 Lowe, T.M. & Eddy, S.R. (1997) tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Research, 25, 955–964. https://doi.org/10.1093/nar/25.5.0955 Lu, C., Liu, Y.Q., Liao, S.Y., Li, B., Xiang, Z.H., Han, H. & Wang, X. (2002) Complete sequence determination and analysis of Bombyx mori mitochondrial genome. Journal of Agricultural Biotechnology, 10, 163–170. Lu, H.F., Su, T.J., Luo, A.R., Zhu, C.D. & Wu, C.S. (2013) Characterization of the complete mitochondrial genome of diurnal moth Amata emma (Butler) (Lepidoptera: Erebidae) and its phylogenetic implications. PLoS One, 8 (9), e72410. Lutz-Bonengel, S., Sanger, T., Pollak, S. & Szibor, R. (2004) Different methods to determine length heteroplasmy within the mitochondrial control region. International Journal of Legal Medicine, 118, 274–281. https://doi.org/10.1007/s00414-004-0457-0 Niu, F. F., Fan, X. L. & Wei, S. J. (2016) Complete mitochondrial genome of the Grapholita dimorpha Komai (Lepidoptera: Tortricidae). Mitochondrial DNA, Part A, Journal of DNA Mapping, Sequencing and Analysis, 27, 775–776. Ogoh, K. & Ohmiya, Y. (2004) Complete mitochondrial DNA sequence of the sea-firefly, Vargula hilgendorfii (Crustacea, Ostracoda) with duplicate control regions. Gene, 327, 131–139. https://doi.org/10.1016/j.gene.2003.11.011 Park, J.S., Kim, M.J., Kim, S.S. & Kim, I. (2014) Complete mitochondrial genome of an aquatic moth, Elophila interruptalis (Lepidoptera: Crambidae). Mitochondrial DNA, Part A, DNA Mapping, Sequencing and Analysis, 25, 275–277. https://doi.org/10.3109/19401736.2013.800504 Park, J.S., Kim, S.S., Kim, K.Y. & Kim, I. (2016) Complete mitochondrial genome of Suzuki's Promolactis moth Promalactis suzukiella (Lepidoptera: Oecophoridae). Mitochondrial DNA, Part A, Journal of DNA Mapping, Sequencing and Analysis, 27, 2093–2094. Regier, J.C., Zwick, A., Cummings, M.P., Kawahara, A.Y., Cho, S., Weller, S., Roe, A., Baixeras, J., Brown, J.W., Parr, C., Davis, D.R., Epstein, M., Hallwachs, W., Hausmann, A., Janzen, D.H., Kitching, I.J., Solis, M.A., Yen, S.H., Bazinet, A.L. & Mitter, C. (2009) Toward reconstructing the evolution of advanced moths and butterflies (Lepidoptera: Ditrysia): an initial molecular study. BMC Evolutionary Biology, 9, 280. https://doi.org/10.1186/1471-2148-9-280 Regier, J.C., Mitter, C., Zwick, A., Bazinet, A.L., Cummings, A.L., Kawahara, A.Y., Sohn, J.-C., Zwickl, D.J., Cho, S., Davis, D.R., Baixeras, J., Brown, J., Parr, C., Weller, S., Lees, D.C. & Mitter, K.T. (2013) A large-scale, higher-level, molecular phylogenetic study of the insect order Lepidoptera (moths and butterflies). PLoS ONE, 8 (3), e58568. https://doi.org/10.1371/journal.pone.0058568 Ronquist, F., Teslenko, M., van der Mark, P., Ayres, D.L., Darling, A., Höhna, S., Larget, B., Liu, L., Suchard, M.A. & Huelsenbeck, J.P. (2012) MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology, 61, 539–542. https://doi.org/10.1093/sysbio/sys029 Scoble, M.J. & Hausmann, A. (2007) Online list of valid and available names of the Geometridae of the World. Available from: http://www.lepbarcoding.org/geometridae/species_checklists.php (accessed 06 March 2017) Shi, B.C., Liu, W. & Wei, S.J. (2013) The complete mitochondrial genome of the codling moth Cydia pomonella (Lepidoptera: Tortricidae). Mitochondrial DNA, Part A, DNA Mapping, Sequencing and Analysis, 24, 37–39. Sun, Y., Tian, S., Qian, C., Sun, Y.X., Abbas, M.N., Kausar, S., Wang, L., Wei, G., Zhu, B.J. & Liu, C.L. (2016) Characterization of the complete mitochondrial genome of Spilarctia robusta (Lepidoptera: Noctuoidea: Erebidae) and its phylogenetic implications. European Journal of Entomology, 113, 558–570. https://doi.org/10.14411/eje.2016.076 Taanman, J.W. (1999) The mitochondrial genome: structure, transcription, translation and replication. Biochimica et Biophysica Acta, 1410, 103–123. https://doi.org/10.1016/S0005-2728(98)00161-3 Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. & Kumar, S. (2011) MEGA5: Molecular evolutionary genetics analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony methods. Molecular Biology and Evolution, 28, 2731–2739. https://doi.org/10.1093/molbev/msr121 Taylor, M.F., McKechnie, S. W., Pierce, N. & Kreitman, M. (1993) The lepidopteran mitochondrial control region: structure

18 · Zootaxa 0000 (0) © 2017 Magnolia Press SUN ET AL. and evolution. Molecular Biology and Evolution, 10, 12591272. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F. & Higgins, D.G. (1997) The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research, 25, 4876–4882. https://doi.org/10.1093/nar/25.24.4876 Timmermans, M.J.T.N., Lees, D.C. & Simonsen, T.J. (2014) Towards a mitogenomic phylogeny of Lepidoptera. Molecular Phylogenetics and Evolution, 79, 169–178. https://doi.org/10.1016/j.ympev.2014.05.031 Wei, S.J., Shi, B.C., Gong, Y.J., Li, Q. & Chen, X.X. (2013) Characterization of the mitochondrial genome of the Diamondback Moth Plutella xylostella (Lepidoptera: Plutellidae) and phylogenetic analysis of advanced moths and butterflies. DNA and Cell Biology, 32, 173–187. https://doi.org/10.1089/dna.2012.1942 Wu, L.W., Lees, D.C., Yen, S.H., Lu, C.C. & Hsu, Y.F. (2010) The complete mitochondrial genome of the near-threatened swallowtail, Agehana maraho (Lepidoptera: Papilionidae): evaluating sequence variability and suitable markers for conservation genetic studies. Entomological News, 121, 267–280. https://doi.org/10.3157/021.121.0308 Wu, Q.L., Cui, W.X. & Wei, S.J. (2015) Characterization of the complete mitochondrial genome of the black cutworm Agrotis ipsilon (Lepidoptera: Noctuidae). Mitochondrial DNA, Part A, DNA Mapping, Sequencing and Analysis, 26, 139–140. Wu, Q.L., Liu, W., Shi, B.C., Gu, Y. & Wei, S.J. (2013) The complete mitochondrial genome of the summer fruit tortrix moth Adoxophyes orana (Lepidoptera: Tortricidae). Mitochondrial DNA, Part A, DNA Mapping, Sequencing and Analysis, 24, 214–216. Wu, Y.P., Li, J., Zhao, J.L., Su, T.J., Luo, A.R., Fan, R.J., Chen, M.C., Wu, C.S. & Zhu, C.D. (2012a) The complete mitochondrial genome of the rice moth, Corcyra cephalonica. Journal of Insect Science, 12, 72. https://doi.org/10.1673/031.012.7201 Wu, Y.P., Zhao, J.L., Su, T.J., Li, J., Yu, F., Chesters, D., Fan, R.J., Chen, M.C., Wu, C.S. & Zhu, C.D. (2012b) The complete mitochondrial genome of Leucoptera malifoliella Costa (Lepidoptera: Lyonetiidae). DNA and Cell Biology, 31, 1508–1522. https://doi.org/10.1089/dna.2012.1642 Yang, L., Wei, Z.J., Hong, G.Y., Jiang, S.T. & Wen, L.P. (2009) The complete nucleotide sequence of the mitochondrial genome of Phthonandria atrilineata (Lepidoptera: Geometridae). Molecular Biology Reports, 36, 1441–1449. https://doi.org/10.1007/s11033-008-9334-0 Yang, X., Xue, D. & Han, H. (2013) The complete mitochondrial genome of Biston panterinaria (Lepidoptera: Geometridae), with phylogenetic utility of mitochondrial genome in the Lepidoptera. Gene, 515, 349–358. https://doi.org/10.1016/j.gene.2012.11.031 Yi, J., Que, S., Xin, T., Xia, B. & Zou, Z. (2016) Complete mitochondrial genome of Thitarodes pui (Lepidoptera: Hepialidae). Mitochondrial DNA, Part A, DNA Mapping, Sequencing and Analysis, 27, 109–110. Yin, J., Hong, G.Y., Wang, A.M., Cao, Y.Z. & Wei, Z.J. (2010) Mitochondrial genome of the cotton bollworm Helicoverpa armigera (Lepidoptera: Noctuidae) and comparison with other Lepidopterans. Mitochondrial DNA, Part A, DNA Mapping, Sequencing and Analysis, 21, 160–169. Yin, J., Wang, A.M., Hong, G.Y., Cao, Y.Z. & Wei, Z.J. (2011) Complete mitochondrial genome of Chilo suppressalis (Walker) (Lepidoptera: Crambidae). Mitochondrial DNA, Part A, DNA Mapping, Sequencing and Analysis, 22, 41–43. Yingqi, F.H.N. (1999) A preliminary report on Calospilos suspecta Warren. Journal of Anhui Agricultural University, 26, 461–464. Yukuhiro, K., Sezutsu, H., Itoh, M., Shimizu, K. & Banno, Y. (2002) Significant levels of sequence divergence and gene rearrangements have occurred between the mitochondrial genomes of the wild mulberry silkmoth, Bombyx mandarina, and its close relative, the domesticated silkmoth, Bombyx mori. Molecular Biology and Evolution, 19, 1385–1389. https://doi.org/10.1093/oxfordjournals.molbev.a004200 Zhang, Z.-Q. (Ed.) (2011) Animal biodiversity: An outline of higher-level classification and survey of taxonomic richness. Zootaxa, 3148, 1–237. Zhu, B.J., Liu, Q.N., Dai, L.S., Wang, L., Sun, Y., Lin, K.Z., Wei, G.Q. & Liu, C.L. (2013) Characterization of the complete mitochondrial genome of Diaphania pyloalis (Lepidoptera: Pyralididae). Gene, 527, 283–291. https://doi.org/10.1016/j.gene.2013.06.035

MITOGENOME OF ABRAXAS SUSPECTA (LEPIDOPTERA) Zootaxa 0000 (0) © 2017 Magnolia Press · 19

View publication stats